Quick-Neuron™ Dopaminergic SeV Complete Kit (Bulk) · May 13, 2019-Page 3-Quick-NeuronTM...

-- Quick-NeuronTM Dopaminergic - SeV Complete Kit (Bulk)May 13, 2019

Quick-Neuron™ Dopaminergic SeV Complete Kit (Bulk)

Table of Contents:I. Introduction 2II. Kit Contents 2III. Additional Materials Required 2IV. Pre-Protocol Preparation 3V. Protocol 4

VI. Appendix A: Freezing cells down on Day 3 9VII. Appendix B: Thawing / Plating 10VIII. Appendix C: Reference Pictures and Figures 11IX. Appendix D: Literature References 13

This kit (EXGS-QNDSV-B) contains 1 set of reagents for use with a 6-well plate or a 100-mm dish.

User Manual

Catalog Number: EXGS-QNDSV-B

Elixirgen Scientific, LLC855 N. Wolfe St., Suite 619Baltimore, MD 21205Phone: (443) 869-5420Email: [email protected]

-- Quick-NeuronTM Dopaminergic - SeV Complete Kit (Bulk) May 13, 2019

I. IntroductionThank you for purchasing the Quick-Neuron™ Dopaminergic - SeV Complete Kit (Bulk). This kit allows users to differentiate human pluripotent stem cells (hPSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), into tubulin beta 3 class III (TUBB3), tyrosine hydroxylase (TH), and dopamine (DA)-positive neurons within 10 days. These neurons are committed to becoming dopaminergic neurons. At Day 10, dopaminergic neurons are good for any experimental utilization or users may maintain differentiated neurons in the maintenance medium best suited for their needs, although we recommend Quick-Neuron™ Dopaminergic Maintenance Medium, available at https://elixirgenscientific.com/store/ (Catalog Number: EXGS-QNDM).

II. Kit ContentsUpon receipt of this kit, immediately store all reagents at their proper storage temperatures as described in the table below. All reagents are shipped on dry ice.

III. Additional Materials RequiredThe following materials are needed but not supplied with this kit:

• Tissue-culture-treated polystyrene 6-well plates or 100-mm dishes

• DMEM/F12 (e.g., ThermoFisher, Catalog Number: 21331-020)

• Neurobasal (e.g., ThermoFisher, Catalog Number: 21103049)

• Glutamax (100x) (e.g., ThermoFisher, Catalog Number: 35050061)

List of Components

Reagents Amount Storage Conditions

QN-SeV (undiluted) 110 µl -80 °C

Component N 840 µl x 2 -20 °C or -80 °C

Component D1 10 µl x 2 -20 °C or -80 °C






Solution D1 1 ml x 3 -20 °C or -80 °C

• This kit contains Sendai virus (SeV; ID Pharma Co., Ltd.) particles which are active at 33°C and become inactive at 37°C. SeV is non-pathogenic in humans, and humans are not natural hosts of SeV; however, Biosafety Level 2 (BSL2) containment is required for its use. Please use a biological safety cabinet, laminar flow hood, and proper personal protective equipment in order to prevent mucosal exposure.

• All plasticware exposed to SeV should be rinsed with a bleach solution such as 10% household bleach, 1% sodium hypochlorite, 70% ethanol, or formaldehyde before being deposited into a Biohazardous and Regulated Medical Waste Bag. Liquid waste should be collected in a separate bottle containing the bleach solution prior to disposal. DO NOT use an aspirator to collect liquid waste containing SeV. Institutional Biosafety Committee (IBC) registration and approval may be required for the use of SeV. Please make sure that users follow the laboratory biosafety protocols referred to by IBC policy (http://osp.od.nih.gov/office-biotechnology-activities/biosafety/institutional-biosafety-committees).


IV. Pre-Protocol Preparation

• This protocol requires two CO2 incubators, at 33°C and 37°C respectively.

• Prepare a neural differentiation medium by mixing following reagents after thawing Componen N at 4°C overnight. The medium is called Medium N and stable for up to 2 weeks when stored at 4°C.

NOTE: SOURCE hPSC CULTURE CONDITIONS• The recipe in the Quick-Neuron™ Dopaminergic - SeV Complete Kit (Bulk) protocol assumes that the

undifferentiated hPSCs (starting materials) are cultured in 35-mm culture dishes (or a few wells of a 6-well plate).

No. Reagent Volume

1 DMEM/F12 24 ml

2 Neurobasal 24 ml

3 200 mM Glutamax (100x) 0.25 ml

4 Penicillin-Streptomycin (10000 units/ml; 100x) 0.5 ml

5 Component N 1.55 ml

• Prepare a 10 mM ROCK inhibitor Y27632 stock solution in DMSO to prepare for Medium iN on Day 0. Preparation steps are as follows:

- Dissolve 10 mg ROCK inhibitor Y27632 in 3.1225 ml DMSO.

- Make aliquots of a convenient volume (e.g., 100 μl) and store at -20°C.

• Prepare 0.002% poly-L-ornithine solution in PBS for use on Day 3. This solution is referred to as Ornithine hereafter. Preparation steps are as follows:

- Take 2 ml 0.01% poly-L-ornithine solution and mix it with 8 ml PBS.

- Store the diluted solution at 4°C and use it within two weeks.

• Prepare 1 mg/ml laminin stock solution in PBS for use on Day 3. This solution is referred to as Laminin hereafter. Preparation steps are as follows:

- Thaw Laminin Mouse Protein, Natural at 4°C or on ice.

- Chill PBS at 4°C or on ice.

- Take cold Laminin Mouse Protein, Natural and mix it with chilled PBS to make 1 mg/ml stock solution (note: the concentration of laminin varies among different lots and is specified on the vial or its certif-icate of analysis. Calculate the volume needed to prepare 1 mg/ml stock solution accordingly).

- Make aliquots of a convenient volume (e.g., 100 μl) and store them at -20°C.

• Penicillin-Streptomycin (e.g., ThermoFisher, Catalog Number: 15140-122)

• iMatrix-511 silk (Nippi, Catalog Number: EXGS-NI511S)

• Poly-L-Ornithine (e.g., Sigma Aldrich, Catalog Number: P4957-50ML)

• Laminin Mouse Protein, Natural (e.g., ThermoFisher, Catalog Number: 23017015)

• Phosphate-buffered saline (PBS without Ca++ Mg++)

• ROCK inhibitor Y27632 (e.g., Selleckchem, Catalog Number: s1049)

• Trypan blue solution, 0.4% (e.g., ThermoFisher, Catalog Number: 15250061)

• Dimethyl sulfoxide (DMSO; e.g., Sigma-Aldrich, Catalog Number: D8418)


V. Protocol

Day 0 - Plating and First Treatment

New Plate Preparation

1. Start thawing Solution D1 and warm Medium N and 10 mM ROCK inhibitor Y27632 at room temperature. Make sure that Solution D1, Medium N and 10 mM ROCK inhibitor Y27632 are at room temperature for at least 1 hour before use. Typically confluent culture of hPSCs in a well of a 6-well plate contains 3 x 10⁶ cells that is sufficient for preparing one 100-mm dish. During neuron differentiation, hPSCs may divide only once, such that 3 x 10⁶ hPSCs will produce 3-6 x 10⁶ neurons.

2. Take undiluted original stock of iMatrix-511 silk on ice.

3. Take 12 ml ice-cold PBS into a new 15 ml conical tube and add 40 µl iMatrix-511 silk to it. Mix them well. This diluted iMatrix-511 silk is for plating around 3 x10⁶ hPSCs.

4. Add 2 ml or 12 ml diluted iMatrix-511 silk to each well of a new 6-well plate or one 100-mm dish.

5. Incubate the plate at 37°C, 5% CO2 for at least 2 hours (or 4°C overnight one day before Day 0) or until hPSCs are ready for plating.

Treatment

Medium iN Medium N(D1D2) Medium N(D2D3) Medium N(D4D6)

Day 0 Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7 Day 8 Day 9 Day 10

Plating &QN-SeV

AssayTemperature Shift Passaging (Optional)

Medium N(D4D5)

37°C33°C

NOTE: DIFFERENTIATION SCALE• Please use 6-well plates or 100-mm cell culture dishes and 0.5 million hPSCs per well or 3.0 million hPSCs

per dish, respectively.• The following protocol describes neuron differentiation in a 6-well plate or a 100-mm dish: according to

the surface area, 6 wells of a 6-well plate are equivalent of one 100-mm dish.

• We do not recommend additional freeze-thaw cycles of any reagents.

• Taking 4x and/or 10x images of cultures every day (or even after every medium change) is a good way to monitor your experiment.

• Customer service on the phone (+1-443-869-5420) and through email ([email protected]) is available to assist users in troubleshooting and interpretation of results.

NOTE: VIRUS IS DELICATE• Before adding QN-SeV, do not centrifuge, vortex, or mix it with a pipettor; it is highly sensitive to physical

stress.

1. Take 1.5 ml user’s hPSC maintenance medium into a new 15 ml conical tube and add 1.5 μl 10 mM ROCK inhibitor Y27632 to it. Mix them well. If more than two wells of hPSC culture are needed to reach 3 x 10⁶ cells, multiply this recipe by the number of wells needed.

2. Aspirate old medium from user’s hPSC culture and add 1.5 ml medium prepared at step 1.

3. Incubate the culture at 37°C, 5% CO2 for 1 hour before harvesting cells. This is to decrease cell death on day 1 and minimize the loss of cells.

4. Start thawing QN-SeV on ice.

5. Aspirate medium from hPSC culture and add 2 ml PBS to it.


6. Rock the dish 3 times, aspirate PBS from the culture, and add 300 μl Solution D1 to it. Keep the rest of Solution D1 at 4°C for its use on Day 3.

7. Incubate the culture at 37°C, 5% CO2 for 5-7 minutes.

8. While cells are treated with Solution D1, take 7 ml Medium N into a tube and add 7 μl 10 mM ROCK inhibitor to it. Mix them well. This medium is referred to as Medium iN. Keep the rest of Medium N at 4°C for its later use.

9. Carefully pipet out Solution D1 from the culture using a P1000 pipettor and add 1 ml Medium iN to it.

10. Disperse the medium over the well bottom surface by pipetting up to 15 times to detach cells.

11. Collect the cell suspension in a tube.

12. Count cells to determine the volume of cell suspension and the number of wells or dishes needed; use 0.5 x 10⁶ cells for each well of a 6-well plate or 3.0 x 10⁶ cells for one 100-mm dish.

13. Take out the determined volume of the cell suspension from the previous step in a 50 ml conical tube and bring up the volume with Medium iN to 0.58 ml.

14. Add 105 µl QN-SeV to the cell suspension and mix them by tapping with finger 2-3 times. Cap the tube loosely to allow gas exchange.

15. Incubate the cell suspension at 33°C, 5% CO2 for 10 minutes with intermittent mixing of the cells every 2 minutes.

Plating

1. Bring up the volume to 6 ml with Medium iN and mix the cell suspension 2-3 times with a 10 ml serologi-cal pipette.

2. (1) for a 6-well plate, aspirate PBS from only three coated wells at a time and add 1 ml cell suspension to each well. Handle three wells after another and mix the cell suspension once before plating it to next 3 wells. (2) for a 10-mm dish, aspirate PBS from the coated dish and add 6 ml cell suspension to it. Note: Most of the PBS should be aspirated but not completely to prevent the coated wells or dishes from drying before adding the cell suspension. Likewise, the cell suspension should be added to the wells immediately after PBS is removed.

3. Rotate the plate or the dish slowly and gently and observe the medium rotate 5 times. This results in evenly distributing QN-SeV in the cultures.

4. Incubate the cultures at 33°C, 5% CO₂ overnight.

Day 1 - Feeding

1. Warm Medium N at room temperature for 20-30 minutes.

2. Thaw two vials of Component D1 at room temperature and one vial of Component D2 on ice for 20-30 minutes.

3. Take 6 ml Medium N into a tube and add 12 μl Component D1 and 12 μl Component D2 to it.

4. Mix them well. This medium is referred to as Medium N(D1D2) and is stable for up to 2 weeks at 4°C. This is for 6 wells of a 6-well plate or one 10-cm dish culture.

5. Pipet out the old medium with QN-SeV from each well using a P1000 pipettor and add 1 ml or 6 ml Me-dium N(D1D2) to each well of the 6-well plate culture or 10-cm dish culture, respectively.

6. Incubate the cultures at 33°C, 5% CO2 overnight.

Day 2 - Temperature Shift

1. In the afternoon, transfer the cultures at 37°C, 5% CO2 without changing medium and incubate them overnight.


NOTE: PASSAGING CELLS TO 6-WELL PLATE• Day 3 involves a passaging step. This protocol assumes that the assay users will conduct with these cells

needs a large number of cells in a bulk manner. Thus, we recommend passaging cells into wells in a 6-well plate to keep the cell seeding density optimal.

Day 3 - Feeding or Passaging

1. In the morning, warm Medium N at room temperature for 20-30 minutes.

2. Thaw one vial of Component D2 on ice and two vials of Component D3 at room temperature for 20-30 minutes.


4. Mix them well. This medium is referred to as Medium N(D2D3) and is stable for up to 2 weeks at 4°C. If users prefer freezing cells down, it can be done on day 3. Skip the steps for new well preparation and passaging but follow steps in Appendix A.

New Well Preparation

1. Start thawing two vials of Solution D1 and 10 mM ROCK inhibitor Y27632 at room temperature.

2. Add 1.5 ml Ornithine to each well of a new 6-well plate.

3. Incubate the plate at 37°C, 5% CO2 for at least 2 hours (or at 4°C overnight one day before).

4. Thaw Laminin on ice for 20-30 minutes. Do not thaw it at room temperature.

5. Take 9 ml ice-cold PBS into a tube and add 90 µl Laminin to it. Mix them well.

6. Aspirate the supernatant from each well from pre-incubated plate on step 2 and add 2 ml PBS to it.

7. Repeat step 5.

8. Aspirate PBS from each well and add 1.5 ml diluted Laminin to it.

9. Incubate the plate at 37°C, 5% CO2 for at least 2 hours.

10. While plate is incubating, take 7 ml pre-warmed Medium N(D2D3) and add 7 ul 10 mM ROCK inhibitor Y27632 to it. Mix them well and this is referred to Medium iN(D2D3) and keep it at room temperature. Keep the rest of Medium N(D2D3) at 4°C for its later use.

11. When second incubation completed, repeat step 5 twice.

12. Aspirate PBS from each well and add 0.5 ml Medium iN(D2D3) to it. Keep this pre-coated plate at the 37°C incubator until cells are ready for plating.

Passaging Cells

1. Make sure Solution D1 is warmed up at room temperature for 20-30 minutes.

2. (1) for a 6-well plate, pipet out the old medium from 3 wells using a serological pipette and add 1 ml PBS to each well, followed by gently rocking the plate. Repeat these steps for next 3 wells. Pipet out PBS from 3 wells using a serological pipette and add 0.3 ml Solution D1 to each well. Repeat these steps for next 3 wells. (2) for a 100-mm dish, pipet out the old medium from each dish using a serological pipette and add 5 ml PBS to each 100-mm dish, followed by gently rocking the dish. Pipet out the PBS and add 1.8 ml Solution D1 to each dish.

3. Incubate the cultures at 37°C, 5% CO2 for 3 minutes. Make sure that the dish/plate is flat during the incu-bation.

4. Take 4x and 10x phase contrast images for your record if cells are dissociated enough.

5. (1) for a 6-well plate, carefully pipet out Solution D1 from 3 wells using a serological pipette and add 0.75 ml Medium iN(D2D3) to each well along the wall of the well. Repeat this step for next 3 wells. (2) for a 100-mm dish, carefully pipet out Solution D1 from the dish using a serological pipette and add dropwise 2 ml Medium iN(D2D3) to it.


NOTE: CRITICAL PASSAGING STEPS• Steps 6-8 below are critical. Perform these steps for one well at a time.

• Refer images below to successfully manage cell treatment and dissociation.

Before Solution D1 treatment During Solution D1 treatment Cell leftover on original wells

Clusters of cells could remain on the original well after cell treatment and dissociation

The clusters could be identified on the well and attached to the plate stronger than individualized cells

After optimal cell treatment and dissociation, there are some cell left-overs mainly from the clusters of cells

6. Disperse the medium quickly over the well bottom surface by pipetting 6-8 times to detach cells using the same P1000 pipettor tip.

7. Observe cells and/or cell aggregates floating in the well under a microscope. It is normal that 10-20% of cells, mostly as clumps, remain attached to the well bottom after pipetting. The clusters of cells are not supposed to be lifted. Do not attempt to detach all of the cells remaining on the well bottom.

8. Gently pipet up and down the cell suspension in the well up to 5 times to break the cell aggregates using the same P1000 pipettor tip. Excessive pipetting can damage the already-suspended neuronal cells.

9. Collect all cell suspension in a tube from each well or dish with the same P1000 pipettor tip, count cells and determine the viability with Trypan Blue staining.

10. Determine the volume of cell suspension needed to plate 0.5 x 10⁶ live cells per well of a 6-well plate.

11. Take out the determined volume of the cell suspension from the previous step in a new tube and adjust the volume of the cell suspension using Medium iN(D2D3) to prepare 1 x 10⁶ live cells/ml cell suspension.

12. Add 0.5 ml cell suspension prepared in the previous step to the center of each well. Since each well al-ready has 0.5 ml Medium iN(D2D3) (see “New Well Preparation” above), the total volume of the medium in each culture is 1 ml.


Day 4-5 - Feeding

1. Warm Medium N(D2D3) at room temperature for 20-30 minutes.

2. Pipet out the old medium from each well using a P1000 pipettor and add 1 ml Medium N(D2D3) to it.

3. Incubate the cultures at 37°C, 5% CO2 for 2 days.

Day 6 - Feeding




4. Mix them well. This medium is referred to as Medium N(D4D5) and is stable for up to 2 weeks at 4°C.




Day 7-9 - Feeding




4. Mix them well. This medium is referred to as Medium N(D4D6) and is stable for up to 2 weeks at 4°C.



7. Repeat steps 5-6 every day until Day 10.

Day 10 - Ready for Assay

NOTE: OBSERVING NEURONS AND ASSAYING• Differentiated neurons can be observed on Day 4 under the microscope. For more mature neurons, we

recommend culturing cells until Day 10. From Day 10, users may maintain differentiated neurons in the maintenance medium best suited for their needs, though we recommend Quick-Neuron™ Dopaminergic Maintenance Medium, available at https://elixirgenscientific.com/store/ (Catalog Number: EXGS-QNDM).

• Differentiation into dopaminergic neurons after using Quick-Neuron™ Dopaminergic - SeV Complete Kit (Bulk) can be confirmed with anti-TUBB3 (tubulin beta 3 class III, a global marker for neurons), anti-TH (tyrosine hydroxylase, a dopaminergic neuron marker), and anti-DA (dopamine, a neurotransmitter of dopaminergic neuron) antibodies. Typical immunostaining images of TUBB3-positive, TH-positive, and DA-positive neurons on Day 10 following Quick-Neuron™ Dopaminergic - SeV Complete Kit treatment are shown in Appendix A.


VI. Appendix A: Freezing cells down on Day 3

1. Disperse the PBS quickly over the bottom surface of the wells or the dish by pipetting 6-8 times to detach cells using the same P1000 pipettor tip.

2. Observe cells and/or cell aggregates floating in the well under a microscope. It is normal that 10-20% of cells, mostly as clumps, remain attached to the well bottom after pipetting. The clusters of cells are not supposed to be lifted. Do not attempt to detach all of the cells remaining on the well bottom.

3. Gently pipet up and down the cell suspension in the well up to 5 times to break the cell aggregates using the same P1000 pipettor tip. Excessive pipetting can damage the already-suspended neuronal cells.

4. Collect all cell suspension from each well or dish with the same P1000 pipettor and transfer it to a new 15 ml conical tube.

5. Count cells and determine the volume of the cell suspension needed for 2 x 10⁶ cells or a multiple of 2 x 10⁶ cells.

6. Centrifuge at 200 xg for 4 min.

7. While waiting for the centrifugation, label each cryovial with the name of the iPSC line used, the type of neurons, harvesting day and date, and the number of cells in the vial.

8. Aspirate the supernatant and resuspend the pellet with Stem Cellbanker to make 2 x 10⁶ cells in 0.5 ml/ vial.

9. Make sure that the caps are closed tightly and transfer the cryovials into MrFrosty. Make sure that Mr-Frosty contains 250 ml isopropanol and no plastic insert.

10. Loosely close the lid of MrFrosty with cryovials, put it into a -80°C freezer and leave it overnight or a few

1. Warm Solution D1 at room temperature for 20-30 minutes.

2. Pipet out the old medium from each well or a dish with differentiating cells using a P1000 pipettor and add 0.5 ml or 1 ml PBS to each well of the 6-well plate or the 10-cm dish, respectively.

3. Rock the plate or the dish 2-3 times. Pipet out PBS from each well or the dish using a P1000 pipettor and add 0.3 ml or 1.8 ml Solution D1 to each well or the dish, respectively.

4. Incubate the cultures at 37°C, 5% CO2 for 3 minutes. Make sure that the plate or the dish is flat during the incubation.

5. While incubating the cultures, take 0.75 ml or 2 ml PBS and add 0.75 μl or 2 μl 10 mM ROCK inhibitor to it, respectively. Mix them well.

6. Carefully pipet out Solution D1 from each well or the dish using a P1000 pipettor and add 0.75 ml or 2 ml PBS with the ROCK inhibitor to each well or the 10-cm dish, respectively.

NOTE: CRITICAL PASSAGING STEPS• Steps 7-10 below are critical. Perform these steps for one well at a time.

• Refer images below to successfully manage cell treatment and dissociation.

Before Solution D1 treatment During Solution D1 treatment Cell leftover on original wells

Clusters of cells could remain on the original well after cell treatment and dissociation

The clusters could be identified on the well and attached to the plate stronger than individualized cells

After optimal cell treatment and dissociation, there are some cell left-overs mainly from the clusters of cells


VII. Appendix B: Thawing / Plating

Please refer our frozen cell thawing protocol from our online store page for Dopaminergic Neurons (https://elixirgenscientific.com/store/exgs-qndsvf-cw50065-1m/, see “Documents” section to find the protocol).

days.

11. Transfer the cryovials into a liquid nitrogen storage tank.


VIII. Appendix C: Reference Pictures and Figures

Figure 1. Representative images of cultures by Quick-Neuron™ Dopaminergic - SeV Complete Kit (Bulk) on Days 1-10 (10x objective).

Day 2Day 1 Day 3

Day 4 Day 6

Day 8

Day 7

Day 10


Figure 2. Immunostaining images of cultures by Quick-Neuron™ Dopaminergic - SeV Complete Kit (Bulk) on Day 10.

Staining conditions: Anti-TUBB3 monoclonal antibody (R&D systems, Cat#MAB1195, 1:10,000 dilution) in combination with a secondary antibody (Invitrogen, Cat#A21424, Alexa 555 goat anti-mouse, 1:500 dilution). Anti-TH primary antibody (GeneTex, Cat#GTX102424, 1:300 dilution) in combination with a secondary antibody (Invitrogen, Cat#A11034, Alexa 488 goat anti-rabbit, 1:500 dilution).

DAPI

10x 10x 10x 10x

TUBB3 TH Merged

DAPI

40x 40x 40x 40x

TUBB3 TH Merged


IX. Appendix D: Literature References1. Goparaju SK, Kohda K, Ibata K, Soma A, Nakatake Y, Akiyama T, Wakabayashi S, Matsushita M, Sakota

M, Kimura H, Yuzaki M, Ko SB & Ko MS (2017). Rapid differentiation of human pluripotent stem cells into functional neurons by mRNAs encoding transcription factors. Scientific Reports 7, 42367.

2. This kit is based on the technology published in (1) and licensed from Keio University and ID Pharma Co., Ltd.

Figure 3. Quantitative RT-PCR analysis of dopaminergic neuronal markers on Day 10. Strong up-regulation of tyrosine hydroxylase (TH), forkhead box A2 (FOXA2), and G-protein-regulated inward-rectifier potassium channel 2 (GIRK2) indicates that hPSCs are differentiating into dopaminergic neurons using Quick-Neuron™ Dopaminergic – SeV Complete Kit. The relative gene expression is normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and then calculated as a fold induction relative to undifferentiated hPSCs as a control. Primers used in real-time PCR experiments were listed below in Table 1.

Gene Forward primer Reverse primer Primer concentration

TH TCATCACCTGGTCACCAAGTT GGTCGCCGTGCCTGTACT 250 nM

FOXA2 CTTCAAGCACCTGCAGATTC AGACCTGGATTTCACCGTGT 250 nM

GIRK2 CACATCAGCCGAGATCGGAC GGTAGCGATAGGTCTCCCTCA 250 nM

GAPDH GTCATACCAGGAAATGAGCT TGACCACAGTCCATGCCATC 200 nM

Table 1 . List of PCR primers

1

10

100

TH FOXA2 GIRK2

1,000

Rela

tive

gene

exp

ress

ion

leve

ls

Find more products and services available at ElixirgenScientific.com!

Live or frozenhiPS/ES cells

Livemature cells

Mon Sat - Mon

Ship Ship

as short as 1 week

Fri

1 ~3 days afterthawingFri

Live differenti-ating cells

Tue - Thu

Differentiation withQuick-TissueTM Series

Keep

Plating

Livemature cellsFrozen cells

Based on preference

Thaw, then

Freeze & Ship Plating

Quick-Tissue™ Stem Cell Differentiation Services

* This kit provides 2 wells per each tissue (total 6 wells of 24-well plate) ** This kit is for 48 wells of a 96-well microplate format

Elixirgen Scientific provides pluripotent stem cell differentiation services with the world’s fastest turnaround time. Customers can simply ship live iPS/ES cells in a T-25 flask and will receive live or fronzen cells in a week (express service) or two weeks (regular service). Contact [email protected] for more details to customize for your project.Currently Elixirgen Scientific offers all tissue types from kits for cell differentiation services. More tissue types are coming soon!

Quick-Tissue™SeriesDifferentiation Kit(mainly for 4 wells of 24-well plate)

Quick-Tissue™SeriesDifferentiationSupport

Category Product Size Request Quote (Catalog number)

Quick-Tissue™ Mesendoderm Booster 8 wells of 24-well plate $99 (EXGS-QTMB)

Quick-Tissue™ Adaptation Kit a 35-mm dish or 1 well of 6-well plate $169 (EXGS-QTA1)

New product coming soon!

Ajinomoto StemFit® Basic02 500 mL Ask (EXGS-ASB02)

Nippi iMatrix-511 silk 175 µg x 6 tubes Ask (EXGS-NI511S)

Nippi iMatrix-511 175 µg x 6 tubes $690 (EXGS-NI511)

Request Quote (Catalog number)Category Product SeV Complete Kit mRNA Complete Kit Maintenance Medium

Quick-Endothelium™ Vascular with Optional Drug Selection $399 (EXGS-QEV) $229 (EXGS-QEVM)

Quick-Trilineage™ Differentiation Kit* $549 (EXGS-Q3D)

Quick-Neuron™ Mixed $349 (EXGS-QNMSV) $129 (EXGS-QNMM)

Quick-Neuron™ Cholinergic $349 (EXGS-QNCSV) $299 (EXGS-QNC) $129 (EXGS-QNCM)

$999 (EXGS-QNCSV96)**

Quick-Neuron™ Dopaminergic $399 (EXGS-QNDSV) $399 (EXGS-QND) $169 (EXGS-QNDM)

Quick-Neuron™ GABAergic $399 (EXGS-QNGSV) $399 (EXGS-QNG) $149 (EXGS-QNGM)

Quick-Muscle™ Skeletal $349 (EXGS-QMSSV) $129 (EXGS-QMSM)

Quick-Hepatocyte™ $499 (EXGS-QHSV) $149 (EXGS-QHM)

Quick-miniBrain™ $999 (EXGS-QMBSVMR)

Reagents forMaintainingUndifferentiatedStem Cells

Elixirgen Scientific, LLC855 N. Wolfe St., Suite 619Baltimore, MD 21205Phone: (443) 869-5420Email: [email protected]

15% off for 3 or more kit

purchasesper order

15% off for 3 or more kit

purchasesper order

Quick-Neuron™ Dopaminergic SeV Complete Kit (Bulk) · May 13, 2019-Page 3-Quick-NeuronTM...

Documents

Transcript of Quick-Neuron™ Dopaminergic SeV Complete Kit (Bulk) · May 13, 2019-Page 3-Quick-NeuronTM...