Quantitative Microbial Risk Assessment of Pathogenic Vibrios inMarine Recreational Waters of Southern California

Gregory Dickinson,a Keah-ying Lim,b Sunny C. Jianga,b

Ecology and Evolutionary Biologya and Civil and Environmental Engineering,b University of California, Irvine, California, USA

This study investigated the occurrence of three types of vibrios in Southern California recreational beach waters during the peakmarine bathing season in 2007. Over 160 water samples were concentrated and enriched for the detection of vibrios. Four sets ofPCR primers, specific for Vibrio cholerae, V. parahaemolyticus, and V. vulnificus species and the V. parahaemolyticus toxingene, respectively, were used for the amplification of bacterial genomic DNA. Of 66 samples from Doheny State Beach, CA,40.1% were positive for V. cholerae and 27.3% were positive for V. parahaemolyticus, and 1 sample (1.5%) was positive for the V.parahaemolyticus toxin gene. Of the 96 samples from Avalon Harbor, CA, 18.7% were positive for V. cholerae, 69.8% were posi-tive for V. parahaemolyticus, and 5.2% were positive for the V. parahaemolyticus toxin gene. The detection of the V. choleraegenetic marker was significantly more frequent at Doheny State Beach, while the detection of the V. parahaemolyticus geneticmarker was significantly more frequent at Avalon Harbor. A probability-of-illness model for V. parahaemolyticus was applied tothe data. The risk for bathers exposed to recreational waters at two beaches was evaluated through Monte Carlo simulation tech-niques. The results suggest that the microbial risk from vibrios during beach recreation was below the illness benchmark set bythe U.S. EPA. However, the risk varied with location and the type of water recreation activities. Surfers and children were ex-posed to a higher risk of vibrio diseases. Microbial risk assessment can serve as a useful tool for the management of risk relatedto opportunistic marine pathogens.

Vibrios are Gram-negative, motile bacteria that can cause dis-eases in humans. They are commonly found in marine coastal

ecosystems, where their population changes with seawater tem-perature, increasing with warmer temperatures and algal bloomsand decreasing with cooler temperatures (1, 2). Vibrio vulnificusand Vibrio parahaemolyticus were two of the most common vibrioinfections reported in the United States between 1997 and 2006,responsible for the most vibrio-related hospitalizations anddeaths (3). V. parahaemolyticus and V. vulnificus are known tocause infection and sepsis if they reach the blood (3). The hemo-lysin enzyme produced by the tdh (temperature direct hemolysin)toxin gene of V. parahaemolyticus can lead to the destruction ofred blood cells, while the lipopolysaccharide toxin of V. vulnificuscan produce diarrhea and blistering dermatitis. V. vulnificus infec-tion has a mortality rate of 50%, with the majority of patientsdying within the first 48 h of infection (4). Outside the developedworld, the most common form of vibrio pathology is the gastro-intestinal disease cholera, caused by Vibrio cholerae. These bacte-ria release the cholera toxin, an enterotoxin that causes an increasein the secretion of sodium in the intestine, leading to diarrhea anddehydration. Cholera epidemics are a serious threat to the devel-oping world, with several hundred thousand cases reported to theWorld Health Organization annually (5).

Vibrios have been isolated from the marine environments ofmany geographic regions, such as the African coast, Australia, andthe coasts of both North and South America, demonstrating aglobal distribution (3, 5, 6). A 2004 survey of coastal waters nearthe Conero River in Italy showed a variety of vibrios, includingpathogenic strains (7).

The U.S. Centers for Disease Control and Prevention released asurvey of recreation-related waterborne diseases in the UnitedStates between 2005 and 2006. This report examined 189 cases ofvibrio infection due to recreational water activity, 18 of whichresulted in death (9.5% mortality rate) (8). Thus, the development

of an understanding of vibrio diseases through marine recre-ational water exposure is important for human health protection.Furthermore, the fecal indicator bacteria (FIB) used to protecthuman health during ocean water recreation are not good indica-tors of vibrios (9, 10), because the occurrence and concentrationof indigenous aquatic bacteria like vibrios are governed by theenvironmental conditions rather than fecal pollution from exter-nal sources. There has not been a risk assessment model to esti-mate the health risk of vibrio diseases associated with marinebeach water recreation.

Here we report the detection of V. cholerae, V. parahaemolyti-cus, V. vulnificus, and the V. parahaemolyticus toxin gene tdh byPCR assays of seawater samples from two popular recreationalbeaches in Southern California. A quantitative microbial risk as-sessment (QMRA) model was applied to estimate the risk of vibriodiseases during water recreation.

MATERIALS AND METHODSSample collection and vibrio enrichment. Sixty-six water samples weretaken at Doheny State Beach, CA, from the surface of the water column at5 locations (locations A to E) from 25 May through 4 July 2007 (Fig. 1).Ninety-six beach samples were also taken at 3 locations (locations A to C)at Avalon Harbor, Catalina Island, CA, from 27 July through 3 September2007 (Fig. 1). The sampling locations on each beach were designed basedon their distance from the source of fecal pollution. Locations C and D at

Received 31 August 2012 Accepted 22 October 2012

Published ahead of print 26 October 2012

Address correspondence to Sunny C. Jiang, sjiang@uci.edu.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.02674-12.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.02674-12

294 aem.asm.org Applied and Environmental Microbiology p. 294–302 January 2013 Volume 79 Number 1

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Doheny State Beach had historically high counts of FIB because of pollu-tion from San Juan Creek. Locations A and B at Avalon Harbor had rela-tively higher counts of FIB. At the Avalon Harbor site, approximately halfof the samples (n � 45) were collected from the surface of the watercolumn at ankle-deep water, and the other portion (n � 51) was collectedfrom the surface of the water column at chest-deep water. The terms ankledeep and chest deep for measuring distance from the shore are commonlyused in water quality assessments by the Orange County Health Depart-ment in California.

Bacteria in water samples (50 to 200 ml) were filtered onto a 0.45-�m-pore-size nylon membrane filter (Whatman, Maidstone, Kent, UnitedKingdom). Filters were placed into 50 ml alkaline peptone water (APW)(10 g/liter of peptone and 10 g/liter of NaCl [pH 9.2]) and incubated at37°C overnight to encourage vibrio growth. Aliquots of 1-ml enrichmentcultures were taken and stored in a �80°C freezer for future analysis.

Genomic DNA extraction. Two methods of bacterial genomic DNAextraction were evaluated: a cetyltrimethylammonium bromide (CTAB)-chloroform-phenol method and a boiling cell lysis method. The CTAB-chloroform-phenol method was performed according to protocols de-scribed in Molecular Cloning: a Laboratory Manual (11). Briefly, cellpellets were resuspended in 1� TE buffer (10 mM Tris Cl, 1 mM EDTA[pH 7.5]) with protein kinase K and an SDS solution and incubated at37°C for 1 h. Next, CTAB in NaCl (10% CTAB in 0.7 M NaCl) was added,and the mixture was heated to 65°C for 10 min. Genomic DNA was ex-

tracted by using isoamyl alcohol, chloroform, and phenol (1:24:25 dilu-tion). The DNA pellet was washed and dried in a Speed Vac concentrator(model SVC100H; Sevant) and resuspended in 1� TE buffer. DNA con-centration and purity were analyzed spectrometrically (DU 7400 spec-trometer; Beckman Coulter, Fullerton, CA).

For the boiling lysis method, enriched samples were allowed to thaw toroom temperature from an �80°C freezer. A subsample of 100 �l wasremoved and centrifuged at 10,000 rpm for 2 min to pellet the bacteria.The pellet was resuspended in 30 �l 1� TE buffer, and the sample tubewas heated to boiling for 10 min and then cooled to room temperature.The lysate was diluted 1:10 with deionized water for PCR assays. A com-parison of the CTAB-chloroform-phenol DNA extraction technique andthe boiling lysis method showed similar efficiencies for PCR amplificationwhen using positive controls (data not shown). The boiling lysis tech-nique proved faster, produced less waste, and was less expensive. There-fore, the CTAB-chloroform-phenol technique was replaced by the boilingcell lysis method for later part of the sample analysis.

PCR. Primers used for the detection of Vibrio species and toxins arelisted in Table 1. We used primer pairs specific for the thermolabile he-molysin (tlh) gene to detect V. parahaemolyticus, and a primer set thattargeted the temperature direct hemolysin (tdh) gene was used to detecttoxic V. parahaemolyticus (6). V. cholerae was detected by using primersthat target the intergenic spacer (its) between the 16S and 23S ribosomalsubunits (12). The primers for V. vulnificus target the cytotoxin-hemoly-

FIG 1 Sampling sites used in this study. Sixty-six water samples were taken from Doheny State Beach (DSB), CA, at the surface of the water column at 5 locations(locations A to E) between 25 May and 4 July 2007. Ninety-six samples were taken at 3 locations (locations A to C) at Avalon Harbor (AH), Catalina Island, CA,between 27 July and 3 September 2007.

TABLE 1 Primers used for PCR amplification of the genetic markers for V. cholerae, V. parahaemolyticus, the V. parahaemolyticus toxin gene, and V.vulnificus

Target Primer name Primer sequence Tm (°C)a Amplicon size (bp) Reference

its, V. cholerae PVC-F2 TTAAGCSTTTTCRCTGAGAATG 57.0 300 12PVCM-R1 AGTCACTTAACCATACAACCCG 61.6

tlh, V. parahaemolyticus tlhF AAAGCGGATTATGCAGAAGCACTG 68.9 450 6tlhR GCTACTTTCTAGCATTTTCTCTGC 61.3

tdh, V. parahaemolyticus toxin tdhF GTAAAGGTCTCTGACTTTTGGAC 59.7 269 6tdhR TGGAATAGAACCTTCATCTTCACC 64.0

cth, V. vulnificus VVF TTCCAACTTCAAACCGAACTATGAC 65.8 205 13VVR ATTCCAGTCGATGCGAATACGTTG 69.5 6

a Tm, melting temperature.

Vibrio Risk in Southern California Recreational Waters

January 2013 Volume 79 Number 1 aem.asm.org 295

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

sin gene cth, also called vvh, the V. vulnificus hemolysin gene (6, 13). Allsamples were tested for V. vulnificus, V. cholerae, and V. parahaemolyticus.Samples that tested positive for V. parahaemolyticus were also analyzed forthe tdh toxin gene. The PCR mixture was composed of 21 �l of master mixand 4 �l of extracted DNA or deionized water (negative control). Positiveand negative controls were run in conjunction with samples to check forcontamination and PCR success and for band size comparisons. The mas-ter mix was composed of 11.2 �l deionized water, 2.5 �l 10� buffer(Lucigen Corp., Middleton, WI), 2.5 �l 25 mM MgCl2 solution (LucigenCorp., Middleton, WI), 2 �l (25 �M solution) each of forward and reverseprimers (Sigma-Aldrich, St. Louis, MO), 0.5 �l deoxynucleoside triphos-phates (dNTPs) (Fisher Scientific, Pittsburgh, PA), 0.2 �l Taq polymerase(Lucigen Corp., Middleton, WI), and 0.1 �l 100� purified bovine serumalbumin (BSA) (New England BioLabs, Ipswich, MA). PCR was per-formed by using a GeneAmp 2700 PCR system (Applied Biosystems, Fos-ter City, CA). PCR conditions and cycling temperatures are shown in

Table 2. After PCR amplification, samples were run on a 2% agarose gelin 1� TAE buffer (40 mM Tris acetate, 2 mM Na2EDTA·2H2O [pH8.5]) and imaged by using a gel documentation system and Alpha EaseFC software, version 6.0.0 (Alpha InnoTech, San Leandro, CA). Re-sults were scored as positive if the expected amplification sizes wereobserved.

QMRA. (i) QMRA model framework for water recreation-relatedvibrio illness. The QMRA steps and model framework are presented inFig. 2. The individual component within the model framework is de-scribed below. The model was constructed and implemented by usingMATLAB R2010a (The Mathworks Inc., Natick, MA). QMRA was per-formed only for V. parahaemolyticus because there was no previous evi-dence of cholera disease due to recreational exposure to contaminatedwater in spite of reports of a wide distribution of V. cholerae in coastaloceans. Risk analysis was performed by using PCR data for samples col-

TABLE 2 PCR amplification conditions for V. cholerae, V. parahaemolyticus, the V. parahaemolyticus toxin gene, and V. vulnificus

Primer pair(s)

Conditions

Denaturing cycle

Repetitive cycle

Elongation cycle1 2 3

PVC-F2/PVCM-R1 94°C, 5 min 94°C, 0.5 min 60°C, 1 min 72°C, 0.5 min 72°C, 7 mintlhF/tlhR and VVF/VVR 94°C, 3 min 94°C, 1 min 65°C, 1 min 72°C, 1 min 72°C, 5 mintdhF/tdhR 94°C, 3 min 94°C, 1 min 60°C, 1 min 72°C, 1 min 72°C, 5 min

FIG 2 Schematics of the QMRA model framework.

Dickinson et al.

296 aem.asm.org Applied and Environmental Microbiology

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

lected at Doheny State Beach and Avalon Harbor, regardless of the sam-pling dates at each beach.

(ii) PCR data treatment. Given that our PCR results had only twooutcomes (positive or negative detection), a binomial probability modelwas used for each recreational beach. Specifically, an m � n (rows �

columns) binary matrix containing 1’s and 0’s was generated by using theranderr function of MATLAB to represent “positive” and “negative” PCRresults, respectively. The percentage of 1’s in each row was selected ran-domly from the binomial distribution of the PCR detection results foreach beach, where the probability of selecting a certain percentage was

FIG 3 Algorithm for generating the probability distribution of the exposure dose.

Vibrio Risk in Southern California Recreational Waters

January 2013 Volume 79 Number 1 aem.asm.org 297

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

highest at the distribution’s mode and decreasing toward its lower andupper confidence levels.

Cell identifications (IDs) in the m � n binary matrix were also ran-domly generated by using the uniformly distributed pseudorandom inte-ger generator randi in MATLAB and were used to represent the location ofeach cell in the matrix. As both the values in the binary matrix and the cellIDs were generated randomly, they served to simulate the stochastic pro-cess occurring in nature.

(iii) Probability distribution function of vibrio concentration. Theprobability distribution function (PDF) curve of the V. parahaemolyticusconcentration at Doheny State Beach and Avalon Harbor was generatedby referring to its concentration distribution in the coastal environmentcompiled from data reported in the literature (14–18) (see Table S1 in thesupplemental material for data). As these data were obtained by usingdifferent methods (e.g., PCR or culture methods), they have differentlower and upper detection limits. In order to fully utilize the availabledata, data points below or above the detection limits were defined by usingtheir lower and upper detection limits, respectively. Data were compiledand binned by using a log-scale interval for generating histograms. Ran-dom samplings under the distribution curve were conducted by using theemprand function (courtesy of Durga Lal Shrestha) written for MATLAB.The integrity of the function was validated by comparing and cross-check-ing histograms of the simulated data with the corresponding histogram of

the original data. All of the PDF curves in this study were producedthrough kernel density estimation.

It should be noted that our model referred only to the V. parahaemo-lyticus concentration from a literature survey when a randomly selectedsample from the binary matrix was “1,” denoting “positive” detection (seeFig. 3 for the steps taken to generate various PDF curves). Each of thesimulated PDF curves/histograms consists of 15,000 iterations, whichwere compared to each other for assessing the degrees of variance amongthem. In our study, three replicates were produced for each simulatedPDF curve.

(iv) Probability distribution function of water volume ingested. Theprobability distribution of water volume ingested by people during waterrecreational activities was adapted from data reported in literature. Dif-ferent distributions of water volume ingested were observed for differentwater recreational activities. Swimming and surfing were the two mainrecreational activities at the beach, and therefore, distributions for watervolume ingested during swimming and surfing were estimated in thisstudy. The amount of water ingested by people during ocean swimmingwas estimated based on a survey conducted previously by Schets et al. (19).Three distributions were reported in their study, which applied to men,women, and children (�15 years old), respectively. The volume of wateringested by men during swimming was described by the gamma distribu-tion as (Ioral) � G {r � 0.45, � � 60} ml/swim event, whereas (Ioral) � G{r � 0.51, � � 35} ml/swim event was given for women and (Ioral) � G{r � 0.58, � � 55} ml/swim event was given for children. Similarly, theamount of water ingested during surfing was estimated based on a surveyconducted previously by Stone et al. (20). However, only adults at least 18years old were included in the study by Stone et al. The volume of wateringested during surfing fits the log-normal (LN) distribution (Ioral) �LN{� � 3.54, � � 1.80} ml/surf event. Data points used for subsequentMonte Carlo analyses were sampled from 95% confidence intervals ofeach swimming distribution and 90% confidence intervals of the surfingdistribution according to previous reports.

(v) Exposure assessment. The exposure of surfers and swimmers to V.parahaemolyticus was estimated by using the joint probability of volumewater ingested during water recreation and the V. parahaemolyticus con-centration encountered at the time of exposure, which is expressed inequation 1:

Dexp � Ioral � P (1)

where Dexp is the exposure dose, P is the pathogen density distribution,and Ioral is the volume of water ingested.

The procedure for generating the exposure distribution curve wassimilar to that used to generate the PDF curve of vibrio concentrations.Figure 3 shows the flowchart of the algorithm for generating the proba-bility distribution of the exposure dose.

(vi) Dose-response model. The probability of illness per surfing or perswimming event was estimated by using a beta-Poisson dose-response

TABLE 3 Detection of V. cholerae, V. parahaemolyticus, the V.parahaemolyticus toxin gene, and V. vulnificus in water samples fromDoheny State Beach and Avalon Harbor, CA

Sampling site (no.of samples)

No. (%) of samples positive for:

V.cholerae

V.parahaemolyticus

V. parahaemolyticustoxin gene

V.vulnificus

Doheny State BeachA (15) 3 (20.0) 4 (26.6) 0 (0) 0 (0)B (14) 5 (35.7) 1 (7.1) 0 (0) 0 (0)C (7) 6 (85.7) 4 (57.1) 1 (14.3) 0 (0)D (15) 5 (33.3) 4 (26.7) 0 (0) 0 (0)E (15) 8 (53.3) 5 (33.3) 0 (0) 0 (0)

Total (66) 27 (40.1) 18 (27.3) 1 (1.5) 0 (0)

Avalon HarborA (32) 5 (15.6) 22 (68.8) 2 (6.3) 0 (0)B (32) 6 (18.8) 22 (68.8) 1 (3.1) 0 (0)C (32) 5 (15.6) 23 (71.9) 2 (6.3) 0 (0)

Total (96) 16 (16.7) 67 (69.8) 5 (5.2) 0 (0)

FIG 4 Frequency of detection of Vibrio cholerae, Vibrio parahaemolyticus, andthe Vibrio parahaemolyticus toxin gene at both Doheny State Beach and AvalonHarbor, presented by sampling date (day/month) in 2007.

TABLE 4 Detection of V. cholerae, V. parahaemolyticus, and the V.parahaemolyticus toxin gene in water samples collected from ankle-deepand chest-deep water at Avalon Harbor, CA

Sample site(no. of samples)

No. of samples positive for:

V.cholerae

V.parahaemolyticus

V. parahaemolyticustoxin gene

Aankle (17) 5 12 1Achest (15) 0 10 1Bankle (17) 4 10 1Bchest (15) 2 12 0Cankle (17) 3 15 2Cchest (15) 2 8 0

Totalankle (51) 12 37 4

Totalchest (45) 4 30 1

Dickinson et al.

298 aem.asm.org Applied and Environmental Microbiology

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

model proposed by the U.S. Food and Drug Administration for V. para-haemolyticus, which is presented in equation 2 (21):

Pill � 1 � �1 � Dexp ⁄ ��� � (2)

where Pill is the probability of illness from a single vibrio exposure duringwater recreation and � and � are model parameters for V. parahaemolyti-cus defined by the U.S. FDA dose-response model. Values for � and � usedfor this study are 0.60 and 1.31 � 106, respectively, which are the bestparameter estimates among the other likely parameter estimates.

RESULTSOccurrence of vibrios and toxins. For the 66 water samples col-lected at Doheny State Beach, the overall frequency for the geneticmarker of V. cholerae was 40.1%, the overall frequency for thegenetic marker of V. parahaemolyticus was 27.3%, and one sampletested positive for the V. parahaemolyticus toxin gene, with a fre-quency of 1.5% (Table 3). For the 96 water samples collected atAvalon Harbor, the overall frequency for the genetic marker of V.cholerae was 18.7%. The detection frequencies for the geneticmarker of V. parahaemolyticus and the V. parahaemolyticus toxingene were 69.8% and 5.2%, respectively (Table 3). No samplesfrom either site tested positive for the V. vulnificus genetic marker(Table 3). A comparison of results from Avalon Harbor and Do-heny State Beach showed that significantly more samples testedpositive for the V. cholerae gene marker at Doheny State Beach(P � 0.033 by one-tailed t test, assuming unequal variance) with a95% confidence interval, while significantly more samples werepositive for the V. parahaemolyticus gene marker at Avalon Har-bor (P � 0.004 by one-tailed t test, assuming unequal variance)

with a 95% confidence interval (Table 3). No significant differencewas detected when samples were analyzed by individual samplinglocation on each beach or the date of collection during the 4months of study with sampling every 5 to 7 days (Fig. 4). Furtherstatistical analysis of samples from Avalon Harbor demonstratedno significant difference when samples positive for a vibrio genemarker, either V. parahaemolyticus or V. cholerae, at an ankle-deeplocation were compared to samples from the chest-deep location(P � 0.53 by two-tailed t test, assuming unequal variance) with a95% confidence interval (Table 4). Thus, the vibrio data at eachbeach were combined for QMRA regardless of the sampling datesand the locations on the beach.

QMRA of vibrio exposure during marine water recreation.Figure 5 shows the PDF of the V. parahaemolyticus concentrationat Doheny State Beach and Avalon Harbor. The three replicates ofsimulated PDF curves all converged after 15,000 iterations andmatched the histogram (Fig. 5). A higher probability of a V. para-haemolyticus concentration of 102 to 103 organisms/100 ml waspredicted at Avalon Harbor, while a flat long tail of up to 105

organisms/100 ml was observed by the PDF for Doheny StateBeach. A V. parahaemolyticus concentration of 10�2 organisms/100 ml was most frequently observed at both sites.

Joint probability distributions of water volume ingested andthe concentration of vibrios showed that human exposure to V.parahaemolyticus varied with the location (Fig. 6). In general, theexposures to V. parahaemolyticus at Doheny State Beach peaked atbetween 10�3 and 10�2 organisms/event and decreased sharplybefore flattening out, resulting in a low flat shoulder toward the

FIG 5 Probability density function and normalized histogram for Vibrio parahaemolyticus concentrations at Doheny State Beach (DSB) and Avalon Harbor(AH). Three replicates were produced for each graph to show the degrees of variance among each curve. Sim, simulated.

FIG 6 Probability density function for dose of Vibrio parahaemolyticus ingested during surfing or swimming at Doheny State Beach (DSB) and Avalon Harbor(AH).

Vibrio Risk in Southern California Recreational Waters

January 2013 Volume 79 Number 1 aem.asm.org 299

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

exposure to the higher pathogen concentration. At Avalon Har-bor, the exposures to V. parahaemolyticus followed a similar trendas that of Doheny State Beach but peaked, decreased slowly, andflattened out with a relatively higher shoulder toward the higherdose of exposure (Fig. 6). The shapes of the exposure dose distri-butions were not significantly different between the surfers andthe swimmers, but the minimum exposure of surfers shifted to theright, showing a 2-order-of-magnitude difference in the mini-mum exposures between surfers and swimmers. Children also ex-perienced a slightly higher rate of exposure at a low dose duringocean swimming, but the elevation was insignificant at a higherdose (Fig. 6).

The risk outcomes due to surfing and swimming at the twoSouthern California beaches are summarized as a cumulative den-sity function (CDF) of the illness risk in Fig. 7. The U.S. EPA(1986) acceptable ocean recreational illness rate of 19 per 1,000bathers was used as a point of reference for interpreting the riskoutcomes. The CDF curve shifted to the right for the surfers andchildren swimmers at both locations, suggesting a relatively higherillness risk per ocean recreation event for the two categories. How-ever, the predicted risks at both beaches were below U.S. EPAocean recreational illness risk benchmarks. Table 5 shows the av-erages and ranges of vibrio disease risk predicted at each beach foreach category of subject. Surfers experienced the highest riskamong all categories. The maximum risk for surfers to experiencevibrio disease was ca. 13 per 1,000 bathers per surfing event atAvalon Harbor. Children were the next group experiencing a

higher risk at Avalon Harbor, with a maximum risk of ca. 6 chil-dren per 1,000 bathers per swimming event.

DISCUSSION

Current recreational marine safety guidelines call for the samplingof FIB such as Escherichia coli and enterococci (22) to protect thepublic from exposure to human pathogens from fecal waste con-tamination. However, marine-indigenous microorganisms alsoplay a role in recreation water health. As was recently documentedby CDC surveillance for recreational-water-related illnesses,vibrio diseases from recreational exposure pose important healthrisks (8). So far, there has not been a good understanding of the riskassociated with exposure to vibrios in marine water or a risk frame-work to estimate the risk.

Vibrios are important members of the microbial communityin coastal waters. Diverse Vibrio spp. were reported in NorthAmerican coastal waters, including pathogenic species of V. chol-erae, V. parahaemolyticus, and V. vulnificus (10, 14, 18, 23–28).However, quantitative studies of different pathogenic groups andassociated toxins are rare, which is due largely to the limitations ofcurrent detection methods. Direct PCR quantification of vibriosusing a concentrated microbial community from seawater wasattempted in this study, but the quantitative PCR results wereinconsistent. This could be due to (i) the presence of PCR inter-ferences and large amounts of nontarget DNAs in the samples and(ii) the low concentrations of the target organisms. In contrast, theculture enrichment samples were highly reproducible for the V.cholerae and V. parahaemolyticus assays. A second round of PCRusing the first PCR products did not yield additional positive re-sults for selected samples. Thus, a positive PCR was considered tobe the presence of at least 1 organism per volume of water sample.The detection limit of this assay ranged between 5 and 20 organ-isms per liter of water.

Samples from Doheny State Beach contained significantlymore V. cholerae, and samples from Avalon Harbor containedsignificantly more V. parahaemolyticus, while neither locationtested positive for V. vulnificus. Many factors could be associatedwith the differences in bacterial types by location, including abi-otic factors, such as salinity, temperature, nutrient content andtype, and wastewater runoff, or biotic factors, such as predation byprotozoans (2). V. cholerae is also known to enter into a viable-but-nonculturable state (29) at cooler water temperatures. Fur-ther studies could explore the relationship between species andgeographical locations.

FIG 7 Cumulative density function of illness risk at Doheny State Beach (DSB) and Avalon Harbor (AH) due to swimming or surfing.

TABLE 5 Summary descriptors of illness risk per recreational event

Site and group

Illness risk (per recreational event)

Range

Avg 95th percentileMin Max

Doheny State BeachSurfers 1.57 � 10�10 1.07 � 10�2 3.15 � 10�5 9.80 � 10�5

SwimmersMen 5.83 � 10�13 3.40 � 10�3 1.19 � 10�5 2.73 � 10�5

Women 9.16 � 10�13 3.66 � 10�3 8.32 � 10�6 1.97 � 10�5

Children 3.57 � 10�12 2.99 � 10�3 1.30 � 10�5 4.26 � 10�5

Avalon HarborSurfers 1.58 � 10�10 1.28 � 10�2 8.20 � 10�5 4.36 � 10�4

SwimmersMen 5.98 � 10�13 5.20 � 10�3 3.10 � 10�5 1.61 � 10�4

Women 9.16 � 10�13 3.25 � 10�3 1.98 � 10�5 1.03 � 10�4

Children 3.58 � 10�12 5.59 � 10�3 3.68 � 10�5 2.00 � 10�4

Dickinson et al.

300 aem.asm.org Applied and Environmental Microbiology

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

The lack of V. vulnificus at both study sites may imply a limi-tation in enrichment because APW may not favor the selection ofV. vulnificus (30) or the low occurrence of V. vulnificus in Califor-nia coastal waters. V. vulnificus is prevalent in warm ocean watersof the Gulf of Mexico and the Atlantic coast. For example, Pan-icker et al. previously analyzed oysters from the Gulf of Mexico,and all samples tested positive for vvh, the marker for V. vulnificus(6). However, the rate of detection is low for the West Coast of theUnited States: only 5.7% of 527 samples were positive for V. vul-nificus in California estuarine waters (26). The cases of V. vulnifi-cus infections in California are related to the consumption ofshellfish collected in the Gulf of Mexico (31). Similarly, in a 2007study, Masini found that only 2% of water samples tested positivefor V. vulnificus off the Italian coast near the Conero River (7). Theoccurrence of V. vulnificus seems to be highly dependent on geo-graphical location.

The results of QMRA indicated that the recreation risks ofexposure to vibrios were below the acceptable illness benchmarkof 19 per 1,000 bathers (22) at two Southern California Beaches.However, it is important to note that both the vibrio concentra-tion and the type of recreational activity are equally significantparameters in predicting the probability of illness. Surfers andchildren are at higher exposure levels and thus are higher-riskgroups for vibrio diseases. The different risk outcomes for twoclose-by California marine recreational beaches also imply theimportance of empirical risk assessment at local beaches, as bothpathogen concentrations and recreational activities vary at differ-ent locations.

The risk assessment performed in this study considered only asingle type of marine bacterium. There are hundreds of thousandsof other indigenous marine bacteria in water that are ingestedduring surfing and swimming. Many of them, including othervibrios, Aeromonas spp., and Pseudomonas spp., etc., are opportu-nistic human pathogens. The compounding effect of these mi-crobes is likely to weaken the human immune system, which leadsto disease that may not be triggered by the dose of a single organ-ism. Human pathogens from fecal pollution, although not as-sessed in this study, also play a compounding role in recreationaldisease outcomes. Thus, risk assessment is much limited by theavailability of models and systematic understandings of diseaseoutcomes.

Risk prediction, like the true nature of human health risk, isdynamic in nature. Similar to previous reports of health risks us-ing average values (19), the average risk reported in this researchshould not be taken at face value. Distributions of the illness riskshould be considered to reveal the full spectrum of risk. The pre-dicted risk may over- or underestimate the true risk due to mul-tiple factors. For example, vibrio infection through wound infec-tion is well known (32) but was not included due to the lack of anexposure model. The parameters used for the beta-Poisson dose-response model were calculated based on human clinical trialdata, which may be inadequate for environmental samples. More-over, the current model considers the responses of healthy adultsonly, which underestimates the higher risks presented for sensitivepopulations, such as the immunocompromised, children, and theelderly.

Although the recreational health risks from vibrio exposurewere below recreational safety standards at the two Californiabeaches, the risks could be very different at other locations wherethese indigenous bacteria are more prevalent and are present in

higher concentrations. The QMRA offers a framework for identi-fying health risk priorities and marine policy gaps and for humanhealth protection.

Conclusions. V. cholerae and V. parahaemolyticus were de-tected at two popular marine recreational beaches in SouthernCalifornia. The prevalences of Vibrio species were different at thetwo locations. The QMRA results suggest that the illness risksfrom vibrio exposure during water recreation were below the rec-reational illness risk benchmark set by the U.S. EPA. However,surfers and children were exposed to relatively higher risks ofvibrio diseases. The QMRA offers a tool for identifying marinerecreational safety priorities.

ACKNOWLEDGMENTS

Funding support for this project was partially provided by a University ofCalifornia Environmental Institute award and an undergraduate researchopportunity award to G.D.

We are thankful to the following individuals and organizations forcollaboration and contribution to this project: John Griffith, Donna Fer-guson, and Yiping Cao at the Southern California Coast Water ResearchProject and Weiping Chu, Michael Lin, and Matthew Linder at the Uni-versity of California, Irvine. We acknowledge Ivan Jeliazkov for his con-tribution to probability analysis and data presentation.

REFERENCES1. Lobitz B, Beck L, Huq A, Wood B, Fuchs G, Faruque AS, Colwell R.

2000. Climate and infectious disease: use of remote sensing for detectionof Vibrio cholerae by indirect measurement. Proc. Natl. Acad. Sci. U. S. A.97:1438 –1443.

2. Worden AZ, Seidel M, Smriga S, Wick A, Malfatti F, Bartlett D, AzamF. 2006. Trophic regulation of Vibrio cholerae in coastal marine waters.Environ. Microbiol. 8:21–29.

3. Dechet AM, Yu PA, Koram N, Painter J. 2008. Nonfoodborne Vibrioinfections: an important cause of morbidity and mortality in the UnitedStates, 1997–2006. Clin. Infect. Dis. 46:970 –976.

4. Bross MH, Soch K, Morales R, Mitchell RB. 2007. Vibrio vulnificusinfection: diagnosis and treatment. Am. Fam. Physician 76:539 –544.

5. Griffith DC, Kelly-Hope LA, Miller MA. 2006. Review of reported chol-era outbreaks worldwide, 1995–2005. Am. J. Trop. Med. Hyg. 75:973–977.

6. Panicker G, Call DR, Krug MJ, Bej AK. 2004. Detection of pathogenicVibrio spp. in shellfish by using multiplex PCR and DNA microarrays.Appl. Environ. Microbiol. 70:7436 –7444.

7. Masini L, De Grandis G, Principi F, Mengarelli C, Ottaviani D. 2007.Research and characterization of pathogenic vibrios from bathing wateralong the Conero Riviera (central Italy). Water Res. 41:4031– 4040.

8. Yoder JS, Hlavsa MC, Craun GF, Hill V, Roberts V, Yu PA, Hicks LA,Alexander NT, Calderon RL, Roy SL, Beach MJ. 2008. Surveillance forwaterborne disease and outbreaks associated with recreational water useand other aquatic facility-associated health events—United States, 2005-2006. MMWR Surveill. Summ. 57:1–29.

9. Jiang SC. 2001. Vibrio cholerae in recreational beach waters and tributariesof Southern California. Hydrobiologia 460:157–164.

10. Pfeffer CS, Hite MF, Oliver JD. 2003. Ecology of Vibrio vulnificus inestuarine waters of eastern North Carolina. Appl. Environ. Microbiol.69:3526 –3531.

11. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual,3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

12. Chun J, Huq A, Colwell RR. 1999. Analysis of 16S-23S rRNA intergenicspacer regions of Vibrio cholerae and Vibrio mimicus. Appl. Environ. Mi-crobiol. 65:2202–2208.

13. Brasher CW, DePaola A, Jones DD, Bej AK. 1998. Detection of micro-bial pathogens in shellfish with multiplex PCR. Curr. Microbiol. 37:101–107.

14. Kaper JB, Remmers EF, Lockman H, Colwell RR. 1981. Distribution ofVibrio parahaemolyticus in Chesapeake Bay during the summer season.Estuaries 4:321–327.

15. Alam MJ, Miyoshi S, Shinoda S. 2003. Studies on pathogenic Vibrioparahaemolyticus during a warm weather season in the Seto Inland Sea,Japan. Environ. Microbiol. 5:706 –710.

Vibrio Risk in Southern California Recreational Waters

January 2013 Volume 79 Number 1 aem.asm.org 301

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

16. Alam MJ, Tomochika KI, Miyoshi SI, Shinoda S. 2002. Environmentalinvestigation of potentially pathogenic Vibrio parahaemolyticus in theSeto-Inland Sea, Japan. FEMS Microbiol. Lett. 208:83– 87.

17. Fukushima H, Seki R. 2004. Ecology of Vibrio vulnificus and Vibrioparahaemolyticus in brackish environments of the Sada River in ShimanePrefecture, Japan. FEMS Microbiol. Ecol. 48:221–229.

18. Blackwell KD, Oliver JD. 2008. The ecology of Vibrio vulnificus, Vibriocholerae, and Vibrio parahaemolyticus in North Carolina estuaries. J. Mi-crobiol. 46:146 –153.

19. Schets FM, Schijven JF, de Rosa Husman AM. 2011. Exposure assess-ment for swimmers in bathing waters and swimming pools. Water Res.45:2392–2400.

20. Stone D, Harding A, Hope B, Slaughter-Mason S. 2008. Exposureassessment and risk of gastrointestinal illness among surfers. J. Toxicol.Environ. Health A 71:1603–1615.

21. US FDA. 19 July 2005. Quantitative risk assessment on the public healthimpact of pathogenic Vibrio parahaemolyticus in raw oysters. US FDA, SilverSpring, MD. http://www.fda.gov/Food/ScienceResearch/ResearchAreas/RiskAssessmentSafetyAssessment/ucm050421.htm. Accessed 19 August2011.

22. US EPA. 1986. Ambient water quality criteria for bacteria—1986. USEnvironmental Protection Agency Office of Research and Development,Microbiology and Toxicology Division, Cincinnati, OH.

23. Louis VR, Russek-Cohen E, Choopun N, Rivera IN, Gangle B, Jiang SC,Rubin A, Patz JA, Huq A, Colwell RR. 2003. Predictability of Vibriocholerae in Chesapeake Bay. Appl. Environ. Microbiol. 69:2773–2785.

24. Jiang SC, Fu W. 2001. Detection of Vibrio cholerae in coastal waters by a16S-23S intergenic spacer probe. Microb. Ecol. 42:540 –548.

25. Jiang SC, Louis V, Choopun N, Sharma A, Huq A, Colwell RR. 2000.Genetic diversity of Vibrio cholerae in Chesapeake Bay determined by am-plified fragment length polymorphism fingerprinting. Appl. Environ. Mi-crobiol. 66:140 –147.

26. Kaysner CA, Abeyta C, Jr, Wekell MM, DePaola A, Jr, Stott RF, LeitchJM. 1987. Incidence of Vibrio cholerae from estuaries of the United StatesWest Coast. Appl. Environ. Microbiol. 53:1344 –1348.

27. Kenyon JE, Piexoto DR, Austin B, Gillies DC. 1984. Seasonal variationsof Vibrio cholerae (non-O1) isolated from California coastal waters. Appl.Environ. Microbiol. 47:1243–1245.

28. Colwell RR, Kaper J, Joseph W. 1977. Vibrio cholerae, Vibrio parahae-molyticus, and other vibrios— occurrence and distribution in ChesapeakeBay. Science 198:394 –396.

29. Binsztein N, Costagliola MC, Pichel M, Jurquiza V, Ramirez FC,Akselman R, Vacchino M, Huq A, Colwell R. 2004. Viable but noncul-turable Vibrio cholerae O1 in the aquatic environment of Argentina. Appl.Environ. Microbiol. 70:7481–7486.

30. Donovan TJ, van Netten P. 1995. Culture media for the isolation andenumeration of pathogenic Vibrio species in foods and environmentalsamples. Int. J. Food Microbiol. 26:77–91.

31. Kizer KW. 1994. Vibrio vulnificus hazard in patients with liver disease.West. J. Med. 161:64 – 65.

32. Collin B, Rehnstam-Holm AS. 2011. Occurrence and potential patho-genesis of Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificuson the South Coast of Sweden. FEMS Microbiol. Ecol. 78:306 –313.

Dickinson et al.

302 aem.asm.org Applied and Environmental Microbiology

on July 14, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from