Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis

Nasrin Khan, Jenny Cheng, John Paul Pezacki,

and Maxim V. Berezovski*,

analytical chemistry, June 29, 2011

BackGround

MicroRNAs (miRNAs) are gen-

erally characterized by their short

length (21-25 bp), 2 nt 3’ over-han-

ging ends and 5’ phosphate groups.

miRNAs have been identified in

normal and malignant cells and are

predicted to regulate at least one-t

hird of all human genes.

BackGround

miRNAs are frequently deregul-ated in some diseases, especially incancer. miRNAs have shown promise as tissue- and blood-based biomarkers for cancer classification and progn- ostication.

BackGround

miRNAs are in fact present in cl- inical samples of plasma and serum i

n a remarkably stable form and coul

d serve as cancer biomarkers.

BackGround

Authors present a ProFACE assay for rapid quantification of miRNA levels in blood serum using SSB and p19 as sep- aration enhancers.

ProFACE: protein-facilitated affinity capillary electrophoresis

SSB: single-stranded DNA binding protein

p19: double-stranded RNA binding protein

BackGround

Capillary electrophoresis with laser-induced fluorescence detection (CE-LIF) is a promising technique for miRNA det- ection where miRNAs are easily separated from most of the other biomolecules because of their strong negative charge.

BackGround

BackGround

Some advantages of ProFACE-LIF o

ver other methods include high sen- sitivity and selectivity toward target molec

ules, rapidity of detection, and

the ability to screen complex samples.

BackGround

SSB: single-stranded DNA binding protein

p19: double-stranded RNA binding protein

single-stranded DNA/RNA probe

miRNA-RNA probe duplex

Materials and Methods

MicroRNA and Hybridization Probes

• miRNA-122 and hybridization probes were synthesized by IDT DNA Technologies.

the sequence of miR-122:

5’-/Phos/UGGAGUGUGACAAUGGUGUUUG-3’

• The fluorescently labeled DNA and RNA probes were with the following sequences and contained 3’ and 5’ modifications:

5’-/Phos/CAAACACCAUUGUCACACUCCA/36-FAM/-3’

5’-/Phos/CAAACACCATTGTCACACTCCA/36-FAM/-3’

Materials and Methods

Hybridization Conditions

The hybridization was carried out in

PCR thermocycler in the following incub-

ation buffer (50mM TrisAc, 50mM NaCl,

10mM EDTA, pH 8.1).

Materials and Methods

Temperature was increased to a de-

naturing 60℃ for DNA probe (55℃ for

RNA probe) and then lowered to 20 ℃

in decrement steps of 1℃ every 3 s to al-

low annealing.

Materials and Methods

p19 Expression and Purification

• Construction of the pTriEx-p19 plasmid encoding the carnation Italian ring spot

virus p19 protein with a C-terminal oct-

ahistidine tag.

Materials and Methods

• E. coli strain BL21 (DE3) cells harboring

p19 construct were grown at 37℃ until an optical density at 600 nm (OD600) of 0.5-0.6

was achieved.

• Cultures were then grown for an additional

2-3 h at 28℃ or until OD600 reaches 1-1.5.∼

Materials and Methods

• After harvesting, bacterial pellets were re-

suspended in the lysis buffer and lysed by

sonication on ice-bath.

50mM Tris-HCl, 300mM NaCl, 10mM imidazole, 1mM dithiothreitol (DTT), 1×complete protease inhibitor cocktail from Roche, pH 8.0

Materials and Methods

• Cell lysate was then centrifuge at 20 000g for 20 min at 4℃. Soluble lysate fraction containing the His-tagged p19 protein was loaded to a HisTrap FF nickel affinity col- umn (GE Healthcare, Piscataway,U.S.A.).

Materials and Methods

• After protein binding the resin was was- hed with 10 column volumes of the wash buffer.

50 mM Tris-HCl, 300 mM NaCl, 50 mM imidazole, pH 8.0

Materials and Methods

• Elution of His-tagged p19 protein was

carried out using the elution buffer and

10 mM DTT was added immediately to the elute.

50 mM Tris-HCl, 300 mM NaCl, 250 mM imidazole, pH 8.0

Materials and Methods

• Fractions containing the desired p19 prote- in were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis

(SDS-PAGE), combined, and stored at 4℃ .

Materials and Methods

Capillary Electrophoresis Separation

• Capillary electrophoresis analyses were performed on a ProteomeLab PA 800 capillary electrophoresis system (Beckman- Coulter, Brea, U.S.A.) with laser-induced fluorescence detection.

Materials and Methods

• The separations were conducted by

applying an electric field of 400 V/cm (positive charge at the inlet and ground at the outlet). The temperature of the

capillary was 15℃ .

Materials and Methods

• The run buffer was 25 mM sodium tetrab- orate at pH 9.2.

• The run buffer was supplemented with SSB in concentrations ranging from 0 to 100 nM

or with the p19 protein in concentrations ranging from 0 to 500 nM.

Materials and Methods

MicroRNA Preconcentration from

Serum Using p19 Beads

Materials and Methods

The MBP helps in p19 purification, and the CBD allows p19 to bind very tightly to chitin magnetic beads.

• The MBP-p19-CBD fusion protein was obtained from New England BioLabs.

The p19 has the N-terminal fusion of the maltose binding protein (MBP) and the C-terminal fusion of the chitin binding domain (CBD).

Materials and Methods

1mL of 100% fetal bovine serum, 200μL of the p19 binding buffer spiked with 100nM masking DNA, 100nM tRNA, 1μL of murine RNase inhibitor, 0.5fM to 500pM miRNA-122, and 1.25nM miR-122 probe.

•The p19 beads were incubated with the mixture.

The binding reaction was then incubated by shaking on a benchtop shaker for 2h at 23℃ .

Materials and Methods

• Unbound RNA was removed by washing 10 times with 500μL of 1×wash buffer that was preheated to 37℃.

For each wash, the beads were shaken for 5min at room temperature.

20mM Tris-HCl, 100 mM NaCl, 1mM EDTA, 100μg /mL BSA, pH 7.0

Materials and Methods

• The bound miRNA was eluted from beads in 10μL of 1×p19 elution buffer by shaking for 10min at 23℃ followed by another 10min of incubation at 37℃.

The eluted 10μL miRNA was analyzed by capillary electrophoresis.

20mMTris-HCl, 100mM NaCl, 1mMEDTA, 0.5%SDS, pH7.0

Materials and Methods

1.Application of SSB for miRNA ProFACE Separ- ation and LIF Detection.

RESULTS AND DISCUSSION

The optimum resolution of the probe and duplex is achieved when the concentration of SSB is in the range of 10-50 nM.

SSB increases the seperation between the excess probe and miRNA-probed uplex.

RESULTS AND DISCUSSION

2.ProFACE Assay of miRNA with p19.

RESULTS AND DISCUSSION

RESULTS AND DISCUSSION

The use of SSB and p19 proteins enhanced the baseline CE separation and allowed for the measurement of the exact amount of miR-122. Without a baseline separation, the excess of a probe cannot be used because of significant overlap with the miRNA duplex peak.

RESULTS AND DISCUSSION

3.MicroRNA Detection in Serum.

The p19 bead precipitation and CE sta- cking helped enrich the miRNA greater than 1000-fold from serum compared with CE experiments without the preco- ncentration.

RESULTS AND DISCUSSION

The use of p19 beads brings two major benefits:

miRNA-selective extraction

Sample enrichment

RESULTS AND DISCUSSION

Conclusion

1.The authors developed a simple techniquefor miRNA analysis in blood serum involving four steps:

ⅳ. CE-based separation and quantitation.

ⅰ. Hybridization with a RNA probe

ⅱ. Precipitation with p19 magnetic beads

ⅲ. Injection with the sample stacking into a capillary

2. SSB and p19 proteins can work as enhanc-ers of the magnetic bead microRNA isolation and CE separation.

3. Without PCR amplification, the ultralow amounts of miRNA in serum can be measu-red by ProFACE.

Conclusion

4. This method can be parallelized to qu- an

titatively detect multiple miRNA-based bio

markers in different biological samples.

Conclusion

• The elutes were combined and concentrated to 0.5 mL using the Amicon Ultra 10 kDaMWCO

centrifugal filter device (Millipore, Concord, MA).

• The concentrated sample was then additionally

purified on a Superdex 200 size exclusion col- umn (GE Healthcare, Piscataway,U.S.A.)

Materials and Methods