Pyrosequencing Experience from Mumbai, India · PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD...

Pyrosequencing

Experience from Mumbai, India

Camilla Rodrigues MD

Consultant Microbiologist

Hinduja Hospital,Mumbai

India

Mumbai ……maximum city

With increasing drug resistance, DST is vital

Liquid Culture

& DSTMolecular Tests

Solid Culture

& DST

Suspected MDR Case

Rapid diagnosis with DST is fundamental

Slo

w

Fas

t

1-2

D

India’s PMDT Scale up

Diagnostic algorithm for DR TB

Guidelines on Programmatic Management of DR TB in India 2017

Beyond Xpert & LPA : Sequencing in the DR TB world

- Sanger Sequencing

- Pyrosequencing (PSQ)

- Targeted NGS

- Whole Genome Sequencing

PSQ Outline

• Principle & Cost

• Clinical applications

• Challenges

What is pyrosequencing ?

Real time diagnostic DNA “ sequencing by synthesis ”

based on actual short segment sequencing (<100bp )

at a speed of 1 min / nucleotide

Unlike Sanger sequencing ( chain termination with dideoxynucleotides),

PSQ relies on pyrophosphate detection on nucleotide incorporation

Can produce clinically relevant results in < 6 hrs from clinical samples

Flexible & adaptable to regional prevalence specifics & new mutations

• DNA extraction

• PCR amplification of 8 specific targets

• Post PCR, biotinylated ss DNA template is

coupled to streptavidin coated beads

• Pyrosequencing

• Software analysis search for 100% identity match in

target library containing all expected mutations

1. Iterative dNTP dispensation only 1 at a time the order determined by known mutations

2. Incorporation of dNTP generates PPi .

3. PPi reacts with substrate & triggers a series of

chemical reactions catalyzed by enzymes.

4. Nucleotide incorporation catalyses a flash of light

5. Apyrase degrades unincorporated dNTP & ATP

6. Pyrogram shows a sequential event of dNTPs

incorporated

Pyrosequencing : cascade of enzymatic reactions

Pyrogram

10

Target: inhA

promoter

100% match with

wild type sequence.

<Sequence read

<Nucleotide Dispensation

Detecting a rpob mutation

Query 1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42

| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |

Library1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42

Complementary nucleotide to the base strand is accompanied

by release of pyrophosphate (PPi) which generates light

12

Target Location Mutations Length

M tuberculosis

complexIS6110 - 24

Isoniazid

katG 312 – 316 5 13

inhA promoter - 4 to -20 7 17

ahpC- oxyR - 4 to -23 5 24

Rifampicin rpoB 507-521

522-533

32 45

35

Fluoroquinolone gyrA 88-96 13 25

SLI

KAN,AMK,CAPrrs 1397-1406 2 10

KAN eis -6 to -47 5 42

PSQ : detecting > 64 mutations in < 6 hrs

PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD PyroMark Q48/ Q96

MD Automated

Throughput 1–24 samples 1–96 samples 1–96 samples 10–960 with automation

option

Running volume 25 µl 40 µl 12 µl 12 µl

Read lengths SQA ~50 – 100 bp

SNP ~10 – 100 bp

AQ ~10 – 100 bp

CpG ~10 – 120 bp

SQA ~50 – 70 bp

SNP ~10 – 100 bp

AQ ~10 – 100 bp

CpG ~10 – 120 bp

SNP ~10 – 100 bp

AQ ~10 – 100 bp

CpG ~10 – 150 bp

SNP ~10 – 100 bp

AQ ~10 – 100 bp

CpG ~10 – 150 bp

Main applications Genetic testing

Epigenetics

Microbilogy

Genetic testing

Epigenetics

Microbiology

Epigenetics

Genetic testing

Epigenetics

Genetic testing

(SNP/AQ only in batch mode)

Sensitivity 5% limit of detection 10% limit of detection 2% limit of detection 2% limit of detection

PSQ : Instrumentation

PSQ : cost

Equipment :

Pyromark Q 48 : approx INR 50 lakhs

Q 96 : approx INR 75 lakhs

Consumables :

TB & XDR detection :approx INR 4500 per sample with controls

PSQ Outline

• Principle & Cost


• Challenges

BMC Infect Dis 2016;16:458

: implications for global implementation

PTB : PSQ Sequencing success by Smear & Culture

BMC Infect Dis 2016;16:458

PSQ success for each target region stratified by smear and culture

What do we use Pyrosequencing for ?

(i) Smear Positive Samples with a LPA WT band present

but no corresponding mutant band or LPA indeterminate

(ii) Smear negative TB : PTB & EPTB

(iii) Resolving discordant Xpert & MGIT DST

(iv) Confirming RIF Resistant in Xpert MTB detected very low

20

Resistant Phenotype Reference

Genes

DR conferring

mutations

No(%) Detected ONLY

WT absent

Only WT absent

with no Mutant

band

INHR kat G

inhA

S315T1/ S315T2

C15T

A16G

T 8C

1728 (87%)

202 ( 9.2%)

27 (1.23%)

katG 315

inhA -15

-16

-8

49(2.23%)

-

-

RIFR rpob D516V

H526Y

H526D

S531L

32 ( 1.4%)

6 ( 0.2%)

4 ( 0.18%)

1717 (93%)

WT 1 : 505-509

WT 2 : 510-513

WT 2/3 : 510-517

WT 3/4 : 513-519

Wt 4/5 : 516-522

WT 5/6 : 518-525

WT 7 : 526-529

WT 8 : 530-533

-

12(0.5%)

8 (0.3%)

13 (0.5%)

6 (0.27%)

-

52 (2.3%)

21 (0.95%)

OFXR gyrA

gyrB

A90VS91P

D94A

D94N/Y

D94GD94H

N538D/ E540G

318 (26%)14 (1.1%)

30 (2.4%)

21 (1.73%)

423 (64%)12 (1%)

2 (0.1%)

gyrA

WT1 : 85-90

WT2 : 89-93

WT3: 92-97

gyrB WT1 : 538-540

-

-

48 (3.96%)

4 ( 0.3%)

KANR

KANR /AMKR / CAPR

eis

rrs

C14T

A1401GG1484T

4 (0.33%)

106 (94%)

eisWT1: G37T,

WT2: -10-14 : WT3 : -2

rrs WT 1: 1401-1402

WT2 1484

5 (0.4%)

44 (3.63%)

9 (0.8%)

HNH 2017 : DR conferring mutations detected by MTBDRplus & MTBDRsl

Comparison of PSQ, GenotypeMTBDR & MGIT DST

Incremental increase in

SNP identification

RIF : 13%

FQL : 8.2%

Tuberculosis 2018 ;110:86-90

Drug Number PSQ mutations / confidence

Rifampicin rpoB 13 / 100 L511(1) Minimal

Q513K (2) High

D516Y (1) Moderate

D516Y+533gag (1) Moderate

H526P(1) Moderate

H526C (1) High

H526L (1) High

S531Q (1) High

L533P (4) Moderate

FQL gyrA 5 / 61 G88C+S95T(1) High

94gtc +S95T(1) ?

Phenotypic MGIT Susceptible with PSQ mutations

Tuberculosis 2018 ;110:86-90

Case 1 PM 32 F

Miliary TB : DOTS for 3 months

A month later developed seizures

Tuberculomas found

Sputum Xpert MTB / RIF R

Smear negative : LPA indeterminate

TB MGIT culture done

Case 1 : Sputum Pyrosequencing

Rifampicin R Fluoroquinolone R

rpob S531L gyrA D94G

Isoniazid R

katG S315T

Global Consortium for Drug resistant TB Diagnostics (GCDD) funded by NIH, USA : Grant #5U01AI082229

Case 1 ….

PreXDR (katG S315T,rpoB S531L & gyrA D94G)

Treated with KAN, CLF, LZD ,PAS, ETH

Follow up well at 6 months

Case 2

19 year male being treated elsewhere

diagnosed as Pulmonary TB

H300R450E800Z1500

2 months later, developed abscess Left palm

Drained pus, smear + , MGIT culture neg

Case 2 …..

4 Months later developed abscess in Lt ankle

Amikacin & levoflox added

Abscess in Rt forearm, Smear +

MGIT : No growth after 6 weeks

3 months later

Pus from Rt forearm , Smear +

MGIT : No growth at 6 weeks

MTB detected

Isoniazid : katG

No mutations

Isoniazid :inhA

No mutation

Isoniazid ahpC

No mutations

FLQ : no mutations

SLI : rrs

No mutations

Pyrosequencing : No mutations detected

v

RIF : no mutations RIF : no mutations

TB : Treatment failure…

…not always drug resistance

Compliance

Dosage issues

Absorption of drugs

Poor quality drugs

Drug Interactions

Penetration at site

To date…67 TBM suspects, 46 PSQ + ve,17 MGIT culture + ve, 21 Xpert + ve

• Drug resistance

• Paradoxical response

• Adequate drug penetration • Vasculitis / infarcts

• Hyponatremia

• Brain edema

• Hydrocephalus

• Seizures

• Mixed infections ( HIV )

Dilemmas in the management of TBM / tuberculomas

Penetration of TB drugs

High (>90%): Isoniazid, Pyrazinamide,

Ethionamide

Intermediate (60-90%): Levofloxacin, Moxifloxacin,

Linezolid, Cycloserine

Low (<50%): Rifampicin, Streptomycin,

Amikacin, Capreomycin

Ethambutol

Case 3

AK 16 years

TBM

Started on HRZE & steroids

partial improvement

After tapering of steroids,

c/o severe headache

Intercisternal tuberculomas with exudates

Referred to ID

Case 3 …..

? DRTB or paradoxical response

Xpert : Not detected

PSQ: INH mono R katG 315ACC

•INH replaced with ETH (better CSF penetration & EBA)

•Re started steroids

Patient improved on FU



but no corresponding mutant band




• Operator related

• Protocol related

• Heteroresistance

• Inadequate knowledge about mutations

Lung India 2018;35(2):168-170

Repeat Xpert RIF: Resistant

Check LJ for 2 types of colonies Repeat Xpert RIF

Susceptible

Send isolate for WGS

Repeat Xpert RIF : Resistant

Perform PSQ for the exact SNP

Perform RIF MIC at 0.25 /

0.12

Xpert MTB/ RIF : Susceptible

MGIT DST RIF : ResistantXpert MTB / RIF : Resistant

MGIT DST RIF : Susceptible

Repeat Xpert from original MGIT tube


Check LJ for 2 types of

colonies (Heteroresistance)

Repeat Xpert RIF

Susceptible



Perform PSQ for the

exact SNP

Perform RIF

MGIT MICs at

0.25 /0.12

Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST

Lung India 2018;35(2):168-170

Mechanisms that underlie resistance

Drug resistance in M. tuberculosis is a mixed bag: significant heterogeneity is present with

low, moderate & high level phenotypic resistance

In high incidence settings

an average of 17% of new TB cases, can be multiply infected

Clin Microbiol Rev 2011; 2 : 314-350. doi: 10.1128/CMR.00059-10.

Upper lobectomy specimen

of a 19 year old male with MDR-TB

Understanding heterogeneity

Within the lung, each lesion is

independent & engaged

in various phases of immune battles

at diff metabolic states of TB bacilli

Single infecting strain showed heteroresistance

Mixed infection in presence of hetero resistance could worsen outcome.


Check LJ for 2 types of colonies Repeat Xpert RIF

Susceptible



MGIT DST RIF : Resistant



Check LJ for 2 types of

colonies (Heteroresistance)


Lung India 2018;35(2):168-170

Repeat Xpert RIF Susceptible



MGIT DST RIF : Resistant


Repeat Xpert RIF

Susceptible



Lung India 2018;35(2):168-170




0.12

Xpert MTB / RIF : Resistant




Perform PSQ for the

exact SNP


Lung India 2018;35(2):168-170




0.12

Xpert MTB / RIF : Resistant




Perform RIF MICs


Lung India 2018;35(2):168-170

Rif R maybe missed for specific rpoB mutations



but no corresponding mutant band


(iii)Resolving discordant Xpert & MGIT DST


Xpert MTB Detected

Caution : False Resistant in MTB Detected VERY LOW

In RIF DST S & Xpert R,

PSQ confirmed no mutations in 10/40

Confirming in RIF R in MTB DETECTED VERY LOW in non MDR suspects

Submitted

PSQ Outline

• Principle & cost


• Challenges

PSQ : challenges

• Homopolymers (more than 3-4)

Homopolymer string (mainly T) regions influence synchronized extension & synthesis of DNA strand

causing non uniform sequence peak heights, affecting read length & possibly cause sequence errors

• In Smear negative, low sensitivity of gyrA & rpoB

• Indeterminate readings (instruments issues, mixed population, new minority mutations)

• Technical expertise essential

• PSQ currently standardised for XDR defining drugs

PLoS One 2015 :10(1):e0116798

Higher rates of Pre XDR TB than MDR TB (56.8% vs 29.4%)

Genetic resistance markers

Drug Mechanism of Action Genetic Marker Function Frequency (%)

Drug Mechanism of Action Genetic Marker Function Frequency (%)

Advantages for WGS Sequencing

1) WGS captures complete genetic mutational profile in one test.

2) New mutations identified that relate to adaptive responses (compensatory mutations).

Genetic resistance markers

WGS for DR conferring mutations

XDR drugs : <10% ( LPA WT absent with no mutant)

Oral FLD : Ethambutol , PZA

Oral SLD : Ethionamide, PAS, cycloserine

Re purposed drugs : CFZ, LZD

New Drugs : BDG, DLD

History will judge us not by our scientific

breakthroughs, but how we apply them…

Pyrosequencing Experience from Mumbai, India · PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD...

Documents

Transcript of Pyrosequencing Experience from Mumbai, India · PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD...