Purification and Molecular Cloning of a Major Antibacterial Protein of the Protozoan Parasite...

Eur. J. Biochem. 231, 831-838 (1995) 0 FEBS 1995

Purification and molecular cloning of a major antibacterial protein of the protozoan parasite Entamoeba histolytica with lysozyme-like properties Thomas JACOBS and Matthias LEPPE

Department of Molecular Biology, Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany

(Received 11 May 1995) - EJB 95 0755/4

A protein with potent antibacterial activity was purified to apparent homogeneity from pathogenic Entamoeba histolytica. It resembles lysozyme in that it is a basic protein which degrades cell walls of Micrococcus luteus, displays optimal activity at acidic pH, and shows a preference for Gram-positive bacteria. The protein has a molecular mass of =23 kDa upon SDSPAGE and is localized inside the cytoplasmic granules of the amoebae. The primary structure was elucidated by protein analysis and molecular cloning of the corresponding cDNA. It yielded a protein of 198 residues with structural similarity to the distinct class of lysozymes found in Streptomyces species and the fungus Chalaropsis.

Keywords. Antibacterial protein; Iysozyme protozoan; lysozyme, chalaropsis-type; Entamoeba histolytica.

The protozoon Entamoeba histolytica, the causative agent of human amoebiasis, colonizes, in its reproductive form, the cav- ity of the lower intestine of man. For unknown reasons, the amoebae may become invasive, penetrate the mucosa of the colon and enter the blood circulation to reach various extraintesti- nal organs (mainly the liver), resulting in massive tissue destruc- tion and live-threatening disease (Ravdin, 1989). The most prominent feature of the amoeba and, consequently, the subject of many studies, is the enormous cytolytic capacity of the parasite which, in vitro, is directed toward almost all cells, including effector cells of the defense system of the host (Petri and Rav- din, 1988).

Apart from its remarkable appearance as a killer cell and destructive parasite, E. histolytica is primarily an actively phago- cytosing protozoon. Bacteria serve as a nutrient source for amoebae, and the ability to selectively interact with and to digest bacteria is important for the growth of the parasite in vivo (for review, see Mirelman, 1987). One may suppose that amoebae have several interrelationships with the resident bacterial flora inside the human colon, and it has been reported that bacteria have a substantial influence on amoebic virulence (Bracha and Mirelman, 1984). However, only little is known about the molecular mechanisms by which engulfed bacteria are killed and degraded by amoebae.

The primary candidate conferring the cytolytic capacity to the amoeba is a pore-forming peptide named amoebapore (for review, see Leippe and Miiller-Eberhard, 1994). We have recently discovered three isoforms of amoebapore in the cytoplasmic granules of E. histolytica and found that this family of cytolytic peptides also exerts antibacterial activity by permeabilizing cytoplasmic membranes of bacteria (Leippe et al.,

Correspondence to M. Leippe, Department of Molecular Biology, Bernhard Nocht Institute for Tropical Medicine, Bernhard-Nocht-Str. 74, D-20359 Hamburg, Germany.

Abbreviation. HEWL, hen egg-white lysozyme. Enzyme. Lysozyme (EC 3.2.1.17). Note. The novel amino acid and nucleotide sequence data published

here has been deposited with the EMBL, GenBank and DDBJ sequence data banks and is available under accession number(s) X87610.

1994a,b). This finding prompted us to hypothesize that molecules effective in destroying mammalian cells may be related to those instrumental in killing ingested bacteria, and to further analyze the antibacterial armament of the amoebae.

Here, we describe the detection of several activities within amoebic extracts which inhibit the growth of Gram-positive and Gram-negative bacteria and report on the purification of a major antibacterial factor. Further characterization of the activity and the molecular properties of the puhfied molecule revealed that it is a bacteriolytic protein with structural similarity to a distinct class of lysozymes.

Materials and methods

Cultivation and harvesting of E. histolytica. Trophozoites of the pathogenic E. histolytica isolate HM-1: IMSS were cultured axenically in medium TYI-S-33 in plastic tissue culture flasks (Diamond et al., 1978). These amoebae do not represent cloned cells. Trophozoites from cultures in late-logarithmic phase were harvested after being chilled on ice for 10 min, sedi- mented at 430Xg for 3 min at 4°C and washed three times in ice-cold 145 M NaCl, 20 mM sodium phosphate, pH 7.4.

Purification of amoeba lysozyme. Freshly harvested and washed amoebae (5X lo8 cells) were extracted overnight with 5 vol. 10% acetic acid. The extract was centrifuged at 150000Xg for 1 h at 4"C, and the resulting supernatant was lyophilized and stored at -20°C. The freeze-dried amoebic extract was resuspended in 10 ml 50 mM sodium acetate, pH 4.5, and centrifuged at 150000Xg for 1 h at 4°C. The supernatant was passed over a Superdex 30 prep-grade 26/60 column (Phar- macia LKB) using 50 mM sodium acetate, pH 4.5, containing 150 mM NaCl as eluent. Each fraction was tested for bacterial- growth-inhibiting activity and pore-forming activity. Fractions were pooled according to activity and elution behaviour. The material representing the first maximum of antibacterial activity was loaded onto a Mono S HR 10/10 cation-exchange column (Pharmacia LKB) after dilution with 3 vol. 50 mh4 sodium acetate, pH 4.5. Adsorbed protein was eluted by washing with the

832 Jacobs and Leippe (Eul: J. Biochem. 231)

same buffer (40 ml) and by use of 0-500 mM NaCl (120 ml) and a final wash of 1 M NaCl (40 ml). Fractions with antibacterial activity were pooled, dialyzed exhaustively against the starting buffer of the next column in tubing with a molecular-mass cut-off of 6000 Da (SpectraPor 6; Spectrum Industries), and applied to a Mono S HR 5/5 column (Pharmacia LKB) equilibrated with 50 mM sodium phosphate, pH 7.8. The column was washed with the same buffer (5 ml) and developed with a 15-ml gradient of 0-500 mM NaC1. Active fractions were pooled and dialyzed against 1 mM sodium phosphate, pH 5.8. This material was subjected to a hydroxyapatite cartridge (1-ml Econo Pac HTP; Bio- Rad) equilibrated with the same buffer. Elution was by washing with 1 ml equilibration buffer and by use of linear gradients of 1-1OmM MgCl (10ml) and 1-5OOmM sodium phosphate, pH 5.8 (15 ml). Active fractions were pooled and stored at -20°C.

Protein analysis. Reverse-phase HPLC was performed on an Aquapore Butyl300 column (2.1 mmX30 mm; Brownlee Labs) connected to a 130 A separation system (Applied Biosys- terns). Elution was with a linear gradient of 0-70% acetonitrile in 0.1 % trifluoroacetic acid at 25°C over 45 min. A flow rate of 0.2 ml min-' was applied, the effluent was monitored by absorbance at 214 nm, and 0.2-ml fractions were collected. Peak fractions were tested immediately for lysozyme activity in the turbidimetric assay. Polyacrylamide gel electrophoresis was performed according to the method of Laemmli (1970) with a 13 % separation gel and a 4% stacking gel. Immunoblots were carried out using the semidry blotting technique and rabbit antibodies to human lysozyme (Dako), and developed as previously described (Leippe et al., 1991). Protein concentration was determined using the bicinchoninic acid reagent assay (Pierce) and bovine serum albumin as a standard (Smith et al., 1985).

Enzymic cleavage and protein sequencing. 50 pg HPLC- purified amoeba lysozyme was lyophilized and dissolved in 50 pl 20 mM Tris/HCl, pH 8.5, containing 1 mM EDTA, 5 mM Tricine and 10 % acetonitrile. Protein fragments were generated by treating the sample with 1 pg endoproteinase-Lys C (Boeh- ringer Mannheim). The resulting peptides were S-pyridylethy- lated and subsequently purified by reverse-phase HPLC using a Aquapore OD 300 column (2.1 mmX220 mm; Brownlee Labs). Peaks were collected manually and analyzed by protein sequencing using a gas-phase protein sequencer (model 437 A; Applied Biosystems). Cysteine residues of the peptides were determined as S-pyridylethylcysteine. The N-terminal sequence of amoeba lysozyme was obtained from the protein purified by chromatography on hydroxyapatite or chromatographed further by reverse- phase HPLC without alkylation. The latter method did not allow the identification of cysteine.

Molecular cloning. Oligodesoxyribonucleotides were constructed and synthesized (Eurogentec) using information on the partial primary structure obtained by sequencing the N-terminus and endoproteinase-Lys-C-generated peptides. To construct a cDNA probe corresponding to amoeba lysozyme, a nested PCR was made using cDNA of a A ZAP cDNA library from E. histolytica isolate HM-1 :IMSS (courtesy of E. Tannich, Bemhard Nocht Institute) and the following oligonucleotides : 5'-GGAiT ATTGATGTA/,TCA/,CAACAAAC-3' (sense primer I ; residues 2- 10) ; 5'-ATGGA/&TTGTA/aGAGC-3' (sense primer I1 ; residues 26- 3 1) : 5'-CA*/,ACA/,GAA/,ACA-TCA/,CCTCTA- TATTG-3' (antisense primer ; C-terminal endoproteinase-Lys-C- generated peptide). PCR was performed under the conditions recently described (Leippe et al., 1994b). Finally, a 520-bp amplification product was obtained, radiolabelled and used to screen the HM-1 :IMSS cDNA library as previously described (Tannich et al., 1991). The isolated cDNA was sequenced on both strands (Sanger et al., 1977). Southern blotting and North-

em blotting were performed according to the published pro- cedures (Maniatis et d., 1982).

Bacteria. The bacterial strains used were: Bacillus megaterium (ATCC 14581), Bacillus subtitis (strain 6001 S), Micrococ- cus luteus (strain 004) (all obtained from the Botanical Institute, University of Hamburg, Germany), Enterobacter cloacae p12 and Escherichia coli K-12 strain D31 (Boman et al., 1974; kindly provided by A. Wiesner, Institute of Zoology, Free Uni- versity of Berlin, Germany), a clinical isolate of Staphylococcus aureus (from our institute) and Yersinia enterocolitica (96-C without plasmid, serotype 0: 9, kindly provided by J. Heese- mann, Institute for Hygiene and Microbiology, University of Wurzburg, Germany). Bacteria were grown in Luria-Bertani medium and subsequently inoculated in Luria-Bertani medium for growth to mid-logarithmic phase. B. megaterium and B. subtilis were dispersed on Luria-Bertani agar plates containing 1 % glucose, grown overnight and subsequently inoculated in Luria-Ber- tani medium containing 1 % glucose.

Antibacterial assays. Plate growth-inhibition assay. Steril Petri dishes received 0.9% agarose in Luria-Bertani medium containing logarithmic-phase cells of M. luteus or E. coli D 31. After solidification of the agar, wells (4mm diameter) were punched into the freshly poured plates. Each well received a 10- pl sample. The plates were incubated overnight at 37 "C, and the diameter of clear zones indicating bacterial growth inhibition due to radial diffusion of active material were recorded after subtraction of the well diameter.

Growth inhibition in solution. Activity against bacteria was also determined by a microdilution susceptibility test (Savoini et al., 1984). Bacterial suspension in Luria-Bertani medium (25 pl; 1 X 1 0 4 bacteria) was added to twofold serial dilutions of purified enzyme in 10 mM sodium phosphate, pH 5.2, containing 150 mM NaCl (25 pl) in microtiter plates. After incubation at 37°C for 16 h, the minimal inhibitory concentration was determined.

Bactericidal assay. Purified protein was serial diluted and incubated with bacteria in microtiter plates at 37 "C as described above. Aliquots were removed after bacterial growth in the control (without enzyme) became clearly visible (=16 h) and plated on Luria-Bertani agar; the minimal bactericidal concentration was determined by counting colony-forming units.

Enzyme assays. For measurements of lysozyme activity, cell wall degradation of lyophilized M. luteus was determined turbi- dimetrically, essentially according to the method of Shugar (1952). A bacterial suspension of 0.3 mg mlF in 0.1 M sodium phosphate, pH 6.4 (950 pl), was incubated with the sample (SO pl) in a 1-ml plastic cuvette at 25°C for 10 min. The rate of lysis was determined from the linear portion of the change of absorbance at 450 nm with time. One unit enzyme activity (U) was defined as the amount of enzyme that catalyzed a decrease in A,,,,, of 0.001 min-'. Alternatively, viable E. coli were used and treated with 150 mM Tris/HCl, pH 7.2, containing 1 mh4 EDTA at 37°C for 2 min to disrupt their outer membrane structure (Leave, 1974) before performing the turbidimetric assay. Here, the decrease at A,, nm was monitored. Hen-egg white lysozyme (HEWL; Sigma) served as a control.

For monitoring lysozyme activity during purification, column fractions were analyzed using the lysoplate technique (Os- sermann and Lawlor, 1966). 5-p1 samples were added to wells, 4 mm in diameter, that had been punched into a plate of 0.9% agarose containing lyophilized M. luteus (0.5 mg ml-l; Sigma) and SO mM sodium phosphate, pH 6.4. After incubation for 20 h at 37"C, the diameter of the cleared zones were measured.

Lyophilized M. luteus and S. aureus were acetylated and dea- cetylated, respectively, according to the method of Brumfitt et al. (1958) and used as targets in the lysoplate assay.

Jacobs and Leippe (Eut: J. Biochem. 231)

h -

i

9

x

t 3

L? .-

.- c 0 c m g

B P P

833

h

40 1

;a E -

-30 5 2 :e Lu e- 0 .

-20f

s - -10 g 8

2 ,3

10 s

Chitinase was assayed by photometrically measuring the hy- drolysis of chitin azur (Sigma) after an incubation of 1 h and 24 h at 37°C (Hackman and Goldberg, 1964).

Measurement of pore-forming activity. The activity of samples to form pores in phospholipid membranes was determined by fluorometrically measuring the dissipation of a valino- mycin-induced diffusion potential in liposomes (Leippe et al., 1991).

Enrichment of cytoplasmic granules and electron microscopy. Cytoplasmic granules of amoebae lysed by nitrogen cavitation were enriched by differential centrifugation (Leippe et al., 1994b). Granules washed in 150 mM NaCl, 5 mM EDTA were attached to glass coverslips coated with poly-L-lysine (Sigma). The preparation was fixed in 2% glutardialdehyde in NaClP,, postfixed with 1 % osmium tetroxide, subsequently treated with 1 % tannic acid, dehydrated in ethanol, and subjected to critical- point drying. Specimens were sputter-coated with gold and observed in a scanning electron microscope (SEM 500; Phillips).

Results

Detection of antibacterial activities in acidic extracts of E. histolytica. Initial separation of an acidic trophozoite extract revealed the presence of several antibacterial factors within the amoebae. Molecular-sieve chromatography and subsequent screening of all fractions for growth-inhibiting activity towards two representatives of Gram-positive and Gram-negative bacteria, M. luteus and E. coli, yielded three peaks with antibacterial activity which were combined separately (Fig. 1). The majority of the antibacterial material (pool I) was eluted at a position corresponding to 10-30 kDa, and exerted activity against M. luteus only. The second maximum of antibacterial activity (pool 11) represented amoebapores, the family of membrane-permeat- ing peptides, as evidenced by liposome depolarization, and also did not affect the growth of E. coli. Additional antibacterial molecules (pool 111) were eluted from the column in later fractions and appeared to differ considerably in molecular mass from the aforementioned factors or in their ability to interact with the column resin. This material was found to be active against both types of bacteria and will be the subject of future studies. Extrac- tion of amoebae in 50 mM sodium acetate, 150 mM NaCl,

Fig. 2. Final purification of an antibacterial protein on hydroxyapatite. Pool I of the molecular-sieve chromatography was purified further by consecutive Mono S-cation-exchange chromatography and applied to hydroxyapatite. Degradation of lyophilized M. luteus (A) and growth inhibition of viable M. luteus (B) were monitored in parallel for each 0.5- ml fraction; the activity zones of fractions 1-6 are shown. The protein was eluted with a gradient of MgCI, at a flow rate of 0.5 ml min-' (C). 10 pl each of the same fractions were subjected to SDSPAGE under reducing conditions and silver stained [inset in (C)]. Molecular mass standards are indicated at left.

pH 4.5, or 50 mM Tris/HCl, 150 mM NaCl, pH 7.8, instead of acetic acid resulted in a change in the protein profile of the column eluate but did not give additional activity maxima (data not shown).

Purification of a lysozyme-like protein. After molecular-sieve chromatography of the acidic extract on Superdex 30, further purification of pool I was achieved by Mono S cation-exchange chromatography at pH 4.5. Active material was retained by the column and eluted at 180 mM NaCl. Repeated cation-exchange chromatography using the same resin at pH 7.9 was efficient for further purification and indicated a high isoelectric point of the active material which eluted at 140 mM NaCl. The active protein was purified in the final step by adsorption to hydroxyapatite; the main portion was eluted with a MgC1, gradient. Since growth inhibition of M. luteus mediated by single fractions par- alleled the degradation of their cell walls (Fig. 2) and was ac- companied by the occurrence of a protein band of -23 kDa, the antibacterial activity appeared to be exhibited by a lysozyme- like protein. In addition to SDSPAGE, it was analyzed by analytical reverse-phase HPLC ; both techniques revealed that the purified material is apparently homogeneous (Fig. 3). Since the material of the single protein peak from HPLC still exerted antibacterial activity (20610 U mgi' protein) and, upon SDSPAGE, again only a protein band of =23 kDa was detectable, the purity and identity of the antibacterial factor with a protein of that molecular mass was ascertained. The isolation of the antibacterial protein, designated amoeba lysozyme, using this purification scheme resulted in a 740-fold purification and a recovery of 22% (Table 1).

Antibacterial spectrum. Purified amoeba lysozyme was tested for growth-inhibiting activity in cultures of four Gram-positive and three Gram-negative isolates (Table 2). The protein displayed antibacterial activity against almost all Gram-positive isolates, being most potent against M. luteus, whereas the con-

834 Jacobs and Leippe (Eul: J. Biochem. 231)

Time, rnin

40 &? i

30 c

20 g 10 Q

0

Fig. 3. Reverse-phase chromatography and SDSPAGE of amoeba lysozyme. (a) Reverse-phase HPLC chromatogram of purified amoeba lysozyme. An aliquot of the fraction from the hydroxyapatite column (0.2 ml; 5 pg protein) was subjected to an Aquapore Butyl 300 column (2.1 mmX30 mm) and eluted with a linear gradient of acetonitrile, 0.1 % trifluoroacetic acid at 25°C. (b) Amoeba lysozyme at different stages of purification. Aliquots of active material (10 p1) were analyzed after each purification step by SDSPAGE on a 13 % separation gel under reducing conditions. Lane 1, Superdex 30 pg fraction (20 pg); lane 2, Mono SI pH 4.5 fraction (100 pg); lane 3, Mono S/pH 7.9 fraction (0.2 pg); lane 4, hydroxyapatite fraction (5 pg). The single protein peak from analytical reverse-phase HPLC, shown in (a), was also subjected to SDSPAGE (lane 5; 0.1 pg).

Table 1. Purification of the amoebic lysozyme. Data are reported for a starting material of 5X108 trophozoites. Lysozyme activity was measured by the turbidimetric assay using Iyophilized M. luteus as substrate.

Material Total Total Specific Yield Purifi- protein activity activity cation

mg units units mg-' %

Trophozoite extract 270 7010 26 100 1 Superdex 30 pg 64 3910 61 56 2.3 Mono S , pH 4.5 4 3120 780 45 30 Mono S , pH 7.9 0.1 2010 20100 29 773 Hydroxy apatite 0.08 1540 19250 22 740

centrations tested (up to 15 pg I&' ; = 0.7 pM) were not sufficient to affect the growth of Gram-negative bacteria. Among the Gram-positive isolates, there was one exception; S. aureus was a resistant isolate and, even at fivefold higher concentration, growth inhibition was not detectable. The minimal bactericidal concentration, the minimal concentration enzyme needed to irre- versibly damage bacteria, was determined by plating out the bacteria after incubation with the protein, and was close to the minimal inhibitory concentration (Table 2). The time course of the bactericidal activity monitored toward M. luteus confirmed that it is based on the enzymic activity of the purified protein. The number of viable cells decreased slowly but constantly over time until almost all bacteria had been killed. Activity was exhibited

Table 2. Antibacterial activity of amoeba lysozyme. The minimal inhibitory concentrations (MIC) of amoeba lysozyme were determined in cultures of various bacterial strains incubated in the presence of the purified protein in twofold serial dilutions for 16 h at 37°C. The minimal bactericidal concentrations (MBC) were determined by counting colony forming units on nutrient agar after the incubation period. MIC values are expressed in pg ml-.' and represent the highest concentration of protein at which bacterial growth was observed and the lowest concentration at which bacterial growth inhibition was detected. MBC values indicate the lowest concentration of protein at which formation of colonies was found to be prevented. (>) No growth inhibition or suppression of colony formation detected at the concentration indicated. Experiments were carried out in triplicate.

Bacterial strain Gram MIC MBC

pg ml-I

Bacillus megaterium + 0.9- 1.8 1.8 Bacillus subtilis + 7.5-15 15 Micrococcus luteus + 0.06-0.12 0.5 Staphylococcus aureus + >75 >75

>15 >15 Escherichia coli D31 -

Enterobacter cloacae p12 - >15 >15 >15 >15 Yersinia enterocolitica -

toward bacteria in nutrient medium as well as in 0.9% NaC1, indicating that the protein is not only effective against growing cells (data not shown).

Change of bacterial susceptibility after modification of their cell wall. Since it is known that S. aureus contain a remarkably high degree of 0-acetyl groups in their cell walls, we subjected lyophilized M. luteus cell walls to chemical acetylation in order to study whether or not this modification confered higher resistance against amoeba lysozyme on the most sensitive bacteria tested. At least five-times higher amounts of material (0.1 mg ml-') are needed to visualize degradation in the lysoplate assay compared to for the unmodified control. When the resistant S. aureus isolate was freeze-dried and chemically deacety- lated, concentrations up to 0.2 mg ml-' were not sufficient to effect cell wall degradation.

With regard to Gram-negative bacteria, the resistance is most likely due to the impermeability of their outer membranes to larger solutes, such as lysozyme. E. coli D31 cells became sensitive to degradation by amoeba lysozyme when this barrier was disrupted by treatment with TrisEDTA. The response of de- fective E. coli to the amoebic enzyme in the turbidimetric assay was found to resemble that to equimolar amounts of HEWL (not shown).

Other characteristics. The amoebic protein displayed optimal lysozyme activity at = pH4, as evidenced in the turbimetric assay with NaCVP, at constant ionic strength. At this pH, the amoebic enzyme was relatively stable. Incubation at 50°C and pH 4.0 for 15 min did not reduce the activity, but the same treatment of the protein at pH 8.0 resulted in complete loss of activity. The activity was also abolished when the enzyme was incubated for 5 min at 100°C. The amoeba lysozyme (10 pg/ml) did not exert chitinase activity in the detection system used. An anti- genic cross-reactivity with human lysozyme or HEWL in West- em blots developed with anti-human lysozyme was not detected (not shown).

Partial primary structure obtained by protein sequencing. Purified amoeba lysozyme was subjected to N-terminal protein sequencing, which gave sequence information up to residue 33

Jacobs and Leippe ( E m J. Biochem. 231) 835

1 K L G I D V S

E Q P T S T S S F T X L R N K G F T T

76 ATGGTTATTGTTAGAGCTTGGAAATCAACTGGTTCATTTGATACTAACTCGCTCCA Z b M V I V R A W K S T G S F D T N A P

130 44

184 62

238 80

292 98

346 116

400 134

454 152

508 170

562 188

616

CAAACTCTTAAGAATGCCAATGCTGCTGGATTTTCAATTGAA?iATTCTGATGTT Q T L K N A N A A G F S I E N S D V

TATTATTATCCATGTATTTCATGTGGTAATATGGCTGGACAACTGTTA~CTTTC Y Y Y P C I S C G N M A G Q V R T F

TGGCAAAAAGTTGGTCAATATAGTTTGAAAGTAAAAAGAGTTTGGTTTGATATT W Q K V G Q Y S L K V K R V W F D I

GAAGGTACTTGGACTTCATCCGTTTCTACTAACCAAAATTATTTAATGCAAATG E G T W T S S V S T N Q N Y L M Q M

ATGAATGAAGCTAGAGCTATTGGTATTGTCCATGGTATTTATGGTTCTAAATAT M N E A R A I G I V H G I Y G S K Y

TATTGGGGAAATCTCTTTGGATCATCTTACAAATATCGTTATCGATCATCTACT Y W G N L F G S S Y K Y R Y R S S T

CCATTATGGTATCCACATTATGATAACTCTCTCCATCATTCTCTGATT~TCATCA P L W Y P H Y D N S P S F S D F S S

TTCGGTGGATGGACTAGCCCATCTATGAAACAACTTATAGAGGAGATGTTTCTGTT F G G W T S P S M K Q Y R G D V S V

TGTTCAGCTGGAGTTGATTATAACTACAAACCATAAACCTTTAATCTAACCATT C S A G V D Y N Y K P *

TTATT (A) n

Fig. 4. Amino acid sequence of amoeba lysozyme. The nucleotide sequence of the cDNA is shown; it codes for residues 26-198 and, therefore, nucleotide numbering starts at 76. The stop codon is marked by an asterisk. The deduced amino acid sequence is given underneath and is preceeded by residues 1-25, determined by N-terminal sequencing of the purified protein (double line). Those parts of the cDNA-deduced amino acid sequence which are confirmed by sequencing of peptides obtained by enzymic cleavage with endoproteinase-Lys C are indicated by a single line. For the residue represented as X, identification was impossible; it is presumably a cysteine residue.

(Fig. 4). The N-terminal region showed some similarity to those of the lysozymes of the fungus Chalaropsis (Felch et al., 1975) and of the bacterium Streptomyces globisporus (Lichenstein et al., 1990; Fig. 5). Enzymic cleavage by endoproteinase Lys-C and subsequent sequencing of the generated protein fragments yielded additional sequence information.

Molecular cloning and elucidation of the complete primary structure. Using specific oligonucleotide primers constructed according to the partial amino acid sequence, a cDNA coding for the protein was amplified by PCR from a cDNA library of E. histolytica. The amplification product was used to isolate corresponding cDNA clones. Sequencing of the longest cDNA in- sert (cEh-Lys 4) revealed almost the complete coding region for amoeba lysozyme. Connection of overlapping amino acid sequences obtained by N-terminal protein sequencing and deduced from the cDNA sequence revealed the complete primary structure of the enzyme (Fig. 4). This was confirmed, in part, by sequence analysis of proteolytic digestion fragments. The protein consists of 198 residues and has a calculated molecular mass of 22378 Da, assuming that residue 17 is cysteine. Despite the fact that the similarity of the entire sequence of amoeba lysozyme to those of the other two lysozymes mentioned above was not striking (Fig. 5), these enzymes were found to be the most similar among proteins with comparable functions.

Southern-blot and Northern-blot analyses. For southern-blot analysis, genomic DNA from trophozoites of E. histolyticu HM- 1 :IMSS was digested with various restriction enzymes and sub-

sequently hybridized to cDNA representing amoeba lysozyme. A single hybridizing fragment was found in each digest, indicating that the protein is encoded by a single-copy gene. Northern- blot analysis performed with total amoebic RNA revealed that the probe hybridized to an RNA of =650 nucleotides, which is in agreement with the expected size of the message (data not shown).

Localization to cytoplasmic granules. Amoebic cytoplasmic granules were enriched by differential centrifugation after sub- jecting the amoebae to nitrogen cavitation (Fig. 6). Extraction of cytoplasmic granules from 1 X lo8 amoebae in 0.9 % NaCl by three cycles of freezinghawing yielded a total lysozyme activity of 1470 units and a specific activity of 60 U pg-'. The corresponding values of the same amount of trophozoites, extracted directly in 0.9% NaCl (2010 total units; 15 U pg-'), indicated that the enzyme is stored in cytoplasmic vesicles.

Discussion

In general, phagocytic cells have evolved oxygen-dependent and oxygen-independent mechanisms to kill ingested bacteria and thereby to prevent microbial growth inside their phagolyso- somes (Elsbach and Weiss, 1992). Since the human colon pro- vides a microaerophilic environment, it may be assumed that amoebic trophozoites use oxygen-independent mechanisms for this purpose. It has been observed that E. histolytica rapidly dis- integrate phagocytosed bacteria inside their digestive vacuoles (Bracha et al., 1982), suggesting that these protozoa are a rich source of antimicrobial peptides and proteins.

Here, we described the detection of several antibacterial activities in amoebic extracts and the purification and molecular characterization of a major antibacterial factor of the parasite. The purified protein resembles lysozyme in the following as- pects: (a) the antibacterial factor degrades lyophilized M. luteus; (b) it is a bacteriolytic enzyme that acts primarily on Gram- positive bacteria; (c) Gram-negative isolates are accessible to lysis and degradation when the outer membrane structure is per- turbed; (d) the protein is most active at acidic pH and its activity is considerably stable to higher temperatures in an acidic environment; (e) it is a basic protein of 23 kDa with sequence similarity to lysozymes of virtually identical molecular mass. There- fore, we propose the term amoeba lysozyme for this factor.

Lysozymes have been recognized in plants, animals, bacteria, fungi and bacteriophages (for review see Jollbs and Jollbs, 1984). The lysozyme of bacteriophage T4 and animal lysozymes from vertebrates, in particular from birds, have been structurally characterized in detail and are the subject of studies on protein evolution (Weaver et al., 1985; Jollbs et al., 1989; Kornegay et al., 1994). Despite the fact that lysozyme-like activity has been detected in a variety of invertebrate species, the number of lysozymes of such animal for which sequence information is available is limited; these are predominantly enzymes from species of the insect order Lepidoptera, which are structurally related to the c (chicken)-type lysozyme (Jollks et al., 1979; Engstrom et al., 1985).

The protein described in this report is, to our knowledge, the first lysozyme characterized for a protozoon. According to the molecular mass and the primary structure reported here, the amoebic enzyme may be viewed as a novel member of a structurally distinct lysozyme class to which the N,O-diacetylmura- midases of Streptomyces species and of the fungus Chalaropsis belong. These lysozymes are different from all other lysozymes known so far in their amino acid sequence (Felch et al., 1975; Lichenstein et al., 1990), their three-dimensional structure (Ha-

Jacobs and Leippe (Eur. J. Biochem. 231) 836

CH

SG

EH

CH

SG

EH

CH

SG

EH

CH

SG

EH

CH

SG

EH

~ M ~ ~ ~ G - ~ N ~ ~ ~ ~ ~ ~ A A ~ ~ A ~ K ~ ~ D ~ H ~ ~ ~ G ~ Y P M ~ N P ~ 1 4 2

P G V L D I E H N P - S G A M C Y G L S T T Q M R T W I N D F H A R Y K A R T T R D V V I Y T T A S 142

I Y G S K Y 133 W F - - D I E G T W T S S V S T N Q N Y L M Q M M N E A R A I G I V H G - - - - - - - -

A Y G G - S N N F I - - - - N G S I D N L K K L A T G 211

R V G G V S G D V D R N K F N G S A A R L L A L A N N T A 217

Y R G D V S V C S A G V D Y N Y K P 198

Fig. 5. Comparison of the amino acid sequence of the amoeba lysozyme (EH) with those of lysozyme of Chularopsis sp. (CH; Felch et al., 1975) and of Streptomyces globisporus (SG; Lichenstein et al., 1990). The one-letter notation for amino acids is used. Residues found identical in at least two of the three proteins are boxed. For optimal alignment, gaps were introduced into the sequences, which are indicated by hyphens. The similarity of amoeba lysozyme to the Chuluropsis lysozyme and to the Streptomyces lysozyme, expressed as the amount of identical residues, is 18% and 21 %, respectively.

Fig. 6. Cytoplasmic granules of E. histolytica. Granules were enriched by differential centrifugation, fixed with glutaraldehyde and subjected to scanning electron microscopy. Bar represents 1 pm.

rada et al., 1981) and their specificity; in contrast to other lysozymes, e.g. c-type lysozymes, these enzymes are capable of ly- sing S. aureus but do not exert chitinase activity (Hash, 1963; Morita et al., 1978). Chitinase activity was also not detected for the amoebic enzyme. However, the more fundamental functional criterion of this lysozyme class is not fulfilled in that the amoe-

bic protein is ineffective against S. aureus, even at high concentrations. As one characteristic among others, the peptidoglycan of Staphylococci contains N , 6-0-diacetylmuramic acid (Stro- minger and Ghuysen, 1967). A higher degree of 0-acetyl groups in bacterial cell walls indeed hamper degradation mediated by the amoeba lysozyme, since a markedly lower activity was exhibited toward chemically acetylated M. luteus. However, deace- tylation of the S. aureus isolate, in our hands, was not sufficient to render these bacteria susceptible to the action of the amoebic enzyme, indicating that other properties of the staphylococcal cell wall contribute to resistance. One may speculate that amoeba do not encounter bacteria having such properties in the human colon; at least, it has been reported that amoebae do not ingest S. aureus in vitro (Bracha et al., 1982). Interestingly, among the two acidic residues considered to be essential for the catalytic activity of Chalaropsis lysozyme (Fouche and Hash, 1978), one residue, aspartic acid at position 6, was found to be conserved in the amoebic protein (residue 3, but the other critical residue, glutamic acid at position 33, is not conserved, an alteration that may involve functional differences.

Like all the antibacterial activities detected inside the amoebic extract, lysozyme appeared to be constitutively synthesized because the enzyme was isolated from axenically cultured (un- challenged) amoebae. The molecular cloning of the cDNA reported here will allow the expression of the lysozyme gene to be monitored in the presence of bacteria. The amoeba lysozyme is concentrated in the subcellular fraction of cytoplasmic granules to which the membrane-active amoebapores have been localized (Leippe et al., 1994 b). Like other phagocytic cells, e.g. mammalian granulocytes (Gabay and Almeida, 1993), the amoeba is suggested to discharge its granule content into phagocytic vacuoles. The range of the pH optimum determined for the

Jacobs and Leippe (Eur: J. Biochem. 231) 837

activity of the enzyme is in agreement with the acidic interior pH measured in amoebic intracellular vesicles (mean, pH 5.1 ; Ravdin et al., 1986). The acidic environment inside digestive vacuoles is provided by the action of proton-transporting AT- Pases of the vacuolar membrane (Yu and Samuelson, 1994).

Since the antibacterial spectrum of amoeba lysozyme is similar to that of amoebapores in that it is preferentially active against Gram-positive bacteria (Leippe et al., 1994a,b), the enzyme may function in synergy with the membrane-active peptides; whereas the latter act rapidly by permeabilizing the bacterial cytoplasmic membrane, lysozyme degrades the cell wall of the bacteria. However, amoebic lysozyme, as well as amoebapores, are also capable of killing Gram-negative bacteria, provided that the outer membranes d o not hamper the contact with their targets. Therefore, the antimicrobial efficacy of these factors may be substantially enhanced by components in the digestive vacuoles, which by themselves are not bactericidal but are capable of perturbing the outer membrane structure (Vaara, 1992). It is noteworthy that additional antibacterial material was detected upon separation of amoebic extract using molecular- sieve chromatography, the activity of which was found to be directed against both Gram-positive and Gram-negative bacteria. In conclusion, the variety of bactericidal molecules present inside the amoeba may provide an efficient internal defense against the growth of a wide spectrum of bacteria.

We thank T. Marti and H. J. Sievertsen for protein sequencing, N. Saritas for technical assistance in assaying antibacterial activity, C. Schmetz for performing electron microscopy and H. J. Muller-Eber- hard for continuous support. The work presented here includes part of the doctoral thesis of T. J. and was supported by the Bundesministerium fiir Forschung und Technologie (BMFT), Germany.

REFERENCES Boman, H. G., Nilsson-Faye, I., Paul, K., & Rasmuson, T. Jr. (1974)

Insect Immunity. I. Characteristics of an inducible cell-free antibacterial reaction in hemolymph of Samia Cynthia pupae, Infect, Immun. 10, 136-145.

Bracha, R., Kobiler, D. & Mirelman, D. (1982) Attachment and ingestion of bacteria by trophozoites of Entamoeba histolytica, Infect. Immun. 36, 396-406.

Bracha, R. & Mirelman, D. (1984) Virulence of Entamoeba histolytica trophozoites. Effects of bacteria, microaerobic conditions, and Met- ronidazole, J. Exp. Med. 160, 353-368.

Brumfitt, W., Wardlaw, A. C. & Park, J. T. (1958) Development of lysozyme-resistance in Micrococcus lysodiekticus and its association with an increased 0-acetyl content of the cell wall, Nature 181, 1783- 1784

Diamond, L. S., Harlow, D. R. & Cunnick, C. C. (1978) A new medium for axenic cultivation of Entamoeba histolytica and other Enta- moeba, Trans. R. SOC. Trop. Med. Hyg. 72, 431-432.

Elsbach, P. & Weiss, J. (1992) Phagocytic cells: oxygen-independent antimicrobial systems, in Inflammation: basic principles and clinical correlates (Gallin, J. I., Goldstein, I. M. & Snyderman, R., eds) 2nd edn, pp. 603-636, Raven Press Ltd., New York.

Engstrom, A., Xanthopoulos, K. G., Boman, H. G. & Bennich, H. (1985) Amino acid and cDNA sequences of lysozyme from Hyalophora cecropia, EMBO J. 4, 2119-2122.

Felch, J. W., Inagami, T. &Hash, J. H. (1975) The N,O-Diacetylmurami- dase of Chalaropsis species. V. The complete amino acid sequence, J. Biol. Chem. 250, 3713-3720.

Fouche, P. B. & Hash, J. H. (1978) The N,O-Diacetylmuramidase of Chalaropsis species. Identification of aspartyl and glutamyl residues in the active site, J. Biol. Chem. 253, 6787-6793.

Gabay, J. E. & Almeida, R. P. (1993) Antibiotic peptides and serine protease homologs in human polymorphonuclear leukocytes : defen- sins and azurocidin, Curr: Opin. Immunol. 5, 97-102.

Hackman, R. H. & Goldberg, M. (1964) New substrates for use with chitinases, Anal. Biochem. 8, 397-401.

Hash, J. N. (1963) Purification and properties of staphylolytic enzymes from Chalaropsis sp., Arch, Biochem. Biophys. 102, 379-388.

Harada, S., Sarma, R., Kakudo, M., Hara, S . & Ikenaka, T. (1981) The three-dimensional structure of the lysozyme produced by Streptomy- ces erythraeus, J. Biol. Chem. 256, 11 600- 11 602.

Jollbs, J., Schoentgen, F., Croizier, G., Croizier, L. & JollBs, P. (1979) Insect lysozymes from three species of lepidoptera: their structural relatedness to the c (chicken) type lysozyme, J. Mol. Evol. 14, 267- 271.

JollBs, P. & Jollbs, J. (1984) What’s new in lysozyme research? Mol. Cell. Biochem. 63, 165-189.

JollBs, J., Jollbs, P., Bowman, B. H., Prager, E. M., Stewart, C.-B. & Wilson, A. C. (1989) Episodic evolution in the stomach lysozymes of ruminants, J. Mol. Evol. 28, 528-535.

Kornegay, J. R., Schilling, J. W. & Wilson, A. C. (1994) Molecular adaptation of a leaf-eating bird: stomach lysozyme of the hoatzin, Mol. Biol. Evol. 11, 921-928.

Laemmli, U. K. (1970) Cleavage of structural proteins during the assem- bly of the head of the bacteriophage T4, Nature 227, 680-685.

Leave, L. (1974) The barrier function of the Gram-negative envelope, Ann. NYAcad. Sci. 235, 109-129.

Leippe, M., Ebel, S., Schoenberger, 0. L., Horstmann, R. D. & Miiller- Eberhard, H. J. (1991) Pore-forming peptide of pathogenic Enta- moeba histolytica, Proc. Natl Acad. Sci. USA 88, 7659-7663.

Leippe, M., Andra, J. & Miiller-Eberhard, H. J. (1994a) Cytolytic and antibacterial activity of synthetic peptides derived from amoebapore, the pore-forming peptide of Entamoeba histolytica, Proc. Natl Acad.

Leippe, M., Andra, J., Nickel, R., Tannich, E. & Muller-Eberhard, H. J. (1994b) Amoebapores, a family of membranolytic peptides from cytoplasmic granules of Entamoeba histolytica : isolation, primary structure, and pore formation in bacterial cytoplasmic membranes, Mot. Microbiol. 14, 895-904.

Leippe, M. & Miiller-Eberhard, H. J. (1994) The pore-forming peptide of Entamoeba histolytica, the protozoan parasite causing human amoebiasis, Toxicology 87, 5-18.

Lichenstein, H. S., Hastings, A. E., Langley, K. E., Mendiaz, E. A,, Rohde, M. F., Elmore, R. & Zukowski, M. M. (1990) Cloning and nucleotide sequence of the N-acetylmuramidase M1-encoding gene from Streptomyces globisporus, Gene (Amst.) 88, 81 -86.

Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular cloning - a laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Mirelman, D. (1987) Ameba-bacterium relationship in amebiasis, Micro- biol. Rev. 51, 272-284.

Morita, T., Hara, S. & Matsushima, Y. (1978) Purification and characterization of lysozyme produced by Streptomyces erythraeus, J. Bi- ochem. 83, 893-903.

Osserman, E. F. & Lawlor, D. P. (1966) Serum and urinary lysozyme (muramidase) in monocytic and monomyelocytic leukemia, J. Exp. Med. 124, 921-951.

Petri, W. A. & Ravdin, J. I. (1988) In vitro models of amebic pathogene- sis, in Amebiasis - Human infection by Entamoeba histolytica (Rav- din, J. I., ed.) pp. 191-204, John Wiley & Sons, New York.

Ravdin, J. I. (1989) Immunobiology of human infection by Entamoeba histolytica, Pathol. Immunopathol. Res.8, 179-205.

Ravdin, J. I., Schlesinger, P. H., Murphy, C. F., Gluzman, I. Y. & Krog- stad, D. J. (1986) Acid intracellular vesicles and the cytolysis of mammalian target cells by Entamoeba histolytica trophozoites, J. Protozool. 33, 478-486.

Sanger, F., Nicklen, S. & Coulson, A. R. (1977) DNA sequencing with chain-termination inhibitors, Proc. Natl Acad Sci. USA 74, 5463 - 5467.

Savoini, A., Marzari, R., Dolzani, L., Serrano, D., Graziosi, G., Gennaro, R. & Romeo, D. (1984) Wide-spectrum antibiotic activity of bovine granulocyte polypeptides, Antimicrob. Agents Chemother: 26, 405 - 407.

Shugar, D. (1952) The measurement of lysozyme activity and the ultravi- olet inactivation of lysozyme, Biochim. Biophys. Acta 8, 302-309.

Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B.

S C ~ . USA 91, 2602-2606.

838 Jacobs and Leippe ( E m J. Biochem. 231)

J. & Klenk, D. C. (1985) Measurement of protein using bicinchoninic acid, Anal. Biochem. 150, 76-85.

Strominger, J. L. & Ghuysen, J.-M. (1967) Mechanisms of enzymic bac- teriolysis, Science 156, 213-221.

Tannich, E., Bruchhaus, I., Walter, R. D. & Horstmann, R. D. (1991) Pathogenic and nonpathogenic Entamoeba histolytica: identification and molecular cloning of an iron-containing superoxide dismutase, Mol. Biochem. Parasitol. 49, 61 -72.

Vaara, M. (1992) Agents that increase the permeability of the outer membrane, Microbiol. Rev. 56, 395-41 1.

Weaver, L. H., Griitter, M. G., Remington, S. J., Gray, T. M., Isaacs, N. W. & Matthews, B. W. (1985) Comparison of goose-type, chicken- type, and phage-type lysozymes illustrates the changes that occur in both amino acid sequence and three-dimensional structure during evolution, J, ~ ~ 1 , ~ ~ ~ l , 21, 97-111.

of the Entamoeba histo- lyrics gene (Ehvma encoding the catalytic peptide of a putative vacuolar membrane protein transporter (V-ATPase), Mol. Biochem. Parasitol. 66, 165-169.

yU, Y, & ~ ~ ~ ~ l ~ ~ ~ , J , (1994) primary

Purification and Molecular Cloning of a Major Antibacterial Protein of the Protozoan Parasite...

Documents

Transcript of Purification and Molecular Cloning of a Major Antibacterial Protein of the Protozoan Parasite...