pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

10

Transcript of pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

Page 1: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 2: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 3: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 4: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 5: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 6: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 7: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 8: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 9: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM
Page 10: pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides

VOLUME II - JICATitle VOLUME II Author fscan_user Created Date 6/21/2007 4:44:44 PM

VOLUME II - JICATitle VOLUME II Author fscan_user Created Date 6/21/2007 4:44:44 PM

 · Author: JUDELMA Created Date: 5/9/2018 1:39:44 PM

 · Author: JUDELMA Created Date: 5/9/2018 1:39:44 PM

 · Author: James.Nash Created Date: 2/11/2015 4:45:44 PM

 · Author: James.Nash Created Date: 2/11/2015 4:45:44 PM

 · Author: Natalia Created Date: 8/14/2017 7:05:44 PM

 · Author: Natalia Created Date: 8/14/2017 7:05:44 PM

 · Author: admineg Created Date: 5/17/2017 4:44:42 PM

 · Author: admineg Created Date: 5/17/2017 4:44:42 PM

 · Author: STAJER Created Date: 7/20/2017 11:52:44 AM

 · Author: STAJER Created Date: 7/20/2017 11:52:44 AM

 · Author: E Created Date: 12/4/2014 3:44:33 PM

 · Author: E Created Date: 12/4/2014 3:44:33 PM

Author: Test Created Date: 2/9/2014 3:44:26 PM

Author: Test Created Date: 2/9/2014 3:44:26 PM

44-Prevention of Malnutrition - Hindi of Malnutrition... · 44-Prevention of Malnutrition - Hindi Author: Power Created Date: 20160512084907Z ...

44-Prevention of Malnutrition - Hindi of Malnutrition... · 44-Prevention of Malnutrition - Hindi Author: Power Created Date: 20160512084907Z ...

JCSP 44 PCEMI 44 - Canadian Forces College › papers › csc › csc44 › sp › ...JCSP 44 PCEMI 44 Disclaimer Avertissement Opinions expressed remain those of the author and do

JCSP 44 PCEMI 44 - Canadian Forces College › papers › csc › csc44 › sp › ...JCSP 44 PCEMI 44 Disclaimer Avertissement Opinions expressed remain those of the author and do

 · Author: DNSE Created Date: 12/12/2018 4:29:44 PM

 · Author: DNSE Created Date: 12/12/2018 4:29:44 PM

S:Live Projects 44 LloydDrawingsCurrent 44 scheme AERIAL ......Title: S:Live Projects 44 LloydDrawingsCurrent 44 scheme AERIAL OVERLAY OVERLAY (1) Author: rowana Created Date: 20161213103501Z

S:Live Projects 44 LloydDrawingsCurrent 44 scheme AERIAL ......Title: S:Live Projects 44 LloydDrawingsCurrent 44 scheme AERIAL OVERLAY OVERLAY (1) Author: rowana Created Date: 20161213103501Z

Author: Sarathi Created Date: 3/12/2015 3:44:41 PM

Author: Sarathi Created Date: 3/12/2015 3:44:41 PM

 · Author: N Created Date: 10/2/2001 9:47:44 AM

 · Author: N Created Date: 10/2/2001 9:47:44 AM

 · Author: user Created Date: 6/1/2015 9:57:44 AM

 · Author: user Created Date: 6/1/2015 9:57:44 AM

...Author User Created Date 7/6/2003 4:44:36 PM

...Author User Created Date 7/6/2003 4:44:36 PM

 · Author: Armbrust Created Date: 4/10/2019 3:26:44 PM

 · Author: Armbrust Created Date: 4/10/2019 3:26:44 PM

...Author: joe Created Date: 1/5/2001 8:44:38 AM

...Author: joe Created Date: 1/5/2001 8:44:38 AM

...Author eto Created Date 11/22/2017 8:48:44 AM

...Author eto Created Date 11/22/2017 8:48:44 AM