Pseudophosphorylation and glycation of tau protein enhance but do ...

1

Pseudophosphorylation and glycation of tau

protein enhance but do not trigger fibrillization

in vitro

Mihaela Necula‡ and Jeff Kuret§

From the ‡Biophysics Program; and §Department of Molecular and Cellular Biochemistry, The Ohio State University College of Medicine and Public Health, Columbus, Ohio 43210

§To whom correspondence should be addressed:

Jeff Kuret, Ph.D. OSU Center for Biotechnology 1060 Carmack Rd Columbus, OH 43210 TEL: (614) 688-5899 FAX: (614) 292-5379 Email: [email protected] Running Title: Posttranslational Modification and tau Assembly Key Words: Alzheimer’s disease, tau, phosphorylation, glycation

JBC Papers in Press. Published on September 10, 2004 as Manuscript M405527200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on March 24, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

2

Abstract Alzheimer’s disease is defined in part by the intraneuronal aggregation of tau protein into

filamentous lesions. The pathway is accompanied by posttranslational modifications including

phosphorylation and glycation, each of which has been shown to promote tau fibrillization in

vitro when present at high stoichiometry. To clarify the site-specific impact of posttranslational

modification on tau fibrillization, the ability of recombinant full-length four repeat tau protein

(htau40) and eleven pseudophosphorylation mutants to fibrillize in the presence of anionic

inducer was assayed in vitro using transmission electron microscopy and laser light scattering

assays. Tau glycated with D-glucose was examined as well. Both glycated tau and

pseudophosphorylation mutants S199E, T212E, S214E, double mutant T212E/S214E, and triple

mutant S199E/S202E/T205E yielded increased filament mass at equilibrium relative to wild-type

tau. Increases in filament mass correlated strongly with decreases in critical concentration,

indicating that both pseudophosphorylation and glycation promoted fibrillization by shifting

equilibrium toward the fibrillized state. Analysis of reaction time courses further revealed that

increases in filament mass were not associated with reduced lag times, indicating that these

posttranslational modifications did not promote filament nucleation. The results suggest that

site-specific posttranslational modifications can stabilize filaments once they nucleate, and

thereby support their accumulation at low intracellular tau concentrations.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

3

Introduction Neurofibrillary lesions are a hallmark pathology of tauopathic neurodegenerative diseases

such as AD1, cortico-basal degeneration, Down’s syndrome, Pick`s disease and progressive

supranuclear palsy (1,2). The lesions are composed primarily of tau, a microtubule-associated

protein that normally functions to promote tubulin assembly, microtubule stability, and

cytoskeletal integrity (3). The tau that accumulates in disease lesions differs from microtubule-

associated protein in its state of aggregation and posttranslational modification, including levels

of phosphorylation (4), glycation (5), proteolytic truncation (6), and racemization (7).

Especially dramatic among these is phosphorylation, which achieves significantly greater

stoichiometries in filamentous tau (averaging 7 – 8 mol/mol) relative to normal tau (averaging 2

- 3 mol/mol) (8,9). The phosphate is distributed into ~30 sites, most of which are clustered into

two regions flanking the microtubule-binding domain (10,11). Because few of these sites are

unique to filamentous tau, hyperphosphorylation mostly reflects increased occupancy of

phosphorylation sites found in normal tau (12,13). At least 15 of these sites fill in hierarchical

fashion as neurofibrillary lesions mature, suggesting a sequential correlation between site

occupancy and neuritic lesion development (14,15). In addition to serving as a marker for

diseased neurons, hyperphosphorylation neutralizes the microtubule-binding activity of tau,

yielding a cytosolic population available for aggregation (16-19). Phosphorylation may also

directly promote fibrillization, but in vitro this reaction requires stoichiometries of

phosphorylation well above average levels observed in filamentous tau (20,21). Part of the

experimental challenge stems from the diversity of tau phosphorylation sites, each of which may

enhance or depress fibrillization (22), and the difficulty of recapitulating the precise pattern

found in disease. To overcome these limitations, and to investigate the contribution of individual


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

4

sites, phosphorylation has been mimicked by mutation of hydroxyamino acids into negatively

charged Asp or Glu residues. The resultant “pseudophosphorylation” mutants imitate

phosphorylation-induced changes in the structure and microtubule-binding function of tau (23-

26), react with many phosphoepitope-selective antibodies (27), and reportedly can promote or

inhibit tau fibrillization depending on the sequence context investigated (24,25,27,28).

Nonetheless, the mechanisms through which phosphorylation or phosphorylation mimicry

modulates fibrillization have not been explored.

In addition to being phosphorylated, AD-derived tau protein is glycated (5,29-31). As with

phosphorylation, glycation has been implicated in events that may contribute to tau fibrillization

and neuronal death (32,33). In vitro glycation of tau can modify at least 13 sites (34), decrease

its affinity for tubulin (35-37), and promote fibrillization (5,30,31). Again the mechanisms

underlying the effect on tau aggregation have not been investigated.

Fibrillization of purified recombinant tau preparations is slow and essentially undetectable

when assayed over a period of days (38,39), but can be greatly accelerated by the addition of

anionic inducers. Among these, anionic surfactants (including fatty acids) have emerged as

especially useful agents because of their efficacy with full-length tau protein under near-

physiological conditions of temperature, pH, ionic strength, reducing environment, and tau

concentration (38,40). Anionic surfactants act in micellar form to stabilize assembly competent

intermediates on their surfaces, which then accumulate to sufficient concentrations so that the

barrier to filament nucleation is overcome (41). Using this approach, differences in fibrillization

efficiency among individual tau isoforms can be quantified in as short as 5 h (39).

Here we extend the approach by investigating the fibrillization properties of glycated tau and

pseudophosphorylation tau mutants that mimic occupancy of sites known to be filled in disease

(14) using quantitative transmission EM and static light scattering assays. The results show that


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

5

glycation and phosphorylation mimicry influence tau aggregation through mechanisms that

include filament stabilization.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

6

Materials and Methods

Materials. Stocks of alkyl sulfate detergent C18H37SO4Na (Research Plus, Bayonne, NJ) were

prepared in 1:1 H2O/isopropanol. AA (Cayman Chemicals, Ann Arbor, MI) was dissolved in

ethanol (333 mM) and stored at -80°C until used. Dithiothreitol was from Sigma (St. Louis,

MO), D-glucose was from Fisher Chemicals (Fair Lawn, NJ), and uranyl acetate, glutaraldehyde

and 300 mesh copper formvar/carbon-coated grids were from EM Sciences (Fort Washington,

PA).

Oligonucleotide-directed Mutagenesis. Vector pT7C-htau40 served as a template for synthesis

of all mutants using the Quick Change site-directed mutagenesis kit (Stratagene, La Jolla, CA)

(42): S199E, 5’-ggctacagcgaacccggctccccaggcactc; S199E/S202E/T205E, 5’-

gcagcggctacagcgagcccggcgagccaggcgagcccggcagcc; T212E, 5’-

ctcccgcgaaccgtcccttccaaccccaccc; S214E, 5’-cgcaccccggaacttccaaccccacccacccg; T212E/S214E,

5’-ggcagccgctcccgcgaaccggaacttccaaccccaccc; T231E, 5’-ggtccgtgaaccacccaagtcgccgtcttccgc;

S235E, 5’-ccacccaaggagccgtcttccgccaagag; S262E, 5’-

gtcaagtccaagatcggcgaaactgagaacctgaagcacc; S409E, 5’-ggcatctcgaaaatgtctcctccaccggcagcatcg;

and S422E, 5’-gcagcatcgacatggtagacgagccccagc (mutated codons are underlined). Double

mutants C291A/C322A, S396E/S404E, and I277P/I308P were each prepared in an htau40

background as described previously (28,43,44). All mutations were confirmed by DNA

sequencing.

Tau Purification. Recombinant wild-type tau protein (htau40) and all tau mutants were purified

as described previously (42). The quality of all preparations was assessed by SDS-PAGE, and

final protein concentrations were calibrated on the basis of optical density (42).

Tau Glycation. Aliquots of recombinant C291A/C322A and assembly incompetent I277P/I308P


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

7

double mutants (20 µM) were incubated in the presence and absence of 10 mM D-glucose in

assembly buffer (10 mM HEPES, 100 mM NaCl, pH 7.4) for 7 days, at 37°C, in the presence of

protease inhibitors (aprotinin and leupeptin; 0.02 mg/ml each) and 0.02% NaN3 (31). To

determine aggregation behavior, aliquots of glycation reactions were diluted to 4 µM tau and

subjected to the tau aggregation assays described below. Where indicated, glycation products

were separated from unincorporated glucose by desalting chromatography (Bio-Rad Econo-Pac

10DG) prior to dilution and assay.

To estimate glycation stoichiometry, tau was glycated as described above except that

radiolabeled D-[14C(U)]-glucose (10 Ci/mol) served as carbohydrate donor. Aliquots of the

glycation reaction were removed as a function of time and precipitated with trichloroacetic acid

(15% final concentration, 15 min on ice; Ref. (45). Trichloroacetic acid pellets were harvested

by centrifugation (15,800g for 10 min at 4°C), washed five times with 1 ml of 10 mM D-

glucose/15% trichloroacetic acid, then resuspended in 1 M NaOH and subjected to scintillation

spectroscopy. Protein was estimated in parallel using the Coomassie blue binding method with

recombinant htau40 as standard (19).

Tau Aggregation Assays. All tau preparations (4 µM) were incubated (25°C) in assembly buffer

containing dithiothreitol (5 mM) and either AA (75 µM) or C18H37SO4Na (50 µM) inducer.

Reaction products were analyzed by two methods. For analysis by transmission EM (46),

aliquots (30 µl) were removed, fixed with glutaraldehyde (2 %) and adsorbed (1 min) onto 300

mesh formvar/carbon-coated copper grids. The grids were washed with water, stained (1 min)

with 2% uranyl acetate, washed again with water, blotted dry, and visualized using a Phillips CM

12 microscope operated at 65 kV. Two to ten random images from each experimental condition

were captured on film at 22,000-fold magnification, digitized, calibrated, and imported into


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

8

Optimas 6.5.1 for quantitation of filament length and number as described previously (46).

Interfacial filament concentration (Γf) is defined as the summed lengths of all filaments >50 nm

in length per unit area of grid surface, and is reported in units of length/field ± S.D or as a

percentage of wild-type htau40 control values ± S.D.

Right angle laser light scattering (LLS) assays were performed as described previously (47),

except that the contribution of micellization to scattering intensity was controlled in parallel

reactions containing htau40I277P/I308P, an assembly incompetent mutant of htau40 (48). When

employed as light scattering control, htau40I277P/I308P was preincubated in exact parallel with

experimental conditions (including glycation and desalting procedures described above). We

refer to this assay as the corrected LLS assay (43). Aggregation reactions (200 µl) were

transferred to quartz cuvettes (3 x 3 mm internal diameter) and illuminated with light from an

argon laser (λ = 488 nm; Edmund Scientific). The scattered light was captured at an angle of 90°

to the incident light using an EDC1000HR digital camera operated at an aperture of f8 and

exposure times ranging from 50 – 400 ms (47). Captured images were imported into Adobe

Photoshop 5.0 and the intensity of scattered light was estimated as described previously (47).

The scattering intensity captured at zero exposure time (dark current) was subtracted from all

measurements, which were then normalized for exposure time so that the arbitrary units of light

scattering intensity reported always corresponded to a 200 ms exposure at aperture f8. Scattering

intensities from parallel reactions containing htau40I277P/I308P were then subtracted from all values

to yield In(90°), the net right angle light scattering intensity. In(90°) values are directly

proportional to Γf values determined by the transmission EM assay (43).

Assembly Critical Concentration Determination. Tau samples (2 – 4.5 µM, final

concentrations) were added from serially diluted stocks to assembly buffer at room temperature


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

9

and incubated for 26 h in the presence of 50 µM anionic surfactant C18H37SO4Na and in the

absence of agitation. Samples were analyzed by laser light scattering as described above. The

net intensity of scattered light corresponding to fibrillization was plotted against tau

concentration. Critical concentration for assembly was estimated from abscissa intercept after

least squares linear regression and expressed as ± S.E. of the estimate.

Analytical Methods. Sigmoidal reaction progress curves were fit to the Gompertz function (49):

( )

eaey bitt

−=

−−

(eq 1)

where y is total filament length (50 nm cutoff) or light scattering intensity measured at time t, ti is

the inflection point corresponding to the time of maximum growth rate, a is the maximum total

filament length or light scattering at equilibrium, and b = 1/kapp , where kapp is the first order rate

constant describing growth of the filament population in units of time-1 (49). Lag times, defined

as the time when the tangent to the point of maximum polymerization rate intersects the abscissa

of the sigmoidal curve (50), were calculated as ti – b (49).

Filament length distributions calculated as described previously (41,51) were fit to the

exponential function:

y = aebx (eq 2)

where y is the percentage of all filaments filling a bin of length interval x, and b is a constant

(slope parameter) with units of length-1.

All parameters estimated by linear or non-linear regression are reported ± S.E.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10

Results

Impact of Phosphorylation Mimicry on tau Fibrillization. The distribution of phosphorylation

sites on authentic AD-derived tau protein reported from mass spectroscopic methods (10,11) is

summarized in Fig. 1. Because of the large number of individual sites, and the even larger

number of potential combinations, only a subset of these were modeled in a full-length, htau40

isoform background by pseudophosphorylation mutagenesis and kinetic analysis (Table I).

These 12 sites, which spanned the proline-rich, microtubule-binding, and C-terminal tau domains

where phosphorylation sites cluster (Fig. 1), were selected because alone or in combination they

compose phosphoepitopes that have been studied extensively by immunohistochemistry and

shown to be occupied in nearly all tauopathies investigated to date (1). Moreover, the temporal

correlation between their occupancy and neuritic pathogenesis has been quantified (14,15).

Therefore 11 mutant proteins containing selected single, double, and triple

pseudophosphorylation mutations in 12 positions were prepared along with wild-type htau40 and

characterized for fibrillization activity.

To determine whether low-stoichiometry site-specific pseudophosphorylation could replicate

the effects of non-specific high-stoichiometry phosphorylation, the ability of each of the mutant

constructs to fibrillize under standard, near-physiological conditions of pH, ionic strength, and

bulk tau concentration (4 µM) was determined relative to wild-type recombinant htau40 in the

presence of AA inducer. All preparations fibrillized with untwisted morphology as described

previously (41), with no morphological differences apparent among samples except mutant 235,

which formed a mixture of typical untwisted filaments and small (< 50 nm in length) amorphous

aggregates (data not shown). Despite similarities in morphology, significant differences in

extents of fibrillization were apparent when reaction products were assayed by quantitative EM.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

11

Greatest differences were observed with mutants 212, 214, 212/214, and 199/202/205, which

accumulated 2 – 3-fold as much filamentous tau as did wild-type htau40 and mutants 231, 262,

396/404, 409, and 422 (Fig. 2A).

To confirm these findings, the amount of filamentous pseudophosphorylated tau at

equilibrium relative to wild-type htau40 was estimated using a second inducer (C18H37SO4Na).

Results showed that pseudophosphorylation mutants differentially fibrillized in response to

C18H37SO4Na inducer as well. Indeed, when the equilibrium levels of fibrillization attained with

AA and C18H37SO4Na inducers were compared, a linear relationship was found with nearly

identical rank orders of mutant fibrillization levels (Fig. 2B). When equilibrium levels of

fibrillization attained with C18H37SO4Na were compared by EM and corrected LLS (a solution-

based assay method), again a consistent rank order of fibrillization levels was observed (Fig.

2C). The only exception was mutant 235, which formed both filamentous and nonfilamentous

aggregates. Because the EM assay only measures filaments, whereas LLS detects all aggregates

in solution, the LLS assay overestimated filament mass for this mutant. Together these results

suggested that low-stoichiometry pseudophosphorylation could recapitulate the effects of non-

specific phosphorylation on tau fibrillization levels at equilibrium, and that they were additive

with the action of anionic inducers.

The equilibrium phase of tau fibrillization is attained when the rate of protein addition to

filament ends equals the rate of protomer dissociation. It is characterized by a “critical”

concentration corresponding to the maximal solubility of protein above which all additional

assembly-competent protein enters the polymeric phase (52). It is the highest concentration of

protein that does not support fibrillization, and therefore can be estimated from the dependence

of fibrillization on bulk protein concentration (53). To determine whether

pseudophosphorylation modulated this equilibrium, the critical concentration of all mutations


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

12

were estimated using corrected LLS and compared to values for wild-type htau40. The value for

wild-type htau40 in the presence of C18H37SO4Na inducer was 2.00 ± 0.07 µM (shown in Fig. 3

and summarized in Table II). Critical concentrations for pseudophosphorylation mutants ranged

from this value to as low as 680 ± 130 nM for mutant 212 (Fig. 3; Table II). The relationship

between critical concentration and equilibrium levels of fibrillization (both assayed with

C18H37SO4Na inducer) was linear, with lowest critical concentrations yielding the greatest

amounts of fibrillization at equilibrium (Fig. 4). These data suggest that the increased

fibrillization at equilibrium produced by pseudophosphorylation resulted from increased affinity

of filament ends for assembly competent tau.

Anionic surfactants trigger protein fibrillization in micellar form by shifting prenuclear

equilibria from assembly-incompetent to assembly-competent conformations (43), which then

serve as substrates for nucleation reactions on the micelle surface (41,51). The enhanced

nucleation rate shifts sigmoidal reaction progress curves toward shorter lag times with increasing

inducer concentrations (43,54). Because the increase in filament mass induced by high-

stoichiometry phosphorylation has been attributed to creation of “nucleation centers” (55), a

similar shift in reaction progress curves should accompany increased fibrillization. To test this

hypothesis using pseudophosphorylation mutants, the total length of tau filaments formed from

each mutant as a function of time in response to anionic surfactant inducer C18H37SO4Na was

quantified using the EM assay. All resultant reaction progress curves were sigmoidal with clear

lag, exponential growth, and equilibrium phases (Fig. 5). Kinetic parameters of lag time (a

measure of nucleation rate; Ref. (50) and kapp (the first order rate of approach to equilibrium)

were derived from fitting these data to a 3-parameter Gompertz growth function as described in

Experimental Procedures. The Gompertz function was used because it better fit time course data

than the 3- or 4-parameter logistic functions we have used in the past (51,54). Under these


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

13

conditions, wild-type htau40 fibrillized with a lag time of 42.8 ± 0.8 min and a kapp of 1.33 ± 0.07

h-1, whereas pseudophosphorylation mutants fibrillized with lag times ranging from 38.9 – 61.6

min and kapp values ranging from 1.00 – 1.40 h-1 (Table II). The nucleation rate as reflected by

lag time was directly proportional to fibrillization at equilibrium, with longest lag times

correlating with greatest fibrillization at equilibrium (Fig. 6A). In contrast, no correlation

between kapp (which incorporates nucleation, elongation, and equilibrium terms) with

fibrillization at equilibrium was apparent (Fig. 6B). These data suggest that

pseudophosphorylation had statistically significant effects on tau fibrillization kinetics, but did

not increase filament nucleation rates.

Despite having a critical concentration (~2 µM) low enough to support fibrillization under

assay conditions (4 µM), the wild-type htau40 preparation used here does not assemble

spontaneously (i.e., in the absence of exogenous inducer) over time courses as long as 7 days at

37°C in the absence of nucleation inducers (38,39). To determine whether assembly-enhancing

effect of pseudophosphorylation could promote spontaneous fibrillization, mutant 212 also was

incubated (4 µM) for 7 days at 37°C under assembly conditions. As with wild-type htau40, no

spontaneous fibrillization was apparent over this period (data not shown). These data suggest

that simply having a lower critical concentration for assembly-competent conformations is

insufficient to promote spontaneous fibrillization at physiological tau concentrations, and that

low stoichiometry pseudophosphorylation alone cannot overcome the energy barrier for

nucleation over the time periods studied.

The nucleation and elongation phases of protein aggregation reactions compete for assembly

competent species, resulting in their time-dependent depletion until the critical concentration is

reached (56). In the case of tau aggregation, the exponential distribution of tau filament lengths

observed at all time points indicates that the rate of elongation exceeds that of nucleation, with


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

14

both occurring throughout the reaction time course (41,57). Under these conditions, lower

critical concentrations could lead to decreased nucleation rates at the latter stages of the time

course by consuming assembly competent tau. The resultant increase in filament elongation

relative to nucleation should be detectable as shifts in filament length distributions toward longer

lengths. For mutants with low critical concentrations, such as 212, the change in distribution was

apparent on visual inspection of electron micrographs (Fig. 7). To test the prediction,

equilibrium length distributions were estimated after fibrillization of all tau constructs in the

presence of AA, with the polydispersity of each population quantified by the slope parameter (b).

Results (Fig. 8) confirmed that the increases in filament mass at equilibrium induced by

pseudophosphorylation correlated with decreases in the slope parameter (i.e., shifts to longer

length distributions). Together these data suggest that the principal effect of

pseudophosphorylation on tau fibrillization is to reduce critical concentration, which leads to a

shift in the length distribution to longer lengths, and a more stable filament population at low

bulk tau concentrations.

Tau Glycation Promotes tau Filament Formation. The effects of glycation on tau assembly

were examined by incubating tau with D-glucose for up to 7 days (31), after which time samples

were analyzed by EM- or LLS-based assays. Double mutant C291A/C322A was used for these

experiments because it lacked Cys residues that could potentially react under glycating

conditions and complicate tau aggregation kinetics (58). On the basis of EM assays using 75 µM

AA as inducer, the presence of up to 2 mM glucose in the assay had no significant effect on

fibrillization levels at equilibrium (Fig. 9). After 7 days incubation at 37°C with 10 mM glucose,

however, statistically significant increases in fibrillization at equilibrium appeared (Fig. 9). On

the basis of parallel reactions containing 14C-labeled glucose, these conditions led to the

incorporation of ~1 mol/mol radiolabel. Desalting of the preparation prior to assay did not


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

15

significantly diminish the stimulatory effect, confirming that the modification was stable and that

carryover of unincorporated glucose was not a contributory factor (Fig. 9).

To determine the mechanism underlying these effects, the full reaction progress curves for

both glycated- and non-glycated C291A/C322A were estimated using the corrected LLS assay

and C18H37SO4Na as a second fibrillization inducer. All glycated samples were desalted prior to

assay in these studies. C291A/C322A incubated at 37°C for 7 days in the absence of glucose

assembled with lag time of 27.4 ± 4.3 min and kapp of 2.15 ± 0.17 h-1 (Fig. 9A). Although

C291A/C322A incubated 7 days in the presence of glucose assembled with similar kinetics as

the non-glycated sample (lag time = 30.9 ± 2.6 min; kapp = 1.86 ± 0.09 h-1), the amount of

fibrillar tau at equilibrium was 1.8 ± 0.1-fold greater (Fig. 9A). Filament accumulation was

accompanied by a shift in length distribution to longer lengths as indicated by a decrease in the

slope parameter to 76 ± 14% of control values (data not shown). To clarify the source of

increased filament mass at equilibrium, critical concentrations of both glycated and non-glycated

samples were determined by LLS and found to be 1.16 ± 0.09 and 1.86 ± 0.14 µM, respectively

(Fig. 9B). These characteristics resemble the effects of pseudophosphorylation on tau assembly,

and indicate that low-stoichiometry glycation enhances fibrillization by lowering critical

concentration and stabilizing filaments.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16

Discussion

Phosphorylation and the tau Aggregation Pathway. Site-specific phosphorylation is an early

and ongoing event in neurofibrillary lesion formation, suggesting a potential role in the process

(14,15,59). Although phosphorylation could potentially modulate multiple aspects of tau biology

(e.g., turnover, localization, etc.), it has been hypothesized that at least one major function in

disease is to directly promote the fibrillization reaction (1). One established mechanism through

which it may do so is the neutralization of tau’s microtubule-binding activity, thereby fostering

an accumulation of freely soluble tau in the cytoplasm (16,19). This reaction, which may

represent the first step in the fibrillization pathway, has been replicated both in situ and in vitro

using various phosphotransferases and also with pseudophosphorylation mutations (16-19,23-

26). But whether it represents a commitment toward fibrillization is not clear. In vivo

phosphorylation of fetal tau at similar sites (12,13) and nearly the same stoichiometry (60) as

PHF-tau does not trigger fibrillization. In situ, tau hyperphosphorylation leads to formation of

thioflavin S-reactive tau species with primarily reticular macroscopic morphology (61),

consistent with the formation of thioflavin S-reactive intermediates but only modest amounts of

filaments (51).

In contrast to these findings, experimentation in vitro suggests that non-specific, high

stoichiometry phosphorylation can directly promote tau aggregation, leading to increased

amounts of amorphous and fibrillar aggregates at equilibrium (20,21,55). This phenomenon has

been proposed to stem from incorporation of negative charge, which may neutralize the net

positive charge of native tau protein and lower the energy barrier for self association (62,63).

Thus the incorporation of negative charge accompanying phosphorylation has been proposed to

create “nucleation centers” that directly trigger tau fibrillization (55).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

17

Although the pseudophosphorylation mutants studied here recapitulated the effects of

hyperphosphorylation with respect to increased filament mass at equilibrium, neither

spontaneous nucleation nor increased nucleation rate in the presence of anionic inducers was

observed. Rather, the mechanism involved a shift in assembly equilibrium toward the

filamentous state as indicated by site-dependent decreases in critical concentration. Lower

critical concentrations reflect decreases in the free energy of the filamentous state, and therefore

increases in the driving force for filament nucleation and subsequent elongation (64). But as

shown here and previously by others (27,38,39,65,66), simply raising tau high above its critical

concentration of assembly (i.e., creating a supersaturated solution) is insufficient to trigger

fibrillization over incubation periods spanning one week. Moreover, supersaturated solutions of

soluble recombinant tau protein do not efficiently polymerize onto exogenous filamentous seeds

in the absence of anionic inducers (38,62), and only small amounts of filaments form in situ even

when tau is expressed at supraphysiological levels (67). These data suggest that while

recombinant tau is natively unfolded (68), the equilibrium conformation is not necessarily

assembly competent. Thus, despite being energetically favorable, filament nucleation proceeds

slowly if at all until assembly competent conformations are attained. Under these conditions,

protein turnover rates may well exceed tau nucleation rates, and the increased cytosolic levels of

supersaturated tau protein engendered by phosphorylation may not lead to fibrillization.

These considerations suggest that assembly competent conformations must be populated

before fibrillization can proceed efficiently. In vitro, the barriers to conformational change and

nucleation can be overcome by anionic condensation agents such as anionic surfactants or

polymers (40,41,51,69,70). Increasing concentrations of anionic inducers lead to decreasing lag

times (i.e., increasing nucleation rates) and increasing quantities of filamentous tau at

equilibrium without changes in critical concentration (43). Similar data has been obtained with


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

18

micelle-mediated fibrillization of α-synuclein (54). The ability of micellar inducers to increase

levels of filamentous tau at equilibrium appears to derive in part from changes in pre-nuclear

equilibria, including the conversion of assembly-incompetent to assembly-competent

conformations (43).

On the basis of these considerations, we propose two general classes of tau assembly

modulators. Those agents or posttranslational modifications that modulate pre-nuclear equilibria

by stabilizing assembly competent conformations can act to trigger fibrillization. Examples

include anionic membranes (41), which because of their association of tau filaments in biopsy

specimens of AD tissue (71), may be pathophysiologically relevant sources of nucleating

activity. The second category includes modifications that affect post-nuclear equilibria such as

critical concentration. These enhance fibrillization by stabilizing filaments and increasing the

driving force for nucleation without necessarily triggering it or increasing its rate. The negative

charges introduced by pseudophosphorylation exemplify this second category. Because of their

different underlying mechanisms, anionic inducers and pseudophosphorylation act

synergistically in vitro. Similarly, multiple fibrillization triggers and enhancers may combine to

promote tau fibrillization in disease.

Molecular Mechanism. The extent of fibrillization of tau and pseudophosphorylation mutants at

equilibrium was found linearly related to the critical concentration, which is defined as (53):

+

−=kkacrit (eq 3)

where acrit is the critical concentration, and k- and k+ are the rate constants for protein monomer

dissociation from and association with filament ends, respectively. Lowering of critical

concentration implies a decrease in k-, an increase in k+, or a combination of both. Although

pseudophosphorylation clearly modulates filament elongation relative to nucleation rate, we


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

19

could not directly test whether elongation rates (i.e., k+) change in response to

pseudophosphorylaton owing to the inability to seed fibrillization reactions in the absence of

condensing agents (38,62).

The relationship between critical concentration and filament nucleation in nucleation-

elongation reactions has been derived as (72):

( )ncrit

init

aC

kk

=−

(eq 4)

where kinit represents the operational nucleation rate from n monomers (i.e., n = nucleus size)

and C is a constant. Thus, decreases in critical concentration can associate with decreases in k-,

increases in kinit, or decreases in nucleation molecularity (n). It has been shown in other systems

that these parameters can change in combination in response to decreases in critical

concentration (73). In the case of tau pseudophosphorylation, however, the absence of increased

nucleation rates suggests that increases in kinit can be ruled out.

The relationship between critical concentration and length distribution has been derived as

(72):

j

critj a

aCx

= (eq 5)

where a is the concentration of free monomer and xj is the concentration of polymers composed

of j protomers. Thus, decreases in critical concentration are associated with lengthening of

filament length distributions at equilibrium. This effect was observed for all

pseudophosphorylation mutants that decreased critical concentration.

These data suggest that the kinetic and equilibrium effects of pseudophosphorylation can be

rationalized from changes in critical concentration, and that in addition to destabilizing tau-

tubulin interactions, a second effect of pseudophosphorylation and potentially phosphorylation is


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

20

to stabilize filaments once nucleated. This mechanism could be significant at early stages of

disease by supporting filament accumulation at submicromolar intracellular concentrations.

Comparison with Previous Work. The effects of pseudophosphorylation on tau fibrillization has

been contentious with many conflicting studies. Much of this stems from differences in the

methodology used to assay fibrillization. Previously we showed a strong increase in

fibrillization tendency with pseudophosphorylation mutant 396/404 (28). However, these results

were based on an LLS assay that was not corrected for inducer micellization, which makes a

major contribution to scattering intensity (43). Eliminating the micelle background as described

here brings the corrected LLS assay into harmony with the EM assay, and reveals that the

increases in fibrillization at equilibrium accompanying pseudophosphorylation at 396/404 are

statistically significant but modest. Others have assayed pseudophosphorylation mutants using

fluorescent reporter probes such as thioflavin S (27). But this reagent fluoresces in the presence

of tau intermediates as well as filaments, and therefore is not specific for fibrillization when

employed under the conditions used here (41). Similarly, centrifugation-based assays pellet both

fibrillar and non-fibrillar tau aggregates, potentially masking fibrillization-specific effects. This

limitation is exemplified by mutant 235, which formed both filamentous and amorphous

aggregates, and therefore yielded higher signals in LLS assays compared to EM assays. Finally,

results are highly dependent on tau concentration. The effects described here, which are readily

apparent at near physiological levels of tau protein, would be difficult to detect at the higher tau

concentrations (40 to 100 µM) used in other assembly paradigms (22,27).

An example of these considerations in the context of the surfactant-induced tau aggregation

system employed here is illustrated in Fig. 4. The relationship between critical concentration

and total fibrillization at equilibrium was found to be linear with an extrapolated ordinate

intercept of 2.8 ± 0.1 µM htau40. These data indicate that tau preparations with critical


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21

concentrations above this level cannot fibrillize under our standard bulk tau concentrations (4

µM), and may explain why certain tau isoforms fail to assemble in the presence of AA (39) but

readily do so at high concentration (40 – 100 µM) in response to heparin (66). Similarly, the

abscissa intercept of this plot shows that the maximum increase in fibrillization theoretically

detectable at “zero” critical concentration and 4 µM bulk htau40 concentration is ~3.6-fold.

Relative increases will appear smaller at higher bulk tau concentrations, illustrating the

importance of working at physiological tau concentration for these studies.

Non-specific, high stoichiometry phosphorylation of recombinant tau in the presence of

crude extracts has been found to enhance aggregate formation with both amorphous and

filamentous morphologies (20,55). The requirement for high stoichiometry (i.e., ≥10 mol/mol,

or ~1.5 standard deviations above the mean stoichiometry observed in autopsy-derived

filamentous tau) may result from non-specific incorporation of anionic charge into multiple sites,

each of which may differ in the ability to enhance fibrillization (as found here). Although these

data have been interpreted as evidence for the phosphorylation-dependent creation of “nucleation

centers”, nonphosphorylated recombinant full-length htau40 also aggregated spontaneously in

these studies (20). As discussed above, the latter result is highly unusual, and suggests the

presence of exogenous aggregation inducers that are absent from most in vitro fibrillization

experiments. Quantitative experiments with purified components will be required to establish

whether high-stoichiometry phosphorylation can also directly accelerate nucleation rate and

promote spontaneous assembly.

Sites of Pseudophosphorylation. On the basis of immunohistochemical studies, tau

phosphorylation sites fill hierarchically during the course of AD (14,15). Early modifications

predominating in the pre-tangle stage include sites 231, 235, 262, and 409.

Pseudophosphorylation mutants corresponding to single residue changes at these positions did


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

22

not differ significantly from wild-type htau40 with respect to assembly kinetics or final

equilibrium position. Sites more fully occupied in classic intracellular NFTs, such as those

detected by monoclonal antibodies AT100 (212/214) and AT8 (199/202/205), however, were

associated with the largest changes in fibrillization behavior. Although both 212 and 214 single

mutants greatly modified fibrillization characteristics, the effects of these closely spaced

mutations were not additive in the 212/214 double mutant. Mutants corresponding to sites

enriched in late-stage disease, including those identified by PHF1 (396/404) and site 422, were

not substantially different from wild type. Correlations with lesion stage must be interpreted

with caution, however, because staging data depends on the differential reactivity of monoclonal

antibodies and is potentially biased toward sites that are stable to the proteolysis (74) and

changes in tau conformation (75) that accompany lesion maturation. Rather than maturation

stage, the rank order of pseudophosphorylation efficacy may more closely reflect their location

in the polypeptide chain, with activating mutations clustering in residues 199 – 214 of the

proline-rich domain. This region flanks the microtubule-binding domain and is required for tau

induced tubulin nucleation in vitro (76). It also promotes interaction of tau with the microtubules

(77). The ability of tau to induce microtubule nucleation is lost upon phosphorylation of this

region (78). Together, these observations support the hypothesis that phosphorylation within the

proline-rich domain critically affects the physiological function and pathological aggregation of

tau.

Role of Glycation. As shown previously (5,30,31), and confirmed here, in vitro glycation can

increase the equilibrium levels of tau fibrillization at constant bulk tau concentration. The

reaction must proceed for several days to yield these differences, however. Like

pseudophosphorylation mutants, glycation depressed critical concentration, indicating that

filament stabilization is one mechanism underlying the phenomenon. Despite its ability to


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

23

enhance tau fibrillization, glycated tau did not fibrillize spontaneously or increase nucleation rate

again suggesting that the glycation conditions used here did not promote the accumulation of

assembly competent conformations.

Together these data are consistent with at least two key roles for tau modifications in

promoting tau fibrillization in early stage disease. The first is to modulate tau/microtubule

equilibrium to regulate intracellular concentrations of free tau. The second is to lower the critical

concentration for assembly thereby stabilizing filaments and increasing the driving force for

nucleation. The approach outlined here will be useful in characterizing the ability of diverse tau

modifications to modulate tau aggregation kinetics.

Acknowledgments

We thank Drs. and Aida Abraha (Chicago State University) and Lester I. Binder (Northwestern

University Medical School) for providing pseudophosphorylation mutant 396/404.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

24

References

1. Buee, L., Bussiere, T., Buee-Scherrer, V., Delacourte, A., and Hof, P. R. (2000) Brain

Res. Brain Res. Rev. 33, 95-130

2. Goedert, M., Spillantini, M. G., and Davies, S. W. (1998) Curr. Opin. Neurobiol. 8, 619-

632

3. Shahani, N., and Brandt, R. (2002) Cell. Mol. Life Sci. 59, 1668-1680

4. Goedert, M. (1996) Ann. N.Y. Acad. Sci. 777, 121-131

5. Ledesma, M. D., Bonay, P., and Avila, J. (1995) J. Neurochem. 65, 1658-1664

6. Mena, R., Edwards, P. C., Harrington, C. R., Mukaetova-Ladinska, E. B., and Wischik,

C. M. (1996) Acta Neuropathol. (Berl) 91, 633-641

7. Watanabe, A., Takio, K., and Ihara, Y. (1999) J. Biol. Chem. 274, 7368-7378

8. Ksiezak-Reding, H., Liu, W. K., and Yen, S. H. (1992) Brain Res. 597, 209-219

9. Kopke, E., Tung, Y. C., Shaikh, S., Alonso, A. C., Iqbal, K., and Grundke-Iqbal, I. (1993)

J. Biol. Chem. 268, 24374-24384

10. Hanger, D. P., Betts, J. C., Loviny, T. L., Blackstock, W. P., and Anderton, B. H. (1998)

J. Neurochem. 71, 2465-2476

11. Morishima-Kawashima, M., Hasegawa, M., Takio, K., Suzuki, M., Yoshida, H., Titani,

K., and Ihara, Y. (1995) J. Biol. Chem. 270, 823-829

12. Matsuo, E. S., Shin, R. W., Billingsley, M. L., Van deVoorde, A., O'Connor, M.,

Trojanowski, J. Q., and Lee, V. M. (1994) Neuron 13, 989-1002

13. Seubert, P., Mawal-Dewan, M., Barbour, R., Jakes, R., Goedert, M., Johnson, G. V.,

Litersky, J. M., Schenk, D., Lieberburg, I., Trojanowski, J. Q., and et al. (1995) J. Biol.

Chem. 270, 18917-18922


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

25

14. Augustinack, J. C., Schneider, A., Mandelkow, E. M., and Hyman, B. T. (2002) Acta

Neuropathol. (Berl) 103, 26-35

15. Kimura, T., Ono, T., Takamatsu, J., Yamamoto, H., Ikegami, K., Kondo, A., Hasegawa,

M., Ihara, Y., Miyamoto, E., and Miyakawa, T. (1996) Dementia 7, 177-181

16. Bramblett, G. T., Goedert, M., Jakes, R., Merrick, S. E., Trojanowski, J. Q., and Lee, V.

M. (1993) Neuron 10, 1089-1099

17. Biernat, J., Gustke, N., Drewes, G., Mandelkow, E. M., and Mandelkow, E. (1993)

Neuron 11, 153-163

18. Patrick, G. N., Zukerberg, L., Nikolic, M., de la Monte, S., Dikkes, P., and Tsai, L. H.

(1999) Nature 402, 615-622

19. Li, G., Yin, H., and Kuret, J. (2004) J. Biol. Chem. 279, 15938-15945

20. Alonso, A., Zaidi, T., Novak, M., Grundke-Iqbal, I., and Iqbal, K. (2001) Proc. Natl.

Acad. Sci. U.S.A. 98, 6923-6928

21. Alonso, A. D., Grundke-Iqbal, I., Barra, H. S., and Iqbal, K. (1997) Proc. Natl. Acad. Sci.

U.S.A. 94, 298-303

22. Schneider, A., Biernat, J., von Bergen, M., Mandelkow, E., and Mandelkow, E. M.

(1999) Biochemistry 38, 3549-3558

23. Leger, J., Kempf, M., Lee, G., and Brandt, R. (1997) J. Biol. Chem. 272, 8441-8446

24. Eidenmuller, J., Fath, T., Hellwig, A., Reed, J., Sontag, E., and Brandt, R. (2000)

Biochemistry 39, 13166-13175

25. Eidenmuller, J., Fath, T., Maas, T., Pool, M., Sontag, E., and Brandt, R. (2001) Biochem.

J. 357, 759-767

26. Fath, T., Eidenmuller, J., and Brandt, R. (2002) J. Neurosci. 22, 9733-9741

27. Haase, C., Stieler, J. T., Arendt, T., and Holzer, M. (2004) J. Neurochem. 88, 1509-1520


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

26

28. Abraha, A., Ghoshal, N., Gamblin, T. C., Cryns, V., Berry, R. W., Kuret, J., and Binder,

L. I. (2000) J. Cell Sci. 113, 3737-3745

29. Yan, S. D., Chen, X., Schmidt, A. M., Brett, J., Godman, G., Zou, Y. S., Scott, C. W.,

Caputo, C., Frappier, T., Smith, M. A., and et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91,

7787-7791

30. Ledesma, M. D., Bonay, P., Colaco, C., and Avila, J. (1994) J. Biol. Chem. 269, 21614-

21619

31. Ledesma, M. D., Medina, M., and Avila, J. (1996) Mol. Chem. Neuropathol. 27, 249-258

32. Smith, M. A., Tabaton, M., and Perry, G. (1996) Neurosci Lett. 217, 210-211

33. Smith, M. A., Taneda, S., Richey, P. L., Miyata, S., Yan, S. D., Stern, D., Sayre, L. M.,

Monnier, V. M., and Perry, G. (1994) Proc. Natl. Acad. Sci. U.S.A. 91, 5710-5714

34. Nacharaju, P., Ko, L., and Yen, S. H. (1997) J. Neurochem. 69, 1709-1719

35. Vitek, M. P., Bhattacharya, K., Glendening, J. M., Stopa, E., Vlassara, H., Bucala, R.,

Manogue, K., and Cerami, A. (1994) Proc Natl Acad Sci U S A 91, 4766-4770

36. Ledesma, M. D., Bonay, P., Colaco, C., and Avila, J. (1994) J Biol Chem 269, 21614-

21619

37. Ledesma, M. D., Bonay, P., and Avila, J. (1995) J Neurochem 65, 1658-1664

38. King, M. E., Ahuja, V., Binder, L. I., and Kuret, J. (1999) Biochemistry 38, 14851-14859

39. King, M. E., Gamblin, T. C., Kuret, J., and Binder, L. I. (2000) J. Neurochem. 74, 1749-

1757

40. Wilson, D. M., and Binder, L. I. (1997) Am. J. Pathol. 150, 2181-2195

41. Chirita, C. N., Necula, M., and Kuret, J. (2003) J. Biol. Chem. 278, 25644-25650

42. Carmel, G., Mager, E. M., Binder, L. I., and Kuret, J. (1996) J. Biol. Chem. 271, 32789-

32795


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

27

43. Necula, M., and Kuret, J. (2004a) Anal. Biochem., in press

44. Gamblin, T. C., King, M. E., Kuret, J., Berry, R. W., and Binder, L. I. (2000)


45. Illenberger, S., Zheng-Fischhofer, Q., Preuss, U., Stamer, K., Baumann, K., Trinczek, B.,

Biernat, J., Godemann, R., Mandelkow, E. M., and Mandelkow, E. (1998) Mol. Biol.

Cell. 9, 1495-1512

46. Necula, M., and Kuret, J. (2004b) Anal. Biochem. 329, 238-246

47. Gamblin, T. C., King, M. E., Dawson, H., Vitek, M. P., Kuret, J., Berry, R. W., and

Binder, L. I. (2000) Biochemistry 39, 6136-6144

48. von Bergen, M., Friedhoff, P., Biernat, J., Heberle, J., Mandelkow, E. M., and

Mandelkow, E. (2000) Proc. Natl. Acad. Sci. U.S.A. 97, 5129-5134

49. Winsor, C. P. (1932) Proc. Natl. Acad. Sci. U.S.A. 18, 1-8

50. Evans, K. C., Berger, E. P., Cho, C. G., Weisgraber, K. H., and Lansbury, P. T., Jr.

(1995) Proc. Natl. Acad. Sci. U.S.A. 92, 763-767

51. Chirita, C. N., and Kuret, J. (2004) Biochemistry 43, 1704-1714

52. Harper, J. D., and Lansbury, P. T., Jr. (1997) Annu. Rev. Biochem. 66, 385-407

53. Timasheff, S. N. (1981) in Protein-Protein Interactions (Frieden, C., and Nichol, L. W.,

eds), pp. 315-336, John Wiley and Sons, New York

54. Necula, M., Chirita, C. N., and Kuret, J. (2003) J. Biol. Chem. 278, 46674-46680

55. Alonso, A. C., Grundke-Iqbal, I., and Iqbal, K. (1996) Nat. Med. 2, 783-787

56. Fesce, R., Benfenati, F., Greengard, P., and Valtorta, F. (1992) J. Biol. Chem. 267,

11289-11299

57. Wilson, D. M., and Binder, L. I. (1995) J. Biol. Chem. 270, 24306-24314

58. Thorpe, S. R., and Baynes, J. W. (2003) Amino Acids 25, 275-281


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

28

59. Bancher, C., Brunner, C., Lassmann, H., Budka, H., Jellinger, K., Wiche, G.,

Seitelberger, F., Grundke-Iqbal, I., Iqbal, K., and Wisniewski, H. M. (1989) Brain Res.

477, 90-99

60. Kenessey, A., and Yen, S. H. (1993) Brain Res. 629, 40-46

61. Sato, S., Tatebayashi, Y., Akagi, T., Chui, D. H., Murayama, M., Miyasaka, T., Planel,

E., Tanemura, K., Sun, X., Hashikawa, T., Yoshioka, K., Ishiguro, K., and Takashima, A.

(2002) J. Biol. Chem. 277, 42060-42065

62. Friedhoff, P., von Bergen, M., Mandelkow, E. M., Davies, P., and Mandelkow, E. (1998)

Proc. Natl. Acad. Sci. U.S.A. 95, 15712-15717

63. Alonso, A., Mederlyova, A., Novak, M., Grundke-Iqbal, I., and Iqbal, K. (2004) J. Biol.

Chem. 279, 34873-34881

64. Kashchiev, D. (2000) Nucleation: basic theory with applications, Butterworth

Heinemann, Oxford

65. Crowther, R. A., Olesen, O. F., Smith, M. J., Jakes, R., and Goedert, M. (1994) FEBS

Lett. 337, 135-138

66. Friedhoff, P., Schneider, A., Mandelkow, E. M., and Mandelkow, E. (1998) Biochemistry

37, 10223-10230

67. Ko, L. W., DeTure, M., Sahara, N., Chihab, R., and Yen, S. H. (2002) J. Mol. Neurosci.

19, 311-316

68. Schweers, O., Schonbrunn-Hanebeck, E., Marx, A., and Mandelkow, E. (1994) J. Biol.

Chem. 269, 24290-24297

69. Perez, M., Valpuesta, J. M., Medina, M., Montejo de Garcini, E., and Avila, J. (1996) J.

Neurochem. 67, 1183-1190


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

29

70. Goedert, M., Jakes, R., Spillantini, M. G., Hasegawa, M., Smith, M. J., and Crowther, R.

A. (1996) Nature 383, 550-553

71. Gray, E. G., Paula-Barbosa, M., and Roher, A. (1987) Neuropathol. Appl. Neurobiol. 13,

91-110

72. Edelstein-Keshet, L., and Ermentrout, G. B. (1998) Bull. Mathematical Biol. 60, 449-475

73. Bubb, M. R., Spector, I., Beyer, B. B., and Fosen, K. M. (2000) J. Biol. Chem. 275, 5163-

5170

74. Braak, E., Braak, H., and Mandelkow, E. M. (1994) Acta Neuropathol. (Berl) 87, 554-

567

75. Garcia-Sierra, F., Ghoshal, N., Quinn, B., Berry, R. W., and Binder, L. I. (2003) J,

Alzheimers Dis, 5, 65-77

76. Brandt, R., and Lee, G. (1993) J. Biol. Chem. 268, 3414-3419

77. Gustke, N., Trinczek, B., Biernat, J., Mandelkow, E. M., and Mandelkow, E. (1994)


78. Brandt, R., Lee, G., Teplow, D. B., Shalloway, D., and Abdel-Ghany, M. (1994) J. Biol.

Chem. 269, 11776-11782


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

30

Footnotes

*This work was supported by National Institutes of Health grant AG14452 (to J.K.)

1The abbreviations used are: AA, arachidonic acid; AD, Alzheimer's disease; EM, electron

microscopy; In(90°), net light scattering intensity corrected for micellization; LLS, laser light

scattering


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

31

Figure Legends

Fig. 1. Distribution of pathophysiological phosphorylation sites on htau40. AD-derived tau

proteins contain covalently bound phosphate distributed across ~30 sites clustered primarily on

each side of tau microtubule binding region (white box) with two sites (Ser262 and Ser356) lying

within it. Sites modeled in this work by phosphorylation mimicry are shown graphically with

hollow symbols and summarized in detail in Table I.

Fig. 2. Site-specific modulation of tau fibrillization equilibria by pseudophosphorylation.

A, Wild-type and mutant htau40 preparations (4 µM) were incubated (4 h at room temperature)

in assembly buffer containing 75 µM AA and then examined by transmission EM. The total

lengths/field of all filaments ≥50 nm in length adsorbed onto grids (Γf ) were measured from the

resultant digitized images. All data are presented as percentages of normalized values ± SD (n =

3), with wild-type control htau40 defined as 100%. Significance at p < 0.05 (*) and p < 0.01

(**) was estimated by t-test. Significant differences in filament mass were detectable within 4 h

in the presence of AA inducer. B, Fibrillization assays were performed as described above

except that 50 µM C18H37SO4Na served as aggregation inducer and that reactions were stopped

after 5 h incubation. Each point represents the normalized fibrillization lengths/field achieved in

the presence of C18H37SO4Na (Γf C18H37SO4Na) relative to AA (Γf AA) inducer, whereas the

line represents linear regression analysis of the data points (symbol key is located in Panel C).

The data show that the effect of mutations on tau fibrillization could be detected in the presence

of both fatty acid and alkyl sulfate inducers. C, Fibrillization assays were performed using 50

µM C18H37SO4Na as aggregation inducer as described above except that fibrillization was

quantified after 26 h by the static light scattering assay. Each point represents the net intensity of


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

32

scattered laser light corresponding to fibrillization, In(90°), normalized to wild-type tau relative

to total filament lengths/field determined in Panel B, whereas the solid line represents linear

regression of the data points (excluding mutant 235, which produced amorphous aggregates as

well as filaments). These data show that the effects of pseudophosphorylation on fibrillization

equilibria were consistent by two distinct assay methods.

Fig. 3. Pseudophosphorylation modulates the critical concentration for assembly. The

fibrillization of wild-type htau40 and pseudophosphorylation mutants incubated (room

temperature for 26 h) with C18H37SO4Na inducer (50 µM) in assembly buffer was assayed as a

function of tau concentration (1 - 4.5 µM) by static LLS. Each data point represents the net

intensity of scattered light corresponding to fibrillization, In(90°), at a specific tau concentration,

whereas each solid line represents linear regression analysis of the data. The critical

concentration of assembly, which was estimated from the abscissa intercept of each regression

line (summarized in Table II), was modulated by site-specific pseudophosphorylation. Although

measured in quadruplicate, error bars on data points have been omitted for clarity.

Fig. 4. Filament mass at equilibrium correlates with critical concentration. The critical

concentrations of wild-type htau40 and pseudophosphorylation mutants (mean ± SD) were

plotted against total filament lengths at equilibrium estimated in Fig. 2C (% wild-type tau control

± SD) and analyzed by linear regression. Total filament lengths were directly proportional to

critical concentrations.

Fig. 5. Effect of pseudophosphorylation on fibrillization kinetics. Fibrillization of wild-type

htau40 and tau phosphorylation mimicry mutants (4 µM) in the presence of 50 µM C18H37SO4Na

was assayed as a function of incubation time at room temperature. Each data point represents

average filament lengths/field calculated from EM images whereas each curve represents best fit


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

33

of the data points to a three parameter Gompertz growth function (eq. 1). Although

pseudophosphorylation had only minor effects on fibrillization kinetics as estimated by lag time

or first order growth rates (summarized in Table II), it greatly modulated total filament mass at

equilibrium relative to wild-type htau40.

Fig. 6. Filament mass at equilibrium correlates with fibrillization lag times. A, lag times

and B, kapp values for wild-type htau40 and pseudophosphorylation mutants estimated in Fig. 5

were plotted against total filament lengths at equilibrium estimated in Fig. 2C (% wild-type tau

control ± SD) and analyzed by linear regression. Horizontal error bars were omitted for clarity.

Total filament lengths at equilibrium were directly proportional to lag times but not kapp,

consistent with a decrease in critical concentration.

Fig. 7. Pseudophosphorylation at position 212 leads to longer filament lengths. A, Wild-

type htau40 and B, mutant htau40T212E preparations (4 µM) were incubated (5 h at room

temperature) under standard conditions (assembly buffer with 75 µM AA) and then visualized by

transmission EM. Although both tau preparations yielded filaments with straight morphology,

mutant htau40T212E yielded filaments with greater average length relative to wild-type htau40.

This profile was typical of all pseudophosphorylation mutants that enhanced tau fibrillization.

Bar = 100 nm.

Fig. 8. Pseudophosphorylation modulates equilibrium length distributions. Wild-type and

mutant htau40 preparations (4 µM) were incubated (4 h at room temperature) in assembly buffer

containing 75 µM AA and then examined by transmission EM. The total lengths/field of all

filaments ≥50 nm in length adsorbed onto grids (Γf ) were measured from the resultant digitized

images. Distributions of lengths that segregated into consecutive intervals (50-nm bins) were

also calculated and quantified by a slope parameter as described in Experimental Procedures.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

34

All data points are presented as percentages of normalized values, with wild-type control htau40

defined as 100% on both axes. The solid line represents the best fit of the data points to an

exponential function. Increases in filament mass at equilibrium produced by

pseudophosphorylation were accompanied by decreases in slope.

Fig. 9. Glycation increases inducer-mediated tau fibrillization. The fibrillization of

htau40C291A/C322A (4 µM) under standard conditions (assembly buffer with 75 µM AA) was

quantified by transmission EM. Total lengths/field of all filaments ≥50 nm in length (Γf) were

calculated as percentages of normalized control values ± SE, with untreated htau40C291A/C322A

(glucose -) defined as 100%. The presence of free D-glucose (2 mM) in the assay (glucose +;

glycation time = 0 d) did not significantly change the extent of fibrillization relative to the no

glucose control, confirming that the presence of free glucose in the assay at low millimolar

concentrations did not modulate tau assembly under these conditions. In contrast, preincubation

of htau40C291A/C322A under glycating conditions (glycation time = 7 d at 37°C) resulted in a nearly

two-fold increase in the amount of filamentous material at equilibrium. The enhanced

aggregation activity was stable to desalting by gel filtration prior to dilution and assay

confirming that it resulted from a stable modification of tau protein and not from free glucose or

other small molecules carried over into the assay. Significance at p < 0.01 (**) was estimated by

t-test.

Fig. 10. Effect of glycation on tau fibrillization kinetics. Mutant htau40C291A/C322A

preparations (4 µM) treated 7 d (37°C) in the presence (○) or absence (●) of 10 mM D-glucose

were subjected to fibrillization conditions (assembly buffer with 50 µM C18H37SO4Na) after

desalting chromatography and examined as a function of A, incubation time or B, tau

concentration by the corrected LLS assay. A, Each data point represents net light scattering


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

35

intensity of glycated (●) and non-glycated (○) sample as a function of time, whereas each

sigmoid curve represents the best fit of the data points to a three parameter Gompertz function

(eq 1). Glycation resulted in increases in equilibrium levels of fibrillization with only minor

changes in lag time. B, varying concentrations (1.5 - 4.5 µM) of glycated (●) and non-glycated

(○) htau40C291A/C322A were fibrillized in the presence of 50 µM C18H37SO4Na for 26 h at 22°C

and then analyzed by corrected LLS. Each data point represents the net intensity of scattered

light at a given tau concentration (mean ± SD of triplicate determinations) whereas the solid lines

represent best fit of the data points to a linear regression. The critical concentration, estimated

from the abscissa intercept of linear regression lines, decreased with glycation.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

36

Table I

Pseudophosphorylation mutants examined in this work

Sites Probea AD Stageb Tauopathya

Ser199, Ser202, Thr205 AT8 Late All

Thr212, Ser214 AT100 Late ---

Thr231, Ser235 AT180; TG3 Early ---

Ser262 12E8 Early Most

Ser396, Ser404 AD2; PHF1 Late All

Ser409 --- Early ---

Ser422 AP422 Mid All

aSite-selective immunological probes of phosphorylation occupancy (AT8, AT100, etc.) are

reviewed in (1).

bRefs. (14,15)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

37

Table II

Kinetic and thermodynamic parameters of pseudophosphorylation mutants

Tau construct aLag time

(min)

akapp

(h-1)

bCritical concentration

(µM)

WT 42.4 ± 0.8 1.33 ± 0.07 2.00 ± 0.07

199 51.5 ± 0.9 1.08 ± 0.10 1.62 ± 0.02

199/202/205 57.9 ± 0.5 1.31 ± 0.07 1.05 ± 0.16

212 59.5 ± 0.4 1.13 ± 0.03 0.68 ± 0.13

214 61.6 ± 0.5 1.03 ± 0.03 0.81 ± 0.09

212/214 53.8 ± 0.3 1.40 ± 0.06 1.07 ± 0.07

231 41.7 ± 0.9 1.08 ± 0.10 2.03 ± 0.14

235 40.3 ± 0.5 1.25 ± 0.09 1.97 ± 0.17

262 38.9 ± 1.1 1.01 ± 0.10 1.95 ± 0.08

396/404 52.6 ± 1.2 1.28 ± 0.12 2.02 ± 0.13

409 41.3 ± 0.7 1.05 ± 0.07 1.92 ± 0.10

422 39.2 ± 1.2 1.00 ± 0.11 1.88 ± 0.11

aDetermined from 4 µM tau and 50 µM C18H37SO4Na by EM and fitted to a three-parameter

Gompertz growth function as described in Experimental Procedures (shown in Fig. 5).

Parameters are expressed ± SE.

bDetermined by static laser-light scattering in the presence of 2 - 4.5 µM tau and 50 µM

C18H37SO4Na (shown in Fig. 3) and expressed as mean ± SD.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

38

Figure 1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

39

Figure 2


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

40

Figure 3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

41

Figure 4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

42

Figure 5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

43

Figure 6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

44

Figure 7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

45

Figure 8


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

46

Figure 9


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

47

Figure 10


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Mihaela Necula and Jeff Kuretfibrillization in vitro

Pseudophosphorylation and glycation of tau protein enhance but do not trigger

published online September 10, 2004J. Biol. Chem.

10.1074/jbc.M405527200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M405527200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M405527200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/09/10/jbc.M405527200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/09/10/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/09/10/jbc.M405527200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Pseudophosphorylation and glycation of tau protein enhance but do ...

Documents

Transcript of Pseudophosphorylation and glycation of tau protein enhance but do ...