,

,

,

Antimicrobial resistance and genetic characterization of

fluoroquinolone resistance of Pseudomonas

aeruginosa isolated from canine infections

J. Rubin a, R.D. Walker b,c, K. Blickenstaff d, S. Bodeis-Jones d, S. Zhao d,*

a Department of Veterinary Microbiology, Western College of Veterinary Medicine,

University of Saskatchewan, 52 Campus Drive, Saskatoon S7N 5B4, Canadab Anti-infectives Research Consultants, Glade Park, CO 81523, United States

c Department of Biological Sciences, Mesa State College, Grand Junction, CO 81501, United Statesd Office of Research, Center for Veterinary Medicine, U.S. Food & Drug Administration,

8401 Muirkirk Road, Laurel, MD 20708, United States

Received 21 December 2007; received in revised form 26 February 2008; accepted 28 February 2008

Abstract

Infections with antimicrobial-resistant bacteria are a great challenge in both human and veterinary medicine. The purpose of

this study was to determine antimicrobial susceptibility of 106 strains of Pseudomonas aeruginosa isolated from dogs with otitis

and pyoderma from 2003 to 2006 in the United States. Three antimicrobial panels, including 6 classes and 32 antimicrobial

agents, were used. A wide range of susceptibility patterns were noted with some isolates being resistant to between 8 and 28

(mean 16) of the antimicrobials tested. Among the b-lactams, all isolates were resistant to ampicillin, cefoxitin, cefpodoximecephalothin and cefazolin followed by amoxicillin/clavulanic acid (99%), ceftiofur (97%), ceftriaxone (39%), cefotaxime

(26%), and cefotaxime/clavulanic acid (20%), whereas less than 7% of isolates were resistant to ceftazidime/clavulanic acid

ceftazidime, piperacillin/tazobactam or cefepime. Two isolates were resistant to the carbapenems. Among the quinolones and

fluoroquinolones, the most isolates were resistant to naladixic acid (96%), followed by orbifloxacin (52%), difloxacin (43%)

enrofloxacin (31%), marbofloxacin (27%), gatifloxacin (23%), levofloxacin (21%), and ciprofloxacin (16%). Among the

aminoglycosides, the most resistance was seen to kanamycin (90%), followed by streptomycin (69%), gentamicin (7%), and

amikacin (3%). Of the remaining antimicrobials 100% of the isolates were resistant to chloramphenicol followed by tetracycline

(98%), trimethoprim/sulfamethoxazole (57%), and sulfisoxazole (51%). Point mutations were present in gyrA, gyrB, parC, and/

or parE genes among 34 of the 102 naladixic acid-resistant isolates. Two isolates contained class 1 integrons carrying aadA gene

conferring streptomycin and spectinomycin resistance. The findings suggest that many antimicrobial agents commonly used in

companion animals may not constitute appropriate therapy for canine pseudomonas infections.

# 2008 Elsevier B.V. All rights reserved.

Keywords: Pseudomonas aeruginosa; Antimicrobial resistance; Fluoroquinolones; Canine; Class 1 integron; QRDR

www.elsevier.com/locate/vetmic

Available online at www.sciencedirect.com

Veterinary Microbiology 131 (2008) 164172

* Corresponding author. Tel.: +1 301 210 4472.

E-mail address: shaohua.zhao@FDA.HHS.GOV (S. Zhao).

0378-1135/$ see front matter # 2008 Elsevier B.V. All rights reserved.doi:10.1016/j.vetmic.2008.02.018

mailto:shaohua.zhao@FDA.HHS.GOVhttp://dx.doi.org/10.1016/j.vetmic.2008.02.018

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172 165

1. Introduction

Pseudomonas aeruginosa, a Gram-negative rod, is

an important pathogen to both humans and animals

(Hillier et al., 2006; Gales et al., 2001). The bacterium

can be resistant to all classes of antimicrobial

agents making it especially difficult to successfully

treat patients with compromised immune defenses

(Jalal et al., 2000; Pirnay et al., 2003). In dogs,

P. aeruginosa is a common cause of pyoderma, otitis

media/external and urinary tract infections (Cole

et al., 2006; Gatoria et al., 2006; Hariharan et al.,

2006; Hillier et al., 2006).

Due to the presence of several drug efflux

systems and porins, P. aeruginosa is intrinsically

resistant to a wide range of antimicrobials including

benzylpenicillins, aminobenzylpenicillins, carboxy-

penicillins, first and second generation cephalospor-

ins, chloramphenicol and tetracycline (Li et al.,

1994; Nikaido, 1994). It also forms biofilms

which are impervious to antimicrobials, further

complicating therapy (Hall-Stoodley et al., 2004).

The major classes of antimicrobials used for the

systemic treatment of infections include the anti-

pseudomonal penicillins, third and fourth generation

cephalosporins, carbapenems, aminoglycosides,

and fluoroquinolones. Unfortunately, resistance to

these drugs is frequently encountered in clinical

practice. Due to highly variable resistance patterns,

empiric therapy may result in inappropriate treat-

ment. Thus, antimicrobial susceptibility testing

should be a crucial step in the selection of

appropriate therapy.

With increasing utilization of fluoroquinolones in

both human and veterinary medicine, emerging

resistance is a concern (Hariharan et al., 2006; Linder

et al., 2005). Resistance to fluoroquinolones is

frequently due to point mutations in the DNA gyrase

(gyrA and gyrB) and topoisomerase IV ( parC and

parE) genes. Plasmid-mediated resistance and efflux

systems have been reported as alternate mechanisms

of resistance. Class 1 integrons are important in the

dissemination of resistance in Gram-negative bacteria

(Hall, 1997). The objectives of this study were to

define susceptibility patterns, characterize quinolone

resistance and screen for class 1 integrons in 106

clinical dog isolates of P. aeruginosa from the United

States.

2. Materials and methods

2.1. Bacterial strains

One hundred and six strains of P. aeruginosa

isolated from dogs with soft tissue infections, e.g.,

otitis externa, otitis medius and pyoderma were used

in this study. All strains were isolated from veterinary

diagnostic laboratories from nine states in the U.S.

between 2003 and 2006. History on prior antimicro-

bial chemotherapy was not available. Following the

initial isolation and identification, the isolates were

sent to the Center for Veterinary Medicine (CVM), the

U.S. Food and Drug Administration (FDA). Upon

receipt, the bacterial isolates were subcultured onto

trypticase soy agar (TSA) plates supplemented with

5% defibrinated sheep blood (Becton Dickinson

Microbiology Systems, Cockeysville, MD). Isolates

were confirmed as P. aeruginosa using VITEK

Gram-negative identification cards (BioMerieux

Inc., Hazelwood, MO) following the manufacturers

instructions and were then suspended in trypticase soy

broth (TSB; Difco) containing 15% glycerol and

stored at 80 8C until used.

2.2. Antimicrobial susceptibility testing

Antimicrobial minimum inhibitory concentrations

(MICs) were determined using the sensititre auto-

mated antimicrobial susceptibility system in accor-

dance with the manufacturers instructions (Trek

Diagnostic Systems, Cleveland, OH). Initially, all

isolates were tested using a panel designed by the

National Antimicrobial Resistance Monitoring Sys-

tem (NARMS). This panel included ceftriaxone,

ceftiofur, amoxicillin/clavulanic acid, ampicillin,

cefoxitin, ciprofloxacin, naladixic acid, amikacin,

gentamicin, streptomycin, kanamycin, sulfamethox-

azole, trimethoprim/sulfamethoxazole, tetracycline,

and chloramphenicol. A panel containing only

fluoroquinolones was also tested, including ciproflox-

acin, levofloxacin, gatifloxacin, marbofloxacin, enro-

floxacin, difloxacin, and orbifloxacin. In addition, all

isolates were tested with a panel of b-lactamantimicrobials which included imipenem, merope-

nem, cefepime, piperacillin/tazobactam, ceftazidime,

ceftazidime/clavulanic acid, cefotaxime/clavulanic

acid, cefotaxime, ceftriaxone, cefoxitin, cefpodoxime,

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172166

ampicillin, cephalothin, and cefazolin. Results were

interpreted in accordance with CLSI interpretive

criteria with the exception of streptomycin (resistant

breakpoint 64 mg/ml). However, among these 32antimicrobials tested, not all had CLSI interpretive

criteria for P. aeruginosa. For those drugs that lacked

specific P. aeruginosa interpretive criteria, CLSI

breakpoints for the Enterobacteriaceae were used

(CLSI, 2004, 2006). Escherichia coli ATCC 25922,

Enterococcus faecalis ATCC 29212, Staphylococcus

aureus ATCC 29213 and P. aeruginosa ATCC 27853

were used as quality control organisms in the

antimicrobial MIC determinations.

2.3. Preparation of DNA template and

amplification of the quinolone resistance

determining regions (QRDRs) in gyrA, gyrB,

parC, and parE

Chromosomal DNA from 102 nalidixic acid-

resistant P. aeruginosa isolates was prepared by

suspending one loop full of bacteria in 500-ml distilledwater and boiling for 10 min, followed by centrifugation

for 30 s. PCR amplification of QRDR of the gyrA, gyrB,

parC, and parE genes was achieved using previously

described PCR primers and amplification conditions.

The primer sequences were listed in Table 1. The PCR

was performed in 50-ml volumes consisting of a200 mM of dNTP, 1.5 mM MgCl2, 1 U of gold Taq DNApolymerase, and 50 pmol of each primer. The PCR was

carried out using a PerkinElmer 9700 thermal cycler

(PerkinElmer, Foster City, CA) with an initial denatur-

ing cycle at 95 8C for 3 min; followed by 35 cycles at95 8C for 30 s, 55 8C (forgyrA and parC) or 60.0 8C (forgyrB and parE) for 30 s and 72 8C for 1 min; a final

Table 1

Primer sequences used to amplify the QRDRs of gyrA, gyrB, parC, parE

Name Sequence

gyrAF 50-AGTCCTATCTCGACTACGCGA TgyrAR 50-AGTCGACGGTTTCCTTTTCCAGgyrBF 50- GCGCGTGAGATGACCCGC CGTgyrBR 50- CTGGCGGTAGAAGAAGGTCAGparCF 50- CTGGAGCC GATTCCAAGCAC-parCR 5- GAAGGACTTGGGATCGTCCGG-

parEF 50CGGCGTTCGTCTCGGGCGTGGTparER 50- TCGAGGGCGTAGTAGATGTCC50-CS 50-GGCATCCAAGCACAAGC-30

30-CS 50-AAGCAGACTTGACTGAT-30

extension step at 72 8C for 7 min. The amplificationproducts were resolved by electrophoresis in a 1.0%

agarose gel and visualized under UV light.

2.4. DNA sequencing and analysis QRDR

PCR amplification products were purified using a

PCR purification kit (Boehringer Mannheim, India-

napolis, IN), and sequenced using an ABI automatic

DNA sequencer (Model 3700, Applied Biosystems),

at FDA/CVM laboratories, using the above described

forward and reverse primers. DNA sequences were

analyzed by comparison with published GenBank

DNA sequences (Accession numbers L29417,

AB00581, AB003428, and AB003429) using the

National Center for Biotechnology Information via the

BLAST network service. Alignment and comparison

of QRDR sequences were done using ClustalW,

Multiple Sequence Alignment Program (http://

www.ebi.ac.uk/clustalw/, European Bioinformatics

Institute (EBI), Cambridge, UK).

2.5. Screen and DNA sequence analysis of class 1

integrons

The presence of class 1 integrons was determined

using previously described PCR primers (Table 1). The

PCR was performed in the sameway as described above,

except the primer annealing temperature at 54 8C. Theamplified products were resolved by electrophoresis in a

1.0% agarose gel, and visualized under UV light. For

each set of PCR reactions, S. typhimurium CVM4499

and E. coli CVM 996 were included as positive and

negative controls, respectively. The DNA sequences of

amplified integrons were then analyzed by comparison

, and class 1 integron

Reference

-30 Akasaka et al., 2001-30 Akasaka et al., 2001-30 Mouneimne et al., 1999-30 Mouneimne et al., 1999

30 Mouneimne et al., 199930 Mouneimne et al., 1999GAAGGA-30 Akasaka et al., 2001TTGCCGA-30 Akasaka et al., 2001

Zhao et al., 2003

Zhao et al., 2003

http://www.ebi.ac.uk/clustalw/http://www.ebi.ac.uk/clustalw/

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172 167

to sequences in the GenBank database (Accession

number AJ620334) as described above.

3. Results

3.1. Antimicrobial susceptibility phenotypes

A total of 106 clinical isolates of P. aeruginosa were

tested for their susceptibility to 32 antimicrobial agents

Table 2

Antimicrobial resistance phenotypes of Pseudomonas aeruginosa isolated

Class and/or antimicrobial MIC range (mg/ml) Resistant b

b-Lactams

Amoxicillin/clavulanic acid 1/0.532/16 32/16Ampicillin 132 32Cefazolin 816 32Cefepime 116 32Cefotaxime 0.2564 64Cefotaxime/clavulanic acid 0.12/464/4 64Cefoxitin 0.564 32Cefpodoxime 0.2532 8Ceftazidime 0.25128 32Ceftazidime/clavulanic acid 0.12/4128/4 32Ceftiofur 0.128 8Ceftriaxone 0.25128 64Cephalothin 816 32Imipenem 0.516 16Meropenem 18 16Piperacillin/tazobactam 4/464/4 128/4

Quinolones and fluoroquinolones

Ciprofloxacin 0.01532 4Difloxacin 0.01532 4Enrofloxacin 0.01532 4Gatifloxacin 0.01516 8Levofloxacin 0.01532 8Marbofloxacin 0.01532 4Nalidixic Acid 0.532 32Orbifloxacin 0.01532 8

Aminoglycosides

Amikacin 0.564 64Gentamicin 0.2516 16Kanamycin 864 64Streptomycinb 3264 64

Sulfonamides and potentiated sulfonamides

Sulfisoxazole 16256 512Trimethoprim/sulfamethoxazole 0.12/2.384/76 4/76Tetracycline 432 16Chloramphenicol 232 32a MIC (mg/ml) determined via microdilution broth methods in accordan

2004; Clinical and Laboratory Standards Institute, 2006).b No CLSI breakpoint.

that are used in human and veterinary medicine. The

results of the susceptibility testing are shown in Table 2.

Among the b-lactam antimicrobials 100% resistancewas seen for ampicillin, cefazolin, cefoxitin, cepha-

lothin, and cefpodoxime, followed by 99% resistance to

amoxicillin/clavulanic acid, and 97% resistance to

ceftiofur. Moderate levels of resistance were seen to the

third generation cephalosporins: ceftriaxone, cefotax-

ime, cefotaxime/clavulanic acid with 39%, 26%, and

20% resistance, respectively. Cefepime, piperacillin/

from dogs (n = 106)

reakpoint (mg/ml)a Resistant strains (%) MIC50 MIC90

99 >32/16 >32/16

100 >32 >32

100 >16 >16

4 4 16

26 32 >64

20 >64/4 >64/4

100 >64 >64

100 >32 >32

6 2 8

7 4/4 16/4

97 >8 >8

39 32 >128

100 >16 >16

1 1 4

1 1 2

5 4/4 32/4

16 0.25 8

43 2 >32

31 1 32

23 2 16

16 0.25 8

27 1 16

96 >32 >32

52 8 >32

3 4 16

7 4 8

90 >64 >64

69 32 >64

51 >256 >256

57 4/76 >4/76

98 32 3

100 >32 >32

ce with CLSI standards (Clinical and Laboratory Standards Institute,

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172168

Table 3

Antimicrobial susceptibility profiles of fluoroquinolones and QRDR mutations

CVM # Antimicrobials (MIC mg/ml) QRDR genes

DIF ORB MAR ENR CIP LEV GAT GyrA GyrB ParC ParE

35819 >32 >32 >32 >32 >32 >32 >16 Thr83Ile Ser87Leu

35820 4 16 1 2 0.5 2 4 Val94Glu

35825 8 32 4 8 1 4 8 Asp87Tyr Val471Phe

35826 32 >32 8 16 4 8 8 Ser468Phe

35828 16 32 4 8 2 8 8 Thr83Ile Glu91Asp,

Ala92Ser

Glu459Lys

35832 16 32 4 8 2 4 8 Ser468Phe

35833 >32 >32 8 32 4 16 16 Ala53Thr

35840 16 32 8 8 2 8 8 Asp87Asn

35841 >32 >32 16 32 8 16 >16 Ser468Tyr

35850 >32 >32 32 >32 16 32 >16 Ser468Phe Tyr89Ser

35851 >32 >32 16 32 8 16 8 Thr83Ile

35852 32 >32 8 16 4 8 8 Thr83Ile Ala503Val

35856 16 >32 4 8 2 4 8 Ser468Phe

35857 >32 >32 16 >32 16 16 16 Thr83Ile

35858 8 16 4 8 2 4 4 Asp87Asn

35861 16 >32 8 8 2 8 8 Asp87Asn Ala473Val

35878 2 4 0.5 1 0.25 1 1 Ala473Thr

35883 2 4 0.5 1 0.25 0.5 1 His509Asp Ala473Val

35885 2 2 0.5 1 0.12 0.5 1 Met93Arg,

Val94Asp

35887 8 16 4 4 2 4 4 Asp87His Met93Arg

35888 16 32 4 8 2 4 8 Thr83Ile

35889 4 16 2 2 0.5 2 4 Asp490Tyr

35895 32 32 4 8 2 8 4 Thr83Ile

35896 >32 >32 >32 >32 >32 >32 >16 Thr83Ile,

Asp87Asn

Ser87Leu

35897 >32 >32 >32 >32 >32 >32 >16 Thr83Ile,

Asp87Gly

Ser87Leu Ala473Val

35903 >32 >32 32 >32 16 32 >16 Thr83Ile

35905 >32 >32 16 32 8 16 >16 Asp87Asn

35906 >32 >32 >32 >32 32 >32 >16 Thr83Ile,

Asp87Gly

Ser87Leu Ala473Val

35912 >32 >32 >32 >32 >32 >32 >16 Thr83Ile,

Asp87Gly

Ser87Leu Ala473Val

35913 >32 >32 >32 >32 >32 >32 >16 Thr83Ile,

Asp87Gly

Ser87Leu Ala473Val

35916 1 2 0.5 0.5 0.06 0.25 0.5 Arg442Ser

35918 2 8 1 2 0.25 1 2 Lys64Thr

35921 32 >32 8 8 4 8 8 Thr83Ile

35926 2 4 0.5 1 0.12 0.5 0.5 Ala473Val

Note: DIF, difloxacin; ORB, orbifloxacin; MAR, marbofloxacin; ENR, enrofloxacin; CIP, ciprofloxacin; LEV, levofloxacin; GAT, gatifloxacin;

Ala, alanine; Thr, threonine; Lys, lysine; Ile, isoleucine; Asp, aspartic acid; Asn, asparagine; Ser, serine; Leu, leucine; Gly, glycine; Val, valine;

Glu, glutamic acid; Lys, lysine; Tyr, tyrosine; Phe, phenylalanine; His, histidine; Met, methionine; Arg, arginine.

tazobactam, ceftazidime, and ceftazidime/clavulanic

acid had under 7% resistance. The carbapenems

(imipenem and meropenem) exhibited the greatest

anti-pseudomonas activity with a single isolate being

resistant to imipenem and another to meropenem.

For the quinolones and fluoroquinolones tested the

most resistance was seen with nalidixic acid (96%)

followed by orbifloxacin (52%), difloxacin (43%),

enrofloxacin (31%), marbofloxacin (27%), gatiflox-

acin (23%), and levofloxacin (21%). Ciprofloxacin

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172 169

had the greatest activity against Pseudomonas isolates

with 16% of isolates being resistant.

Among the aminoglycosides, most isolates were

resistant to kanamycin (90%) and streptomycin

(69%). Low levels of resistance were seen to

gentamicin (7%) and amikacin (3%). Of the remaining

antimicrobials tested 100% of the isolates were

resistant to chloramphenicol, 98% to tetracycline,

57% to trimethoprim/sulfamethoxazole, and 51% to

sulfisoxazole.

Susceptibility patterns varied greatly. On average

the isolates were resistant to 16 of 32 antimicrobials

with a range of 8 (n = 1) to 28 (n = 2). This included

those antimicrobial agents to which P. aeruginosa is

intrinsically resistant to, e.g. benzylpenicillins, ami-

nobenzylpenicillins, carboxypenicillins, first and

second generation cephalosporins, chloramphenicol,

and tetracycline. Of particular interest was an isolate

resistant to all antimicrobials with the exception of

sulfisoxazole, trimethoprim/sulfamethoxazole and the

carbapenems. Three isolates that were resistant to all

b-lactams with the exception of carbapenems and twoisolates resistant to carbapenems (one resistant to

imipenem, one to meropenem) were also identified.

This study demonstrated that canine isolates of P.

aeruginosa were frequently resistant to the antimi-

crobial agents most commonly used in veterinary

medicine including the fluoroquinolones.

3.2. QRDR mutations

Of 102 naladixic acid resistant isolates, 34 had

QRDR mutations in one or more of the genes analyzed

(Table 3.). Of the 22 altered gyrA sequences, 20 isolates

had mutations at the Thr 83 and/or Asp 87 positions.

These isolates were all resistant to difloxacin,

orbifloxacin, marbofloxacin, and enrofloxacin. The

MICs for ciprofloxacin, levofloxacin, and gatifloxacin

for these isolates were above the MIC50. Two isolates

had gyrA mutations outside the hotspots, at Ala 53

and Lys 64. The isolate with the Ala 53 mutation

showed resistance to all fluoroquinolones, the strain

with Lys 64 mutation was only resistant to orbifloxacin

with decreased susceptibility to the other fluoroquino-

lones. Nine isolates had gyrB mutations; five occurring

at Ser 468 with the remaining four located at Val 471,

Arg 442, Asp 490 and His 509, respectively. Of the 11

isolates with parC mutations, 6 occurred at Ser 87; all of

which had MICs above the highest tested concentration

for all fluoroquinolones. These 6 isolates also had gyrA

hot spot mutations. The remaining five isolates had

parC mutations at Tyr 89, Glu 91 and Ala 92, Met 93,

Met 93 and Val 94, and Val 94. Ten isolates had

mutations on the parE gene occurring at Ala 473, Glu

459, and Ala 503. With the exception of one, all isolates

resistant to ciprofloxacin contained QRDR mutations.

There was a high correlation between QRDR mutations

and increased fluoroquinolone MICs (Table 3). High

level fluoroquinolone resistance was seen, particularly

in isolates with both gyrA and parC mutations. There

were, however, a number of isolates with decreased

fluoroquinolone susceptibility without QRDR muta-

tions.

3.3. Class 1 integrons

Class 1 integrons were amplified from two isolates,

and subsequently sequenced. Sequence analysis

revealed that both 1 kb fragments encoded aadA, a

gene conferring resistance to streptomycin and

spectinomycin. Phenotypically, these isolates had

MICs of >64 mg/ml to streptomycin. Additionally,as class 1 integrons are flanked by sulfa resistance

genes, MICs to sulfamethoxazole of >256 mg/mlwere noted (Hall, 1997).

4. Discussion

P. aeruginosa is an opportunistic bacterial patho-

gen that is well known for its intrinsic and acquired

resistance and ability to cause serious infections in

animals. Consistent with its reputation of being

resistant to many antimicrobial agents the isolates

tested in this study were resistant to between 8 and 28

drugs with a mean of 16. These isolates were all

resistant to multiple compounds, including intrinsic

resistant antimicrobial agents as well as acquired

resistance to newer synthetic antimicrobial agents that

are commonly used in canine therapies. However,

while some highly resistant isolates were identified,

none met the criteria of multidrug-resistant P.

aeruginosa (MDRPA) (Gales et al., 2001; Para-

mythiotou et al., 2004) which is defined as resistance

to piperacillin, ceftazidime, imipenem, and gentami-

cin. Highly variable susceptibility profiles were noted

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172170

among these isolates, for example, some isolates were

resistant to the aminoglycosides (amikacin, gentami-

cin, kanamycin, and streptomycin) while susceptible

to the fluoroquinolones and vice versa. As would be

expected, the first generation cephalosporins, amino-

benzylpenicillins, and potentiated amoxycillin, which

are commonly used in veterinary medicine (Prescott

et al., 2002), had no activity against the isolates tested

in this study.

The results presented in this study are consistent

with those presented elsewhere on the P. aeruginosas

highly variable resistance patterns (Gales et al., 2001).

These studies underlined the importance of perform-

ing antimicrobial susceptibility tests on this bacterial

pathogen. However, perhaps due to less selective

pressure, resistances to anti-pseudomonal drugs are

lower in veterinary isolates than in human clinical

isolates (Paramythiotou et al., 2004; Prescott et al.,

2002). For example, in one canine study an MIC90 of

2 mg/ml was reported for ciprofloxacin (Tejedor et al.,2003), while a study on human MDRPA revealed

30.2% resistance (MIC 4 mg/ml) to the same drug(Paramythiotou et al., 2004). In the current study, 16%

of isolates showed resistance to ciprofloxacin

(MIC 4 mg/ml), although the MIC90 is 8 mg/ml.Paramythiotou et al. (2004) also found 21.9%, 23.5%,

and 55.9% resistance to ceftazidime, imipenam and

piperacillin, respectively, compared to 6%, 1%, and

5%, respectively in this study. It has been postulated

that MDRPA is most likely selected for by the use of

antimicrobials with specific anti-pseudomonal activ-

ity; therefore, these drugs should be reserved for cases

where other treatment options are not available

(Paramythiotou et al., 2004). In our study, imipe-

nem/meropenem, amikacin, cefepime and piperacil-

lin/tazobactam had the most conserved activity with

1%, 3%, 4%, and 5% resistance, respectively. The b-lactams tested here with the most anti-pseudomonal

activity, are not labeled for use in veterinary medicine

(CLSI, 2004; Health Canada, 2007, www.hc-sc.ga.ca/

dhp-mps/prodpharma/databasdon/index_e.html.)

highlighting the lack of registered effective veterinary

anti-pseudomonal drugs. Of the fluoroquinolones, the

least isolates were resistant to ciprofloxacin 16%,

while 27% were resistant to marbofloxacin, the most

active of the veterinary labeled fluoroquinolones. It is

important for veterinarians to know that many of the

available anti-pseudomonal drugs are also key drugs

in the treatment of human infections, so that restricted

use of these drugs would help to prolong the

effectiveness of these drugs in treating human

infections.

With detection in only two isolates, the relative lack

of class 1 integrons was surprising. These genetic

elements have been found to be common in

Enterobacteriaceae from dogs and other domestic

species (Goldstein et al., 2001; van Duijkeren et al.,

2005). In one study 82% of Enterobacteriaceae from

horses and dogs contained class 1 integrons, suggest-

ing an important role in the dissemination of

antimicrobial resistance (van Duijkeren et al., 2005)

and another study documented class 1 integrons in the

flora of wild animals (Goldstein et al., 2001). To the

best of our knowledge, class 1 integrons have never

been reported in P. aeruginosa isolated from dogs.

Class 1 integrons are commonly found in human

isolates of P. aeruginosa with a prevalence of 40.8

63.5% (Fonseca et al., 2005; Gu et al., 2007). Both

integrons characterized here contained the aadA gene,

which is commonly identified in P. aeruginosa

isolated from human infections (Gu et al., 2007).

In the present study 102 of 106 isolates were

resistant to naladixic acid, but only 34 of the isolates

had QRDR mutations. Since first step mutations

commonly occur in the gyrA or gyrB genes (Hooper,

1999), we expected a higher portion of mutants in the

naladixic acid resistant sub-population. Additionally,

in one study 100% of Shigella dysenteriae that were

naladixic acid resistant had gyrA mutations (Talukder

et al., 2006). Furthermore, one isolate resistant to

ciprofloxacin contained no QRDR mutations. Despite

this, a strong association appeared to exist between the

gyrA mutation Thr 83-Ile, the parC mutation Ser 87-

Leu and high levels of resistance to all fluoroquino-

lones tested. However, due to the lower than expected

prevalence of QRDR mutations, other mechanisms of

resistance are likely involved. Such mechanisms

include: porin deficiencies (decreased drug entry to

cell), increased efflux pumps (removal of drug prior to

target contact) and plasmid mediated (protection of

drug targets) (Martinez et al., 2006; Li, 2005).

The emergence of antimicrobial resistance in

Gram-negative pathogens will continue to pose

therapeutic challenges in both human and veterinary

medicine. Further research defining the relationship

between specific therapies and the development of

http://www.hc-sc.ga.ca/dhp-mps/prodpharma/databasdon/index_e.htmlhttp://www.hc-sc.ga.ca/dhp-mps/prodpharma/databasdon/index_e.html

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172 171

resistance to anti-pseudomonal antimicrobials would

be useful. The present study indicated that in dog,

infections caused by resistant to anti-pseudomonal

antimicrobials of P. aeruginosa are occurring at

different levels. The findings stress the need for

continued monitoring of antimicrobial resistance

among animal bacterial pathogens and the value of

laboratory antimicrobial susceptibility testing as the

basis for clinical treatment decisions.

Acknowledgments

We would also like to thank Mr. Donald Bade,

Microbial Research, Fort Collins, CO, and Dr. Dave

Bemis from the University of Tennessee for providing

some of the clinical isolates used in this study.

References

Akasaka, T., Tanaka, M., Yamaguchi, A., Sato, K., 2001. Type II

topoisomerase mutations in flouroquinolone-resistamt clinical

strains of Pseudomonas aeruginosa isolated in 1998 and 1999:

role of target enzyme in mechanism of fluoroquinolone resis-

tance. Antimicrob. Agents Chemother. 45, 22632268.

Cole, L.K., Luu, D.H., Rajala-Schultz, P.J., Meadows, C., Torres,

A.H., 2006. In vitro activity of an ear rinse containing trometha-

mine, EDTA, and benzyl alcohol on bacterial pathogens from

dogs with otitis. Am. J. Vet. Res. 67, 10401044.

CLSI, 2004. Performance standards for antimicrobial disk

and dilution susceptibility tests for bacteria isolated from

animals, informational supplement. CLSI/NCCLS document

M31-S1. Clinical and Laboratory Standards Institute, Wayne,

PA.

CLSI, 2006. Performance standards for antimicrobial susceptibility

testing, sixteenth informational supplement. CLSI/NCCLS

ducument M100-S16. Clinical and Laboratory Standards Insti-

tute, Wayne, PA.

Fonseca, E.L., Vieira, V.V., Cipriano, R., Vicente, A.C.P., 2005.

Class 1 integrons in Pseudomonas aeruginosa isolates from

clinical settings in Amazon region, Brazil. FEMS Immunol.

Med. Microbiol. 44, 303309.

Gales, A.C., Jones, R.N., Turnidge, J., Rennie, R., Ramphal, R.,

2001. Characterization of Pseudomonas aeruginosa isolates:

occurrence rates, antimicrobial susceptibility patterns, and

molecular typing in the global SENTRY antimicrobial surveil-

lance program, 19971999. Clin. Infect. Dis. 32 (Suppl. 2), 146

155.

Gatoria, I.S., Saini, N.S., Rai, T.S., Dwivdei, P.N., 2006. Compar-

ison of three techniques for the diagnosis of urinary tract

infections in dogs with urolithiasis. J. Small Anim. Pract. 47,

727732.

Goldstein, C., Lee, M.D., Sanchez, S., Hudson, C., Phillips, B.,

Register, B., Grady, M., Liebert, C., Summers, A.O., White,

D.G., Maurer, J.J., 2001. Incidence of class 1 and 2 integrases in

clinical and commensal bacteria from livestock, companion

animals, and exotics. Antimicrob. Agents Chemother. 45,

723726.

Gu, B., Tong, M., Zhao, W., Liu, G., Ning, M., Pan, S., Zhao, W.,

2007. Prevalence and characterization of class 1 integrons

among Pseudomonas aeruginosa and Acinetobacter baumannii

isolates from patients in Nanjing, China. J. Clin. Microbiol. 45,

241243.

Hall, R.M., 1997. Mobile gene cassettes and integrons: moving

antibiotic resistance genes in Gram-negative bacteria. Ciba

Found. Symp. 207, 192202.

Hall-Stoodley, L., Costerton, J.W., Stoodley, P., 2004. Bacterial

biofilms: from the natural environment to infectious diseases.

Nat. Rev. Microbiol. 2, 95108.

Hariharan, H., Coles, M., Poole, D., Lund, L., Page, R., 2006.

Update on antimicrobial susceptibilities of bacterial isolates

from canine and feline otitis externa. Can. Vet. J. 47, 253255.

Health Canada, 2007. Therapeutic Products Directorate: Drug Pro-

duct Database (DPD). www.hc-sc.ga.ca/dhp-mps/prodpharma/

databasdon/index_e.html (accessed February 21, 2007).

Hillier, A., Alcorn, J.R., Cole, L.K., Kowalski, J.J., 2006. Pyoderma

caused by Pseudomonas aeruginosa infection in dogs20

cases. Vet. Dermatol. 17, 432439.

Hooper, D.C., 1999. Mode of action of fluoroquinolones. Drugs 58

(Suppl. 2), 610.

Jalal, S., Ciofu, O., Hoiby, N., Gotoh, N., Wretlind, B., 2000.

Molecular mechanisms of fluoroquinolone resistance in Pseu-

domonas aeruginosa isolates from cystic fibrosis patients. Anti-

microb. Agents Chemother. 44, 710712.

Li, X., 2005. Quinolone resistance in bacteria: emphasis on plasmid-

mediated mechanisms. Int. J. Antimicrob. Agents 25, 453463.

Li, X., Livermore, D.M., Nikaido, H., 1994. Role of efflux pump(s)

in intrinsic resistance of Pseudomonas aeruginosa: resistance to

tetracycline, chloramphenicol and norfloxacin. Antimicrob.

Agents Chemother. 28, 17321741.

Linder, J.A., Huang, E.S., Steinman, M.A., Gonzalas, R., Stafford,

R.S., 2005. Fluoroquinolone prescribing in the United States:

1995 to 2002. Am. J. Med. 118, 259268.

Martinez, M., McDermott, P., Walker, R., 2006. Pharmacology of

the fluoroquinolones: a perspective for the use in domestic

animals. Vet. J. 172, 1028.

Mouneimne, H., Robert, J., Jarlier, V., Cambau, E., 1999. Type II

topoisomerase mutations in ciprofloxacin-resistant strains of

Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 43,

6266.

Nikaido, H., 1994. Prevention of drug access to bacterial targets:

permeability barriers and active efflux. Science 264, 382

388.

Paramythiotou, E., Lucet, J.C., Timsit, J.F., Vanjak, D., Paugam-

Burtz, C., Trouillet, J.L., Belloc, S., Kassis, N., Karabinis, A.,

Andremont, A., 2004. Acquisition of multidrug-resistant Pseu-

domonas aeruginosa in patients in intensive care units: role of

antibiotics with antipseudomonal activity. Clin. Infect. Dis. 38,

670677.

http://www.hc-sc.ga.ca/dhp-mps/prodpharma/databasdon/index_e.htmlhttp://www.hc-sc.ga.ca/dhp-mps/prodpharma/databasdon/index_e.html

J. Rubin et al. / Veterinary Microbiology 131 (2008) 164172172

Pirnay, J., De Vos, D., Cochez, C., Bilocq, F., Pirson, J., Struelens,

M., Duinslaeger, L., Cornelis, P., Zizi, M., Vanderkelen, A.,

2003. Molecular epidemiology of Pseudomonas aeruginosa

colonization in a burn unit: persistence of a multidrug-resistant

clone and a silver sulfadiazine-resistant clone. J. Clin. Micro-

biol. 41, 11921202.

Prescott, J.F., Hanna, W.J.B., Reid-Smith, R., Drost, Kelli., 2002.

Antimicrobial drug use and resistance in dogs. Can. Vet. J. 43,

107116.

Talukder, K.A., Khajanchi, B.K., Islam, M.A., Islam, Z., Dutta,

D.K., Rahman, M., Watanabe, H., Nair, G.B., Sack, D.A., 2006.

Fluoroquinolone resistance linked to both gyrA and parC muta-

tions in the quinolone resistance-determining region of Shigella

dysenteriae Type 1. Curr. Microbiol. 52, 108111.

Tejedor, M.T., Martin, J.L., Navia, M., Freixes, J., Vila, J., 2003.

Mechanisms of fluoroquinolone resistance in Pseudomonas

aeruginosa isolates from canine infections. Vet. Microbiol.

94, 295301.

van Duijkeren, E., Box, A.T.A., Schellen, P., Houwers, D.J., Fluit,

A.C., 2005. Class 1 integrons in Enterobacteriaceae isolated

from clinical infections of horses and dogs in the Netherlands.

Microb. Drug Resist. 11, 383386.

Zhao, S., Qaiyumi, S., Freidman, F., Singh, R., Foley, S.L.,

White, D.G., McDermott, P.F., Donkar, T., Bolin, C., Munro,

S., Baron, E.J., Walker, R.D., 2003. Characterization

of Salmonella enterica serotype Newport isolated from

humans and food animals. J. Clin. Microbiol. 41, 5366

5371.

Antimicrobial resistance and genetic characterization of fluoroquinolone resistance of Pseudomonas aeruginosa isolated from canine infectionsIntroductionMaterials and methodsBacterial strainsAntimicrobial susceptibility testingPreparation of DNA template and amplification of the quinolone resistance determining regions (QRDRs) in gyrA, gyrB, parC, and parEDNA sequencing and analysis QRDRScreen and DNA sequence analysis of class 1 integronsResultsAntimicrobial susceptibility phenotypesQRDR mutationsClass 1 integronsDiscussionAcknowledgmentsReferences