Insights Into Native Epitopes of Proliferating Cell Nuclear Antigen ...
Prox1 Identifies Proliferating Neuroblasts and Nascent ...Prox1 Identifies Proliferating...
Transcript of Prox1 Identifies Proliferating Neuroblasts and Nascent ...Prox1 Identifies Proliferating...
Prox1 Identifies Proliferating Neuroblasts andNascent Neurons during Neurogenesis inSympathetic Ganglia
Julia Holzmann,1 Melanie Hennchen,1 Hermann Rohrer1,2
1 Max-Planck-Institute for Brain Research; Research Group Developmental Neurobiology,Max-von-Laue-Str. 4, 60438 Frankfurt/Main, Germany
2 Institute of Clinical Neuroanatomy, Goethe-University Frankfurt, Theodor-Stern-Kai 7,Frankfurt/Main, Germany
Received 20 February 2015; accepted 12 March 2015
ABSTRACT: Neurogenesis in embryonic sympa-
thetic ganglia involves neuroblasts that resume prolifera-
tion following neuronal differentiation. As cell cycle exit
is not associated with neuronal differentiation, the iden-
tity of proliferating neuroblasts is incompletely under-
stood. Here, we use sympathetic ganglia of chick
embryos to define the timing of neurogenesis and neuro-
blast identity focusing on the expression and function of
the transcription factor Prox1. We show that a large
fraction of neuroblasts has initially withdrawn from the
cell cycle at embryonic day 3 (E3), which is reflected by a
high proportion of p271/Islet1
1neuroblasts (63%) and
low numbers of EdU1
/Islet11
cells (12%). The propor-
tion of proliferating Islet11
neuroblasts, identified by
EdU pulse labeling and by the absence of the postmitotic
marker p27 increases to reach maximal levels at E5,
when virtually all neuroblasts are in the cell cycle (95%).
Subsequently, the proportion of EdU-labeled and p272
neuroblasts is reduced to reach low levels at E11. Inter-
estingly, the expression of the transcription factor Prox1
is restricted to the neuronal lineage, that is, Sox101/
Phox2b1 neuron progenitors, proliferating p272/Islet11
neuroblasts and nascent neurons but is rapidly lost in
postmitotic neurons. In vitro and in vivo knockdown and
overexpression experiments demonstrate effects of Prox1
in the support of neuroblast proliferation and survival.
Taken together, these results define the neurogenesis
period in the chick paravertebral sympathetic ganglia
including an initial cell cycle withdrawal and identify
Prox1 as a marker and regulator of proliferating
sympathetic neuroblasts. VC 2015 Wiley Periodicals, Inc. Develop
Neurobiol 75: 1352–1367, 2015
Keywords: sympathetic; neurogenesis; Prox1; prolifera-
tion; neuroblast
INTRODUCTION
Neurons are generated during neurogenesis from neu-
ral stem and progenitor cells. In most parts of the
nervous system proliferation, cell cycle exit and pro-
genitor differentiation are integrated into a coherent
developmental program, which ensures the genera-
tion of appropriate numbers of neuronal subtypes
(Nguyen et al., 2006; Centanin and Wittbrodt, 2014;
Taverna et al., 2014). In strong contrast, differentia-
tion is not linked to withdrawal from the cell cycle
during the generation of sympathetic neurons and
adrenal chromaffin cells (Rohrer, 2011). Sympathoa-
drenal progenitors in the anlagen of sympathetic gan-
glia and adrenal medulla continue to proliferate after
acquisition of neuronal characteristics (Rothman
et al., 1978; Rohrer and Thoenen, 1987; Gonsalvez
Correspondence to: H. Rohrer ([email protected]).Contract grant sponsor: Wilhelm-Sander-Stiftung (to H.R.);
contract grant number: 2010.004.1/2.� 2015 Wiley Periodicals, Inc.Published online 20 June 2015 in Wiley Online Library (wileyonli-nelibrary.com).DOI 10.1002/dneu.22289
1352
et al., 2013). Thus, the majority of postmitotic neu-
rons are generated from proliferating immature sym-
pathetic neurons termed neuroblasts. The observation
that tumors of the developing PNS are restricted to
sympathetic ganglia and the adrenal medulla (neuro-
blastoma) suggests that termination of neurogenesis
may be less tightly controlled when it is not linked to
differentiation (Maris et al., 2007; Cheung and Dyer,
2013). How neuroblast proliferation is controlled dur-
ing normal development and which signals may lead
to aberrant growth and neuroblastoma development
remains the focus of active investigation (Chesler
and Weiss, 2011; Reiff et al., 2011; Molenaar et al.,
2012; Cazes et al., 2014)
The homeodomain transcription factor Prox1 is
expressed in neuroblastoma and shows antiprolifera-
tive effects in neurobastoma cell lines, implicating a
function in the regulation of sympathetic neurogene-
sis (Becker et al., 2010; Foskolou et al., 2012). Prox1
is the vertebrate homologue of prospero, a key regu-
lator of neurogenesis in the Drosophila central nerv-
ous system (Doe et al., 1991; Myster and Duronio,
2000). Prospero is transiently expressed in neuro-
blasts and ganglion mother cells (GMCs) where it
induces differentiation and represses neuroblast-
specific and cell cycle genes (Hirata et al., 1995;
Choksi et al., 2006). In the absence of prospero, stem
cell-like cells accumulate (Betschinger et al., 2006).
In the developing vertebrate CNS, Prox1 is also tran-
siently expressed in progenitors of the embryonic tel-
encephalon, hippocampus, spinal cord, and retina and
in the external granular layer of the postnatal cerebel-
lum. Prox1 is not detected in nestin1, Sox21 neural
stem cell/progenitor cells of the ventricular zone but
marks subventricular zone (SVZ) cells during or
immediately after withdrawal from the cell cycle
(Torii et al., 1999; Lavado and Oliver, 2007; Misra
et al., 2008). Loss- and gain-of-function approaches
demonstrated essential functions for Prox1 in neuron
differentiation and maturation and in the survival of
intermediate progenitors (Dyer et al., 2003; Misra
et al., 2008; Kaltezioti et al., 2010; Lavado et al.,
2010; Karalay et al., 2011). With respect to progeni-
tor proliferation different effects were observed in
distinct neuronal lineages. In Prox1-deficient retina
the number of proliferating progenitors increased
(Dyer et al., 2003), implying an anti-proliferative
Prox1 function, whereas progenitor proliferation was
not affected by Prox1 knockdown in the dentate neu-
roepithelium (Karalay et al., 2011) and in the neural
tube (Misra et al., 2008). In the latter system, Prox1
is also not expressed in proliferating BrdU1 cells
(Misra et al., 2008; Kaltezioti et al., 2010). Thus, the
timing of expression with respect to cell cycle exit
and the function of Prox1 is context dependent and
varies between different neuronal lineages.
Here, we have analyzed the expression of Prox1 in
developing sympathetic ganglia, using the chick
embryo for high resolution of embryonic develop-
ment. Prox1 expression is restricted to the neuronal
lineage and is initiated in Sox101/Phox2b1 sympa-
thetic neuron progenitors. Subsequently, Prox1 is
observed in proliferating neuroblasts and is rapidly
lost in nascent postmitotic neurons identified by the
expression of p27. Neurogenesis in chick sympathetic
ganglia involves an initial phase at embryonic day 3
(E3) with a large fraction of neuroblasts that have
withdrawn from the cell cycle, followed by a peak in
proliferation at E5 when virtually all neuroblasts are
cycling and a decline of neurogenesis to reach back-
ground levels at E11. These findings establish Prox1
as a marker for neuroblasts in the cell cycle and nas-
cent neurons. Overexpression and knockdown results
implicate functions for Prox1 in the maintenance of
neuroblast proliferation and survival rather than in
cell cycle exit.
METHODS
Animals, Tissue Fixation, and Sectioning
Developmental stages of chicken embryos were determined
according to Hamburger Hamilton (Hamburger and Hamil-
ton, 1951). Embryos (HH 19–HH 38) were fixed in 4%
paraformaldehyde in 0.1 M sodium phosphate buffer for
short time periods, between 13 min and 120 min, depending
on embryonic stage. The fixative was replaced by 15%
sucrose in 0.1 M sodium phosphate buffer overnight. For
immunostaining, cryosections of 14 mm were prepared at
thoracic level. Chick embryos that are referred to as E3 and
E5 are at HH 21 and HH 27, respectively. In the dataset
shown in Figure 1, E3 and E5 embryos were staged as HH
19 and HH 26, respectively.
Immunostaining
Sections were washed for 10 min with PBS, treated with
blocking buffer (10% fetal calf serum, 0.5% or 2% Tri-
tonX100 in PBS) for 1 h and incubated overnight at 4�C in
blocking buffer. After repeated washing steps (PBS with
0% or 0.2% TritonX100) secondary antibodies were added
for 1–3 h at room temperature in blocking buffer. Stained
sections were coverslipped after washing with PBS/
0.2%TritonX100 and/or PBS. Detection of Prox1 was
enabled using a rabbit polyclonal Prox1 antibody (102-
PA32; 1:300; ReliaTech, Wolfenb€uttel, Germany) or by a
mouse monoclonal antibody (MAB5654; 1:500; Millipore,
Schwalbach, Germany). Antibodies against Islet1 (1:20;
39.4D5, and 1:50; 40.2D6) and gag (1:50; AMV-3C2) were
Prox1 in Sympathetic Neurogenesis 1353
Developmental Neurobiology
both mouse monoclonal and obtained at Developmental
Studies Hybridoma Bank (Iowa City, IA). Sox10 antibody
(1:500; rabbit, polyclonal) was purchased from Abcam
(Cambridge, England) and Phox2b (1:50; H-20, goat, pol-
yclonal) from Santa Cruz Biotechnology (Dallas, TX).
P27kip antibody (1:500; mouse, monoclonal) was
obtained from BD Transduction Laboratories (Heidelberg,
Germany). The TH mouse monoclonal antibody was gen-
erated and characterized previously (Rohrer et al., 1986;
Bonnefoy et al., 1988). The secondary antibodies were
labeled with Alexa488, Alexa546, Alexa647, and Cy3.
Subtype specific secondary antibodies goat anti-mouse
IG1, goat anti-mouse IG2a, and goat anti-mouse IG2b
were used for double staining with two mouse primary
antibodies (1:500; Life technologies, Karlsruhe, Ger-
many). Cell nuclei were visualized with DAPI (Sanofi
Aventis, Frankfurt, Germany).
Quantification of p27, Prox1, and Islet1Expressing Cells
To quantify the cellular composition of sympathetic gan-
glia at E5, E7, E9, and E11, double staining for Islet1 and
Prox1, Islet1 and p27, and Prox1 and p27 were performed
and quantified. At E5, E7, and E9 �97% of Prox1-positive
cells in sympathetic ganglia co-express Islet1. At E11, this
is the case for 93% of all Prox1-positive cells. For simplic-
ity, it was assumed that all Prox1 cells co-express Islet1.
The proportion of Islet1, Prox1, and p27 cells was calcu-
lated as detailed in the following. The percentage of Islet1
cells that co-express Islet1, Prox1, and p27 [Fig. 5(B), red
bar] is obtained by multiplying the percentage of Prox11
cells co-expressing p27 (Prox11p271/Prox11) with the
proportion of Islet11 cells co-expressing Prox1
(Islet1Prox11/Islet11). The population of Islet11/ p271
cells [Fig. 5(B) blue bar] was calculated by subtracting the
proportion of cells that co-express Islet1, Prox1, and p27
(red bar) from the proportion of Islet1 and p27 double pos-
itive cells (Islet11p271/Islet11). Likewise, the percentage
of Islet1 and Prox1-positive cells [Fig. 5(B), yellow bar]
results from subtracting the proportion of cells that
express Islet1, Prox1, and p27 (red bar) from the quanti-
fied proportion of Islet1 and Prox1 double positive cells
(Islet11Prox11/Islet11). The population of Islet1 cells
that neither co-express Prox1 nor p27 is calculated by sub-
tracting the yellow, blue, and red bar from the proportion
of total Islet1-positive cells (100%). Error bars (mean-
6 sem) were calculated according to Gaussian error
propagation.
Proliferation Analysis In Vivo
To visualize proliferating cells, chicken embryos were
pulsed with EdU (500 mL, 500 mM EdU in PBS) for 4 h.
The EdU signal was detected using the Click-iTVR EdU
Alexa FluorVR 647 Imaging Kit (Life technologies, Karls-
ruhe, Germany) according to manufacturer’s protocol.
For double staining with Prox1 antibody (mouse,
monoclonal), immunostaining was performed before the
detection of EdU-positive cells. To determine the propor-
tion of Prox1/EdU double positive cells within the Islet1/
EdU double positive population [Fig. 6(B)], the propor-
tion of Prox1/EdU double positive cells (Prox11EdU1/
Prox11) was multiplied with the population of Prox1
Islet1 double positive cells (Islet11Prox11/Islet11),
which was established in a previous analysis (Fig. 2).
Error bars were calculated according to Gaussian error
propagation.
Figure 1 Islet1 is an early marker for the sympathetic neu-
ron lineage. (A) Double-immunostaining for Islet1/Sox10
and Islet1/TH in sections of E3 (HH 19) and E5 (HH 26)
sympathetic ganglia. Islet1 and Sox10 are expressed in non-
overlapping populations at E5. At E3, a very low propor-
tion of Sox101/Islet11 cells is detected (arrowhead). Islet1
and TH are co-expressed in the vast majority of E5 gan-
glion cells, whereas most Islet11 cells are devoid of TH-
immunoreactivity at E3. (B) Quantification of Islet11/TH1,
Islet11/TH2, and Islet12/TH1 cells at E3 (HH 19), E4
(HH 24), and E5 (HH 26) (mean 6 sem; n 5 3). Scale bars
20 mm. [Color figure can be viewed in the online issue,
which is available at wileyonlinelibrary.com.]
1354 Holzmann et al.
Developmental Neurobiology
qRT-PCR on Ciliary Ganglia
qPCR analyses were performed as previously described
(Huber et al., 2012). At least triplets of every condition
were performed in parallel. GAPDH was used as reference
gene. Data were evaluated using the delta-delta Ct-method.
Experiments were repeated independently three times and
statistically analyzed using unpaired two-tailed Student’s t-test. Primer pairs were analyzed for efficiency (�95%) and
used for quantitative analyses. Prox1 for: CATTCAGATG-
GAGAA; Prox1 rev: TGGAACCTGCTCAAA; GAPDH
for: ATCCTAGGATACACAGAGGAC; GAPDH rev:
ATTGTCATACCAGGAAACAAGC
Primary Sympathetic Neuron CulturePreparation and Transfection
Embryonic paravertebral lumbosacral sympathetic gan-
glia were gathered from embryonic day 7 (E7) chicken
embryos and dissociated as previously described (Rohrer
and Thoenen, 1987; Zackenfels et al., 1995). For electro-
poration an Amaxa Basic Neuron Small Cell Number
(SCN) Nucleofector Kit was used according to manufac-
turer’s protocol (400.000 cells, Program: SCN #2, trans-
fection efficiency � 50%). pmax-GFP of 0.5 mg (Lonza,
Cologne, Germany) was mixed with either 0.5 mg
pCAGGS (control), 0.16 mg pCAGGS-Prox1, or 0.5 mg
dsRed-shProx1. Transfected cells were plated on poly-
DL-ornithin/laminin-coated 4-well culture dishes and cul-
tured for 2 days in MEM, 10% horse serum, 5% FCS,
1% glutamine, 1% penicillin, and 1% streptomycine at
37�C and 5% CO2. EdU was added to the culture
medium 24 h before fixation (1:1000, Life technologies,
Karlsruhe, Germany). Cells were fixed with 4% paraformal-
dehyde for 15 min and stained using the Click-iTVR EdU
Alexa FluorVR 594 Imaging Kit (Life technologies,
Karlsruhe, Germany) according to manufacturer’s protocol.
Plasmids contain the coding sequence of mouse Prox1 and a
shProx1 construct (described in Kaltezioti et al., 2010),
respectively, and were kindly provided by P. Politis
(Biomedical Research Foundation, Athens, Greece).
Overexpression and Knockdown ofProx1 In Vivo
For virus infections, replication-competent avian sarcoma
(RCAS) constructs containing a mouse Prox1 coding
sequence (RCAS-BP(B)-Prox1) and a shProx sequence
(RCAS-BP(A)-shProx1) were designed. The RCAS vector
was used and modified as described previously (Tsarovina
et al., 2004). Insert sequences were extracted from
pCAGGS-Prox1 and dsRed-shProx1 plasmids, which were
kindly provided by P. Politis (Biomedical Research Foun-
dation, Athens, Greece). Fertilized virus and pathogen free
eggs (Charles River, Sulzfeld, Germany) were incubated
and infected with empty RCAS virus for control, RCAS-
Prox1 or RCAS-shProx1 virus concentrate as described
(R€udiger et al., 2009). Embryos were kept until stage St26/
27 or St30/31, pulsed with EdU (500 mL, 500 mM EdU in
PBS) for 4 h and fixed in 4% paraformaldehyde.
Figure 2 Prox1 expression during sympathetic ganglion
development. (A) The proportion of Islet11 neuroblasts that
express Prox1 was determined by double-immunostaining
on frozen sections of E3, E5, E7, and E9 embryos. (B)
Quantification of the proportion of Prox11 neuroblasts
(mean 6 sem; n 5 3–5). Scale bars 20 mm. (C) Sox101 cells
co-expressing Prox1 (indicated by arrows) were observed at
E3 but not at E5. [Color figure can be viewed in the online
issue, which is available at wileyonlinelibrary.com.]
Prox1 in Sympathetic Neurogenesis 1355
Developmental Neurobiology
RESULTS
Temporally Restricted Expression ofProx1 in the Sympathetic Neuron Lineage
The generation of postmitotic sympathetic neurons is
not associated with a change in the expression of the
transcription factors Hand2, Insm1, Ascl1, Sox11,
and Phox2b that affect, at least transiently sympa-
thetic neuroblast proliferation during early develop-
ment (Hendershot et al., 2008; Wildner et al., 2008;
Morikawa et al., 2009; Coppola et al., 2010; Potzner
et al., 2010). Given that Prox1 regulates the exit of
progenitor cells from the cell cycle in the embryonic
mouse retina (Dyer et al., 2003), inhibits proliferation
in neuroblastoma cell lines (Foskolou et al., 2012)
and defines nascent neurons in the spinal cord and
telencepahlon (Misra et al., 2008; Kaltezioti et al.,
2010; Vessey et al., 2012), it was of interest to
analyze the expression of Prox1 in the developing
sympathetic neuron lineage.
To determine the identity of Prox1 expressing
cells in developing sympathetic ganglia, Sox10 was
used as marker for neural crest progenitor and glial
cells and Islet1 as marker for neuroblasts and neu-
rons. Islet1 and Sox10 are expressed in largely non-
overlapping populations at E3 and E5 with a very
small proportion of double-labeled cells at E3 (about
1%) and no double-labeled cells at E5 [Fig. 1(A)].
Islet1 is co-expressed with the adrenergic marker
tyrosine hydroxylase (TH) in E4 and E5 sympathetic
ganglia but shows an earlier onset of expression as
indicated by the presence of Islet11/TH2 cells at E3
[Fig. 1(A,B)]. A minor population of TH1/Islet12
cells was also detected but this most likely reflects
the difficulty to associate cytoplasmic and nuclear
staining. As Islet1 has the advantage of nuclear
localization, which allows unambiguous quantifica-
tion of co-labeled nuclear antigens like Prox1 and is
an earlier marker than TH, Islet1 is used as marker
for the sympathetic neuron lineage.
During the initial phase of neurogenesis (E3),
which involves the generation of sympathetic neuro-
blasts from undifferentiated Sox10-positive progeni-
tors (Tsarovina et al., 2008), Prox1 is expressed in
subpopulations of Sox101 progenitors (18 6 1%;
mean 6 sem; n 5 6) and Islet11 cells (37 6 7%;
mean 6 sem; n 5 5) [Fig. 2(A, a-c); Fig. 2(B, a-c)].
At E5, Prox1 is no more observed in Sox10-positive
cells [Fig. 2(C, d-f)], but is restricted to Islet11 neu-
roblasts and neurons [Fig. 2(A, d-f)].
To address the identity of Prox11/Sox101 cells at
E3, triple staining for Prox1, Sox10, and Phox2b was
performed. The vast majority of Prox1-positive cells
Figure 3 Timing of neurogenesis during sympathetic ganglion development. (A–D) The proportion
of Islet11 neuroblasts that has left the cell cycle was analyzed by staining for p27 on frozen sections
at different developmental stages (E3–E11). (E) Quantification of p271/Islet11 cells. (F–I) Islet11
cells that are in S-Phase of the cell cycle were identified by a 4 h EdU pulse and co-staining for EdU
and Islet1. (J) Quantification of EdU1/Islet11 cells. Neurogenesis extends from E3 to E11 with a
peak of proliferation at E5–7. Please note a high proportion of newly generated neuroblasts at E3 that
do not proliferate. Data shown are the mean 6 sem of five independent experiments. Scale bars
20 mm. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
1356 Holzmann et al.
Developmental Neurobiology
at E3 are also co-expressing Phox2b (90 6 4%;
n 5 4; mean 6 sem) which includes a population of
Prox11/Phox2b1/Sox101 cells (23 6 3% of Prox11
cells; n 5 4; mean 6 sem). This suggests that Prox1
expression is initiated in Phox2b1/Sox101 neuron
progenitors generated in a Notch-dependent manner
as previously described (Tsarovina et al., 2008).
Notably, only very few Prox11/Sox101/Phox2b2
cells are present in E3 ganglia (1.4 6 0.5% of
Sox101 cells; mean 6 sem; n 5 4), which indicates
that Prox1 expression is restricted to sympathetic
neuron progenitors rather than to Sox101 neural crest
or developing satellite glia cells.
Prox1 expression in Islet11 neuroblasts increases
rapidly from 37 6 7% (mean 6 sem; n 5 3–5) at E3
to 90 6 4% at E4 (not shown) and 93 6 1% (mean-
6 sem; n 5 3) at E5 and subsequently decreases to
reach background levels at E12 (1.5 6 0.2%; mean-
6 sem; n 5 3) [Fig. 2(A,B)]. The decrease of Prox1
expression during development correlates with the
reduced number of proliferating neuroblasts previ-
ously observed in vivo and in cultured sympathetic
ganglion cells (Rothman et al., 1978; Rohrer and
Thoenen, 1987; Rohrer, 2011). As timing and extent
of neurogenesis in chick sympathetic ganglia were
not known in sufficient detail, proliferating sympa-
thetic neuroblasts are quantified between E3 and E11
by determining the proportion of Islet11 S-phase
cells using EdU labeling. In parallel, the population
of Islet11 cells that have left the cell cycle was quan-
tified by staining for the cyclin-dependent-kinase
inhibitor protein p27. P27 promotes cell cycle exit in
cultured sympathetic neuroblasts (Reiff et al., 2010)
and marks non-cycling neurons in sympathetic gan-
glia, as revealed by a very low proportion of p27 cells
labeled by a 30 min in vivo EdU pulse at E7
(1.2 6 0.2%; mean 6 sem; n 5 3), which demon-
strates that S-phase neuroblasts are virtually devoid
of p27. In addition, only a small fraction of mitotic
E7 neuroblasts (PH31) co-express p27 (10 6 2%).
At E3, during initial differentiation of sympathetic
progenitors a large proportion of Islet11 cells
co-express p27 (63 6 4%, mean 6 sem; n 5 5) [Fig.
3(A,E)]. Subsequently, p27 expression decreases to
Figure 4 Location of Prox1 expressing cells in sympathetic ganglia. Double-immunostaining for
EdU/ Prox1 (A) and p27/Prox1 (B) on E7 sympathetic ganglion sections. Prox1-expressing and
EdU-labeled cells are mainly located at the ganglion periphery (A, a-c), whereas p27-expressing
neuroblasts are located in the ganglion core (B, b-c). Arrows in (A) and (B) point to EdU/Prox1
and p27/Prox1 double-labeled cells, respectively. Scale bars 20 mm. [Color figure can be viewed in
the online issue, which is available at wileyonlinelibrary.com.]
Prox1 in Sympathetic Neurogenesis 1357
Developmental Neurobiology
very low numbers at E5 (6.6 6 1.7%; mean 6 sem;
n 5 5) to gradually increase to 90 6 2% at E11
(mean 6 sem; n 5 5) [Fig. 3(A–E)]. The high propor-
tion of p271/Islet11 cells at E11 demonstrates that
p27 is maintained in mature sympathetic neurons
[Fig. 3(A–E)]. Islet11 cells that are devoid of p27
can, therefore, be considered as cycling sympathetic
neuroblasts (growth fraction) representing >90% of
neuroblasts at E5, whereas only about 10% are still in
the cell cycle at E11. Sympathetic neuroblast prolif-
eration was also analyzed by determining the propor-
tion of Islet1 positive cells that are in S-phase, using
EdU pulse labeling. Proliferation is maximal at E5–7
(23 6 2% and 25 6 2%, mean 6 sem; n 5 5) and is
decreased to very low levels at E11 (2.6 6 0.3; mean-
6 sem; n 5 5) [Fig. 3(F–J)]. Interestingly, E3 sympa-
thetic ganglia show a low proportion of Islet11
neuroblasts in S-phase (12 6 3%; mean 6 sem;
n 5 5), which is in agreement with the high percent-
age of p271 cells [Fig. 3(E,J)]. The large proportion
of p271/EdU2/Islet11 neuroblast during initial neu-
rogenesis at E3 reinforces previous observations that
initial generation of TH1/Tuj11 neuroblasts from
Sox101 progenitors correlates with a transient cell
cycle withdrawal in the mouse stellate ganglion
(Gonsalvez et al., 2013). The similar proportions of
neuroblasts that express Prox1 and are in the cell
cycle [compare Figs. 2(B) and 3(E,J)] point to an
association of Prox1 with proliferating neuroblasts
throughout neurogenesis (E3–E11). This is supported
by the observation that Prox1-expressing neuroblasts
are EdU-labeled and mainly located at the ganglion
periphery [Fig. 4(A)], whereas p271/Prox12 neuro-
blasts occupy the ganglion core [Fig. 4(B)]. Together,
these findings raise the questions how strict Prox1
expression is linked to cycling cells and in which
way proliferation may be controlled by Prox1.
Is Prox1 Expression Restricted to CyclingNeuroblasts?
The decrease of Prox1 expression at the end of neuro-
genesis demonstrates that Prox1 is not maintained in
mature sympathetic neurons. It remained unclear,
however, whether Prox1 is expressed only in cycling
neuroblasts or also in nascent postmitotic neurons that
withdraw from the cell cycle. To address this issue
we first investigated whether Prox1 is also present in
p27-positive sympathetic neurons. Indeed, virtually all
newly generated p271 neurons that become postmi-
totic at E5 co-express Prox1. This is deduced from
the observation that 87 6 4% (mean 6 sem; n 5 5) of
p271 cells co-express Prox1 [Fig. 5(A,B)] and Islet1
(87 6 4%; mean 6 sem; n 5 5) at E5. During develop-
ment the proportion of p271 cells co-expressing
Prox11 decreases to 5 6 1% (mean 6 sem; n 5 4) at
E11. Conversely, the proportion of Prox11 cells that
co-express p27 is very low during the peak of neuro-
genesis (E5, E7) but increases toward the end of neu-
rogenesis to about 35 6 2% (mean 6 sem; n 5 4) at
E11 [Fig. 5(A)]. Referred to the total ganglion popula-
tion the percentage of Prox11/p271 cells (red bars)
remains relatively constant [Fig. 5(B)]. As expected
from the transient co-expression, double positive cells
show a weak fluorescence signal for Prox1, p27, or
both [Fig. 4(B)]. Together, this suggests that Prox11/
p271 cells represent nascent neurons that downregu-
late Prox1 in more differentiated stages.
In a second approach, we determined the propor-
tion of Prox11 neuroblasts in S-phase by EdU-
labeling [Fig. 6(A)]. The population co-expressing
Figure 5 Prox1 is expressed in nascent postmitotic sym-
pathetic neurons. (A) The proportion of p271 postmitotic
neurons that co-express Prox1 (- W -) and the proportion of
Prox11 cells that express the postmitotic neuron marker
p27 (– w –) were analyzed (mean 6 sem; n 5 4–5). (B)
Combined quantification of the proportion of Islet11 cells
co-expressing Prox1 (yellow), p27 (blue), Prox1 and p27
(red), and Islet11 cells devoid of Prox1 and p27 (green) at
E5, E7, E9, and E11. Each bar represents 100% of Islet11
cells. The proportions are calculated from the quantification
of Prox11/Islet11 cells (Fig. 2), p271/Islet11 (Fig. 3)
p271/Prox11, and Prox11/p271 as described in METH-
ODS. Errors (sem) are calculated according to Gaussian
error propagation. [Color figure can be viewed in the online
issue, which is available at wileyonlinelibrary.com.]
1358 Holzmann et al.
Developmental Neurobiology
Prox1 and Islet1 as compared to the Islet11 popula-
tion displayed a higher proportion of EdU-labeled
cells at E7 and E9 [compare Figs. 3(J) and 6(A)].
This finding is expected, as Prox1 expression is
largely restricted to the p27 negative growth fraction
[Fig. 5(B)]. It should be noted, however, that prolifer-
ating Prox12/Islet11/EdU1 cells also contribute to
sympathetic neurogenesis as revealed by quantifying
the proportion of EdU-labeled Prox11 and Prox12
neuroblasts [Fig. 6(B)]. The proportion of proliferat-
ing Prox12 neuroblasts increases toward the end of
neurogenesis [Fig. 6(B)].
Prox1 Expression in the ParasympatheticCiliary Ganglion
Neurogenesis in the parasympathetic ciliary ganglion
proceeds like in the CNS or DRG by proliferation of
progenitor cells that start to differentiate on cell cycle
exit. Neuron birth in the quail ciliary ganglion is
maximal at E3/4 and the last ciliary ganglion neurons
are born at E5, which corresponds to about E5.5 in
the chick (Dupin, 1984). Differentiated parasympa-
thetic neurons, although they are closely related to
sympathetic neurons do not proliferate (Rohrer and
Thoenen, 1987; Huber et al., 2012). Thus, it was of
interest to investigate whether Prox1 is expressed in
proliferating progenitors, nascent and/or mature ciliary
neurons. This question was addressed by immunostain-
ing and qPCR. Prox1 expression analyzed by immuno-
staining in sections of E4 and E5 ciliary ganglia was
virtually absent in Islet1-negative progenitors
(Prox11/Islet12 cells at E4: 0.9 6 0.5%, at E5:
0.2 6 0.1%; mean 6 sem; n 5 3, compared to the num-
ber of Islet11cells). A very low proportion of Islet11
cells co-expressed Prox1 (E4: 6 6 1%; E5:
1.1 6 0.6%; mean 6 sem; n 5 3) [Fig. 7(B)], in con-
trast to the situation in E7 sympathetic ganglia [Figs.
7(A) and 2(A)]. The low level of Prox1 expression in
ciliary ganglia was confirmed by qRT-PCR analysis,
showing 66 and 250-fold lower Prox1 signals at E5
and E9, respectively as compared to E7 sympathetic
ganglia [Fig. 7(C)]. The restriction of Prox1 expression
to a small subpopulation of ciliary ganglion cells is
surprising considering the expression in a large num-
ber of neuronal lineages. Conversely, it supports the
evidence for strong differences in the control of neuro-
genesis between sympathetic and parasympathetic
ganglia, reflected by the differential expression of pro-
liferation regulators like Midkine, AP-2b, Hand2, and
Gata2 (M€uller and Rohrer, 2002; Tsarovina et al.,
2004; Reiff et al., 2011; Schmidt et al., 2011).
Prox1 Supports Proliferation of CulturedSympathetic Neurons
To study the function of Prox1 in the control of sym-
pathetic neuron proliferation, cultures of E7 chick
Figure 6 Prox1 is expressed in proliferating sympathetic neuroblasts. (A) The proportion of Prox11
neuroblasts that are in the S-phase is quantified by 4 h EdU-labeling (mean 6 sem; n 5 4–5). (B)
Quantification of Prox11 and Prox12 EdU-labeled neuroblasts at E5, E7, and E9. The proportion of
EdU1/Prox12/Islet11 cells was determined as described in METHODS. The majority of proliferating
EdU1 neuroblasts expresses Prox1, but proliferating Prox12 neuroblasts also contribute to neurogen-
esis. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
Prox1 in Sympathetic Neurogenesis 1359
Developmental Neurobiology
sympathetic ganglia were used that respond to extrin-
sic and intrinsic proliferation signals like IGFs,
BDNF, BMP4, Alk, Phox2b, MycN, p27, and Hand2
(Zackenfels et al., 1995; Straub et al., 2007; Reiff
et al., 2010; Reiff et al., 2011). For Prox1, overex-
pression or knockdown dissociated ganglion cells
were co-transfected by electroporation with expres-
sion plasmids coding for GFP and either Prox1 or
shProx1. Proliferation was analyzed by determining
the proportion of EdU-labeled transfected GFP1
cells. We observed a significant, albeit small reduc-
tion (by 19 6 5%) in the number of EdU1 cells on
shRNA-mediated Prox1-knockdown (Fig. 8). The
specificity of this effect is demonstrated by co-
expression of shRNA with full length Prox1, which
rescues the knockdown effect. Prox1 overexpression
significantly increases sympathetic neuron prolifera-
tion but the effect is small compared to that of Insm1
overexpression used as internal control (Fig. 8) and
previously demonstrated effects of Alk and Hand2
(Reiff et al., 2010; Reiff et al., 2011). The effect
of Prox1 knockdown and overexpression was
controlled by determining the proportion of Prox1-
immunoreactive neurons in control transfected cells
and cells transfected with shProx1 or Prox1. About
50% (50 6 1%; mean 6 sem; n 5 4) of sympathetic
neurons were Prox1-immunoreactive in control trans-
fections, which is close to the in vivo situation [Fig.
3(E)]. The proportion of Prox1 cells was significantly
decreased in the cells transfected with shRNA
(33 6 6%; mean 6 sem; n 5 4) and increased on
transfection with Prox1 (78 6 5%; mean 6 sem;
n 5 4).
Taken together, these results demonstrate that
Prox1 is involved in the proliferation of cultured
sympathetic neuroblasts. To investigate the physio-
logical relevance of these in vitro observations,
Prox1 expression was also modified in vivo, in devel-
oping chick embryos.
Figure 7 Prox1 is expressed in a small minority of ciliary ganglion cells. (A) Prox1 immunostaining
in sections of E7 sympathetic ganglia and (B) E5 ciliary ganglia demonstrate the absence of Prox1 in
the vast majority of ciliary ganglion cells. The arrow points to a Prox1-expressing cell. (C) qRT-PCR
analysis confirms the massively reduced expression of Prox1 mRNA in E5 and E9 ciliary ganglia
compared to E7 sympathetic ganglia (E5: 0.015 6 0.008; E9: 0.004 6 0.001; n 5 3). Scale bars
20 mm. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
Figure 8 Prox1 knockdown and overexpression affects
neuroblast proliferation in vitro. E7 sympathetic neuro-
blasts were transfected with expression vectors for shProx1,
Prox1, and empty control vector as indicated. Transfected
cells were identified by co-electroporation of a GFP expres-
sion vector. Proliferating cells were quantified by determin-
ing the proportion of EdU/GFP double positive neuroblasts
after 2 days in vitro (mean 6 sem; n 5 5–18; **p� 0.001,
***p� 0.0001, significantly different from control).
1360 Holzmann et al.
Developmental Neurobiology
RCAS-Mediated Expression of Prox1 andshProx1 in Developing SympatheticGanglia
Prox1 levels in sympathetic ganglion cells were
altered by retroviral expression of Prox1 and
shProx1. Neural crest cells were infected with
RCAS-Prox1 and RCAS-shProx1 virus concentrate
before migration to the vicinity of the dorsal aorta
(R€udiger et al., 2009; Reiff et al., 2011). Embryos
were analyzed after a 4 h EdU pulse at E7 for RCAS-
infection by staining for the avian leukosis virus spe-
cific gag polyprotein. Strongly infected ganglia were
then analyzed in parallel sections for the proportion
of Islet11 neuroblasts labeled with EdU [Fig. 9(A)].
In addition, the number of Islet11 cells per ganglion
area was determined.
A reduced number of Islet1-positive cells was
observed in embryos infected with RCAS-shProx1 as
compared to embryos with Prox1 overexpression
[Fig. 9(C)]. Compared to controls infected with
empty RCAS (gray bar) this effect did not reach sig-
nificance. The number of EdU1/Islet11 cells was not
affected in these experiments [Fig. 9(B)]. At earlier
stages (E5; HH 26/27), Prox1 overexpression or
knockdown did neither affect neuroblast proliferation
nor the number of Islet1-positive cells (not shown).
DISCUSSION
Sympathetic neurogenesis proceeds in two phases, an
early phase characterized by the generation of
Figure 9 In vivo knockdown and overexpression of Prox1 in sympathetic ganglia. (A) RCAS-
shProx1, RCAS-Prox1, and control RCAS were used to infect neural crest cells. Sympathetic gan-
glia of infected embryos were analyzed at E7 for the proportion of proliferating EdU1/Islet11 neu-
roblasts and for the number of Islet11 neuroblasts and neurons per section (a–c). [(c) represents the
merge of independent pictures of two consecutive sections.] (B) Quantification of neuroblast prolif-
eration (mean 6 sem; n 5 3–4). (C) Quantification of Islet11 neuroblast/neuron number per section
(mean 6 sem; n 5 3–4). *p� 0.05. Scale bars 20mm. [Color figure can be viewed in the online
issue, which is available at wileyonlinelibrary.com.]
Prox1 in Sympathetic Neurogenesis 1361
Developmental Neurobiology
differentiated neuroblasts from undifferentiated neu-
ral crest progenitor cells and a second phase where
neuroblasts proliferate and give rise to postmitotic
neurons. We now demonstrate that during the early
phase a large proportion of neuroblasts in E3 chick
ganglia have withdrawn from the cell cycle whereas
at E5 in the second phase virtually all neuroblasts are
in the cell cycle. Similar observations have previ-
ously been made in the developing mouse stellate
ganglion (Gonsalvez et al., 2013). Together, these
findings suggest a transient cell cycle withdrawal of
initially generated neuroblasts followed by continu-
ous neuroblast proliferation, which results in the pro-
duction of postmitotic sympathetic neurons up to at
least E11. Expression of the transcription factor
Prox1 is restricted to the period of neurogenesis and
marks the majority of cycling cells as well as nascent
postmitotic cells. In vitro and in vivo gain- and loss-
of-function experiments are compatible with a func-
tion of Prox1 supporting proliferation and survival of
neuroblasts rather than cell cycle exit. Our findings
delineate the timing of sympathetic neurogenesis,
identify a transient cell cycle withdrawal in chick
sympathetic neuroblasts and characterize Prox1 as a
gene transiently expressed during neurogenesis.
Neurogenesis in Chick SympatheticGanglia
The generation of neurons in most parts of the nerv-
ous system involves proliferation of undifferentiated
progenitors and continuous increase in the production
of differentiated neurons during the period of neuro-
genesis. This pattern is observed for neuronal line-
ages in the CNS, for example, neocortex and retina
(Prada et al., 1991; Alexiades and Cepko, 1996;
Takahashi et al., 1996; Rapaport et al., 2004) as well
as during neurogenesis in various parts of the PNS,
including sensory and parasympathetic ganglia (Carr
and Simpson, 1978; Lawson and Biscoe, 1979;
Dupin, 1984; Gonsalvez et al., 2013; Gonsalvez
et al., 2014). Neurogenesis in sympathetic ganglia
has previously been analyzed in the chick embryo
focusing on the relationship between cell division
and the acquisition of neuronal characteristics
(Cohen, 1974; Rothman et al., 1978; Rohrer and
Thoenen, 1987; Tsarovina et al., 2008). These studies
established that postmitotic neurons in sympathetic
ganglia, in contrast to other neuronal lineages are
generated by proliferating differentiated neuroblasts
rather than by progenitors that differentiate after cell
cycle exit. However, the timing and extent of neuro-
genesis, in particular the proportion of proliferating
neuroblasts at specific developmental stages
remained unclear. Here, we use p27 as marker for
postmitotic sympathetic neurons and demonstrate invivo that in E5 sympathetic ganglia virtually all neu-
roblasts are in the cell cycle, i.e. devoid of p27. With
increasing development the proportion of cycling
cells decreases to reach low levels at E11 (10%).
Timing and extent of neurogenesis revealed by quan-
tification of p27 expressing cells is confirmed by
EdU labeling. In the retina and spinal cord some pro-
genitors upregulate p27 to exit the cell cycle, whereas
others upregulate p57 (Dyer and Cepko, 2001; Gui
et al., 2007; Misra et al., 2008). p272 neuroblasts at
E11 may thus represent a distinct population that
uses a different type of cyclin-dependent kinase
inhibitor for cell cycle exit. The presence of S-phase
neuroblasts at E11 suggests, however, that p272 neu-
roblasts are still proliferating and will become post-
mitotic at later time points. Low numbers of
thymidine-labeled proliferating catecholaminergic
neuroblasts were observed previously until hatching
(Rothman et al., 1978).
We characterized an additional specific trait of sym-
pathetic neurogenesis, which is a high proportion of
neuroblasts that are arrested in the cell cycle at the
onset of neurogenesis. In E3 chick sympathetic gan-
glia, the majority of neuroblasts have withdrawn from
the cell cycle. This early phase of sympathetic neuro-
genesis is characterized by the generation of Islet11/
SCG101/Sox102 neuroblasts from Sox101/Phox2b1/
SCG102/Islet12 progenitors (Tsarovina et al., 2008
and present study). At E5 progenitors have differenti-
ated to SCG101/Islet11 neuroblasts and >90% of
them are in the cell cycle as shown by the absence of
p27 expression (Tsarovina et al., 2008 and present
study). The most straightforward interpretation of these
results is that nascent Islet11 sympathetic neuroblasts
during their differentiation from Sox101/Islet12 pro-
genitors transiently withdraw from the cell cycle,
induce p27 expression and subsequently re-enter the
cell cycle. In the mouse stellate ganglion, a complete
cell cycle arrest in nascent TH-expressing neuroblasts
was observed at E10.5 (Gonsalvez et al., 2013). The
complete proliferation block in mouse stellate ganglia
as compared to the partial effect in chick sympathetic
ganglia may be explained by the compressed and syn-
chronous kinetics of sympathetic neuron development
in the mouse versus extended development in the chick
embryo, as indicated by the restriction of Phox2b1/
TH2/TuJ12 progenitors in the mouse stellate ganglion
to E10.5 (Gonsalvez et al., 2013), whereas Phox2b1/
SCG102 progenitors are found in the chick embryo
from E3 to E5 (Tsarovina et al., 2008).
Alternative explanations for the transiently high
proportion of p271/Islet11 cells at the beginning of
1362 Holzmann et al.
Developmental Neurobiology
sympathetic neurogenesis are that postmitotic neu-
rons are initially generated, which is followed by a
rapid decrease in the proportion of postmitotic neu-
rons (i) due to massive increase in neuroblast number
or (ii) due to neuron death. Overgrowth by proliferat-
ing neuroblasts is excluded, as five cell divisions are
required to reduce the proportion of p271 cells from
60% at E3 to 5% at E5, which is not possible with a
neuroblast cell cycle length of about 18 h (J. Holz-
mann, pers. comm.). Death of postmitotic neurons
would also explain the decrease in p271/Islet11 cells
between E3 and E5, but has been excluded for the
equivalent population in mouse stellate ganglia (Gon-
salvez et al., 2013). Thus, the most straightforward
explanation for the presence of p271 sympathetic
neuroblasts during early neurogenesis is a transient
withdrawal from the cell cycle. During neurogenesis
in the adult hippocampus p27 regulates quiescence of
neural stem cells, downstream of BMP signaling
(Mira et al., 2010; Andreu et al., 2014). A role of
BMPs in transient cell cycle exit of nascent sympa-
thetic neuroblasts seems unlikely, however, as canon-
ical BMP signaling is a positive regulator of
neuroblast proliferation in vivo (Buchmann-Moller
et al., 2009; Morikawa et al., 2009). All analyzed reg-
ulators, including Hand2 (Hendershot et al., 2008),
Sox11 (Potzner et al., 2010), Ascl1 (Morikawa et al.,
2009), Insm1 (Wildner et al., 2008), frizzeld-3 and b-
catenin (Armstrong et al., 2011), and MycN (Sawai
et al., 1993) that regulate proliferation in developing
sympathetic ganglia show a knockout phenotype with
impaired neuroblast proliferation rather than nascent
neuroblasts arrested in quiescence at E10.5. Thus, the
molecular mechanisms responsible for the entry and
exit from sympathetic neuroblast cell cycle arrest
remain elusive.
Prox1 Expression in Sympathetic andParasympathetic Neurogenesis
Prox1 mRNA expression in the developing CNS has
initially been found to be restricted to postmitotic,
undifferentiated young neurons in the SVZ (Oliver
et al., 1993). This has been confirmed for spinal cord
and cortex (Misra et al., 2008; Kaltezioti et al., 2010;
Vessey et al., 2012) but in other lineages Prox1 is
expressed additionally in proliferating progenitors or
differentiated mature neurons (Dyer and Cepko,
2000; Dyer et al., 2003; Lavado et al., 2010; Karalay
et al., 2011). Prox1 expression has been detected in
various parts of the developing vertebrate PNS,
including sensory and sympathetic ganglia, but not
investigated in detail (Rodriguez-Niedenfuhr et al.,
2001; Becker et al., 2010).
The present study identifies Prox1 as a marker for
cycling sympathetic neuroblasts that is expressed in a
pattern inverse to that of the postmitotic marker p27.
Throughout neurogenesis a small proportion of
Prox11/p271 co-expressing cells are observed. They
represent nascent sympathetic neurons, which have
left the cell cycle.
The transient presence of Prox1-expressing
Sox101 cells at E3 is explained by the onset of Prox1
expression in Phox2b-positive sympathetic neuron
progenitors that subsequently acquire neuronal prop-
erties like Islet1 and SCG10 (Tsarovina et al., 2004).
The restriction of Prox1 expression at E3 to only
37% of newly generated Islet1-positive cells argues
against a general role in the initiation of sympathetic
neuron differentiation. Notably, also at later stages of
neurogenesis Prox1 is never expressed in all Islet1-
positive sympathetic neuroblasts. Proliferating neuro-
blasts can be subdivided into a large population of
Prox11 and a minor fraction of Prox12 cells, raising
the question whether this may reflect predisposition
to different sympathetic neuron fates. The increase in
the proportion of proliferating Prox12 neuroblasts
during late stages of neurogenesis suggests that late
born sympathetic neurons are generated at least in
part from Prox12 neuroblasts. Distinct types of rat
sympathetic neurons withdraw from the cell cycle at
overlapping but different times, with late peaks of
cell cycle withdrawal for secretomotor and muscle
vasomotor neurons (Chubb and Anderson, 2010).
Thus, it would be of considerable interest to trace the
progeny of Prox1-expressing and Prox1-negative
sympathetic neuroblasts in vivo.
During neurogenesis in the parasympathetic ciliary
ganglion differentiation of neuron progenitor cells is
associated with cell cycle exit. Unexpectedly, Prox1
expression was detectable only in a small number of
ganglion cells at E4 and E5 when ciliary and choroid
neurons are born (Dupin, 1984). Prox1 is absent in
the vast majority of proliferating progenitors and nas-
cent neurons. Also mature E9 ciliary ganglion neu-
rons are devoid of Prox1. These findings add Prox1
to the list of genes differentially expressed between
sympathetic and parasympathetic genes.
Prox1 Function in SympatheticNeurogenesis
The expression of Prox1 in proliferating sympathetic
neuroblasts and nascent postmitotic neurons suggests
a function in the control of proliferation. Prox1 over-
expression in cultured sympathetic neuroblasts leads
indeed to increased proportion of proliferating EdU1
cells, whereas Prox1 knockdown results in reduced
Prox1 in Sympathetic Neurogenesis 1363
Developmental Neurobiology
proliferation. These findings exclude a function of
Prox1 in the termination of neuroblast proliferation
and rather indicate a role in the maintenance of pro-
liferation and/or survival of proliferating cells.
The effects observed in cultured primary sympa-
thetic neuroblasts differ from Prox1 response
observed in neuroblastoma cell lines (Foskolou et al.,
2012). In both mouse and human neuroblastoma cell
lines, Prox1 overexpression resulted in complete cell
cycle arrest, whereas Prox1 knockdown increased
proliferation. Interestingly, Prox1 induces cyclinE1,
which is sufficient to stimulate neuroblastoma prolif-
eration on overexpression. The antiproliferative
effect of Prox1 is mediated by p27 and cdc25A that
are induced by Prox1 and counteract cyclinE1 func-
tion (Foskolou et al., 2012). Differential cell type
specific activation of these antagonistic downstream
signal transduction pathways may explain the oppo-
site effects of Prox1 in sympathetic neuroblasts and
neuroblastoma cell lines. Indeed, endogenous Prox1
seems not induce p27 expression in neuroblasts dur-
ing normal development as indicated by the mirror
image expression of Prox1 and p27 in sympathetic
ganglia. Although p27 is a direct target of Prox1 in
neuroblastoma (Foskolou et al., 2012) and p27 over-
expression leads to cell cycle withdrawal of cultured
sympathetic neuroblasts (Reiff et al., 2010) our data
argue against a causal role of Prox1 alone in the onset
of p27 expression and cell cycle exit, in contrast to
the situation in neuroblastoma cell lines. Context-
dependent functions of Prox1 are not only evident
from the different effects of Prox1 in various neuro-
nal lineages (Dyer et al., 2003; Misra et al., 2008;
Karalay et al., 2011) but also by alternative roles in
different tissues and tumors where Prox1 either accel-
erates growth, as in lymphatic endothelial cells, liver
stem/progenitor cells and colon cancer (Kamiya
et al., 2008; Petrova et al., 2008; Baxter et al., 2011),
or suppresses proliferation as in hematopoietic stem
cells, neural progenitor cells, pancreatic and esopha-
geal cancer cell lines (Dyer et al., 2003; Takahashi
et al., 2006; Hope et al., 2010; Akagami et al., 2011).
Notably, the growth promoting activity of Prox1 in
lymphatic endothelial cells is mediated by increased
expression of the cyclinE1 gene, a direct target of
Prox1 (Baxter et al., 2011).
The in vitro results were tested by in vivo gain-
and loss-of-function experiments using retroviral
expression vectors (R€udiger et al., 2009; Reiff et al.,
2011). After infection of neural crest cells with
RCAS retrovirus to express Prox1 and shProx1 in
sympathetic ganglia, effects on the proportion of
EdU-labeled sympathetic neuroblasts were not
observed. However, a significant difference between
neuroblast numbers in Prox1 overexpressing ganglia
and Prox1 knockdown ganglia was detected, suggest-
ing effects of Prox1 on the survival of sympathetic
neuroblasts and/or neurons. The absence of prolifera-
tion effects in vivo may be explained by the larger
variability of in vivo data and insufficient infection of
the cells. It should also be pointed out that although
embryos with efficient RCAS infection of sympa-
thetic ganglia were selected the time of neuroblast
infection is unclear and may be too delayed to affect
Prox1 expression levels. Survival effects observed invivo but not in vitro in cultured E7 sympathetic gan-
glion cells may be due to culture conditions opti-
mized for sympathetic neuroblast and neuron
survival (Ernsberger et al., 1989), including extracel-
lular matrix and serum components that are absent invivo. Survival effects of Prox1 were previously
observed during adult neurogenesis in the dentate
gyrus in addition to effects on the differentiation of
nascent neurons (Lavado et al., 2010; Karalay et al.,
2011).
Conclusions
Our analysis of neuroblast proliferation in developing
chick sympathetic ganglia defines onset and termina-
tion of neurogenesis and provides a quantification of
the changing proportion of cycling neuroblasts in
sympathetic ganglia. A stage of transient cell cycle
withdrawal at the onset of neurogenesis was observed
in chick sympathetic ganglia. The transcription factor
Prox1 is expressed in neuron progenitors, proliferat-
ing neuroblasts and nascent neurons, and supports
neuroblast proliferation and survival. A minor popu-
lation of Prox12 neuroblasts, which increases during
late neurogenesis may represent a sublineage of late
born sympathetic neurons.
Thanks are due to Julia Andrees and Melanie Pulver for
excellent technical assistance and to Uwe Ernsberger and
Panagiotis Politis for helpful discussions and comments on
the manuscript.
REFERENCES
Akagami M, Kawada K, Kubo H, Kawada M, Takahashi
M, Kaganoi J, Kato S, et al. 2011. Transcriptional factor
Prox1 plays an essential role in the antiproliferative
action of interferon-gamma in esophageal cancer cells.
Ann Surg Oncol 18:3868–3877.
Alexiades MR, Cepko C. 1996. Quantitative analysis of
proliferation and cell cycle length during development of
the rat retina. Dev Dyn 205:293–307.
1364 Holzmann et al.
Developmental Neurobiology
Andreu Z, Khan MA, Gonzalez-Gomez P, Negueruela S,
Hortiguela R, San Emeterio J, Ferron SR, et al. 2014. The
cyclin-dependent kinase inhibitor p27 regulates radial
stem cell quiescence and neurogenesis in the adult hippo-
campus. Stem Cells 33:219–229.
Armstrong A, Ryu YK, Chieco D, Kuruvilla R. 2011.
Frizzled3 is required for neurogenesis and target innerva-
tion during sympathetic nervous system development.
J Neurosci 31:2371–2381.
Baxter SA, Cheung DY, Bocangel P, Kim HK, Herbert K,
Douville JM, Jangamreddy JR, et al. 2011. Regulation of
the lymphatic endothelial cell cycle by the PROX1 home-
odomain protein. Biochim Biophys Acta 1813:201–212.
Becker J, Wang B, Pavlakovic H, Buttler K, Wilting J.
2010. Homeobox transcription factor Prox1 in sympa-
thetic ganglia of vertebrate embryos: Correlation with
human stage 4s neuroblastoma. Pediatr Res 68:112–117.
Betschinger J, Mechtler K, Knoblich JA. 2006. Asymmetric
segregation of the tumor suppressor brat regulates self-
renewal in Drosophila neural stem cells. Cell 124:1241–
1253.
Bonnefoy E, Ferrara P, Rohrer H, Gros F, Thibault J. 1988.
Role of the N-terminus of rat pheochromocytoma tyro-
sine hydroxylase in the regulation of the enzyme’s activ-
ity. Eur J Biochem 174:685–690.
Buchmann-Moller S, Miescher I, John N, Krishnan J, Deng
CX, Sommer L. 2009. Multiple lineage-specific roles of
Smad4 during neural crest development. Dev Biol 330:
329–338.
Carr VM, Simpson SB. 1978. Proliferative and degenerative
events in the early development of chick dorsal root gan-
glia I. Normal development. J Comp Neurol 182:727–740.
Cazes A, Lopez-Delisle L, Tsarovina K, Pierre-Eugene C,
De Preter K, Peuchmaur M, Nicolas A, et al. 2014. Acti-
vated Alk triggers prolonged neurogenesis and Ret upreg-
ulation providing a therapeutic target in ALK-mutated
neuroblastoma. Oncotarget 5:2688–2702.
Centanin L, Wittbrodt J. 2014. Retinal neurogenesis.
Development 141:241–244.
Chesler L, Weiss WA. 2011. Genetically engineered
murine models–contribution to our understanding of the
genetics, molecular pathology and therapeutic targeting
of neuroblastoma. Semin Cancer Biol 21:245–255.
Cheung NK, Dyer MA. 2013. Neuroblastoma: Develop-
mental biology, cancer genomics and immunotherapy.
Nat Rev Cancer 13:397–411.
Choksi SP, Southall TD, Bossing T, Edoff K, de Wit E,
Fischer BE, van Steensel B, et al. 2006. Prospero acts as
a binary switch between self-renewal and differentiation
in Drosophila neural stem cells. Dev Cell 11:775–789.
Chubb DP, Anderson CR. 2010. The relationship of the
birth date of rat sympathetic neurons to the target they
innervate. Dev Dyn 239:897–904.
Cohen A. 1974. DNA synthesis and cell division in differ-
entiating avian adrenergic neuroblasts. In: Fuxe K, Olson
L, Zotterman Y, Fuxe K, Olson L, Zotterman YS, editors.
Wenner-Gren Center International Symposion Series.
Oxford: Pergamon Press, pp 359–370.
Coppola E, d’Autreaux F, Rijli FM, Brunet JF. 2010.
Ongoing roles of Phox2 homeodomain transcription fac-
tors during neuronal differentiation. Development 137:
4211–4220.
Doe CQ, Chu-LaGraff Q, Wright DM, Scott MP. 1991. The
prospero gene specifies cell fates in the Drosophila cen-
tral nervous system. Cell 65:451–464.
Dupin E. 1984. Cell division in the ciliary ganglion of quail
embryos in situ and after back transplantation into the
neural crest migration pathways of chick embryos. Dev
Biol 105:288–299.
Dyer MA, Cepko CL. 2000. Control of Muller glial cell
proliferation and activation following retinal injury. Nat
Neurosci 3:873–880.
Dyer MA, Cepko CL. 2001. p27Kip1 and p57Kip2 regulate
proliferation in distinct retinal progenitor cell popula-
tions. J Neurosci 21:4259–4271.
Dyer MA, Livesey FJ, Cepko CL, Oliver G. 2003. Prox1
function controls progenitor cell proliferation and hori-
zontal, cell genesis in the mammalian retina. Nat Genet
34:53–58.
Ernsberger U, Edgar D, Rohrer H. 1989. The survival of
early chick sympathetic neurons in vitro is dependent on
a suitable substrate but independent of NGF. Dev Biol
135:250–262.
Foskolou IP, Stellas D, Rozani I, Lavigne MD, Politis PK.
2012. Prox1 suppresses the proliferation of neuroblas-
toma cells via a dual action in p27-Kip1 and Cdc25A.
Oncogene 32:947–960.
Gonsalvez DG, Cane KN, Landman KA, Enomoto H,
Young HM, Anderson CR. 2013. Proliferation and cell
cycle dynamics in the developing stellate ganglion.
J Neurosci 33:5969–5979.
Gonsalvez DG, Li-Yuen-Fong M, Cane KN, Stamp LA,
Young HM, Anderson CR. 2014. Different neural crest
populations exhibit diverse proliferative behaviors. Dev
Neurobiol 75:287–301.
Gui H, Li S, Matise MP. 2007. A cell-autonomous require-
ment for Cip/Kip cyclin-kinase inhibitors in regulating
neuronal cell cycle exit but not differentiation in the
developing spinal cord. Dev Biol 301:14–26.
Hamburger V, Hamilton HL. 1951. A series of normal
stages in the development of the chick embryo. J Exp
Zool 88:49–92.
Hendershot TJ, Liu H, Clouthier DE, Shepherd IT, Coppola
E, Studer M, Firulli AB, et al. 2008. Conditional deletion
of Hand2 reveals critical functions in neurogenesis and
cell type-specific gene expression for development of
neural crest-derived noradrenergic sympathetic ganglion
neurons. Dev Biol 319:179–191.
Hirata J, Nakagoshi H, Nabeshima Y, Matsuzaki F. 1995.
Asymmetric segregation of the homeodomain protein Pros-
pero during Drosophila development. Nature 377:627–630.
Hope KJ, Cellot S, Ting SB, MacRae T, Mayotte N, Iscove
NN, Sauvageau G. 2010. An RNAi screen identifies Msi2
and Prox1 as having opposite roles in the regulation of
hematopoietic stem cell activity. Cell Stem Cell 7:101–
113.
Prox1 in Sympathetic Neurogenesis 1365
Developmental Neurobiology
Huber L, Ferdin M, Holzmann J, Stubbusch J, Rohrer H.
2012. HoxB8 in noradrenergic specification and differen-
tiation of the autonomic nervous system. Dev Biol 363:
219–233.
Kaltezioti V, Kouroupi G, Oikonomaki M, Mantouvalou E,
Stergiopoulos A, Charonis A, Rohrer H, et al. 2010.
Prox1 regulates the notch1-mediated inhibition of neuro-
genesis. PLoS Biol 8:e1000565.
Kamiya A, Kakinuma S, Onodera M, Miyajima A, Nakauchi
H. 2008. Prospero-related homeobox 1 and liver receptor
homolog 1 coordinately regulate long-term proliferation of
murine fetal hepatoblasts. Hepatology 48:252–264.
Karalay O, Doberauer K, Vadodaria KC, Knobloch M,
Berti L, Miquelajauregui A, Schwark M, et al. 2011.
Prospero-related homeobox 1 gene (Prox1) is regulated
by canonical Wnt signaling and has a stage-specific role
in adult hippocampal neurogenesis. Proc Natl Acad Sci
USA 108:5807–5812.
Lavado A, Lagutin OV, Chow LM, Baker SJ, Oliver G.
2010. Prox1 is required for granule cell maturation and
intermediate progenitor maintenance during brain neuro-
genesis. PLoS Biol 8:e1000460.
Lavado A, Oliver G. 2007. Prox1 expression patterns in the
developing and adult murine brain. Dev Dyn 236:518–524.
Lawson SN, Biscoe TJ. 1979. Development of mouse dor-
sal root ganglia: An autoradiographic and quantitative
study. J.Neurocytol 8:265–227.
Maris JM, Hogarty MD, Bagatell R, Cohn SL. 2007. Neu-
roblastoma. Lancet 369:2106–2120.
Mira H, Andreu Z, Suh H, Lie DC, Jessberger S, Consiglio A,
San Emeterio J, et al. 2010. Signaling through BMPR-IA
regulates quiescence and long-term activity of neural stem
cells in the adult hippocampus. Cell Stem Cell 7:78–89.
Misra K, Gui H, Matise MP. 2008. Prox1 regulates a transi-
tory state for interneuron neurogenesis in the spinal cord.
Dev Dyn 237:393–402.
Molenaar JJ, Domingo-Fernandez R, Ebus ME, Lindner S,
Koster J, Drabek K, Mestdagh P, et al. 2012. LIN28B
induces neuroblastoma and enhances MYCN levels via
let-7 suppression. Nat Genet 44:1199–1206.
Morikawa Y, Zehir A, Maska E, Deng C, Schneider MD,
Mishina Y, Cserjesi P. 2009. BMP signaling regulates
sympathetic nervous system development through
Smad4-dependent and -independent pathways. Develop-
ment 136:3575–3584.
M€uller F, Rohrer H. 2002. Molecular control of ciliary neu-
ron development: BMPs and downstream transcriptional
control in the parasympathetic lineage. Development
129:5707–5717.
Myster DL, Duronio RJ. 2000. To differentiate or not to
differentiate? Curr Biol 10:R302–R304.
Nguyen L, Besson A, Roberts JM, Guillemot F. 2006. Cou-
pling cell cycle exit, neuronal differentiation and migra-
tion in cortical neurogenesis. Cell Cycle 5:2314–2318.
Oliver G, Sosa-Pineda B, Geisendorf S, Spana EP, Doe
CQ, Gruss P. 1993. Prox 1, a prospero-related homeobox
gene expressed during mouse development. Mech Dev
44:3–16.
Petrova TV, Nykanen A, Norrmen C, Ivanov KI,
Andersson LC, Haglund C, Puolakkainen P, et al. 2008.
Transcription factor PROX1 induces colon cancer
progression by promoting the transition from benign
to highly dysplastic phenotype. Cancer Cell 13:407–
419.
Potzner MR, Tsarovina K, Binder E, Penzo-Mendez A,
Lefebvre V, Rohrer H, Wegner M, et al. 2010. Sequential
requirement of Sox4 and Sox11 during development of
the sympathetic nervous system. Development 137:775–
784.
Prada C, Puga J, P�erez-M�endez L, Lop�ez R, Ramirez G.
1991. Spatial and temporal pattern of neurogenesis in the
chick retina. Eur J Neurosci 3:559–569.
Rapaport DH, Wong LL, Wood ED, Yasumura D, LaVail
MM. 2004. Timing and topography of cell genesis in the
rat retina. J Comp Neurol 474:304–324.
Reiff T, Huber L, Kramer M, Delattre O, Janoueix-Lerosey
I, Rohrer H. 2011. Midkine and Alk signaling in sympa-
thetic neuron proliferation and neuroblastoma predisposi-
tion. Development 138:4699–4708.
Reiff T, Tsarovina K, Majdazari A, Schmidt M, del Pino I,
Rohrer H. 2010. Neuroblastoma phox2b variants stimu-
late proliferation and dedifferentiation of immature sym-
pathetic neurons. J Neurosci 30:905–915.
Rodriguez-Niedenfuhr M, Papoutsi M, Christ B, Nicolaides
KH, von Kaisenberg CS, Tomarev SI, Wilting J. 2001.
Prox1 is a marker of ectodermal placodes, endodermal
compartments, lymphatic endothelium and lymphangio-
blasts. Anat Embryol (Berl) 204:399–406.
Rohrer H. 2011. Transcriptional control of differentiation
and neurogenesis in autonomic ganglia. Eur J Neurosci
34:1563–1573.
Rohrer H, Acheson AL, Thibault J, Thoenen H. 1986.
Developmental potential of quail dorsal root ganglion cells
analyzed in vitro and in vivo. J Neurosci 6:2616–2624.
Rohrer H, Thoenen H. 1987. Relationship between differ-
entiation and terminal mitosis: Chick sensory and ciliary
neurons differentiate after terminal mitosis of precursor
cells whereas sympathetic neurons continue to divide
after differentiation. J Neurosci 7:3739–3748.
Rothman TP, Gershon MD, Holtzer H. 1978. The relation-
ship of cell division to the acquisition of adrenergic char-
acteristics by developing sympathetic ganglion cell
precursors. Dev Biol 65:321–341.
R€udiger R, Binder E, Tsarovina K, Schmidt M, Reiff T,
Stubbusch J, Rohrer H. 2009. In vivo role for CREB sig-
naling in the noradrenergic differentiation of sympathetic
neurons. Mol Cell Neurosci 42:142–151.
Sawai S, Shimono A, Wakamatsu Y, Palmes C, Hanaoka
K, Kondoh H. 1993. Defects of embryonic organogenesis
resulting from targeted disruption of the N-myc gene in
the mouse. Development 117:1445–1455.
Schmidt M, Huber L, Majdazari A, Schutz G, Williams T,
Rohrer H. 2011. The transcription factors AP-2beta and
AP-2alpha are required for survival of sympathetic pro-
genitors and differentiated sympathetic neurons. Dev
Biol 355:89–100.
1366 Holzmann et al.
Developmental Neurobiology
Straub JA, Sholler GL, Nishi R. 2007. Embryonic sympa-
thoblasts transiently express TrkB in vivo and proliferate
in response to brain-derived neurotrophic factor in vitro.
BMC Dev Biol 7:10.
Takahashi M, Yoshimoto T, Shimoda M, Kono T, Koizumi
M, Yazumi S, Shimada Y, et al. 2006. Loss of function of
the candidate tumor suppressor prox1 by RNA mutation
in human cancer cells. Neoplasia 8:1003–1010.
Takahashi T, Nowakowski RS, Caviness VS Jr. 1996. The
leaving or Q fraction of the murine cerebral proliferative
epithelium: A general model of neocortical neuronogene-
sis. J Neurosci 16:6183–6196.
Taverna E, Gotz M, Huttner WB. 2014. The cell biology of
neurogenesis: Toward an understanding of the develop-
ment and evolution of the neocortex. Annu Rev Cell Dev
Biol 30:465–502.
Torii M, Matsuzaki F, Osumi N, Kaibuchi K, Nakamura S,
Casarosa S, Guillemot F, et al. 1999. Transcription
factors Mash-1 and Prox-1 delineate early steps in
differentiation of neural stem cells in the developing cen-
tral nervous system. Development 126:443–456.
Tsarovina K, Pattyn A, Stubbusch J, M€uller F, Van der
Wees J, Schneider C, Brunet JF, et al. 2004. Essential
role of Gata transcription factors in sympathetic neuron
development. Development 131:4775–4786.
Tsarovina K, Schellenberger J, Schneider C, Rohrer H.
2008. Progenitor cell maintenance and neurogenesis in
sympathetic ganglia involves Notch signaling. Mol Cell
Neurosci 37:20–31.
Vessey JP, Amadei G, Burns SE, Kiebler MA, Kaplan DR,
Miller FD. 2012. An asymmetrically localized Staufen2-
dependent RNA complex regulates maintenance of mam-
malian neural stem cells. Cell Stem Cell 11:517–528.
Wildner H, Gierl MS, Strehle M, Pla P, Birchmeier C.
2008. Insm1 (IA-1) is a crucial component of the
transcriptional network that controls differentiation of
the sympatho-adrenal lineage. Development 135:473–
481.
Zackenfels K, Oppenheim RW, Rohrer H. 1995. Evidence
for an important role of IGF-I and IGF-II for the early
development of chick sympathetic neurons. Neuron 14:
731–741.
Prox1 in Sympathetic Neurogenesis 1367
Developmental Neurobiology