Prox1 Identifies Proliferating Neuroblasts and Nascent ...Prox1 Identiﬁes Proliferating...

Prox1 Identifies Proliferating Neuroblasts andNascent Neurons during Neurogenesis inSympathetic Ganglia

Julia Holzmann,1 Melanie Hennchen,1 Hermann Rohrer1,2

1 Max-Planck-Institute for Brain Research; Research Group Developmental Neurobiology,Max-von-Laue-Str. 4, 60438 Frankfurt/Main, Germany

2 Institute of Clinical Neuroanatomy, Goethe-University Frankfurt, Theodor-Stern-Kai 7,Frankfurt/Main, Germany

Received 20 February 2015; accepted 12 March 2015

ABSTRACT: Neurogenesis in embryonic sympa-

thetic ganglia involves neuroblasts that resume prolifera-

tion following neuronal differentiation. As cell cycle exit

is not associated with neuronal differentiation, the iden-

tity of proliferating neuroblasts is incompletely under-

stood. Here, we use sympathetic ganglia of chick

embryos to define the timing of neurogenesis and neuro-

blast identity focusing on the expression and function of

the transcription factor Prox1. We show that a large

fraction of neuroblasts has initially withdrawn from the

cell cycle at embryonic day 3 (E3), which is reflected by a

high proportion of p271/Islet1

1neuroblasts (63%) and

low numbers of EdU1

/Islet11

cells (12%). The propor-

tion of proliferating Islet11

neuroblasts, identified by

EdU pulse labeling and by the absence of the postmitotic

marker p27 increases to reach maximal levels at E5,

when virtually all neuroblasts are in the cell cycle (95%).

Subsequently, the proportion of EdU-labeled and p272

neuroblasts is reduced to reach low levels at E11. Inter-

estingly, the expression of the transcription factor Prox1

is restricted to the neuronal lineage, that is, Sox101/

Phox2b1 neuron progenitors, proliferating p272/Islet11

neuroblasts and nascent neurons but is rapidly lost in

postmitotic neurons. In vitro and in vivo knockdown and

overexpression experiments demonstrate effects of Prox1

in the support of neuroblast proliferation and survival.

Taken together, these results define the neurogenesis

period in the chick paravertebral sympathetic ganglia

including an initial cell cycle withdrawal and identify

Prox1 as a marker and regulator of proliferating

sympathetic neuroblasts. VC 2015 Wiley Periodicals, Inc. Develop

Neurobiol 75: 1352–1367, 2015

Keywords: sympathetic; neurogenesis; Prox1; prolifera-

tion; neuroblast

INTRODUCTION

Neurons are generated during neurogenesis from neu-

ral stem and progenitor cells. In most parts of the

nervous system proliferation, cell cycle exit and pro-

genitor differentiation are integrated into a coherent

developmental program, which ensures the genera-

tion of appropriate numbers of neuronal subtypes

(Nguyen et al., 2006; Centanin and Wittbrodt, 2014;

Taverna et al., 2014). In strong contrast, differentia-

tion is not linked to withdrawal from the cell cycle

during the generation of sympathetic neurons and

adrenal chromaffin cells (Rohrer, 2011). Sympathoa-

drenal progenitors in the anlagen of sympathetic gan-

glia and adrenal medulla continue to proliferate after

acquisition of neuronal characteristics (Rothman

et al., 1978; Rohrer and Thoenen, 1987; Gonsalvez

Correspondence to: H. Rohrer ([email protected]).Contract grant sponsor: Wilhelm-Sander-Stiftung (to H.R.);

contract grant number: 2010.004.1/2.� 2015 Wiley Periodicals, Inc.Published online 20 June 2015 in Wiley Online Library (wileyonli-nelibrary.com).DOI 10.1002/dneu.22289

1352

et al., 2013). Thus, the majority of postmitotic neu-

rons are generated from proliferating immature sym-

pathetic neurons termed neuroblasts. The observation

that tumors of the developing PNS are restricted to

sympathetic ganglia and the adrenal medulla (neuro-

blastoma) suggests that termination of neurogenesis

may be less tightly controlled when it is not linked to

differentiation (Maris et al., 2007; Cheung and Dyer,

2013). How neuroblast proliferation is controlled dur-

ing normal development and which signals may lead

to aberrant growth and neuroblastoma development

remains the focus of active investigation (Chesler

and Weiss, 2011; Reiff et al., 2011; Molenaar et al.,

2012; Cazes et al., 2014)

The homeodomain transcription factor Prox1 is

expressed in neuroblastoma and shows antiprolifera-

tive effects in neurobastoma cell lines, implicating a

function in the regulation of sympathetic neurogene-

sis (Becker et al., 2010; Foskolou et al., 2012). Prox1

is the vertebrate homologue of prospero, a key regu-

lator of neurogenesis in the Drosophila central nerv-

ous system (Doe et al., 1991; Myster and Duronio,

2000). Prospero is transiently expressed in neuro-

blasts and ganglion mother cells (GMCs) where it

induces differentiation and represses neuroblast-

specific and cell cycle genes (Hirata et al., 1995;

Choksi et al., 2006). In the absence of prospero, stem

cell-like cells accumulate (Betschinger et al., 2006).

In the developing vertebrate CNS, Prox1 is also tran-

siently expressed in progenitors of the embryonic tel-

encephalon, hippocampus, spinal cord, and retina and

in the external granular layer of the postnatal cerebel-

lum. Prox1 is not detected in nestin1, Sox21 neural

stem cell/progenitor cells of the ventricular zone but

marks subventricular zone (SVZ) cells during or

immediately after withdrawal from the cell cycle

(Torii et al., 1999; Lavado and Oliver, 2007; Misra

et al., 2008). Loss- and gain-of-function approaches

demonstrated essential functions for Prox1 in neuron

differentiation and maturation and in the survival of

intermediate progenitors (Dyer et al., 2003; Misra

et al., 2008; Kaltezioti et al., 2010; Lavado et al.,

2010; Karalay et al., 2011). With respect to progeni-

tor proliferation different effects were observed in

distinct neuronal lineages. In Prox1-deficient retina

the number of proliferating progenitors increased

(Dyer et al., 2003), implying an anti-proliferative

Prox1 function, whereas progenitor proliferation was

not affected by Prox1 knockdown in the dentate neu-

roepithelium (Karalay et al., 2011) and in the neural

tube (Misra et al., 2008). In the latter system, Prox1

is also not expressed in proliferating BrdU1 cells

(Misra et al., 2008; Kaltezioti et al., 2010). Thus, the

timing of expression with respect to cell cycle exit

and the function of Prox1 is context dependent and

varies between different neuronal lineages.

Here, we have analyzed the expression of Prox1 in

developing sympathetic ganglia, using the chick

embryo for high resolution of embryonic develop-

ment. Prox1 expression is restricted to the neuronal

lineage and is initiated in Sox101/Phox2b1 sympa-

thetic neuron progenitors. Subsequently, Prox1 is

observed in proliferating neuroblasts and is rapidly

lost in nascent postmitotic neurons identified by the

expression of p27. Neurogenesis in chick sympathetic

ganglia involves an initial phase at embryonic day 3

(E3) with a large fraction of neuroblasts that have

withdrawn from the cell cycle, followed by a peak in

proliferation at E5 when virtually all neuroblasts are

cycling and a decline of neurogenesis to reach back-

ground levels at E11. These findings establish Prox1

as a marker for neuroblasts in the cell cycle and nas-

cent neurons. Overexpression and knockdown results

implicate functions for Prox1 in the maintenance of

neuroblast proliferation and survival rather than in

cell cycle exit.

METHODS

Animals, Tissue Fixation, and Sectioning

Developmental stages of chicken embryos were determined

according to Hamburger Hamilton (Hamburger and Hamil-

ton, 1951). Embryos (HH 19–HH 38) were fixed in 4%

paraformaldehyde in 0.1 M sodium phosphate buffer for

short time periods, between 13 min and 120 min, depending

on embryonic stage. The fixative was replaced by 15%

sucrose in 0.1 M sodium phosphate buffer overnight. For

immunostaining, cryosections of 14 mm were prepared at

thoracic level. Chick embryos that are referred to as E3 and

E5 are at HH 21 and HH 27, respectively. In the dataset

shown in Figure 1, E3 and E5 embryos were staged as HH

19 and HH 26, respectively.

Immunostaining

Sections were washed for 10 min with PBS, treated with

blocking buffer (10% fetal calf serum, 0.5% or 2% Tri-

tonX100 in PBS) for 1 h and incubated overnight at 4�C in

blocking buffer. After repeated washing steps (PBS with

0% or 0.2% TritonX100) secondary antibodies were added

for 1–3 h at room temperature in blocking buffer. Stained

sections were coverslipped after washing with PBS/

0.2%TritonX100 and/or PBS. Detection of Prox1 was

enabled using a rabbit polyclonal Prox1 antibody (102-

PA32; 1:300; ReliaTech, Wolfenb€uttel, Germany) or by a

mouse monoclonal antibody (MAB5654; 1:500; Millipore,

Schwalbach, Germany). Antibodies against Islet1 (1:20;

39.4D5, and 1:50; 40.2D6) and gag (1:50; AMV-3C2) were

Prox1 in Sympathetic Neurogenesis 1353

Developmental Neurobiology

both mouse monoclonal and obtained at Developmental

Studies Hybridoma Bank (Iowa City, IA). Sox10 antibody

(1:500; rabbit, polyclonal) was purchased from Abcam

(Cambridge, England) and Phox2b (1:50; H-20, goat, pol-

yclonal) from Santa Cruz Biotechnology (Dallas, TX).

P27kip antibody (1:500; mouse, monoclonal) was

obtained from BD Transduction Laboratories (Heidelberg,

Germany). The TH mouse monoclonal antibody was gen-

erated and characterized previously (Rohrer et al., 1986;

Bonnefoy et al., 1988). The secondary antibodies were

labeled with Alexa488, Alexa546, Alexa647, and Cy3.

Subtype specific secondary antibodies goat anti-mouse

IG1, goat anti-mouse IG2a, and goat anti-mouse IG2b

were used for double staining with two mouse primary

antibodies (1:500; Life technologies, Karlsruhe, Ger-

many). Cell nuclei were visualized with DAPI (Sanofi

Aventis, Frankfurt, Germany).

Quantification of p27, Prox1, and Islet1Expressing Cells

To quantify the cellular composition of sympathetic gan-

glia at E5, E7, E9, and E11, double staining for Islet1 and

Prox1, Islet1 and p27, and Prox1 and p27 were performed

and quantified. At E5, E7, and E9 �97% of Prox1-positive

cells in sympathetic ganglia co-express Islet1. At E11, this

is the case for 93% of all Prox1-positive cells. For simplic-

ity, it was assumed that all Prox1 cells co-express Islet1.

The proportion of Islet1, Prox1, and p27 cells was calcu-

lated as detailed in the following. The percentage of Islet1

cells that co-express Islet1, Prox1, and p27 [Fig. 5(B), red

bar] is obtained by multiplying the percentage of Prox11

cells co-expressing p27 (Prox11p271/Prox11) with the

proportion of Islet11 cells co-expressing Prox1

(Islet1Prox11/Islet11). The population of Islet11/ p271

cells [Fig. 5(B) blue bar] was calculated by subtracting the

proportion of cells that co-express Islet1, Prox1, and p27

(red bar) from the proportion of Islet1 and p27 double pos-

itive cells (Islet11p271/Islet11). Likewise, the percentage

of Islet1 and Prox1-positive cells [Fig. 5(B), yellow bar]

results from subtracting the proportion of cells that

express Islet1, Prox1, and p27 (red bar) from the quanti-

fied proportion of Islet1 and Prox1 double positive cells

(Islet11Prox11/Islet11). The population of Islet1 cells

that neither co-express Prox1 nor p27 is calculated by sub-

tracting the yellow, blue, and red bar from the proportion

of total Islet1-positive cells (100%). Error bars (mean-

6 sem) were calculated according to Gaussian error

propagation.

Proliferation Analysis In Vivo

To visualize proliferating cells, chicken embryos were

pulsed with EdU (500 mL, 500 mM EdU in PBS) for 4 h.

The EdU signal was detected using the Click-iTVR EdU

Alexa FluorVR 647 Imaging Kit (Life technologies, Karls-

ruhe, Germany) according to manufacturer’s protocol.

For double staining with Prox1 antibody (mouse,

monoclonal), immunostaining was performed before the

detection of EdU-positive cells. To determine the propor-

tion of Prox1/EdU double positive cells within the Islet1/

EdU double positive population [Fig. 6(B)], the propor-

tion of Prox1/EdU double positive cells (Prox11EdU1/

Prox11) was multiplied with the population of Prox1

Islet1 double positive cells (Islet11Prox11/Islet11),

which was established in a previous analysis (Fig. 2).

Error bars were calculated according to Gaussian error

propagation.

Figure 1 Islet1 is an early marker for the sympathetic neu-

ron lineage. (A) Double-immunostaining for Islet1/Sox10

and Islet1/TH in sections of E3 (HH 19) and E5 (HH 26)

sympathetic ganglia. Islet1 and Sox10 are expressed in non-

overlapping populations at E5. At E3, a very low propor-

tion of Sox101/Islet11 cells is detected (arrowhead). Islet1

and TH are co-expressed in the vast majority of E5 gan-

glion cells, whereas most Islet11 cells are devoid of TH-

immunoreactivity at E3. (B) Quantification of Islet11/TH1,

Islet11/TH2, and Islet12/TH1 cells at E3 (HH 19), E4

(HH 24), and E5 (HH 26) (mean 6 sem; n 5 3). Scale bars

20 mm. [Color figure can be viewed in the online issue,

which is available at wileyonlinelibrary.com.]

1354 Holzmann et al.


http://wileyonlinelibrary.com

qRT-PCR on Ciliary Ganglia

qPCR analyses were performed as previously described

(Huber et al., 2012). At least triplets of every condition

were performed in parallel. GAPDH was used as reference

gene. Data were evaluated using the delta-delta Ct-method.

Experiments were repeated independently three times and

statistically analyzed using unpaired two-tailed Student’s t-test. Primer pairs were analyzed for efficiency (�95%) and

used for quantitative analyses. Prox1 for: CATTCAGATG-

GAGAA; Prox1 rev: TGGAACCTGCTCAAA; GAPDH

for: ATCCTAGGATACACAGAGGAC; GAPDH rev:

ATTGTCATACCAGGAAACAAGC

Primary Sympathetic Neuron CulturePreparation and Transfection

Embryonic paravertebral lumbosacral sympathetic gan-

glia were gathered from embryonic day 7 (E7) chicken

embryos and dissociated as previously described (Rohrer

and Thoenen, 1987; Zackenfels et al., 1995). For electro-

poration an Amaxa Basic Neuron Small Cell Number

(SCN) Nucleofector Kit was used according to manufac-

turer’s protocol (400.000 cells, Program: SCN #2, trans-

fection efficiency � 50%). pmax-GFP of 0.5 mg (Lonza,

Cologne, Germany) was mixed with either 0.5 mg

pCAGGS (control), 0.16 mg pCAGGS-Prox1, or 0.5 mg

dsRed-shProx1. Transfected cells were plated on poly-

DL-ornithin/laminin-coated 4-well culture dishes and cul-

tured for 2 days in MEM, 10% horse serum, 5% FCS,

1% glutamine, 1% penicillin, and 1% streptomycine at

37�C and 5% CO2. EdU was added to the culture

medium 24 h before fixation (1:1000, Life technologies,

Karlsruhe, Germany). Cells were fixed with 4% paraformal-

dehyde for 15 min and stained using the Click-iTVR EdU

Alexa FluorVR 594 Imaging Kit (Life technologies,

Karlsruhe, Germany) according to manufacturer’s protocol.

Plasmids contain the coding sequence of mouse Prox1 and a

shProx1 construct (described in Kaltezioti et al., 2010),

respectively, and were kindly provided by P. Politis

(Biomedical Research Foundation, Athens, Greece).

Overexpression and Knockdown ofProx1 In Vivo

For virus infections, replication-competent avian sarcoma

(RCAS) constructs containing a mouse Prox1 coding

sequence (RCAS-BP(B)-Prox1) and a shProx sequence

(RCAS-BP(A)-shProx1) were designed. The RCAS vector

was used and modified as described previously (Tsarovina

et al., 2004). Insert sequences were extracted from

pCAGGS-Prox1 and dsRed-shProx1 plasmids, which were

kindly provided by P. Politis (Biomedical Research Foun-

dation, Athens, Greece). Fertilized virus and pathogen free

eggs (Charles River, Sulzfeld, Germany) were incubated

and infected with empty RCAS virus for control, RCAS-

Prox1 or RCAS-shProx1 virus concentrate as described

(R€udiger et al., 2009). Embryos were kept until stage St26/

27 or St30/31, pulsed with EdU (500 mL, 500 mM EdU in

PBS) for 4 h and fixed in 4% paraformaldehyde.

Figure 2 Prox1 expression during sympathetic ganglion

development. (A) The proportion of Islet11 neuroblasts that

express Prox1 was determined by double-immunostaining

on frozen sections of E3, E5, E7, and E9 embryos. (B)

Quantification of the proportion of Prox11 neuroblasts

(mean 6 sem; n 5 3–5). Scale bars 20 mm. (C) Sox101 cells

co-expressing Prox1 (indicated by arrows) were observed at

E3 but not at E5. [Color figure can be viewed in the online

issue, which is available at wileyonlinelibrary.com.]




RESULTS

Temporally Restricted Expression ofProx1 in the Sympathetic Neuron Lineage

The generation of postmitotic sympathetic neurons is

not associated with a change in the expression of the

transcription factors Hand2, Insm1, Ascl1, Sox11,

and Phox2b that affect, at least transiently sympa-

thetic neuroblast proliferation during early develop-

ment (Hendershot et al., 2008; Wildner et al., 2008;

Morikawa et al., 2009; Coppola et al., 2010; Potzner

et al., 2010). Given that Prox1 regulates the exit of

progenitor cells from the cell cycle in the embryonic

mouse retina (Dyer et al., 2003), inhibits proliferation

in neuroblastoma cell lines (Foskolou et al., 2012)

and defines nascent neurons in the spinal cord and

telencepahlon (Misra et al., 2008; Kaltezioti et al.,

2010; Vessey et al., 2012), it was of interest to

analyze the expression of Prox1 in the developing

sympathetic neuron lineage.

To determine the identity of Prox1 expressing

cells in developing sympathetic ganglia, Sox10 was

used as marker for neural crest progenitor and glial

cells and Islet1 as marker for neuroblasts and neu-

rons. Islet1 and Sox10 are expressed in largely non-

overlapping populations at E3 and E5 with a very

small proportion of double-labeled cells at E3 (about

1%) and no double-labeled cells at E5 [Fig. 1(A)].

Islet1 is co-expressed with the adrenergic marker

tyrosine hydroxylase (TH) in E4 and E5 sympathetic

ganglia but shows an earlier onset of expression as

indicated by the presence of Islet11/TH2 cells at E3

[Fig. 1(A,B)]. A minor population of TH1/Islet12

cells was also detected but this most likely reflects

the difficulty to associate cytoplasmic and nuclear

staining. As Islet1 has the advantage of nuclear

localization, which allows unambiguous quantifica-

tion of co-labeled nuclear antigens like Prox1 and is

an earlier marker than TH, Islet1 is used as marker

for the sympathetic neuron lineage.

During the initial phase of neurogenesis (E3),

which involves the generation of sympathetic neuro-

blasts from undifferentiated Sox10-positive progeni-

tors (Tsarovina et al., 2008), Prox1 is expressed in

subpopulations of Sox101 progenitors (18 6 1%;

mean 6 sem; n 5 6) and Islet11 cells (37 6 7%;

mean 6 sem; n 5 5) [Fig. 2(A, a-c); Fig. 2(B, a-c)].

At E5, Prox1 is no more observed in Sox10-positive

cells [Fig. 2(C, d-f)], but is restricted to Islet11 neu-

roblasts and neurons [Fig. 2(A, d-f)].

To address the identity of Prox11/Sox101 cells at

E3, triple staining for Prox1, Sox10, and Phox2b was

performed. The vast majority of Prox1-positive cells

Figure 3 Timing of neurogenesis during sympathetic ganglion development. (A–D) The proportion

of Islet11 neuroblasts that has left the cell cycle was analyzed by staining for p27 on frozen sections

at different developmental stages (E3–E11). (E) Quantification of p271/Islet11 cells. (F–I) Islet11

cells that are in S-Phase of the cell cycle were identified by a 4 h EdU pulse and co-staining for EdU

and Islet1. (J) Quantification of EdU1/Islet11 cells. Neurogenesis extends from E3 to E11 with a

peak of proliferation at E5–7. Please note a high proportion of newly generated neuroblasts at E3 that

do not proliferate. Data shown are the mean 6 sem of five independent experiments. Scale bars

20 mm. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]




at E3 are also co-expressing Phox2b (90 6 4%;

n 5 4; mean 6 sem) which includes a population of

Prox11/Phox2b1/Sox101 cells (23 6 3% of Prox11

cells; n 5 4; mean 6 sem). This suggests that Prox1

expression is initiated in Phox2b1/Sox101 neuron

progenitors generated in a Notch-dependent manner

as previously described (Tsarovina et al., 2008).

Notably, only very few Prox11/Sox101/Phox2b2

cells are present in E3 ganglia (1.4 6 0.5% of

Sox101 cells; mean 6 sem; n 5 4), which indicates

that Prox1 expression is restricted to sympathetic

neuron progenitors rather than to Sox101 neural crest

or developing satellite glia cells.

Prox1 expression in Islet11 neuroblasts increases

rapidly from 37 6 7% (mean 6 sem; n 5 3–5) at E3

to 90 6 4% at E4 (not shown) and 93 6 1% (mean-

6 sem; n 5 3) at E5 and subsequently decreases to

reach background levels at E12 (1.5 6 0.2%; mean-

6 sem; n 5 3) [Fig. 2(A,B)]. The decrease of Prox1

expression during development correlates with the

reduced number of proliferating neuroblasts previ-

ously observed in vivo and in cultured sympathetic

ganglion cells (Rothman et al., 1978; Rohrer and

Thoenen, 1987; Rohrer, 2011). As timing and extent

of neurogenesis in chick sympathetic ganglia were

not known in sufficient detail, proliferating sympa-

thetic neuroblasts are quantified between E3 and E11

by determining the proportion of Islet11 S-phase

cells using EdU labeling. In parallel, the population

of Islet11 cells that have left the cell cycle was quan-

tified by staining for the cyclin-dependent-kinase

inhibitor protein p27. P27 promotes cell cycle exit in

cultured sympathetic neuroblasts (Reiff et al., 2010)

and marks non-cycling neurons in sympathetic gan-

glia, as revealed by a very low proportion of p27 cells

labeled by a 30 min in vivo EdU pulse at E7

(1.2 6 0.2%; mean 6 sem; n 5 3), which demon-

strates that S-phase neuroblasts are virtually devoid

of p27. In addition, only a small fraction of mitotic

E7 neuroblasts (PH31) co-express p27 (10 6 2%).

At E3, during initial differentiation of sympathetic

progenitors a large proportion of Islet11 cells

co-express p27 (63 6 4%, mean 6 sem; n 5 5) [Fig.

3(A,E)]. Subsequently, p27 expression decreases to

Figure 4 Location of Prox1 expressing cells in sympathetic ganglia. Double-immunostaining for

EdU/ Prox1 (A) and p27/Prox1 (B) on E7 sympathetic ganglion sections. Prox1-expressing and

EdU-labeled cells are mainly located at the ganglion periphery (A, a-c), whereas p27-expressing

neuroblasts are located in the ganglion core (B, b-c). Arrows in (A) and (B) point to EdU/Prox1

and p27/Prox1 double-labeled cells, respectively. Scale bars 20 mm. [Color figure can be viewed in

the online issue, which is available at wileyonlinelibrary.com.]




very low numbers at E5 (6.6 6 1.7%; mean 6 sem;

n 5 5) to gradually increase to 90 6 2% at E11

(mean 6 sem; n 5 5) [Fig. 3(A–E)]. The high propor-

tion of p271/Islet11 cells at E11 demonstrates that

p27 is maintained in mature sympathetic neurons

[Fig. 3(A–E)]. Islet11 cells that are devoid of p27

can, therefore, be considered as cycling sympathetic

neuroblasts (growth fraction) representing >90% of

neuroblasts at E5, whereas only about 10% are still in

the cell cycle at E11. Sympathetic neuroblast prolif-

eration was also analyzed by determining the propor-

tion of Islet1 positive cells that are in S-phase, using

EdU pulse labeling. Proliferation is maximal at E5–7

(23 6 2% and 25 6 2%, mean 6 sem; n 5 5) and is

decreased to very low levels at E11 (2.6 6 0.3; mean-

6 sem; n 5 5) [Fig. 3(F–J)]. Interestingly, E3 sympa-

thetic ganglia show a low proportion of Islet11

neuroblasts in S-phase (12 6 3%; mean 6 sem;

n 5 5), which is in agreement with the high percent-

age of p271 cells [Fig. 3(E,J)]. The large proportion

of p271/EdU2/Islet11 neuroblast during initial neu-

rogenesis at E3 reinforces previous observations that

initial generation of TH1/Tuj11 neuroblasts from

Sox101 progenitors correlates with a transient cell

cycle withdrawal in the mouse stellate ganglion

(Gonsalvez et al., 2013). The similar proportions of

neuroblasts that express Prox1 and are in the cell

cycle [compare Figs. 2(B) and 3(E,J)] point to an

association of Prox1 with proliferating neuroblasts

throughout neurogenesis (E3–E11). This is supported

by the observation that Prox1-expressing neuroblasts

are EdU-labeled and mainly located at the ganglion

periphery [Fig. 4(A)], whereas p271/Prox12 neuro-

blasts occupy the ganglion core [Fig. 4(B)]. Together,

these findings raise the questions how strict Prox1

expression is linked to cycling cells and in which

way proliferation may be controlled by Prox1.

Is Prox1 Expression Restricted to CyclingNeuroblasts?

The decrease of Prox1 expression at the end of neuro-

genesis demonstrates that Prox1 is not maintained in

mature sympathetic neurons. It remained unclear,

however, whether Prox1 is expressed only in cycling

neuroblasts or also in nascent postmitotic neurons that

withdraw from the cell cycle. To address this issue

we first investigated whether Prox1 is also present in

p27-positive sympathetic neurons. Indeed, virtually all

newly generated p271 neurons that become postmi-

totic at E5 co-express Prox1. This is deduced from

the observation that 87 6 4% (mean 6 sem; n 5 5) of

p271 cells co-express Prox1 [Fig. 5(A,B)] and Islet1

(87 6 4%; mean 6 sem; n 5 5) at E5. During develop-

ment the proportion of p271 cells co-expressing

Prox11 decreases to 5 6 1% (mean 6 sem; n 5 4) at

E11. Conversely, the proportion of Prox11 cells that

co-express p27 is very low during the peak of neuro-

genesis (E5, E7) but increases toward the end of neu-

rogenesis to about 35 6 2% (mean 6 sem; n 5 4) at

E11 [Fig. 5(A)]. Referred to the total ganglion popula-

tion the percentage of Prox11/p271 cells (red bars)

remains relatively constant [Fig. 5(B)]. As expected

from the transient co-expression, double positive cells

show a weak fluorescence signal for Prox1, p27, or

both [Fig. 4(B)]. Together, this suggests that Prox11/

p271 cells represent nascent neurons that downregu-

late Prox1 in more differentiated stages.

In a second approach, we determined the propor-

tion of Prox11 neuroblasts in S-phase by EdU-

labeling [Fig. 6(A)]. The population co-expressing

Figure 5 Prox1 is expressed in nascent postmitotic sym-

pathetic neurons. (A) The proportion of p271 postmitotic

neurons that co-express Prox1 (- W -) and the proportion of

Prox11 cells that express the postmitotic neuron marker

p27 (– w –) were analyzed (mean 6 sem; n 5 4–5). (B)

Combined quantification of the proportion of Islet11 cells

co-expressing Prox1 (yellow), p27 (blue), Prox1 and p27

(red), and Islet11 cells devoid of Prox1 and p27 (green) at

E5, E7, E9, and E11. Each bar represents 100% of Islet11

cells. The proportions are calculated from the quantification

of Prox11/Islet11 cells (Fig. 2), p271/Islet11 (Fig. 3)

p271/Prox11, and Prox11/p271 as described in METH-

ODS. Errors (sem) are calculated according to Gaussian

error propagation. [Color figure can be viewed in the online





Prox1 and Islet1 as compared to the Islet11 popula-

tion displayed a higher proportion of EdU-labeled

cells at E7 and E9 [compare Figs. 3(J) and 6(A)].

This finding is expected, as Prox1 expression is

largely restricted to the p27 negative growth fraction

[Fig. 5(B)]. It should be noted, however, that prolifer-

ating Prox12/Islet11/EdU1 cells also contribute to

sympathetic neurogenesis as revealed by quantifying

the proportion of EdU-labeled Prox11 and Prox12

neuroblasts [Fig. 6(B)]. The proportion of proliferat-

ing Prox12 neuroblasts increases toward the end of

neurogenesis [Fig. 6(B)].

Prox1 Expression in the ParasympatheticCiliary Ganglion

Neurogenesis in the parasympathetic ciliary ganglion

proceeds like in the CNS or DRG by proliferation of

progenitor cells that start to differentiate on cell cycle

exit. Neuron birth in the quail ciliary ganglion is

maximal at E3/4 and the last ciliary ganglion neurons

are born at E5, which corresponds to about E5.5 in

the chick (Dupin, 1984). Differentiated parasympa-

thetic neurons, although they are closely related to

sympathetic neurons do not proliferate (Rohrer and

Thoenen, 1987; Huber et al., 2012). Thus, it was of

interest to investigate whether Prox1 is expressed in

proliferating progenitors, nascent and/or mature ciliary

neurons. This question was addressed by immunostain-

ing and qPCR. Prox1 expression analyzed by immuno-

staining in sections of E4 and E5 ciliary ganglia was

virtually absent in Islet1-negative progenitors

(Prox11/Islet12 cells at E4: 0.9 6 0.5%, at E5:

0.2 6 0.1%; mean 6 sem; n 5 3, compared to the num-

ber of Islet11cells). A very low proportion of Islet11

cells co-expressed Prox1 (E4: 6 6 1%; E5:

1.1 6 0.6%; mean 6 sem; n 5 3) [Fig. 7(B)], in con-

trast to the situation in E7 sympathetic ganglia [Figs.

7(A) and 2(A)]. The low level of Prox1 expression in

ciliary ganglia was confirmed by qRT-PCR analysis,

showing 66 and 250-fold lower Prox1 signals at E5

and E9, respectively as compared to E7 sympathetic

ganglia [Fig. 7(C)]. The restriction of Prox1 expression

to a small subpopulation of ciliary ganglion cells is

surprising considering the expression in a large num-

ber of neuronal lineages. Conversely, it supports the

evidence for strong differences in the control of neuro-

genesis between sympathetic and parasympathetic

ganglia, reflected by the differential expression of pro-

liferation regulators like Midkine, AP-2b, Hand2, and

Gata2 (M€uller and Rohrer, 2002; Tsarovina et al.,

2004; Reiff et al., 2011; Schmidt et al., 2011).

Prox1 Supports Proliferation of CulturedSympathetic Neurons

To study the function of Prox1 in the control of sym-

pathetic neuron proliferation, cultures of E7 chick

Figure 6 Prox1 is expressed in proliferating sympathetic neuroblasts. (A) The proportion of Prox11

neuroblasts that are in the S-phase is quantified by 4 h EdU-labeling (mean 6 sem; n 5 4–5). (B)

Quantification of Prox11 and Prox12 EdU-labeled neuroblasts at E5, E7, and E9. The proportion of

EdU1/Prox12/Islet11 cells was determined as described in METHODS. The majority of proliferating

EdU1 neuroblasts expresses Prox1, but proliferating Prox12 neuroblasts also contribute to neurogen-

esis. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]




sympathetic ganglia were used that respond to extrin-

sic and intrinsic proliferation signals like IGFs,

BDNF, BMP4, Alk, Phox2b, MycN, p27, and Hand2

(Zackenfels et al., 1995; Straub et al., 2007; Reiff

et al., 2010; Reiff et al., 2011). For Prox1, overex-

pression or knockdown dissociated ganglion cells

were co-transfected by electroporation with expres-

sion plasmids coding for GFP and either Prox1 or

shProx1. Proliferation was analyzed by determining

the proportion of EdU-labeled transfected GFP1

cells. We observed a significant, albeit small reduc-

tion (by 19 6 5%) in the number of EdU1 cells on

shRNA-mediated Prox1-knockdown (Fig. 8). The

specificity of this effect is demonstrated by co-

expression of shRNA with full length Prox1, which

rescues the knockdown effect. Prox1 overexpression

significantly increases sympathetic neuron prolifera-

tion but the effect is small compared to that of Insm1

overexpression used as internal control (Fig. 8) and

previously demonstrated effects of Alk and Hand2

(Reiff et al., 2010; Reiff et al., 2011). The effect

of Prox1 knockdown and overexpression was

controlled by determining the proportion of Prox1-

immunoreactive neurons in control transfected cells

and cells transfected with shProx1 or Prox1. About

50% (50 6 1%; mean 6 sem; n 5 4) of sympathetic

neurons were Prox1-immunoreactive in control trans-

fections, which is close to the in vivo situation [Fig.

3(E)]. The proportion of Prox1 cells was significantly

decreased in the cells transfected with shRNA

(33 6 6%; mean 6 sem; n 5 4) and increased on

transfection with Prox1 (78 6 5%; mean 6 sem;

n 5 4).

Taken together, these results demonstrate that

Prox1 is involved in the proliferation of cultured

sympathetic neuroblasts. To investigate the physio-

logical relevance of these in vitro observations,

Prox1 expression was also modified in vivo, in devel-

oping chick embryos.

Figure 7 Prox1 is expressed in a small minority of ciliary ganglion cells. (A) Prox1 immunostaining

in sections of E7 sympathetic ganglia and (B) E5 ciliary ganglia demonstrate the absence of Prox1 in

the vast majority of ciliary ganglion cells. The arrow points to a Prox1-expressing cell. (C) qRT-PCR

analysis confirms the massively reduced expression of Prox1 mRNA in E5 and E9 ciliary ganglia

compared to E7 sympathetic ganglia (E5: 0.015 6 0.008; E9: 0.004 6 0.001; n 5 3). Scale bars

20 mm. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Figure 8 Prox1 knockdown and overexpression affects

neuroblast proliferation in vitro. E7 sympathetic neuro-

blasts were transfected with expression vectors for shProx1,

Prox1, and empty control vector as indicated. Transfected

cells were identified by co-electroporation of a GFP expres-

sion vector. Proliferating cells were quantified by determin-

ing the proportion of EdU/GFP double positive neuroblasts

after 2 days in vitro (mean 6 sem; n 5 5–18; **p� 0.001,

***p� 0.0001, significantly different from control).




RCAS-Mediated Expression of Prox1 andshProx1 in Developing SympatheticGanglia

Prox1 levels in sympathetic ganglion cells were

altered by retroviral expression of Prox1 and

shProx1. Neural crest cells were infected with

RCAS-Prox1 and RCAS-shProx1 virus concentrate

before migration to the vicinity of the dorsal aorta

(R€udiger et al., 2009; Reiff et al., 2011). Embryos

were analyzed after a 4 h EdU pulse at E7 for RCAS-

infection by staining for the avian leukosis virus spe-

cific gag polyprotein. Strongly infected ganglia were

then analyzed in parallel sections for the proportion

of Islet11 neuroblasts labeled with EdU [Fig. 9(A)].

In addition, the number of Islet11 cells per ganglion

area was determined.

A reduced number of Islet1-positive cells was

observed in embryos infected with RCAS-shProx1 as

compared to embryos with Prox1 overexpression

[Fig. 9(C)]. Compared to controls infected with

empty RCAS (gray bar) this effect did not reach sig-

nificance. The number of EdU1/Islet11 cells was not

affected in these experiments [Fig. 9(B)]. At earlier

stages (E5; HH 26/27), Prox1 overexpression or

knockdown did neither affect neuroblast proliferation

nor the number of Islet1-positive cells (not shown).

DISCUSSION

Sympathetic neurogenesis proceeds in two phases, an

early phase characterized by the generation of

Figure 9 In vivo knockdown and overexpression of Prox1 in sympathetic ganglia. (A) RCAS-

shProx1, RCAS-Prox1, and control RCAS were used to infect neural crest cells. Sympathetic gan-

glia of infected embryos were analyzed at E7 for the proportion of proliferating EdU1/Islet11 neu-

roblasts and for the number of Islet11 neuroblasts and neurons per section (a–c). [(c) represents the

merge of independent pictures of two consecutive sections.] (B) Quantification of neuroblast prolif-

eration (mean 6 sem; n 5 3–4). (C) Quantification of Islet11 neuroblast/neuron number per section

(mean 6 sem; n 5 3–4). *p� 0.05. Scale bars 20mm. [Color figure can be viewed in the online





differentiated neuroblasts from undifferentiated neu-

ral crest progenitor cells and a second phase where

neuroblasts proliferate and give rise to postmitotic

neurons. We now demonstrate that during the early

phase a large proportion of neuroblasts in E3 chick

ganglia have withdrawn from the cell cycle whereas

at E5 in the second phase virtually all neuroblasts are

in the cell cycle. Similar observations have previ-

ously been made in the developing mouse stellate

ganglion (Gonsalvez et al., 2013). Together, these

findings suggest a transient cell cycle withdrawal of

initially generated neuroblasts followed by continu-

ous neuroblast proliferation, which results in the pro-

duction of postmitotic sympathetic neurons up to at

least E11. Expression of the transcription factor

Prox1 is restricted to the period of neurogenesis and

marks the majority of cycling cells as well as nascent

postmitotic cells. In vitro and in vivo gain- and loss-

of-function experiments are compatible with a func-

tion of Prox1 supporting proliferation and survival of

neuroblasts rather than cell cycle exit. Our findings

delineate the timing of sympathetic neurogenesis,

identify a transient cell cycle withdrawal in chick

sympathetic neuroblasts and characterize Prox1 as a

gene transiently expressed during neurogenesis.

Neurogenesis in Chick SympatheticGanglia

The generation of neurons in most parts of the nerv-

ous system involves proliferation of undifferentiated

progenitors and continuous increase in the production

of differentiated neurons during the period of neuro-

genesis. This pattern is observed for neuronal line-

ages in the CNS, for example, neocortex and retina

(Prada et al., 1991; Alexiades and Cepko, 1996;

Takahashi et al., 1996; Rapaport et al., 2004) as well

as during neurogenesis in various parts of the PNS,

including sensory and parasympathetic ganglia (Carr

and Simpson, 1978; Lawson and Biscoe, 1979;

Dupin, 1984; Gonsalvez et al., 2013; Gonsalvez

et al., 2014). Neurogenesis in sympathetic ganglia

has previously been analyzed in the chick embryo

focusing on the relationship between cell division

and the acquisition of neuronal characteristics

(Cohen, 1974; Rothman et al., 1978; Rohrer and

Thoenen, 1987; Tsarovina et al., 2008). These studies

established that postmitotic neurons in sympathetic

ganglia, in contrast to other neuronal lineages are

generated by proliferating differentiated neuroblasts

rather than by progenitors that differentiate after cell

cycle exit. However, the timing and extent of neuro-

genesis, in particular the proportion of proliferating

neuroblasts at specific developmental stages

remained unclear. Here, we use p27 as marker for

postmitotic sympathetic neurons and demonstrate invivo that in E5 sympathetic ganglia virtually all neu-

roblasts are in the cell cycle, i.e. devoid of p27. With

increasing development the proportion of cycling

cells decreases to reach low levels at E11 (10%).

Timing and extent of neurogenesis revealed by quan-

tification of p27 expressing cells is confirmed by

EdU labeling. In the retina and spinal cord some pro-

genitors upregulate p27 to exit the cell cycle, whereas

others upregulate p57 (Dyer and Cepko, 2001; Gui

et al., 2007; Misra et al., 2008). p272 neuroblasts at

E11 may thus represent a distinct population that

uses a different type of cyclin-dependent kinase

inhibitor for cell cycle exit. The presence of S-phase

neuroblasts at E11 suggests, however, that p272 neu-

roblasts are still proliferating and will become post-

mitotic at later time points. Low numbers of

thymidine-labeled proliferating catecholaminergic

neuroblasts were observed previously until hatching

(Rothman et al., 1978).

We characterized an additional specific trait of sym-

pathetic neurogenesis, which is a high proportion of

neuroblasts that are arrested in the cell cycle at the

onset of neurogenesis. In E3 chick sympathetic gan-

glia, the majority of neuroblasts have withdrawn from

the cell cycle. This early phase of sympathetic neuro-

genesis is characterized by the generation of Islet11/

SCG101/Sox102 neuroblasts from Sox101/Phox2b1/

SCG102/Islet12 progenitors (Tsarovina et al., 2008

and present study). At E5 progenitors have differenti-

ated to SCG101/Islet11 neuroblasts and >90% of

them are in the cell cycle as shown by the absence of

p27 expression (Tsarovina et al., 2008 and present

study). The most straightforward interpretation of these

results is that nascent Islet11 sympathetic neuroblasts

during their differentiation from Sox101/Islet12 pro-

genitors transiently withdraw from the cell cycle,

induce p27 expression and subsequently re-enter the

cell cycle. In the mouse stellate ganglion, a complete

cell cycle arrest in nascent TH-expressing neuroblasts

was observed at E10.5 (Gonsalvez et al., 2013). The

complete proliferation block in mouse stellate ganglia

as compared to the partial effect in chick sympathetic

ganglia may be explained by the compressed and syn-

chronous kinetics of sympathetic neuron development

in the mouse versus extended development in the chick

embryo, as indicated by the restriction of Phox2b1/

TH2/TuJ12 progenitors in the mouse stellate ganglion

to E10.5 (Gonsalvez et al., 2013), whereas Phox2b1/

SCG102 progenitors are found in the chick embryo

from E3 to E5 (Tsarovina et al., 2008).

Alternative explanations for the transiently high

proportion of p271/Islet11 cells at the beginning of



sympathetic neurogenesis are that postmitotic neu-

rons are initially generated, which is followed by a

rapid decrease in the proportion of postmitotic neu-

rons (i) due to massive increase in neuroblast number

or (ii) due to neuron death. Overgrowth by proliferat-

ing neuroblasts is excluded, as five cell divisions are

required to reduce the proportion of p271 cells from

60% at E3 to 5% at E5, which is not possible with a

neuroblast cell cycle length of about 18 h (J. Holz-

mann, pers. comm.). Death of postmitotic neurons

would also explain the decrease in p271/Islet11 cells

between E3 and E5, but has been excluded for the

equivalent population in mouse stellate ganglia (Gon-

salvez et al., 2013). Thus, the most straightforward

explanation for the presence of p271 sympathetic

neuroblasts during early neurogenesis is a transient

withdrawal from the cell cycle. During neurogenesis

in the adult hippocampus p27 regulates quiescence of

neural stem cells, downstream of BMP signaling

(Mira et al., 2010; Andreu et al., 2014). A role of

BMPs in transient cell cycle exit of nascent sympa-

thetic neuroblasts seems unlikely, however, as canon-

ical BMP signaling is a positive regulator of

neuroblast proliferation in vivo (Buchmann-Moller

et al., 2009; Morikawa et al., 2009). All analyzed reg-

ulators, including Hand2 (Hendershot et al., 2008),

Sox11 (Potzner et al., 2010), Ascl1 (Morikawa et al.,

2009), Insm1 (Wildner et al., 2008), frizzeld-3 and b-

catenin (Armstrong et al., 2011), and MycN (Sawai

et al., 1993) that regulate proliferation in developing

sympathetic ganglia show a knockout phenotype with

impaired neuroblast proliferation rather than nascent

neuroblasts arrested in quiescence at E10.5. Thus, the

molecular mechanisms responsible for the entry and

exit from sympathetic neuroblast cell cycle arrest

remain elusive.

Prox1 Expression in Sympathetic andParasympathetic Neurogenesis

Prox1 mRNA expression in the developing CNS has

initially been found to be restricted to postmitotic,

undifferentiated young neurons in the SVZ (Oliver

et al., 1993). This has been confirmed for spinal cord

and cortex (Misra et al., 2008; Kaltezioti et al., 2010;

Vessey et al., 2012) but in other lineages Prox1 is

expressed additionally in proliferating progenitors or

differentiated mature neurons (Dyer and Cepko,

2000; Dyer et al., 2003; Lavado et al., 2010; Karalay

et al., 2011). Prox1 expression has been detected in

various parts of the developing vertebrate PNS,

including sensory and sympathetic ganglia, but not

investigated in detail (Rodriguez-Niedenfuhr et al.,

2001; Becker et al., 2010).

The present study identifies Prox1 as a marker for

cycling sympathetic neuroblasts that is expressed in a

pattern inverse to that of the postmitotic marker p27.

Throughout neurogenesis a small proportion of

Prox11/p271 co-expressing cells are observed. They

represent nascent sympathetic neurons, which have

left the cell cycle.

The transient presence of Prox1-expressing

Sox101 cells at E3 is explained by the onset of Prox1

expression in Phox2b-positive sympathetic neuron

progenitors that subsequently acquire neuronal prop-

erties like Islet1 and SCG10 (Tsarovina et al., 2004).

The restriction of Prox1 expression at E3 to only

37% of newly generated Islet1-positive cells argues

against a general role in the initiation of sympathetic

neuron differentiation. Notably, also at later stages of

neurogenesis Prox1 is never expressed in all Islet1-

positive sympathetic neuroblasts. Proliferating neuro-

blasts can be subdivided into a large population of

Prox11 and a minor fraction of Prox12 cells, raising

the question whether this may reflect predisposition

to different sympathetic neuron fates. The increase in

the proportion of proliferating Prox12 neuroblasts

during late stages of neurogenesis suggests that late

born sympathetic neurons are generated at least in

part from Prox12 neuroblasts. Distinct types of rat

sympathetic neurons withdraw from the cell cycle at

overlapping but different times, with late peaks of

cell cycle withdrawal for secretomotor and muscle

vasomotor neurons (Chubb and Anderson, 2010).

Thus, it would be of considerable interest to trace the

progeny of Prox1-expressing and Prox1-negative

sympathetic neuroblasts in vivo.

During neurogenesis in the parasympathetic ciliary

ganglion differentiation of neuron progenitor cells is

associated with cell cycle exit. Unexpectedly, Prox1

expression was detectable only in a small number of

ganglion cells at E4 and E5 when ciliary and choroid

neurons are born (Dupin, 1984). Prox1 is absent in

the vast majority of proliferating progenitors and nas-

cent neurons. Also mature E9 ciliary ganglion neu-

rons are devoid of Prox1. These findings add Prox1

to the list of genes differentially expressed between

sympathetic and parasympathetic genes.

Prox1 Function in SympatheticNeurogenesis

The expression of Prox1 in proliferating sympathetic

neuroblasts and nascent postmitotic neurons suggests

a function in the control of proliferation. Prox1 over-

expression in cultured sympathetic neuroblasts leads

indeed to increased proportion of proliferating EdU1

cells, whereas Prox1 knockdown results in reduced



proliferation. These findings exclude a function of

Prox1 in the termination of neuroblast proliferation

and rather indicate a role in the maintenance of pro-

liferation and/or survival of proliferating cells.

The effects observed in cultured primary sympa-

thetic neuroblasts differ from Prox1 response

observed in neuroblastoma cell lines (Foskolou et al.,

2012). In both mouse and human neuroblastoma cell

lines, Prox1 overexpression resulted in complete cell

cycle arrest, whereas Prox1 knockdown increased

proliferation. Interestingly, Prox1 induces cyclinE1,

which is sufficient to stimulate neuroblastoma prolif-

eration on overexpression. The antiproliferative

effect of Prox1 is mediated by p27 and cdc25A that

are induced by Prox1 and counteract cyclinE1 func-

tion (Foskolou et al., 2012). Differential cell type

specific activation of these antagonistic downstream

signal transduction pathways may explain the oppo-

site effects of Prox1 in sympathetic neuroblasts and

neuroblastoma cell lines. Indeed, endogenous Prox1

seems not induce p27 expression in neuroblasts dur-

ing normal development as indicated by the mirror

image expression of Prox1 and p27 in sympathetic

ganglia. Although p27 is a direct target of Prox1 in

neuroblastoma (Foskolou et al., 2012) and p27 over-

expression leads to cell cycle withdrawal of cultured

sympathetic neuroblasts (Reiff et al., 2010) our data

argue against a causal role of Prox1 alone in the onset

of p27 expression and cell cycle exit, in contrast to

the situation in neuroblastoma cell lines. Context-

dependent functions of Prox1 are not only evident

from the different effects of Prox1 in various neuro-

nal lineages (Dyer et al., 2003; Misra et al., 2008;

Karalay et al., 2011) but also by alternative roles in

different tissues and tumors where Prox1 either accel-

erates growth, as in lymphatic endothelial cells, liver

stem/progenitor cells and colon cancer (Kamiya

et al., 2008; Petrova et al., 2008; Baxter et al., 2011),

or suppresses proliferation as in hematopoietic stem

cells, neural progenitor cells, pancreatic and esopha-

geal cancer cell lines (Dyer et al., 2003; Takahashi

et al., 2006; Hope et al., 2010; Akagami et al., 2011).

Notably, the growth promoting activity of Prox1 in

lymphatic endothelial cells is mediated by increased

expression of the cyclinE1 gene, a direct target of

Prox1 (Baxter et al., 2011).

The in vitro results were tested by in vivo gain-

and loss-of-function experiments using retroviral

expression vectors (R€udiger et al., 2009; Reiff et al.,

2011). After infection of neural crest cells with

RCAS retrovirus to express Prox1 and shProx1 in

sympathetic ganglia, effects on the proportion of

EdU-labeled sympathetic neuroblasts were not

observed. However, a significant difference between

neuroblast numbers in Prox1 overexpressing ganglia

and Prox1 knockdown ganglia was detected, suggest-

ing effects of Prox1 on the survival of sympathetic

neuroblasts and/or neurons. The absence of prolifera-

tion effects in vivo may be explained by the larger

variability of in vivo data and insufficient infection of

the cells. It should also be pointed out that although

embryos with efficient RCAS infection of sympa-

thetic ganglia were selected the time of neuroblast

infection is unclear and may be too delayed to affect

Prox1 expression levels. Survival effects observed invivo but not in vitro in cultured E7 sympathetic gan-

glion cells may be due to culture conditions opti-

mized for sympathetic neuroblast and neuron

survival (Ernsberger et al., 1989), including extracel-

lular matrix and serum components that are absent invivo. Survival effects of Prox1 were previously

observed during adult neurogenesis in the dentate

gyrus in addition to effects on the differentiation of

nascent neurons (Lavado et al., 2010; Karalay et al.,

2011).

Conclusions

Our analysis of neuroblast proliferation in developing

chick sympathetic ganglia defines onset and termina-

tion of neurogenesis and provides a quantification of

the changing proportion of cycling neuroblasts in

sympathetic ganglia. A stage of transient cell cycle

withdrawal at the onset of neurogenesis was observed

in chick sympathetic ganglia. The transcription factor

Prox1 is expressed in neuron progenitors, proliferat-

ing neuroblasts and nascent neurons, and supports

neuroblast proliferation and survival. A minor popu-

lation of Prox12 neuroblasts, which increases during

late neurogenesis may represent a sublineage of late

born sympathetic neurons.

Thanks are due to Julia Andrees and Melanie Pulver for

excellent technical assistance and to Uwe Ernsberger and

Panagiotis Politis for helpful discussions and comments on

the manuscript.

REFERENCES

Akagami M, Kawada K, Kubo H, Kawada M, Takahashi

M, Kaganoi J, Kato S, et al. 2011. Transcriptional factor

Prox1 plays an essential role in the antiproliferative

action of interferon-gamma in esophageal cancer cells.

Ann Surg Oncol 18:3868–3877.

Alexiades MR, Cepko C. 1996. Quantitative analysis of

proliferation and cell cycle length during development of

the rat retina. Dev Dyn 205:293–307.



Andreu Z, Khan MA, Gonzalez-Gomez P, Negueruela S,

Hortiguela R, San Emeterio J, Ferron SR, et al. 2014. The

cyclin-dependent kinase inhibitor p27 regulates radial

stem cell quiescence and neurogenesis in the adult hippo-

campus. Stem Cells 33:219–229.

Armstrong A, Ryu YK, Chieco D, Kuruvilla R. 2011.

Frizzled3 is required for neurogenesis and target innerva-

tion during sympathetic nervous system development.

J Neurosci 31:2371–2381.

Baxter SA, Cheung DY, Bocangel P, Kim HK, Herbert K,

Douville JM, Jangamreddy JR, et al. 2011. Regulation of

the lymphatic endothelial cell cycle by the PROX1 home-

odomain protein. Biochim Biophys Acta 1813:201–212.

Becker J, Wang B, Pavlakovic H, Buttler K, Wilting J.

2010. Homeobox transcription factor Prox1 in sympa-

thetic ganglia of vertebrate embryos: Correlation with

human stage 4s neuroblastoma. Pediatr Res 68:112–117.

Betschinger J, Mechtler K, Knoblich JA. 2006. Asymmetric

segregation of the tumor suppressor brat regulates self-

renewal in Drosophila neural stem cells. Cell 124:1241–

1253.

Bonnefoy E, Ferrara P, Rohrer H, Gros F, Thibault J. 1988.

Role of the N-terminus of rat pheochromocytoma tyro-

sine hydroxylase in the regulation of the enzyme’s activ-

ity. Eur J Biochem 174:685–690.

Buchmann-Moller S, Miescher I, John N, Krishnan J, Deng

CX, Sommer L. 2009. Multiple lineage-specific roles of

Smad4 during neural crest development. Dev Biol 330:

329–338.

Carr VM, Simpson SB. 1978. Proliferative and degenerative

events in the early development of chick dorsal root gan-

glia I. Normal development. J Comp Neurol 182:727–740.

Cazes A, Lopez-Delisle L, Tsarovina K, Pierre-Eugene C,

De Preter K, Peuchmaur M, Nicolas A, et al. 2014. Acti-

vated Alk triggers prolonged neurogenesis and Ret upreg-

ulation providing a therapeutic target in ALK-mutated

neuroblastoma. Oncotarget 5:2688–2702.

Centanin L, Wittbrodt J. 2014. Retinal neurogenesis.

Development 141:241–244.

Chesler L, Weiss WA. 2011. Genetically engineered

murine models–contribution to our understanding of the

genetics, molecular pathology and therapeutic targeting

of neuroblastoma. Semin Cancer Biol 21:245–255.

Cheung NK, Dyer MA. 2013. Neuroblastoma: Develop-

mental biology, cancer genomics and immunotherapy.

Nat Rev Cancer 13:397–411.

Choksi SP, Southall TD, Bossing T, Edoff K, de Wit E,

Fischer BE, van Steensel B, et al. 2006. Prospero acts as

a binary switch between self-renewal and differentiation

in Drosophila neural stem cells. Dev Cell 11:775–789.

Chubb DP, Anderson CR. 2010. The relationship of the

birth date of rat sympathetic neurons to the target they

innervate. Dev Dyn 239:897–904.

Cohen A. 1974. DNA synthesis and cell division in differ-

entiating avian adrenergic neuroblasts. In: Fuxe K, Olson

L, Zotterman Y, Fuxe K, Olson L, Zotterman YS, editors.

Wenner-Gren Center International Symposion Series.

Oxford: Pergamon Press, pp 359–370.

Coppola E, d’Autreaux F, Rijli FM, Brunet JF. 2010.

Ongoing roles of Phox2 homeodomain transcription fac-

tors during neuronal differentiation. Development 137:

4211–4220.

Doe CQ, Chu-LaGraff Q, Wright DM, Scott MP. 1991. The

prospero gene specifies cell fates in the Drosophila cen-

tral nervous system. Cell 65:451–464.

Dupin E. 1984. Cell division in the ciliary ganglion of quail

embryos in situ and after back transplantation into the

neural crest migration pathways of chick embryos. Dev

Biol 105:288–299.

Dyer MA, Cepko CL. 2000. Control of Muller glial cell

proliferation and activation following retinal injury. Nat

Neurosci 3:873–880.

Dyer MA, Cepko CL. 2001. p27Kip1 and p57Kip2 regulate

proliferation in distinct retinal progenitor cell popula-

tions. J Neurosci 21:4259–4271.

Dyer MA, Livesey FJ, Cepko CL, Oliver G. 2003. Prox1

function controls progenitor cell proliferation and hori-

zontal, cell genesis in the mammalian retina. Nat Genet

34:53–58.

Ernsberger U, Edgar D, Rohrer H. 1989. The survival of

early chick sympathetic neurons in vitro is dependent on

a suitable substrate but independent of NGF. Dev Biol

135:250–262.

Foskolou IP, Stellas D, Rozani I, Lavigne MD, Politis PK.

2012. Prox1 suppresses the proliferation of neuroblas-

toma cells via a dual action in p27-Kip1 and Cdc25A.

Oncogene 32:947–960.

Gonsalvez DG, Cane KN, Landman KA, Enomoto H,

Young HM, Anderson CR. 2013. Proliferation and cell

cycle dynamics in the developing stellate ganglion.

J Neurosci 33:5969–5979.

Gonsalvez DG, Li-Yuen-Fong M, Cane KN, Stamp LA,

Young HM, Anderson CR. 2014. Different neural crest

populations exhibit diverse proliferative behaviors. Dev

Neurobiol 75:287–301.

Gui H, Li S, Matise MP. 2007. A cell-autonomous require-

ment for Cip/Kip cyclin-kinase inhibitors in regulating

neuronal cell cycle exit but not differentiation in the

developing spinal cord. Dev Biol 301:14–26.

Hamburger V, Hamilton HL. 1951. A series of normal

stages in the development of the chick embryo. J Exp

Zool 88:49–92.

Hendershot TJ, Liu H, Clouthier DE, Shepherd IT, Coppola

E, Studer M, Firulli AB, et al. 2008. Conditional deletion

of Hand2 reveals critical functions in neurogenesis and

cell type-specific gene expression for development of

neural crest-derived noradrenergic sympathetic ganglion

neurons. Dev Biol 319:179–191.

Hirata J, Nakagoshi H, Nabeshima Y, Matsuzaki F. 1995.

Asymmetric segregation of the homeodomain protein Pros-

pero during Drosophila development. Nature 377:627–630.

Hope KJ, Cellot S, Ting SB, MacRae T, Mayotte N, Iscove

NN, Sauvageau G. 2010. An RNAi screen identifies Msi2

and Prox1 as having opposite roles in the regulation of

hematopoietic stem cell activity. Cell Stem Cell 7:101–

113.



Huber L, Ferdin M, Holzmann J, Stubbusch J, Rohrer H.

2012. HoxB8 in noradrenergic specification and differen-

tiation of the autonomic nervous system. Dev Biol 363:

219–233.

Kaltezioti V, Kouroupi G, Oikonomaki M, Mantouvalou E,

Stergiopoulos A, Charonis A, Rohrer H, et al. 2010.

Prox1 regulates the notch1-mediated inhibition of neuro-

genesis. PLoS Biol 8:e1000565.

Kamiya A, Kakinuma S, Onodera M, Miyajima A, Nakauchi

H. 2008. Prospero-related homeobox 1 and liver receptor

homolog 1 coordinately regulate long-term proliferation of

murine fetal hepatoblasts. Hepatology 48:252–264.

Karalay O, Doberauer K, Vadodaria KC, Knobloch M,

Berti L, Miquelajauregui A, Schwark M, et al. 2011.

Prospero-related homeobox 1 gene (Prox1) is regulated

by canonical Wnt signaling and has a stage-specific role

in adult hippocampal neurogenesis. Proc Natl Acad Sci

USA 108:5807–5812.

Lavado A, Lagutin OV, Chow LM, Baker SJ, Oliver G.

2010. Prox1 is required for granule cell maturation and

intermediate progenitor maintenance during brain neuro-

genesis. PLoS Biol 8:e1000460.

Lavado A, Oliver G. 2007. Prox1 expression patterns in the

developing and adult murine brain. Dev Dyn 236:518–524.

Lawson SN, Biscoe TJ. 1979. Development of mouse dor-

sal root ganglia: An autoradiographic and quantitative

study. J.Neurocytol 8:265–227.

Maris JM, Hogarty MD, Bagatell R, Cohn SL. 2007. Neu-

roblastoma. Lancet 369:2106–2120.

Mira H, Andreu Z, Suh H, Lie DC, Jessberger S, Consiglio A,

San Emeterio J, et al. 2010. Signaling through BMPR-IA

regulates quiescence and long-term activity of neural stem

cells in the adult hippocampus. Cell Stem Cell 7:78–89.

Misra K, Gui H, Matise MP. 2008. Prox1 regulates a transi-

tory state for interneuron neurogenesis in the spinal cord.

Dev Dyn 237:393–402.

Molenaar JJ, Domingo-Fernandez R, Ebus ME, Lindner S,

Koster J, Drabek K, Mestdagh P, et al. 2012. LIN28B

induces neuroblastoma and enhances MYCN levels via

let-7 suppression. Nat Genet 44:1199–1206.

Morikawa Y, Zehir A, Maska E, Deng C, Schneider MD,

Mishina Y, Cserjesi P. 2009. BMP signaling regulates

sympathetic nervous system development through

Smad4-dependent and -independent pathways. Develop-

ment 136:3575–3584.

M€uller F, Rohrer H. 2002. Molecular control of ciliary neu-

ron development: BMPs and downstream transcriptional

control in the parasympathetic lineage. Development

129:5707–5717.

Myster DL, Duronio RJ. 2000. To differentiate or not to

differentiate? Curr Biol 10:R302–R304.

Nguyen L, Besson A, Roberts JM, Guillemot F. 2006. Cou-

pling cell cycle exit, neuronal differentiation and migra-

tion in cortical neurogenesis. Cell Cycle 5:2314–2318.

Oliver G, Sosa-Pineda B, Geisendorf S, Spana EP, Doe

CQ, Gruss P. 1993. Prox 1, a prospero-related homeobox

gene expressed during mouse development. Mech Dev

44:3–16.

Petrova TV, Nykanen A, Norrmen C, Ivanov KI,

Andersson LC, Haglund C, Puolakkainen P, et al. 2008.

Transcription factor PROX1 induces colon cancer

progression by promoting the transition from benign

to highly dysplastic phenotype. Cancer Cell 13:407–

419.

Potzner MR, Tsarovina K, Binder E, Penzo-Mendez A,

Lefebvre V, Rohrer H, Wegner M, et al. 2010. Sequential

requirement of Sox4 and Sox11 during development of

the sympathetic nervous system. Development 137:775–

784.

Prada C, Puga J, P�erez-M�endez L, Lop�ez R, Ramirez G.

1991. Spatial and temporal pattern of neurogenesis in the

chick retina. Eur J Neurosci 3:559–569.

Rapaport DH, Wong LL, Wood ED, Yasumura D, LaVail

MM. 2004. Timing and topography of cell genesis in the

rat retina. J Comp Neurol 474:304–324.

Reiff T, Huber L, Kramer M, Delattre O, Janoueix-Lerosey

I, Rohrer H. 2011. Midkine and Alk signaling in sympa-

thetic neuron proliferation and neuroblastoma predisposi-

tion. Development 138:4699–4708.

Reiff T, Tsarovina K, Majdazari A, Schmidt M, del Pino I,

Rohrer H. 2010. Neuroblastoma phox2b variants stimu-

late proliferation and dedifferentiation of immature sym-

pathetic neurons. J Neurosci 30:905–915.

Rodriguez-Niedenfuhr M, Papoutsi M, Christ B, Nicolaides

KH, von Kaisenberg CS, Tomarev SI, Wilting J. 2001.

Prox1 is a marker of ectodermal placodes, endodermal

compartments, lymphatic endothelium and lymphangio-

blasts. Anat Embryol (Berl) 204:399–406.

Rohrer H. 2011. Transcriptional control of differentiation

and neurogenesis in autonomic ganglia. Eur J Neurosci

34:1563–1573.

Rohrer H, Acheson AL, Thibault J, Thoenen H. 1986.

Developmental potential of quail dorsal root ganglion cells

analyzed in vitro and in vivo. J Neurosci 6:2616–2624.

Rohrer H, Thoenen H. 1987. Relationship between differ-

entiation and terminal mitosis: Chick sensory and ciliary

neurons differentiate after terminal mitosis of precursor

cells whereas sympathetic neurons continue to divide

after differentiation. J Neurosci 7:3739–3748.

Rothman TP, Gershon MD, Holtzer H. 1978. The relation-

ship of cell division to the acquisition of adrenergic char-

acteristics by developing sympathetic ganglion cell

precursors. Dev Biol 65:321–341.

R€udiger R, Binder E, Tsarovina K, Schmidt M, Reiff T,

Stubbusch J, Rohrer H. 2009. In vivo role for CREB sig-

naling in the noradrenergic differentiation of sympathetic

neurons. Mol Cell Neurosci 42:142–151.

Sawai S, Shimono A, Wakamatsu Y, Palmes C, Hanaoka

K, Kondoh H. 1993. Defects of embryonic organogenesis

resulting from targeted disruption of the N-myc gene in

the mouse. Development 117:1445–1455.

Schmidt M, Huber L, Majdazari A, Schutz G, Williams T,

Rohrer H. 2011. The transcription factors AP-2beta and

AP-2alpha are required for survival of sympathetic pro-

genitors and differentiated sympathetic neurons. Dev

Biol 355:89–100.



Straub JA, Sholler GL, Nishi R. 2007. Embryonic sympa-

thoblasts transiently express TrkB in vivo and proliferate

in response to brain-derived neurotrophic factor in vitro.

BMC Dev Biol 7:10.

Takahashi M, Yoshimoto T, Shimoda M, Kono T, Koizumi

M, Yazumi S, Shimada Y, et al. 2006. Loss of function of

the candidate tumor suppressor prox1 by RNA mutation

in human cancer cells. Neoplasia 8:1003–1010.

Takahashi T, Nowakowski RS, Caviness VS Jr. 1996. The

leaving or Q fraction of the murine cerebral proliferative

epithelium: A general model of neocortical neuronogene-

sis. J Neurosci 16:6183–6196.

Taverna E, Gotz M, Huttner WB. 2014. The cell biology of

neurogenesis: Toward an understanding of the develop-

ment and evolution of the neocortex. Annu Rev Cell Dev

Biol 30:465–502.

Torii M, Matsuzaki F, Osumi N, Kaibuchi K, Nakamura S,

Casarosa S, Guillemot F, et al. 1999. Transcription

factors Mash-1 and Prox-1 delineate early steps in

differentiation of neural stem cells in the developing cen-

tral nervous system. Development 126:443–456.

Tsarovina K, Pattyn A, Stubbusch J, M€uller F, Van der

Wees J, Schneider C, Brunet JF, et al. 2004. Essential

role of Gata transcription factors in sympathetic neuron

development. Development 131:4775–4786.

Tsarovina K, Schellenberger J, Schneider C, Rohrer H.

2008. Progenitor cell maintenance and neurogenesis in

sympathetic ganglia involves Notch signaling. Mol Cell

Neurosci 37:20–31.

Vessey JP, Amadei G, Burns SE, Kiebler MA, Kaplan DR,

Miller FD. 2012. An asymmetrically localized Staufen2-

dependent RNA complex regulates maintenance of mam-

malian neural stem cells. Cell Stem Cell 11:517–528.

Wildner H, Gierl MS, Strehle M, Pla P, Birchmeier C.

2008. Insm1 (IA-1) is a crucial component of the

transcriptional network that controls differentiation of

the sympatho-adrenal lineage. Development 135:473–

481.

Zackenfels K, Oppenheim RW, Rohrer H. 1995. Evidence

for an important role of IGF-I and IGF-II for the early

development of chick sympathetic neurons. Neuron 14:

731–741.



Prox1 Identifies Proliferating Neuroblasts and Nascent ...Prox1 Identiﬁes Proliferating...

Documents

Transcript of Prox1 Identifies Proliferating Neuroblasts and Nascent ...Prox1 Identiﬁes Proliferating...