Pe

ElMDa Mb In

Glac D

Un

Veterinary Microbiology 174 (2014) 448–455

A

Art

Re

Re

Ac

Ke

Law

Pro

Sh

Su

Se

*

Pa

fax

Da1

Cin

Sp2

Sy

Ed

htt

03

roteomic analysis of Lawsonia intracellularis revealsxpression of outer membrane proteins during infection

eanor Watson a,*, M. Pilar Alberdi a,b,1, Neil F. Inglis a, Alex Lainson a,egan E. Porter c, Erin Manson a, Lisa Imrie a,2, Kevin Mclean a,avid G.E. Smith a,b,*

oredun Research Institute, Bush Loan, Penicuik, United Kingdom

stitute of Infection, Immunity and Inflammation, College of Medical, Veterinary and Life Sciences, University of Glasgow,

sgow, United Kingdom

ivision of Infection and Immunity, The Roslin Institute, Royal (Dick) School of Veterinary Studies, University of Edinburgh,

ited Kingdom

1. Introduction

Lawsonia intracellularis is the aetiological agent ofproliferative enteropathy (PE), or ileitis, which affectsswine populations worldwide with considerable econom-ic impact (Jacobson et al., 2009). L. intracellularis is a Gram-negative, microaerophilic obligate intracellular bacteri-um which replicates in the cytoplasm of infected cells. Thebacterium primarily infects the immature enterocytesof intestinal crypts where it induces proliferation and

R T I C L E I N F O

icle history:

ceived 5 June 2014

ceived in revised form 3 October 2014

cepted 5 October 2014

ywords:

sonia intracellularis

liferative enteropathy

otgun proteomics

rface proteins

rology

A B S T R A C T

Lawsonia intracellularis is the aetiological agent of the commercially significant porcine

disease, proliferative enteropathy. Current understanding of host–pathogen interaction is

limited due to the fastidious microaerophilic obligate intracellular nature of the

bacterium. In the present study, expression of bacterial proteins during infection was

investigated using a mass spectrometry approach. LC-ESI-MS/MS analysis of two isolates

of L. intracellularis from heavily-infected epithelial cell cultures and database mining using

fully annotated L. intracellularis genome sequences identified 19 proteins. According to the

Clusters of Orthologous Groups (COG) functional classification, proteins were identified

with roles in cell metabolism, protein synthesis and oxidative stress protection; seven

proteins with putative or unknown function were also identified. Detailed bioinformatic

analyses of five uncharacterised proteins, which were expressed by both isolates,

identified domains and motifs common to other outer membrane-associated proteins

with important roles in pathogenesis including adherence and invasion. Analysis of

recombinant proteins on Western blots using immune sera from L. intracellularis-infected

pigs identified two proteins, LI0841 and LI0902 as antigenic. The detection of five outer

membrane proteins expressed during infection, including two antigenic proteins,

demonstrates the potential of this approach to interrogate L. intracellularis host–pathogen

interactions and identify novel targets which may be exploited in disease control.

� 2014 Elsevier B.V. All rights reserved.

Corresponding author. Moredun Research Institute, Pentlands Science

rk, Bush Loan, Penicuik, UK, EH26 0PZ. Tel.: +44 1314455111;

: +44 1314456235.

E-mail addresses: Eleanor.Watson@moredun.ac.uk (E. Watson),

vid.G.E.Smith@moredun.ac.uk (David G.E. Smith).

Current address: SaBio, Instituto de Investigacion en Recursos

egeticos IREC-CSIC-UCLM-JCCM, Ronda de Toledo s/n, Ciudad Real,

ain.

Current address: Kinetic Parameter Facility, SynthSys - Synthetic and

stems Biology, The King’s Buildings, The University of Edinburgh,

inburgh, United Kingdom.

Contents lists available at ScienceDirect

Veterinary Microbiology

jou r nal h o mep ag e: w ww .e ls evier . co m/lo c ate /vetm i c

p://dx.doi.org/10.1016/j.vetmic.2014.10.002

78-1135/� 2014 Elsevier B.V. All rights reserved.

svawtyadpthvho2p

dauinGecw

nfrin

gin

ethimr(Acainohidso

E. Watson et al. / Veterinary Microbiology 174 (2014) 448–455 449

ubsequently hyperplasia (Smith and Lawson, 2001). Aariety of clinical manifestations are presented; acute casesre associated with bloody diarrhoea and sudden deathhereas chronic infection, more common in younger pigs, ispified by wasting and loss of condition which may be

ccompanied by mild diarrhoea. This results in a significantecrease in financial returns due to the effects on pigroduction compounded by the cost of prophylactic anderapeutic antibiotics. PE has been reported in a wide

ariety of other domestic and wild animals including theamster, rabbit, rat, guinea pig, ferret, deer, dog, wolf, fox,strich, emu and rhesus macaque (Lawson and Gebhart,000) and equine PE is an emerging problem with infectionrimarily reported in post-weaning foals (Frazer, 2008).

In the laboratory the bacterium is extremely fastidious,ue to its microaerophilic obligate intracellular lifestyle. As

result, conventional laboratory approaches, including these of genetic manipulation, which can be used toterrogate the host–pathogen interaction, are restricted.enetic dissimilarity between L. intracellularis and othernteric pathogens has also hampered characterisation. Thelosest known relatives of L. intracellularis are Bilophila

adsworthia and Desulfovibrio desulfuricans although theiches occupied by these free-living bacteria are distinctom L. intracellularis and their relevance as models for L.

tracellularis pathogenesis is limited. Although there is arowing body of literature describing expression of L.

tracellularis gene transcripts (Vannucci et al., 2012), fewxpressed bacterial determinants have been reported ate protein level, including mainly uncharacterisedmunogens (Guedes and Gebhart, 2003) and more

ecently, major components of a type III secretion systemlberdi et al., 2009). Shotgun proteomic analysis of

omplex protein mixtures has proved to be a successfulpproach for investigating the proteomes of obligatetracellular bacteria where technical difficulties in

btaining preparations of organisms free from extraneousost cell material has previously hampered proteinentification. To date, such methods have been exten-

ively employed to analyse proteomes and sub-proteomesf a number of obligate intracellular bacteria including

Rickettsia typhi, Anaplasma phagocytophilum, Neorickettsia

sennetsu, and Ehrlichia chaffeensis, (Lin et al., 2011; Searset al., 2012; Troese et al., 2011).

We recently described the detection of a L. intracellularis

immunogenic autotransporter protein expressed duringhost cell infection using liquid chromatography electro-spray ionisation tandem mass spectrometry (LC-ESI-MS/MS) (Watson et al., 2011). In the present study we appliedthese same methodologies to perform a shotgun proteomicanalysis of bacterial cells and report a number of L.

intracellularis proteins that are expressed during theinteraction with host cells in vitro. Bioinformatic analyseswere used to tentatively assign function to consistentlyexpressed proteins and several outer membrane proteinswere identified. Further immunological investigation wasfacilitated by recombinant fusion proteins and a panel ofsera from naturally infected and uninfected pigs, whichidentified two proteins as potential immunogens.

2. Materials and methods

2.1. Bacterial strains, plasmids and growth conditions

Bacterial isolates and plasmids used in this study arelisted in Table 1. The Lawsonia intracellularis isolatesLR189/5/83 and N343, were co-cultured in IEC-18 or INT-407 epithelial cells respectively, essentially as previouslydescribed (Lawson et al., 1993) at 37 8C under microaer-ophilic conditions (8.0% CO2; 8.8% O2). Recombinantplasmids were maintained in the Escherichia coli TOP10strain which was routinely cultured under aerobic condi-tions on LB medium containing 50 mg/ml ampicillin. The E.

coli BL21(DE3)pLysS strain was used for expression ofrecombinant fusion proteins and was cultured on LBmedium containing ampicillin (50 mg/ml) and chloram-phenicol (35 mg/ml).

2.2. L. intracellularis sample preparation

LR189/5/83 isolate was prepared by extracting approx-imately 5 ml of cell culture medium from heavily infected

Table 1

Bacterial isolates, plasmids and oligonucleotide primers used in this study.

Isolate Description Source

LR189/5/83 L. intracellularis isolate UK isolate

N343 L. intracellularis reference strain ATCC 55672

TOP10 E. coli cloning isolate Invitrogen, Paisley, UK

BL21(DE3)pLysS E. coli cloning isolate Invitrogen, Paisley, UK

Plasmid Description Source

pRSETA Expression vector Invitrogen, Paisley, UK

pEWSF1 pRSETA<LI0841 This study

pEWSF2 pRSETA<LI0902 This study

pEWSF3 pRSETA<LI0691 This study

Primer Sequence (50-30) Restriction sites

LI0841F CGGGTACCGCATGAGAAAATTATGGATTTT KpnI

LI0841R GCGAATTCTTAGAATGTTAAACGTGCACTT EcoRI

LI0902F CGGGTACCGCTTTGCTGTTACATTATTAAC KpnI

LI0902R GCAAGCTTCTAATCAAAAAAGACAAGTTCT HindIII

LI0691F CGGGTACCGCTTAGTAGTATTAAGTGCAGG KpnI

LI0691R GCGAATTCTTACTTGGCAATAATACGAAAA EcoRI

L.

m20tathfinisomMscanthinrecepeprinno

2.3

SDun(B19onThw(GgeFig

2.4

coteslidedutraph(LpesycoFLUVpuChciemca3 mreHeapelu8–

E. Watson et al. / Veterinary Microbiology 174 (2014) 448–455450

intracellularis IEC-18 epithelial cultures. Cell cultureedium stored at �80 8C, was defrosted and centrifuged at0 � g for 5 min to remove cellular debris. The superna-

nt was then centrifuged at 5500 � g for 10 min to pellete bacteria which were washed three times in PBS andally resuspended in a final volume of 500 ml PBS. N343late was extracted from infected INT-407 confluent

onolayers cultured in a 225 cm2 tissue culture flask.onolayers were detached in 10 ml PBS using a cellraper. Detached cells were pelleted at 250 � g for 3 mind resuspended in 4.5 ml PBS. Cells were lysed by passagerough a 23 G needle 20 times. Cell lysate containingtact bacteria was centrifuged at 250 � g for 10 min tomove intact cells and nuclei then the supernatant wasntrifuged at 500 � g for a further 10 min. Bacteria werelleted at 10,000 � g, resuspended in dH20 containingotease inhibitors in accordance with manufacturer’sstructions (Roche Diagnostics, Burgess Hill, UK, catalog. 1873580) and stored at �20 8C.

. SDS-PAGE

Proteins were resolved on discontinuous Tris/glycineS-PAGE mini-gels (4% stacking gel; 10% resolving gel)der reducing conditions using the Mini-ProteanTM III cellioRad Laboratories, Hemel Hempstead, UK) (Laemmli,70). Molecular size standards were included routinely gels (Fermentas PageRuler Prestained Protein Ladder,ermo Fisher Scientific, Hemel Hempstead, UK). Proteins

ere visualised using Colloidal Coomassie Blue Stainenomic Solutions) or SimplyBlue Safe StainTM (Invitro-n, Paisley, United Kingdom). Gel images are shown in. S1.

. LC-ESI-MS/MS

A series of SDS-PAGE gel slices of equal size (2.5 mm),vering the entire sample lane, was excised and submit-d for LC-ESI-MS/MS. Proteins contained within each gelce from sample lanes were subjected to standard in-gel-staining, reduction, alkylation and trypsinolysis proce-res (Shevchenko et al., 1996). Digested samples werensferred to HPLC sample vials for liquid chromatogra-y-electrospray ionisation-tandem mass spectrometry

C-ESI-MS/MS) analysis. Liquid chromatography wasrformed using a Dionex Ultimate 3000 nano-HPLCstem (Thermo Fisher Scientific, Hemel Hempstead, UK)mprising a WPS-3000 well-plate micro auto sampler, aM-3000 flow manager and column compartment, aD-3000 UV detector, an LPG-3600 dual-gradient micro-mp and an SRD-3600 solvent rack controlled byromeleon chromatography software (www.thermos-ntific.com/dionex). A micro-pump flow rate of 246 ml/

in�1 was used in combination with a cap-flow splitterrtridge, affording a 1/82 flow split and a final flow rate of

l/min�1 through a 5 cm � 200 mm ID monolithicversed phase column (Thermo Fisher Scientific, Hemelmpstead, UK) maintained at 50 8C. Samples of 4 ml wereplied to the column by direct injection. Peptides wereted by the application of a 15 min linear gradient from

45% solvent B (80% acetonitrile, 0.1% (v/v) formic acid)

and directed through a 3 nl UV detector flow cell. LC wasinterfaced directly with a 3-D high capacity ion trap massspectrometer (Esquire HCTplusTM, Bruker Daltonics, Bre-men, Germany) via a low-volume (50 ml/min�1 maximum)stainless steel nebuliser (Agilent, cat. no. G1946-20260)and ESI. Parameters for tandem MS analysis were set aspreviously described (Batycka et al., 2006).

2.4.1. Database mining

Deconvoluted MS/MS data was submitted to an in-house MASCOT server and searched against fully annotat-ed L .intracellularis genomic databases using MASCOT V2.2software (Matrix Science, London, UK) (Perkins et al.,1999). The presentation and interpretation of MS/MS datawas performed in accordance with published guidelines(Taylor and Goodlett, 2005). To this end, carbamidomethyl(C) was set as a fixed modification and oxidation (M) anddeamidation (NQ) were set as variable modifications, andmass tolerance values for MS and MS/MS were set at 1.5 Daand 0.5 Da respectively, permitting one missed cleavage.Deconvoluted MS/MS data in .mgf (Mascot GenericFormat) were imported into ProteinScapeTM V2.1 proteo-mics data analysis software (Bruker Daltonics, Bremen,Germany) which compiles data from all gel slices utilisingthe MASCOT search algorithm (Matrix Science, London,UK). The protein content of individual gel slices wasestablished using the ‘‘protein search’’ feature of Protein-ScapeTM, whilst separate compilations of the proteinscontained in all gel slices representing each of the two gellanes analysed were produced using the ‘‘protein extrac-tor’’ feature of the software. Confident protein identifica-tions were based on: (i) recognition of either a minimum oftwo peptides, each with an unbroken series of four or more‘‘b’’ or ‘‘y’’ ions or by one peptide where the unbroken ‘‘b’’ or‘‘y’’ ion series was 8 or more residues in length; (ii)verification that amino acid strings corresponding toindividual peptides were exclusive to a single protein.Specifically, proteins were included as confident onlywhen assigned peptide sequences matched identically to aunique protein from L. intracellularis when searchedagainst the entire NCBInr database. L. intracellularis

genomic databases for strains PHE/MN1-00 and N343are available at the National Centre for BiotechnologyInformation (http://www.ncbi.nlm.nih.gov/genbank/) (ac-cession numbers: NC_008011, NC_008012, NC_008013,NC_008014, NC_020127.1, NC_020128.1, NC_020129.1,NC_020130.1).

2.5. In silico characterisation

BLAST algorithms were used to identify sequencesimilarity between proteins (Altschul et al., 1997). Inorder to predict functional domains or motifs, primaryamino acid sequences were submitted to protein signaturedatabases including Pfam (pfam.sanger.ac.uk), InterPro(www.ebi.ac.uk/interpro/) and NCBInr Conserved Domain,(www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) (March-ler-Bauer et al., 2009; Punta et al., 2012; Zdobnov andApweiler, 2001). Secondary structure prediction wascarried out using Phyre2 (Protein Homology/analogYRecognition Engine V 2.0) (www.sbg.bio.ic.ac.uk/phyre2/),

wpSsp

2

paDcueam

2

pPuMtofipsewaptrmmCe

2

BtuuydicsainrisU4fouaathly

E. Watson et al. / Veterinary Microbiology 174 (2014) 448–455 451

hich generates a consensus secondary structure based onredictions from J-Pred, PSI-Pred and SS-PRO (Kelley andternberg, 2009). The LipoP 1.0 Server (www.cbs.dtu.dk/ervices/LipoP/) was used to predict N-terminal signaleptides in lipoproteins (Juncker et al., 2003).

.6. Molecular biology techniques

PCR amplification, restriction digests, DNA ligations,lasmid isolation, and transformations were carried outccording to standard methods (Sambrook et al., 1989).NA was visualised using GelRedTM (Cambridge Bios-iences, Cambridge, United Kingdom) on agarose gelsnder UV. Taq polymerase, T4 DNA ligase and restrictionndonucleases were purchased from Promega (South-mpton, United Kingdom) and used in accordance with theanufacturer’s recommendations.

.7. Construction of recombinant plasmids

Regions of open reading frames corresponding toroteins LI0841, LI0902 and LI0691 were amplified byCR from L. intracellularis LR189/5/83 DNA; all primerssed in this study are listed in Table 1 (MWG-Biotech Ltd.,ilton Keynes, United Kingdom). Primers were designed introduce restriction sites (underlined) into the ampli-

ed product and to exclude the N-terminal putative signaleptide regions of the natural proteins to facilitateuccessful protein expression. PCR products and pRSETAxpression vector (Invitrogen, Paisley, United Kingdom)ere cleaved using appropriate restriction endonucleases

nd ligated to generate the recombinant plasmids pEWSF1,EWSF2 and pEWSF3. TOP10 competent cells wereansformed with plasmids in accordance with theanufacturer’s instructions. Plasmid DNA from transfor-ants was isolated using QIAPrep Spin Mini kit (Qiagen,

rawley, United Kingdom) and confirmed by restrictionndonuclease analysis.

.8. Expression and purification of recombinant proteins

pEWSF1, pEWSF2 and pEWSF3 were used to transformL21(DE3)pLysS cells in accordance with the manufac-rer’s instructions. Freshly transformed isolates were

sed to inoculate 2 ml SOB medium (20 g tryptone, 5 geast extract, 0.186 g KCl, 0.5 g NaCl, 1 M MgSO4 in 1 LH20), containing ampicillin (50 mg/ml) and chloramphen-ol (35 mg/ml) and incubated overnight at 37 8C with

haking at 200 rpm. Transfectants were subcultured bydding 2 ml overnight culture to 38 ml SOB medium andcubating at 37 8C for 2 h at 200 rpm. Expression of

ecombinant proteins was induced by the addition ofopropylthiogalactopyranoside (IPTG) (Sigma, Poole,nited Kingdom), at a final concentration of 1 mM, for

h. Bacteria were harvested by centrifugation at 5000 � g

r 10 min and the resulting pellets were stored at �20 8Cntil further use. 1 ml samples of culture prior to and 4 hfter induction were removed to confirm the expressionnd solubility of the recombinant fusion protein carryinge N-terminal six-histidine (6xHis) tag. Bacteria weresed by freeze thawing three times in PBS, pelleted at

13000 � g for 10 min and proteins in the soluble (super-natant) and insoluble (pellet) fractions were separated bySDS-PAGE and visualised with Coomassie SimplyBlueTM

SafeStain (Invitrogen, Paisley, United Kingdom). Prominentbands of approximately 28 kDa, 40 kDa and 20 kDa,corresponding to the predicted molecular weights ofrLI0841, rLI0902 and rLI0691 respectively with combinedpolyhistidine tags (ExPASy Compute pI/Mw tool; http://www.expasy.org/tools/pi_tool.html) (Bjellqvist et al.,1993) were visible only in induced samples on SDS-PAGEgels, and their presence was confirmed by Westernimmunoblotting using Anti-HisG-HRP monoclonal anti-body (Invitrogen). Recombinant fusion proteins presentin the insoluble fractions (data not shown) weresubsequently enriched from whole cell lysate underdenaturing conditions by immobilised metal affinitycapture (ProBondTM Nickel-Chelating Resin) (Invitrogen,Paisley, United Kingdom) in accordance with the manu-facturer’s recommendations. Confirmatory identificationof the affinity-enriched proteins as rLI0841, rLI0902 andrLI0691 was performed by peptide mass fingerprintingand sequencing of selected precursor ions using matrixassisted laser desorption ionisation time of flight tandemmass spectrometry (MALDI-ToF MS/MS).

2.9. Western blotting

Pig sera were kindly donated by Boehringer Ingelheim.Prior to receipt, serological status was confirmed at sourceusing the Enterisol Ileitis-ELISA (bioScreen, Munster,Germany) and pigs found to be seropositive or seronega-tive were designated naturally-infected or uninfected,respectively. Recombinant fusion proteins resolved onSDS-PAGE gels, across the entire width of the gel, weretransferred onto Hybond-C nitrocellulose membranes GEHealthcare, Buckinghamshire, United Kingdom using aSemi-dry Blotter (Fisher Scientific, Loughborough, UnitedKingdom) and cut into 6 mm wide strips. Membranes wereblocked for 1 h in 2% BSA then incubated with sera at a1:5000 dilution. Membranes were washed thoroughly inPBS-0.3% Tween 20 and incubated with HRP conjugatedanti-pig IgG (Sigma, Poole, United Kingdom) at a 1:10000dilution then washed again. Bound antibody was detectedusing the Pierce enhanced chemiluminescence (ECL)system (Thermo Fisher Scientific, Rockford, IL).

3. Results and discussion

In the present study a shotgun proteomics approach,combining rapid monolithic column liquid chromatogra-phy and electrospray ionisation with ultra-fast MS/MSscanning, is applied to the detection and identificationof proteins expressed by laboratory-propagated L.

intracellularis. LC-ESI-MS/MS analysis of L. intracellularis

infected epithelial cell cultures identified 19 bacterialproteins (Table 2) with roles in a variety of cell functionsincluding cell metabolism, protein synthesis and oxidativestress protection as well as surface proteins, chaperonesand hypothetical proteins with unknown function.

A number of proteins were annotated as hypothetical orputative membrane proteins. This includes LI0649, which

praudiseuswpraub-sigfeseLIBen2e

prwseOmw

Ta

L.

P

M

L

L

L

L

L

L

L

L

L

L

L

L

L

L

L

L

L

L

L

L

a

b

c

CM

mo

Tra

tra

E. Watson et al. / Veterinary Microbiology 174 (2014) 448–455452

eviously has been identified and described as antotransporter protein (LatA), and therefore will not bescussed further here (Watson et al., 2011). Amino acidquences of five proteins common to both analyses wereed in in silico sequence analyses and all five proteinsere tentatively identified as outer membrane-associatedoteins (Fig. 1). LI0045 was also identified as antotransporter protein, and contains an autotransporterbarrel domain at residues 583-879 (IPR005546) and anal peptide at the N-terminal domain, both structural

atures of autotransporters. LI0045 shares greatestquence similarity with two L. intracellularis proteins,004, annotated as ‘‘Asn/Thr/Ser/Val rich protein’’

coded on L. intracellularis plasmid 2 (32% identity,-120) and LatA (32% identity, 5e-115).A signal peptide was predicted at the N-terminus of

otein LI0461 but no other conserved motifs or domainsere identified. BLASTP analysis of the amino acidquence revealed highest sequence similarity with

pBW of Bilophila wadsworthia (48% identity, 3e-159),hich has been identified as a porin (Avidan et al., 2008).

High Mascot MOWSE scores (545 and 748) were achievedfor LI0461 with good sequence coverage (52% and 45%) inpreparations of both L. intracellularis strains, suggestingthat this protein is present at high levels during interactionwith host cells.

Analysis of protein LI0902 by InterProScan revealedan OmpA/MotB domain (IPR006665), named after theC-terminal domain of E. coli OmpA and the flagellar motorprotein MotB, which is found at the C-terminus of manyGram-negative outer membrane lipoproteins and porins.These domains contain a conserved ligand binding site,which is thought to mediate peptidoglycan recognition(Parsons et al., 2006). This binding site was identifiedwithin LI0902 and is indicated in Fig. 1. The N-terminalregion was predicted to contain a von Willebrand factortype A domain (PF13519); von Willebrand Factor (vWF) isa eukaryotic glycoprotein that mediates platelet adhesionand proteins containing vWF domains perform a range ofwell established roles in eukaryotes. Recently vWFdomains have been identified in prokaryotic proteins(Ponting et al., 1999). Proteins containing vWF domains are

ble 2

intracellularis proteins identified by mass spectrometry.

HE/

N1-00

ocus tag

N343

Locus tag

NCBI PHE/MN1-00 annotation LR189/5/83 N343 MWb

[kDa]

COGc

% Sequence

Coverage

# Peptides

identified

MOWSEa

score

% Sequence

Coverage

# Peptides

identified

MOWSE

score

I0625 LAW_00645 Chaperonin GroEL 62.6 33 1175.6 73 39 1834.4 58.6 PM

I0461 LAW_00475 Hypothetical protein 53.6 20 859.3 59.6 25 1132.3 54.9 /

IC103 LAW_30101 Methyl-accepting

chemotaxis protein

27.2 16 158.6 28.4 21 221.3 76.7 CMS/

STM

I0912 LAW_00942 Molecular chaperone dnaK 29.9 16 230.0 24.2 11 156.1 68 PM

I0045 LAW_00044 Hypothetical protein 15.4 12 152.8 17.3 13 312.3 95.1 /

I0902 LAW_00931 Outer membrane protein 24.7 8 295.8 32.1 8 318.9 37.6 CEB/GF

I0841 LAW_00871 Putative invasin 23.4 7 246.6 57.4 10 258.6 26.7 CEB

I0935 LAW_00967 tufA elongation factor Tu 14.6 5 137.6 32 8 332.3 43.6 TRB

I0696 LAW_00722 Rubrerythrin 37.7 5 185.5 26.7 4 320.8 21.6 EPC

I0649 LAW_00671 Hypothetical protein 7.4 4 123.2 12.7 8 196.9 91.8 /

I0691 LAW_00717 Outer membrane protein

and related

peptidoglycan-associated

(lipo)proteins

7.4 1 49.4 25.3 4 86.7 18.2 CEB

I0606 LAW_00625 Transcriptional regulator 17.6 3 89.5 – – – T

I0624 LAW_00644 GroES/HSP10-like protein 25.7 2 84.8 – – – PM

I0944 LAW_00976 fusA elongation factor G – – 27.5 11 129.7 76.4 TRB

I0024 LAW_00023 4-hydroxy-3-methylbut-

2-en-1-yl

diphosphate synthase

– – 40.4 10 92.2 38.6

I1171 LAW_01208 50-nucleotidase/20 ,30-cyclic

phosphodiesterase and

related esterases

– – 21.2 10 148.7 62.3 NTM

I0847 LAW_00877 Hypothetical protein – – 31.8 6 215.3 29.5 /

I1119 LAW_01161 Glyceraldehyde-3-phosphate

dehydrogenase/erythrose-

4-phosphate

dehydrogenase

– – 22.8 5 97.7 37.4 CTM

I0005 LAW_00005 Superoxide dismutase

precursor (Cu-Zn)

– – 25 4 58.8 18.8 IITM

Molecular Weight Search.

Molecular Weight.

Clusters of Orthologous Groups.

S; Cell motility and secretion, IITM; Inorganic ion transport and metabolism, AATM; Amino acid transport and metabolism, PM; Post-translational

dification, protein turnover, chaperones, T; Transcription, CEB; Cell envelope biogenesis, outer membrane, EPC; Energy production and conversion, TRB;

nslation, ribosomal structure and biogenesis, CTM; Carbohydrate transport and metabolism, NTM; Nucleotide transport and metabolism, STM; Signal

nsduction mechanisms, GF; General function prediction only.

fresis4

teghcrLlithaccnumwethfisgawiscr

F

lo

P

m

li

E. Watson et al. / Veterinary Microbiology 174 (2014) 448–455 453

equently involved in protein-protein interactions via, forxample, a highly conserved metal ion dependent adhe-ion site (MIDAS); a perfect MIDAS motif (DxSxS. . .T. . .D)

present within the vWF domain of LI0902 at residues2-147.

LI0691 shares the presence of an OmpA/MotB, C-rminal domain (IPR006665) and a conserved peptido-

lycan binding site with LI0902, although these proteinsave low sequence similarity (30% identity of 29%overage, 2e-10). Additionally, analysis with LipoPevealed the presence of a lipoprotein signal peptide.I0691 is annotated as Pal (peptidoglycan associatedpoprotein) by NCBI and shows 50% identity (2e-25) withe well-characterised protein Pal in E. coli; bioinformatic

nalysis described here supports this annotation. Pal is aomponent of the Tol-Pal system which is a multiproteinomplex spanning the inner and outer membrane of Gram-egative bacteria. The role of the system is not thoroughlynderstood although it is thought to be involved in theaintenance of membrane integrity and its interactionith peptidoglycan, formation of membrane vesicles,

xpression of LPS antigens, transport of compounds acrosse cytoplasmic membrane and translocation of DNA

lamentous phage (Godlewska et al., 2009). The expres-ion of Pal by L. intracellularis is unsurprising as theenomes of the majority of Gram-negative bacteria contain

tol-pal locus. Pal itself is a poorly conserved lipoproteinith a possible additional role in pathogenesis; Pal of E. coli

recognised by TLR2 which leads to pro-inflammatoryytokine gene transcription (Liang et al., 2005) and iseleased into the bloodstream in animal models which can

lead to septic shock (Hellman et al., 2002) although this isnot a phenomenon observed in L. intracellularis infection.Furthermore, Pal proteins of other bacteria, including theintracellular pathogen Legionella pneumophila, have beenshown to be antigenic (Badr et al., 1999). Preliminaryanalysis of the L. intracellularis genome revealed thepresence of a tol-pal locus comprising genes encodingthe five core proteins of conserved Tol-Pal systems.Interestingly, another protein detected in this study,rubrerythrin (LI0696) is located directly upstream fromthe locus, in a position which is often occupied by ybgC, acytoplasmic protein with thioesterase activity in otherGram-negative bacteria. Any further speculation on theexpression and function of a complete L. intracellularis Tol-Pal system and its association with rubrerythrin requiresan in-depth study.

LI0841 is annotated by NCBI as a putative invasin;BLASTP analysis of this protein revealed sequencesimilarity with several proteins which have been shownto promote adherence and invasion thus supporting thisannotation. Sequence similarity was found with Hek/Tia-like proteins of several members of the Enterobacter-iaceae family (30–36% identity). These outer membraneproteins have been reported to contribute to the adher-ence and invasion of epithelial cells (Lambert and Smith,2008). Analysis of LI0841 by InterProScan and Phyre2identified a beta barrel and a PagP outer membraneenzyme domain (IPR011250). In Bordetella bronchiseptica

and Legionella pneumophila, PagP plays a role in evasion ofthe host immune response (Pilione et al., 2004; Robeyet al., 2001).

ig. 1. Schematic diagram of selected L. intracellularis predicted outer membrane proteins identified in this study. Conserved domains indicating membrane

calisation were identified in all five proteins; green box: signal peptide, yellow box: lipoprotein signal peptide, IPR005546: Autotransporter beta-domain,

F13519: Von Willebrand factor type A domain, IPR006665: Outer membrane protein, OmpA/MotB, C-terminal, IPR011250: Outer membrane protein/outer

embrane enzyme PagP, beta-barrel. Amino acid positions (numbers), metal ion-dependent adhesion sites (blue inverted triangles) and peptidoglycan

gand binding sites (red inverted triangles) are also indicated. 3D structures were generated using Phyre2.

LI0pranofDNpLrLesun

infrofroreanansostrReanthsu

dethinprthpr

Fig

Pro

me

sev

inf

six

nin

fro

rec

wa

tha

wi

E. Watson et al. / Veterinary Microbiology 174 (2014) 448–455454

The predicted outer membrane localisation of proteins841 and LI0902 and the evidence that other bacterial

oteins with strong sequence similarity to LI0691 aretigenic, prompted an investigation of the seroreactivity

these three L. intracellularis proteins. L. intracellularis

A sequences were cloned and expressed in BL21(DE3)-ysS cells then recombinant fusion proteins (rLI0902,I0841 and rLI0691) were probed on Western blots totablish recognition by sera from nine infected and seveninfected animals (Fig. 2).Both rLI0841 and rLI0902 were recognised by sera from

fected pigs. rLI0841 was consistently recognised by seram infected pigs and recognition was minimal by seram six of the seven uninfected animals. rLI0902 was

cognised by sera from all but one of the infected groupd was not recognised by sera from any of the uninfectedimals. Despite earlier reports that the Pal protein ofme bacteria is antigenic, rLI0691 was recognisedongly by serum from only one infected animal.cognition of rLI0841 and rLI0902 by sera from infectedimals indicates that these proteins are encountered bye immune system and their detection by most seraggests consistent expression within their natural host.The work presented here is, to date, the most extensive

scription of L. intracellularis proteins expressed duringe interaction with host cells but it is by no meanstended as a comprehensive analysis of the completeoteome. It does however demonstrate the potential ofese methodologies for further proteomic and immuno-oteomic analysis once the difficulties of routine bacterial

culture are overcome and methodologies to extractsufficient bacterial protein have been developed. Bacterialsurface proteins play important roles in many aspects ofbacterial life including nutrient transport, secretion ofbacterial proteins and the sensing of environmentalconditions, as well as their involvement in host–pathogeninteractions such as invasion, adherence and colonisation.Further investigation of surface proteins may also lead tothe development of diagnostics and vaccines as they oftenact as protective antigens being readily accessible to theimmune system. The proteins described here couldrepresent important factors involved in colonisation,attachment and invasion which are expressed by thisunusual and fastidious bacterium during infection as wellas potential candidates for therapeutic intervention, suchas vaccines, and diagnosis.

Acknowledgements

This work was supported by BBSRC research grant BB/C510532/1. The authors would like to thank Drs. K. Elbersand M. Roof of Boehringer Ingelheim Vetmedica forarranging provision of culture stocks and sera fromseropositive and seronegative animals. Moredun ResearchInstitute receives funding from Scottish Government’sRural and Environment Science and Analytical ServicesDivision (RESAS).

Appendix A. Supplementary data

Supplementary material related to this article can befound, in the online version, at http://dx.doi.org/10.1016/j.vetmic.2014.10.002.

References

Alberdi, M.P., Watson, E., McAllister, G.E., Harris, J.D., Paxton, E.A., Thom-son, J.R., Smith, D.G., 2009. Expression by Lawsonia intracellularis oftype III secretion system components during infection. Vet. Microbiol.139, 298–303.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W.,Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation ofprotein database search programs. Nucleic Acids Res. 25, 3389–3402.

Avidan, O., Kaltageser, E., Pechatnikov, I., Wexler, H.M., Shainskaya, A.,Nitzan, Y., 2008. Isolation and characterization of porins from Desul-fovibrio piger and Bilophila wadsworthia: structure and gene sequenc-ing. Arch. Microbiol. 190, 641–650.

Badr, W.H., Loghmanee, D., Karalus, R.J., Murphy, T.F., Thanavala, Y., 1999.Immunization of mice with P6 of nontypeable Haemophilus influen-zae: kinetics of the antibody response and IgG subclasses. Vaccine 18,29–37.

Batycka, M., Inglis, N.F., Cook, K., Adam, A., Fraser-Pitt, D., Smith, D.G., Main,L., Lubben, A., Kessler, B.M., 2006. Ultra-fast tandem mass spectrometryscanning combined with monolithic column liquid chromatographyincreases throughput in proteomic analysis. Rapid Commun. MassSpectrom. 20, 2074–2080.

Bjellqvist, B., Hughes, G.J., Pasquali, C., Paquet, N., Ravier, F., Sanchez, J.C.,Frutiger, S., Hochstrasser, D., 1993. The focusing positions of poly-peptides in immobilized pH gradients can be predicted from theiramino acid sequences. Electrophoresis 14, 1023–1031.

Frazer, M.L., 2008. Lawsonia intracellularis infection in horses: 2005-2007. J. Vet. Intern. Med. 22, 1243–1248.

Godlewska, R., Wisniewska, K., Pietras, Z., Jagusztyn-Krynicka, E.K., 2009.Peptidoglycan-associated lipoprotein (Pal) of Gram-negative bacte-ria: function, structure, role in pathogenesis and potential applicationin immunoprophylaxis. FEMS Microbiol. Lett. 298, 1–11.

Guedes, R.M., Gebhart, C.J., 2003. Preparation and characterization ofpolyclonal and monoclonal antibodies against Lawsonia intracellu-laris. J. Vet. Diagn. Invest. 15, 438–446.

. 2. Recognition of purified rLI0841, rLI0902 and rLI0691 by pig sera.

teins were resolved by SDS-PAGE, electroblotted onto nitrocellulose

mbranes and probed with sera from nine infected animals (1–9) or

en uninfected animals (10–16) (1:5000 dilution). Sera from all nine

ected animals reacted with rLI0841(A), whereas reactivity of sera from

of seven uninfected animals was negligible (B). Sera from eight out of

e infected animals reacted with rLI0902 (C), whereas reactivity of sera

m all uninfected animals was negligible (D). rLI0691 was only

ognised strongly by serum from one infected animal; recognition

s negligible by other sera (E). Induction of specific antibodies indicates

t LI0841 and LI0902 are antigens expressed during in vivo infection

th L. intracellularis.

H

Ja

Ju

K

L

L

L

L

L

L

M

P

P

P

E. Watson et al. / Veterinary Microbiology 174 (2014) 448–455 455

ellman, J., Roberts Jr., J.D., Tehan, M.M., Allaire, J.E., Warren, H.S., 2002.Bacterial peptidoglycan-associated lipoprotein is released into thebloodstream in gram-negative sepsis and causes inflammation anddeath in mice. J. Biol. Chem. 277, 14274–14280.

cobson, M., Fellstrom, C., Jensen-Waern, M., 2009. Porcine proliferativeenteropathy: an important disease with questions remaining to besolved. Vet J.

ncker, A.S., Willenbrock, H., Von Heijne, G., Brunak, S., Nielsen, H., Krogh,A., 2003. Prediction of lipoprotein signal peptides in Gram-negativebacteria. Protein Sci. 12, 1652–1662.

elley, L.A., Sternberg, M.J., 2009. Protein structure prediction on theWeb: a case study using the Phyre server. Nat. Protoc. 4, 363–371.

aemmli, U.K., 1970. Cleavage of structural proteins during the assemblyof the head of bacteriophage T4. Nature 227, 680–685.

ambert, M.A., Smith, S.G., 2008. The PagN protein of Salmonella entericaserovar Typhimurium is an adhesin and invasin. BMC Microbiol. 8, 142.

awson, G.H., Gebhart, C.J., 2000. Proliferative enteropathy. J. Comp.Pathol. 122, 77–100.

awson, G.H., McOrist, S., Jasni, S., Mackie, R.A., 1993. Intracellular bacte-ria of porcine proliferative enteropathy: cultivation and maintenancein vitro. J. Clin. Microbiol. 31, 1136–1142.

iang, M.D., Bagchi, A., Warren, H.S., Tehan, M.M., Trigilio, J.A., Beasley-Topliffe, L.K., Tesini, B.L., Lazzaroni, J.C., Fenton, M.J., Hellman, J., 2005.Bacterial peptidoglycan-associated lipoprotein: a naturally occurringtoll-like receptor 2 agonist that is shed into serum and has synergywith lipopolysaccharide. J. Infect. Dis. 191, 939–948.

in, M., Kikuchi, T., Brewer, H.M., Norbeck, A.D., Rikihisa, Y., 2011. Globalproteomic analysis of two tick-borne emerging zoonotic agents:Anaplasma phagocytophilum and Ehrlichia chaffeensis. Front. Micro-biol. 2, 24.

archler-Bauer, A., Anderson, J.B., Chitsaz, F., Derbyshire, M.K., DeWeese-Scott, C., Fong, J.H., Geer, L.Y., Geer, R.C., Gonzales, N.R., Gwadz, M., He,S., Hurwitz, D.I., Jackson, J.D., Ke, Z., Lanczycki, C.J., Liebert, C.A., Liu, C.,Lu, F., Lu, S., Marchler, G.H., Mullokandov, M., Song, J.S., Tasneem, A.,Thanki, N., Yamashita, R.A., Zhang, D., Zhang, N., Bryant, S.H., 2009.CDD: specific functional annotation with the Conserved DomainDatabase. Nucleic Acids Res. 37, D205–D210.

arsons, L.M., Lin, F., Orban, J., 2006. Peptidoglycan recognition by Pal, anouter membrane lipoprotein. Biochemistry 45, 2122–2128.

erkins, D.N., Pappin, D.J., Creasy, D.M., Cottrell, J.S., 1999. Probability-based protein identification by searching sequence databases usingmass spectrometry data. Electrophoresis 20, 3551–3567.

ilione, M.R., Pishko, E.J., Preston, A., Maskell, D.J., Harvill, E.T., 2004. pagPis required for resistance to antibody-mediated complement lysis

during Bordetella bronchiseptica respiratory infection. Infect. Immun.72, 2837–2842.

Ponting, C.P., Aravind, L., Schultz, J., Bork, P., Koonin, E.V., 1999. Eukaryoticsignalling domain homologues in archaea and bacteria. Ancient an-cestry and horizontal gene transfer. J. Mol. Biol. 289, 729–745.

Punta, M., Coggill, P.C., Eberhardt, R.Y., Mistry, J., Tate, J., Boursnell, C.,Pang, N., Forslund, K., Ceric, G., Clements, J., Heger, A., Holm, L.,Sonnhammer, E.L., Eddy, S.R., Bateman, A., Finn, R.D., 2012. The Pfamprotein families database. Nucleic Acids Res. 40, D290–D301.

Robey, M., O’Connell, W., Cianciotto, N.P., 2001. Identification of Legionellapneumophila rcp, a pagP-like gene that confers resistance to cationicantimicrobial peptides and promotes intracellular infection.Infect. Immun. 69, 4276–4286.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Labo-ratory Manual, 2nd edition. Cold Spring Harbour Laboratory Press,New York.

Sears, K.T., Ceraul, S.M., Gillespie, J.J., Allen Jr., E.D., Popov, V.L., Ammer-man, N.C., Rahman, M.S., Azad, A.F., 2012. Surface proteome analysisand characterization of surface cell antigen (Sca) or autotransporterfamily of Rickettsia typhi. PLoS Pathog. 8, e1002856.

Shevchenko, A., Wilm, M., Vorm, O., Mann, M., 1996. Mass spectrometricsequencing of proteins silver-stained polyacrylamide gels. Anal. Chem.68, 850–858.

Smith, D.G., Lawson, G.H., 2001. Lawsonia intracellularis: getting insidethe pathogenesis of proliferative enteropathy. Vet. Microbiol. 82,331–345.

Taylor, G.K., Goodlett, D.R., 2005. Rules governing protein identificationby mass spectrometry. Rapid Commun. Mass Spectrom. 19, 3420.

Troese, M.J., Kahlon, A., Ragland, S.A., Ottens, A.K., Ojogun, N., Nelson, K.T.,Walker, N.J., Borjesson, D.L., Carlyon, J.A., 2011. Proteomic analysis ofAnaplasma phagocytophilum during infection of human myeloid cellsidentifies a protein that is pronouncedly upregulated on the infec-tious dense-cored cell. Infect. Immun. 79, 4696–4707.

Vannucci, F.A., Foster, D.N., Gebhart, C.J., 2012. Comparative transcrip-tional analysis of homologous pathogenic and non-pathogenic Law-sonia intracellularis isolates in infected porcine cells. PLoS One 7,e46708.

Watson, E., Clark, E.M., Alberdi, M.P., Inglis, N.F., Porter, M., Imrie, L.,McLean, K., Manson, E., Lainson, A., Smith, D.G., 2011. A novel Law-sonia intracellularis autotransporter protein is a prominent antigen.Clin. Vaccine Immunol. 18, 1282–1287.

Zdobnov, E.M., Apweiler, R., 2001. InterProScan–an integration platformfor the signature-recognition methods in InterPro. Bioinformatics 17,847–848.