Protein Chemistry/Proteomics/Mass spectrometry Uni. of...
Transcript of Protein Chemistry/Proteomics/Mass spectrometry Uni. of...
![Page 1: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/1.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Towards dynamic protein networks
Maciej Lalowski
Biomedicum Helsinki,Helsinki University
Trasmed course 02/11/2010
![Page 2: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/2.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
The functional genomic era
Therapy
Development ofcausal therapies for the society´smost devastating disorders
Draft DNAsequence of thehuman genome
~ 35,000 protein-encoding genes
~2000 knownhuman diseasegenes
The Human Genome Project
Functional genomics
approaches
Transcriptomics
Proteomics
Model organisms
Interactomics
Metabolomics
Bioinformatics
Knowledge
Gene function in healthy individuals
Gene dysfunc-tion in disease states
Molecular mechanisms of diseases
![Page 3: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/3.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
The “interactome”
interactomemaps
structure of the ribosome
ccgcctcgcc gcgacacttc acacacagcttcgcctcacc ccattacagt ctcaccacgccccgtcccct ctccgttgag ccccgcgccttcgcccgggt ggggcgctgc gctgtcagcggccttgctgt gtgaggcaga acctgcgggggcaggggcgg gctggttccc tggccagccattggcagagt ccgcaggcta gggctgtcaatcatgctggc cggcgtggcc ccgcctccgccggcgcggcc ccgcctccgc cggcgcagcgtctgggacgc aaggcgccgt gggggctgccgggacgggtc caagatggac ggccgctcaggttctgcttt tacctgcggc ccagagccccattcattgcc ccggtgctga gcggcgccgcgagtcggccc gaggcctccg gggactgccgtgccgggcgg gagaccgcca tggcgaccctggaaaagctg atgaaggcct tcgagtccctcaagtccttc cagcagcagc agcagcagcagcagcagcag cagcagcagc agcagcagcagcagcagcaa cagccgccac cgccgccgccgccgccgccg cctcctcagc ttcctcagccgccgccgcag gcacagccgc tgctgcctcagccgcagccg cccccgccgc cgcccccgccgccacccggc ccggctgtgg ctgaggagccgctgcaccga ccgtgagttt gggcccgctgcagctccctg tcccggcggg tcccaggctacggcggggat ggcggtaacc ctgcagcctgcgggccggcg acacgaaccc ccggccccgcagagacagag tgacccagca acccagagcccatgagggac acccgccccc tcctggggcgaggccttccc ccacttcagc cccgctccctcacttgggtc ttcccttgtc ctctcgcgaggggaggcaga gccttgttgg ggcctgtcctgaattcaccg aggggagtca cggcctcagc
genomic sequences
=> framework that describes all interactions that can take place in the cell
![Page 4: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/4.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Networks
Examples:
• Internet
• Social Networks
• Neuronal Networks
Properties:
• Scale-free
• Small World
![Page 5: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/5.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Global view of protein interaction networks:degree distribution / Small world properties
Small world phenomenon: Everyone in the world can be reached through a short chain of social acquaintances.
Six degrees of separation: (Stanley Milgram, 1967): “Two random US citizens are connected on average by a chain of six acquaintances”.
D.J. Watts and S. H. Strogatz, 1998: “Beginning with a regular lattice, the addition of a small number of random links reduces the diameter of the network (the longest direct path between any two vertices, from being very long to being very short)”.
![Page 6: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/6.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Global view of protein interaction networks:degree distribution / scale free properties
(i) Winner takes all phenomenon: new
vertices attach preferentially to sites that
are already well connected: hubs
(ii) Rich gets richer: generative model
where „page with many in-links attracts
more in-links than a regular page“
(iii) Copy model: new node chooses an
existent node at random and copy a
fraction of the links of the existent node
(iv) However, communities of special
interests resemble normal distribution
Distrubution of links in scale free network of the Web follows a Power law (PL)
Barabasi & Alberts, Science 1999; Barabasi & Oltvai, Nature Rev. Gen. 2004
P(d) d-k, k>1 is a constant
V
E
![Page 7: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/7.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Using PPI networks to study biological processes
Proteins interact with other proteins in assemblies and pathways to exert their biological function
the majority of cellular proteins form large interaction networks (PPI networks)
PPI networks help to understand protein function and malfunction in health and disease
![Page 8: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/8.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Principle of the yeast two-hybrid system
Benefits: • In vivo technique• Transient and unstable interactions can be detected
• Independent of endogenous protein expression
• Fine resolution, enabling interaction mapping within proteins
Drawbacks:• Only two proteins tested at a time • Takes place in the nucleus, so many proteins are not in their native compartment
• Predicts possible interactions, but is unrelated to the physiological setting
Yeast two-hybrid system
![Page 9: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/9.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
A first map of the human interactome
• 5632 AD fusion proteins
• 4456 DNA-binding domain fusion proteins
• 25x106 protein pairs tested
• 2005: 3186 unique PPIs between 1705 proteins
• 2008: 6211 unique PPIs between 2948 proteinsStelzl, Worm, Lalowski et al. Cell, 2005
Parkinson‘s disease:
![Page 10: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/10.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
UniHI: An entry gate to the human interactome
HOMOMINTHOMOMINTORTHOLOGY
ORTHOORTHOLOGY
OPHIDORTHOLOGY
COCITTEXT-MINING
BINDLITERATURE
HPRDLITERATURE
CCSB-H1Y2H
MDCMDC--Y2H Y2H Y2H
REACTOMELITERATURE
DIPLITERATURE
253,980 interactions among 22,307 unique human proteins,http://theoderich.fb3.mdc-berlin.de:8080/unihi/?
![Page 11: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/11.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Development of a novel conceptual framework for interactomemapping
Venkatesan et al. Nature Methods, 2009
The square of the number of genes used to generate a data set, relative to the square of the estimated number of all protein-encoding genes, represents the fraction of all pairwise combinations that can be tested or “completeness”.
Assay sensitivity, or inherent bias of an assay, is the fraction of all biophysical interactions that can possibly be identified by that assay under optimal experimental conditions.
Sampling sensitivity of a data set represents the fraction of all theoretically detectable interactions for a particular assay found under a given sampling condition.
Precision refers to the fraction of observed pairs that are true positives. False positive pairs reflect technical artifacts that are erroneously scored positive in a given assay.
![Page 12: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/12.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Verification of PPIs by membrane Co-immunoprecipitation
Interactions between huntingtin and known interaction partners
The principle
![Page 13: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/13.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
• Adaptation of Lumier
(Barrios-Rodiles et al., Science
2005)
• Reporter assay format: readouts
for IP and Co-IP
• Determination of binding affinities
• Medium HTP (ELISA IgG-coated
plates)
=> Validation and quantification of binary interactions
Tools: PPIs validation: Quantification of PPIsHEK293 cells
![Page 14: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/14.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
A: The Y3H system can be used
to assay the competitive
binding of three proteins
B: The Y3H detects also the
protein complexes consisting
of three proteins
=> Assaying the competitive binding of three proteins or triple protein complex formation
PPIs validation: Protein complex assembly
![Page 15: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/15.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Disease networks
• Identification of new disease genes and their prospective networks
• Identification of disease-related subnetworks
• Network-based disease classification
![Page 16: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/16.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Properties of disease genes: differentially expressed cancer genes tend toward higher network connectivity
Both up- and down-regulated genes show significant positive correlation to protein degree, in contrast to the set of all genes on the microarray
Wachi, S., Yoneda, K., and Wu, R. 2005. Bioinformatics 21: 4205–4208.
![Page 17: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/17.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Prediction of disease causing genes: a gene-phenotype network
Network-neighbor of a disease-causing gene is likely to cause either the same or a similar diseaseOti, M. and Brunner, H.G. 2007. Clin. Genet. 71: 1–11.
![Page 18: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/18.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Discriminative subnetworks enriched with hallmarks of cancer
Network-based classifier to the prognosis of breast cancer metastasisChuang, H.Y., Lee, E., Liu, Y.T., Lee, D., and Ideker, T. 2007. Mol. Syst.Biol. 3: 140.
Metastatic (red) Non-metastatic (green) cancer genes.
Diamond- gene is significantly differentially expressed Circle- no significant difference in expression
Susceptibility genes-blue asterisk
![Page 19: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/19.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
PolyQ disorders
Diseases of unstable repeat expansion are a diverse group of disorders that are caused by the expansion of tri-, tetra-, or pentanucleotide repeat sequences.
Repeat expansion disorders include several spinocerebellar ataxias, Huntington disease, spinal and bulbar muscular atrophy, and dentatorubral-pallidoluysian atrophy.
These disorders share many points of pathogenic convergence, such as protein misfolding and accumulation, but also unique aspects that are determined by the normal function of the disease protein.
Everett and Wood, Brain 2004
![Page 20: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/20.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Huntington‘s Disease
Progressive neurodegenerativedisorder with autosomal dominantinheritance
Affects one in 10,000 individuals
Characterized by personality changes,motor impairment and subcortical dementia
Generally midlife age of onset
Duration of 15-20 years
Selective neuropathology in theputamen and caudate nucleus, including intranulear inclusions
Several functions of htt can be inferred from PPI networks
HD
![Page 21: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/21.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
The first disease protein interaction network
• 35 baits and 51 preys with186 interactions
• 167 potential interaction are novel
• 16 of the novel interactions were independently verified
• 16 uncharacterized proteins were functionally annotated
•15 novel Htt-IP identified
Systematic interactionmapping is a valuabletool for the assessmentof protein function providing a basis for the understanding of human diseases
Goehler, Lalowski et al. Mol Cell, 2004
![Page 22: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/22.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Identification of GIT1 - a novel stimulator of huntingtinaggregation
3 273 374 432 483 652 692124 231137
ARF Ank SHD1 CC PBS
Goehler, Lalowski et al. Mol Cell, 2004
ARF GTPase activating protein GIT1
![Page 23: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/23.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
GIT1 and huntingtin form complex in mammalian cells and colocalize in neuronal inclusions
Goehler, Lalowski et al. Mol Cell, 2004
SH-SY5Y cells
COS1
Human brain
R6/1 transgenic mice
HD patient
PC12 cells
![Page 24: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/24.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Function of GIT1
• Multidomain protein
• Localizes to PSD
• Directly associates with FAK
• Regulates Arf GTPases
• Binds to paxillin, PIX and PAK
• Role in vesicle trafficking, adhesion and cytoskeletal organization
3 273 374 432 483 652 692124 231137
ARF Ank SHD1 CC PBS
![Page 25: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/25.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
GIT1 forms a complex with PIX and regulates actin dynamics
Ser/ Thr p21-activating kinase; Rac1 effector
PAK3 PAK
Oligophrenin 3
PAK3
Rho family GAPOligophrenin 1OPHN1
GEF for Rac/ Cdc42;activator of PAK
PIXARHGEF6
FunctionProteinGene
X-linked mental retardation is associated with abnormalities in dendritic spines
GIT1PBSSHD1AnkGAP
SH3 DH PH
PIX
PAKKinasecribPP PP
Rac Rac*
GDP GTP
Actin dynamics
Spine morphogenesis Synapse formation
![Page 26: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/26.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Loss of GIT1 function may contribute to the development of HD
Exocytosis
Endocytosis
AMPARNMDR AMPAR
RecyclingRecycling
ExocytosisEndocytosis
Goehler, Lalowski et al. Mol Cell, 2004
![Page 27: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/27.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Network-based characterization of brain-specific Huntington's disease modifiers
Interactome Transcriptome Phenome Foldome
Functional maps of disease processesIdentification of disease modulators
![Page 28: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/28.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Hodges A et al.Hum Mol Genet.2006, 15(6):965-77
Network-based strategy for selection HD brain-specific modifiersGene Atlas: Su et. al. PNAS, 2006: ~15,000 genes
Stroedicke et al. submitted
![Page 29: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/29.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Huntington‘s disease relevant candidate genes
Up-regulated, p<0.01 Down-regulated, p<0.01Stroedicke et al. submitted
![Page 30: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/30.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
The family is composed of five cytoplasmic phosphoproteins of high sequence homology, named CRMP1-5CRMPs are highly expressed in brain, where they form tetramersCRMPs are important for axon formation and neurite differentiationCRMPs are mediators of semaphorin induced growth cone collapse, and part of Akt/Rho/Rac and GSK3signalling
Wang & Strittmatter, 1996
D-box
1 149 157 572317 321 380 413 503 528
CRMP-binding site
T-box Proline rich extension
NLS
D-box
1 149 157 572317 321 380 413 503 528
CRMP-binding site
T-box Proline rich extension
D-box
1 149 157 572317 321 380 413 503 528
CRMP-binding site
T-box Proline rich extension
NLSD-box: Signal for proteolysis
T-box: Putative DNA binding domain
HA-CRMP1HA-Vector
TAP-VectorTAP-HD510Q17 kDa
64
82
64
64
- -++- - ++
-- ++
IB: Anti-HA
IB: Anti-Htt
IB: Anti-CRMP1
IB:Anti-HA
Out
put
Out
put
Inpu
tIn
put
-+- +
++++++
Anti-H
tt (Pa
b)
Anti-H
tt (NIS)
No abInp
ut(10
%)
64
220
Mouse cortex
IB: Anti-CRMP1
IB: Anti-Htt (Mab)
++
++
Anti-s
ynaptob
revin
CRMPs are multidomain proteins
A B
D-box: Signal for proteolysis
T-box: Putative DNA binding domain
HA-CRMP1HA-Vector
TAP-VectorTAP-HD510Q17 kDa
64
82
64
64
- -++- - ++
-- ++
IB: Anti-HA
IB: Anti-Htt
IB: Anti-CRMP1
IB:Anti-HA
Out
put
Out
put
Inpu
tIn
put
-+- +
++++++
Anti-H
tt (Pa
b)
Anti-H
tt (NIS)
No abInp
ut(10
%)
64
220
Mouse cortex
IB: Anti-CRMP1
IB: Anti-Htt (Mab)
++
++
Anti-s
ynaptob
revin
CRMPs are multidomain proteins
A B
The collapsin response mediator protein family
![Page 31: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/31.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
CRMP1 binds to Htt and is reduced in HD brain
Stroedicke et al. submitted
Endogenous complex in the brain
Downregulation/cleavage at the protein level
Binary interaction quantified
![Page 32: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/32.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
CRMP1 reduces huntingtin aggregation and toxicity
Stroedicke et al. submitted
![Page 33: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/33.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
CRMP1 expression rescues a Htt336Q128 induced eye phenotype
![Page 34: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/34.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
INCLUSIONS
Impair proteasomefunction
OLIGOMERS
Full length HttQn
Qn
Toxic Htt fragment
Protection by sequestering oligomers
Toxic by blocking axonal transport
Increase Htt levels
Metabolic effects
TranscriptionCBPSp1core transcription machinery PGC 1
Mitochondrial function
Excitotoxicity
CalpainsROS
?
?
?
?
? ?
?
?
Systematic prediction of HD modifiers
Stroedicke et al. submitted
![Page 35: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/35.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Combination of different protein interaction techniques to increase the level of confidence
Figeys, Cell Res, 2008
![Page 36: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/36.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Gateway-Entryvector
pBTM116-D9
pcDNA3.1-PA-D57
pcDNA3.1-YFP
pcDNA3.1-GFP
pGEX-6p-D21
pDESTcopGAD426-D3
pcDNA3.1-Luc
Shuttling of human cDNAs from an entry vector into different destination plasmids using the GATEWAY® cloning technology.
Four libraries currently available:
1) Mammalian Gene Collection (MGC, USA)human ORFeome v5.1 contains app. 18,500 Full ORF Shuttle Clones http://horfdb.dfci.harvard.edu/(2) ImaGenes (Berlin, Germany):Full ORF Shuttle Clones contain the complete coding sequences for genes of interest (Human, mouse, rat).www.imagenes-bio.de/ (purchasable)3) NBRC (Japan):Human Gateway Entry Clones (33,275 clones) www.hgpd.jp/ (purchasable)4) MDC (Prof. Erich E. Wanker):The library contains ~16,000 unique genes and covers approximately 75% of the human genome (available on collaborative basis).
PPIs screening technologies: “GATEWAY recombinational cloning”
![Page 37: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/37.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Mass spectrometry of purified complexes
FLAG affinity purificationand mass spectrometry
GST (His6)- affinity purificationand mass spectrometry
Tandem affinity purificationand mass spectrometry
![Page 38: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/38.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
Affinity support
Affinity support
Affinity support
Tag Tag
Tag
Protease cleavage
Polyacrylamide gel electrophoresis
Protein identification bymass spectrometry
Mass spectrometry of purified complexes
Affinity chromatography and mass spectrometry
•Tandem affinity purification (TAP)•High-throughput mass-spectrometricprotein complex identification (HMS-PCI)Benefits: •Several members of a complex can be tagged, giving an internal check for consistency•Detects real complexes in physiological settings
Drawbacks:•Might miss some complexes not present under the given conditions•Tagging may disturb complex formation•Loosely associated components may be washed off during purification
![Page 39: Protein Chemistry/Proteomics/Mass spectrometry Uni. of ...research.med.helsinki.fi/corefacilities/proteinc...Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki zThe family](https://reader031.fdocuments.net/reader031/viewer/2022012008/612095291e8a617f970c38c1/html5/thumbnails/39.jpg)
Protein Chemistry/Proteomics/Mass spectrometry Uni. of Helsinki
PPI/Genetic interactions/pathways databases• UniHi Unified Human Interactome
(http://theoderich.fb3.mdc-berlin.de:8080/unihi/?)• PINA (http://csbi.ltdk.helsinki.fi/pina/interactome.tutorial.do)• IntAct (http://www.ebi.ac.uk/intact/main.xhtml)• HPRD Human Protein Reference Database (www.hprd.org/)• BioGRID (http://thebiogrid.org/)• Reactome (http://www.reactome.org/)• BIND (www.bind.ca)• DIP (http://dip.doe-mbi.ucla.edu/dip/Main.cgi)• Others…..
• Compendium: (http://ppi.fli-leibniz.de/jcb_ppi_databases.html)Databases & Data Collections
1. Experimental2. Predictions3. Related Domain, Pathway and Network Databases4. Webtools5. Books