This article was downloaded by: [Florida Atlantic University]On: 16 August 2013, At: 05:29Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Natural Product Research: FormerlyNatural Product LettersPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/gnpl20

Propolis immunomodulatory activityon TLR-2 and TLR-4 expression bychronically stressed miceCláudio Lera Orsatti a & José Maurício Sforcin aa Department of Microbiology and Immunology, BiosciencesInstitute, Sao Paulo State University, 18618-000 Botucatu, SaoPaulo, BrazilPublished online: 13 Apr 2011.

To cite this article: Cludio Lera Orsatti & Jos Maurcio Sforcin (2012) Propolis immunomodulatoryactivity on TLR-2 and TLR-4 expression by chronically stressed mice, Natural Product Research:Formerly Natural Product Letters, 26:5, 446-453, DOI: 10.1080/14786419.2010.482049

To link to this article: http://dx.doi.org/10.1080/14786419.2010.482049

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the“Content”) contained in the publications on our platform. However, Taylor & Francis,our agents, and our licensors make no representations or warranties whatsoever as tothe accuracy, completeness, or suitability for any purpose of the Content. Any opinionsand views expressed in this publication are the opinions and views of the authors,and are not the views of or endorsed by Taylor & Francis. The accuracy of the Contentshould not be relied upon and should be independently verified with primary sourcesof information. Taylor and Francis shall not be liable for any losses, actions, claims,proceedings, demands, costs, expenses, damages, and other liabilities whatsoever orhowsoever caused arising directly or indirectly in connection with, in relation to or arisingout of the use of the Content.

This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions

Natural Product ResearchVol. 26, No. 5, March 2012, 446–453

Propolis immunomodulatory activity on TLR-2 and TLR-4 expression

by chronically stressed mice

Claudio Lera Orsatti and Jose Maurıcio Sforcin*

Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo StateUniversity, 18618-000 Botucatu, Sao Paulo, Brazil

(Received 22 October 2009; final version received 22 March 2010)

Our group has been investigating the immunomodulatory activity ofpropolis in stressed mice. In this work, we wish to report the action ofpropolis in chronically stressed mice, assessing the Toll-like receptor (TLR-2 and TLR-4) expression by spleen cells and corticosterone levels as a stressindicator. Male C57BL/6 mice were divided into four groups: G1 wasconsidered the control; G2 was treated with propolis (200mg kg�1); G3 wassubmitted to restraint stress for 14 days; and G4 was treated with propolisand immediately submitted to stress. After sacrifice, spleens were removedand TLR-2 and TLR-4 gene expression was analysed. TLR-2 and TLR-4expression was increased in propolis-treated mice, and propolis adminis-tration to stressed mice prevented the inhibition of TLR-2 and TLR-4expression. No differences were seen in the corticosterone levels among thegroups. Propolis exerted an immunomodulatory action in chronicallystressed mice, upregulating TLR-2 and TLR-4 mRNA expression,contributing to the recognition of microorganisms and favouring the initialsteps of the immune response during stress.

Keywords: propolis; stress; Toll-like receptors

1. Introduction

Stress may be defined as any threat to homeostasis, depending on the nature andintensity of the stressor. Stress includes the sympatho-adrenal and hypothalamic–pituitary–adrenocortical (HPA) systems, resulting in the release of cathecolaminesand glucocorticoids, which can lead to immunosuppression (Sanchez, Toledo-Pinto,Menezes, & Pereira, 2003). Impaired immune competence has been shown inindividuals experiencing chronic stress, and may lead to increased risk of infectiousdiseases and cancer (Kunz-Ebrecht, Mohamed-Ali, Feldman, Kirschbaum, &Steptoe, 2003).

In the past few years, our research group has been investigating propolis actionon the immune system of acutely or chronically stressed mice (Missima, Pagliarone,Orsatti, & Sforcin, 2009; Missima & Sforcin, 2008; Pagliarone, Missima, Orsatti,Bachiega, & Sforcin, 2009a; Pagliarone et al., 2009b; Sforcin, Missima, Orsatti,Pagliarone, & Kaneno, 2008). Propolis is a hive product, collected by bees from

*Corresponding author. Email: sforcin@ibb.unesp.br

ISSN 1478–6419 print/ISSN 1478–6427 online

� 2012 Taylor & Francis

http://dx.doi.org/10.1080/14786419.2010.482049

http://www.tandfonline.com

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013

the bud and exudates of certain trees and plants and stored inside their hives toprotect the colony due to its antimicrobial properties (Bankova, 2005). Propolis hasbeen intensively used in folk medicine due to its several biological properties, such asanti-inflammatory, antibacterial, antifungal, antiviral, antitumoural, antioxidantand immunomodulatory, among others (Bassani-Silva, Sforcin, Amaral, Gaspar, &Rocha, 2007; Bufalo et al., 2009; Orsolic, Saranovic, & Basic, 2006; Sforcin, 2007;Sforcin, Fernandes, Lopes, Bankova, & Funari, 2000). The main vegetal source ofour propolis sample is Baccharis dracunculifolia D.C., followed by Eucalyptuscitriodora Hook and Araucaria angustifolia (Bert.) O. Kuntze (Bankova et al., 1999).

Toll-like receptors (TLRs) play a critical role in the recognition of specificmolecular patterns found in a broad range of microbial pathogens and in theinitiation of immune responses (Kawai & Akira, 2006; Pannacci et al., 2006; Sodhi,Tarang, & Kesherwani, 2007). TLR-2 and TLR-4 have been widely studied due totheir importance against microorganisms: TLR-2 recognises, for example, compo-nents from Gram-positive bacteria and fungi zymozan, whereas TLR-4 recognisesGram-negative bacteria and lipopolysaccharides (LPS) (Doyle & O’Neill, 2006).

Recently, we showed that propolis counteracted the inhibition on TLR-4 mRNAexpression and partially restored TLR-2 expression in acutely stressed mice(Pagliarone et al., 2009b). In this work, we evaluate TLR-2 and TLR-4 gene expres-sion by spleen cells from chronically stressed mice treated with or without propolis,in order to explore the potential of this apitherapeutic agent during stress.

2. Results and discussion

The effects of propolis on the immune system of stressed mice have previously beenthe subject of investigation in our laboratory (Missima et al., 2009). The mainconstituents of our propolis sample, investigated by TLC, GC and GC–MS analysis,were: aromatic acids (dihydrocinnamic acid, p-coumaric acid, ferulic acid, caffeicacid, 3,5-diprenyl-p-coumaric acid, 2,2-dimethyl-6-carboxy-ethenyl-8-prenyl-2H-1-benzo-pyran); flavonoids (kaempferid, 5,6,7-trihydroxy-3,40 dimethoxyflavone,aromadendrine-40-methyl ether); a prenylated p-coumaric acid and two benzopyr-anes: E and Z 2,2-dimethyl-6-carboxyethenyl-8-prenyl-2H-benzopyranes); essentialoils (spathulenol, [2Z,6E ]-farnesol, benzyl benzoate and prenylated acetophenones);di- and triterpenes, among others (Bankova, Boudourova-Krasteva, Popov, Sforcin,& Funari, 1998). Here, we investigated propolis action on TLR-2 and TLR-4 geneexpression by spleen cells from chronically stressed mice.

TLR-2 and TLR-4 have been widely studied due to their importance in immuneresponse against bacterial infection, enhancing phagocytosis activity and thecapacity of presenting antigens to T cells (Takeda & Akira, 2005). Followingpathogen activation, TLR activation induces downstream signalling cascades thatresult in the transcription of pro-inflammatory genes, antiviral responses andmaturation of dendritic cells (Akira & Takeda, 2004; Kawai & Akira, 2005; Lu, Yeh,& Ohashi, 2008).

Propolis-treated mice (G2) showed a non-significant increase in TLR-2expression by murine spleen cells compared to control mice (G1). TLR-2 mRNAexpression was non-significantly inhibited in the spleen cells from stressed mice (G3),whereas propolis administration for 14 days to stressed mice (G4) prevented the

Natural Product Research 447

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013

inhibition of TLR-2 expression (p5 0.01) (Figure 1). A significantly increasedTLR-4 gene expression was found only in propolis-treated mice (G2) (p5 0.001),and no difference was seen between G1, G3 and G4 (Figure 2). Ethanol (the propolissolvent) did not influence TLR expression, and propolis effects were exclusively dueto its constituents (data not shown). Stressed mice showed a non-significant decreasein both receptors, whereas propolis administration prevented the inhibitionof TLR-2 and TLR-4 expression, showing that these receptors can be regulatedby propolis treatment during stressful conditions.

It has been reported that propolis administration over a short term leads topositive results concerning the immune system, increasing the immunologicalresponses (Sforcin, 2007). In fact, we showed in a previous work by our groupthat propolis administration to mice for three consecutive days activated the initialsteps of the immune response by upregulating TLRs expression and the productionof pro-inflammatory cytokines by BALB/c mice (Orsatti et al., 2010). Moreover,

Figure 2. Relative quantification by real-time PCR of TLR-4 expression by spleen cells.Notes: All results, normalised to �-actin, were expressed as arbitrary units relative to the valueof 1.0. G1¼ control; G2¼ propolis; G3¼ stress; G4¼ propolisþ stress. Data are expressed asmeans and standard-deviation (n¼ 8). ?Significantly different from G1 (p5 0.001).

G1 G2 G3 G40

2

4

6

*

*

TLR

-2 r

elat

ive

expr

essi

on

Figure 1. Relative quantification by real-time PCR of TLR-2 expression by spleen cells.Notes: All results, normalised to �-actin, are expressed as arbitrary units relative to the valueof 1.0. G1¼ control; G2¼ propolis; G3¼ stress; G4¼ propolisþ stress. Data are expressed asmeans and standard deviation (n¼ 8). ?Significantly different from G3 (p5 0.01).

448 C.L. Orsatti and J.M. Sforcin

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013

mice submitted to restraint stress for three days had a significant inhibition in TLR-2

and TLR-4 expression by spleen cells, while propolis treatment prevented the

stress-induced TLR-4 inhibition in stressed mice, and partially restored TLR-2

expression, contributing to a better recognition of infectious microorganisms during

stress (Pagliarone et al., 2009b).As to corticosterone levels, no significant differences were seen between the

experimental groups (Table 1). It has been related that different types of stress,

intensity, time of measurement of a particular parameter and mice strains may lead

to different biological effects and to controversial results regarding this stress

indicator (Kioukia-Fougia et al., 2002). Ikushima et al. (2004) have reported that

TLR-2 and TLR-4 expression was suppressed in peripheral blood mononuclear cells

from patients after surgical stress, due to the modulation of these receptors’

expression by steroids. On the other hand, it has been verified that glucocorticoids

can induce TLR-2 and TLR-4 expression in multiple cell types (Homma et al., 2004),

suggesting that the role of glucocorticoids on TLR modulation needs further

investigation. Different stressors commonly used in research may not activate

the physiological response to the same extent, and variations in the measured

immune responses may reflect differential HPA axis activation and differential

metabolic pathways in response to specific stressors (Bowers, Bilbo, Dhabhar, &

Nelson, 2007).One may conclude that propolis exerted an immunorestorative role in stressed

mice, preventing TLR-2 and TLR-4 inhibition. This is an important finding, since

TLRs play a crucial role in microbial recognition and development of the adaptive

immune response. Our group has shown, for the first time, the effects of propolis

alone on TLR expression by normal mice as well as by acutely or chronically stressed

mice; however, new studies are still needed to understand how propolis affects

different cells of the immune system, mainly during the impact of stress on the

immune system.

3. Experimental

3.1. Animals

Male C57BL/6 mice aged between 8 and 12 weeks were kept in the Department

of Microbiology and Immunology, Biosciences Institute, UNESP, Campus of

Botucatu, at 22–24�C for 12 h in a light–dark cycle, with food and water ad libitum

for a week before the assays.

Table 1. Serum corticosterone concentration (ngmL�1).

Control Propolis Stress Propolisþ stress

64.70� 35.39 104.94� 59.20 39.96� 20.51 51.90� 22.77

Notes: G1¼ control; G2¼ propolis; G3¼ stress; G4¼propolisþ stress. Data are expressed as means and standarddeviation (n¼ 8) (p4 0.05).

Natural Product Research 449

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013

3.2. Propolis solution

Propolis was produced by Apis mellifera L. bees in an apiary located in the LageadoFarm, UNESP, Campus of Botucatu, using plastic nets. Samples were collected andsubsequently frozen to promote propolis removal from the nets. Afterwards,propolis was ground and a 30% ethanol extract was prepared (30 g of propolis addedto a 70% ethanol solution, totalling 100mL), in the absence of bright light, at roomtemperature and shaken moderately (Missima et al., 2009). After a week, extractswere filtered and final concentrations were calculated, and the dry weight of thesolutions was obtained (120mgmL�1). The chemical composition of propoliswas investigated using TLC, GC, and GC–MS analyses. Specific dilution was carriedout to determine the concentration of the propolis solutions to be given to theanimals (200mgkg�1).

3.3. Experimental groups and stress procedures

Mice were randomly divided into four groups (G1, G2, G3 and G4), each consistingof eight animals. G1 was considered as the control and G2 was treated with propolissolution (200mgkg�1 day�1, 0.1mL, by gavage – previously standardised in ourlaboratory) (Missima & Sforcin, 2008). G3 was submitted to stress by restraint in animmobilisation conical tube of 50mL (restrainer), with ventilation holes, for 14consecutive days, increasing the immobilisation period: 15, 30, 45, 60, 75, 90 and120min during 7 consecutive days, and from the 7th to the 14th day mice weresubmitted to restraint stress for 2 h a day, at a fixed time between 8:00 and 11:00 a.m.This procedure is easily performed and causes no physical pain to the animals(Missima et al., 2009). Both G1 and G3 received physiological solution (NaCl 0.9%,0.1mLday�1) by gavage before the stress procedures. G4 was treated with propolisand immediately submitted to stress protocols. A group of mice was treated with70% ethanol (the propolis solvent) only at the same concentration as the propolissolution, in order to investigate its effects after 14 days. All groups were sacrificedimmediately after the last stress procedure, using a CO2 inhalation chamber. Animalprocedures were carried out in accordance with Ethical Principles in AnimalResearch adopted by Brazilian College of Animal Experimentation, and this projectwas approved in May 2005 (no. 464).

3.4. Corticosterone determination by radioimmunoassay

Blood of all experimental groups was obtained by cardiac puncture, and sera werestored at �20�C. Corticosterone levels were determined by radioimmunoassay, usinga commercial kit and following the manufacturer’s instructions (Coat-A-Count� RatCorticosterone, Siemens, Los Angeles, CA).

3.5. RNA isolation and cDNA synthesis

Approximately 30mg of the spleens were kept in 250 mLof RNA Safer (OmegaBio-Tek, Inc. USA) at �80�C until RNA isolation procedures. Total RNA wasextracted with an RNA spin mini RNA isolation kit (GE–Healthcare, USA)following the manufacturer’s instructions. After purification, RNA was treated with

450 C.L. Orsatti and J.M. Sforcin

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013

RQ1 RNase-free DNase (Promega, Madison, WI, USA) for 30min at 37�C in order

to avoid false-positive results due to the amplification of contaminating genomic

DNA. Total RNA concentrations (using 1 mg RNA for each sample) were

determined spectrophotometrically at 260 nm. For cDNA synthesis, 1 mg of total

RNA from each sample was mixed with 500 ng of random primer in a final volume

of 8 mL. The mixture was incubated for 5min at 70�C. For each sample, the master

mix was prepared with 8 mLof reaction buffer (Improm II 5x) containing 1.5mM

of MgCl2, 200 units of RNase Out (Invitrogen), 250 nM of each dNTP,

1 mLof Improm RT II (Promega, USA) and 13.2mLof nuclease-free water. For

each sample, 32 mLof Master Mix was added and the mixture was incubated for

5min at 25�C, 60min at 42�C and for 15min at 70�C. The cDNA samples were

stored at �20�C.

3.6. Quantitative real time PCR

Primers for murine TLR were designed based on the sequences retrieved from

Genebank using the IDTSciTools software (http://www.idtdna.com) and synthesised

by IDT (USA). The sequences of specific primers for TLR-2, TLR-4 and �-actin are

given in Table 2. The PCR mixture consisted of 4 mLof cDNA, 200 nM of each

primer, 10 mLof 2x Power Sybr� Green PCR Master Mix (Applied Biosystems,

Foster City, CA) and sterile nuclease-free water for a final volume of 20 mL. Thereaction conditions were as follows: 95�C per 10min for initial denaturation,

amplification for 40 cycles (95�C for 15 s for denaturation, 60�C for 1min for

annealing and extension), and to confirm the PCR product, one cycle of melting

curve analysis at 95�C for 15 s, 60�C for 30 s and 95�C for 15 s. Fluorescence data

were collected during each annealing/extension step and threshold cycle

numbers (CT) were determined using ABI PRISM� 7300 sequence detector

(Applied Biosystems, USA) and software SDS Version 1.2.3 (7300 Real Time

PCR System, Applied Biosystems, USA). Reaction mixtures with no cDNA were

used as a negative control and all PCR assays were performed in duplicate. The

standard curve was generated by performing serial dilutions of cDNA from a

reference sample. To the smallest dilution of cDNA standard, it was given the

relative value of 100, and following the same reason of dilution, the other three

points were 50, 25 and 12.5. The relative concentration of TLR-2 and TLR-4 was

Table 2. Sequences of primers for TLR-2, TLR-4 and �-actin.

Primers Sequences 50–30 Accession number

TLR2 forward CTTCCTGGTTCCCTGCTCGTTCTC NM0119052TLR2 reverse CAAGAACAAAGAAAATGAGTCAAG NM0119052TLR4 forward TGACAGGAAACCCTATCCAGAGTT NM021297TLR4 reverse TCTCCACAGCCACCAGATTCT NM021297�-actin forward AAGTGTGACGTTGACATCCGTAA Yang, Xu, Iuvone and

Grossniklaus (2006)�-actin reverse TGCCTGGGTACATGGTGGTA Yang et al. (2006)

Natural Product Research 451

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013

determined by the relative standard curve method after normalisation with �-actin(Larionov, Krause, & Miller, 2005), using the SDS software.

3.7. Statistical analysis

All results were analysed using the statistical software GraphPad (GraphPadSoftware, Inc., San Diego, CA, USA). Significant differences between treatmentswere determined by analysis of variance (ANOVA), followed by Tukey–Kramer’stest. Statistical significance was accepted when p5 0.05.

References

Akira, S., & Takeda, K. (2004). Toll-like receptor signaling. Nature Reviews Immunology,

4, 499–511.Bankova, V. (2005). Recent trends and important developments in propolis research.

Evidence-Based Complementary and Alternative Medicine, 2, 29–32.Bankova, V., Boudourova-Krasteva, G., Popov, S., Sforcin, J.M., & Funari, S.R.C. (1998).

Seasonal variations of the chemical composition of Brazilian propolis. Apidologie, 29,

361–367.Bankova, V., Boudourova-Krasteva, G., Sforcin, J.M., Frete, X., Kujumgiev, A.,

Maimoni-Rodella, R., et al. (1999). Phytochemical evidence for the plant origin

of Brazilian propolis from Sao Paulo State. Zeitschrift fur Naturforschung C, 54,

401–405.Bassani-Silva, S., Sforcin, J.M., Amaral, A.S., Gaspar, L.F.J., & Rocha, N.S. (2007). Propolis

effect in vitro on canine transmissible venereal tumor cells. Revista Portuguesa de

Ciencias Veterinarias, 102, 261–265.

Bowers, S.L., Bilbo, S.D., Dhabhar, F.S., & Nelson, R.J. (2007). Stressor-specific alterations

in corticosterone and immune responses in mice. Brain, Behavior, and Immunity, 22,

105–113.Bufalo, M.C., Figueiredo, A.S., Sousa, J.P.B., Candeias, J.M.G., Bastos, J.K., & Sforcin, J.M.

(2009). Anti-poliovirus activity of Baccharis dracunculifolia and propolis by cell viability

determination and real-time PCR. Journal of Applied Microbiology, 107, 1669–1680.Doyle, S.L., & O’Neill, L.A.J. (2006). Toll-like receptors: from the discovery of NF�B to new

insights into transcriptional regulations in innate immunity. Biochemical Pharmacology,

72, 1102–1113.

Homma, T., Kato, A., Hashimoto, N., Batchelor, J., Yoshikawa, M., Imai, S., et al. (2004).

Corticosteroid and cytokines synergistically enhance Toll-like receptor 2 expression in

respiratory epithelial cells. American Journal of Respiratory Cell and Molecular Biology,

31, 463–469.

Ikushima, H., Nishida, T., Takeda, K., Ito, T., Yasuda, T., Yano, M., et al. (2004). Expression

of Toll-like receptors 2 and 4 is downregulated after operation. Surgery, 135, 376–385.

Kawai, T., & Akira, S. (2005). Pathogen recognition with Toll-like receptors. Current Opinion

in Immunology, 17, 338–344.Kawai, T., & Akira, S. (2006). TLR signaling. Cell Death and Differentiation, 13, 816–825.

Kioukia-Fougia, N., Antoniou, K., Bekris, S., Liapi, C., Christofidis, I., & Papadopoulou-

Daifoti, Z. (2002). The effects of stress exposure on the hypothalamic-pituitary-adrenal

axis, thymus, thyroid hormones and glucose levels. Progress in Neuro-

Psychopharmacology and Biological Psychiatry, 26, 823–830.

452 C.L. Orsatti and J.M. Sforcin

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013

Kunz-Ebrecht, S.R., Mohamed-Ali, V., Feldman, P.J., Kirschbaum, C., & Steptoe, A. (2003).Cortisol responses to mild psychological stress are inversely associated withproinflammatory cytokines. Brain, Behavior, and Immunity, 17, 373–383.

Larionov, A., Krause, A., & Miller, W. (2005). A standard curve based method for relative

real time PCR data processing. BMC Bioinformatics, 6, 62.Lu, Y.C., Yeh, W.C., & Ohashi, P.S. (2008). LPS/TLR4 signal transduction pathway.

Cytokine, 42, 145–151.

Missima, F., Pagliarone, A.C., Orsatti, C.L., & Sforcin, J.M. (2009). The effect of propolis onpro-inflammatory cytokines produced by melanoma-bearing mice submitted to chronicstress. Journal of ApiProduct and ApiMedical Science, 1, 11–15.

Missima, F., & Sforcin, J.M. (2008). Green Brazilian propolis action on macrophages andlymphoid organs in chronically stressed mice. Evidence-based Complementary andAlternative Medicine, 5, 71–75.

Orsatti, C.L., Missima, F., Pagliarone, A.C., Bachiega, T.F., Bufalo, M.C., Araujo Jr, J.P.,et al. (2010). Propolis immunomodulatory action in vivo on Toll-like receptors 2 and 4expression and on pro-inflammatory cytokines production in mice. PhyotherapyResearch, 24, 1141–1146.

Orsolic, N., Saranovic, A.B., & Basic, I. (2006). Direct and indirect mechanism(s) ofantitumour activity of propolis and its polyphenolic compounds. Planta Medica,72, 20–27.

Pagliarone, A.C., Missima, F., Orsatti, C.L., Bachiega, T.F., & Sforcin, J.M. (2009a).Propolis effect on Th1/Th2 cytokines production by acutely stressed mice. Journalof Ethnopharmacology, 125, 230–233.

Pagliarone, A.C., Orsatti, C.L., Bufalo, M.C., Missima, F., Bachiega, T.F., Araujo Jr,J.P., et al. (2009b). Propolis effects on pro-inflammatory cytokine production and Toll-like receptor 2 and 4 expression in stressed mice. International Immunopharmacology, 9,1352–1356.

Pannacci, M., Lucini, V., Colleoni, F., Martucci, C., Grosso, S., Sacerdote, P., et al. (2006).Panax ginseng C.A. Mayer G 115 modulates pro-inflammatory cytokine production inmice throughout the increase of macrophage Toll-like receptor 4 expression during

physical stress. Brain, Behavior, and Immunity, 20, 546–551.Sanchez, A., Toledo-Pinto, E.A., Menezes, M.L., & Pereira, O.C.M. (2003). Changes in

norepinephrine and epinephrine concentrations in adrenal gland of the rats submitted to

acute immobilization stress. Pharmacological Research, 48, 607–613.Sforcin, J.M. (2007). Propolis and the immune system: a review. Journal of

Ethnopharmacology, 113, 1–14.

Sforcin, J.M., Fernandes Jr, A., Lopes, C.A.M., Bankova, V., & Funari, S.R.C. (2000).Seasonal effect on Brazilian propolis antibacterial activity. Journal ofEthnopharmacology, 73, 243–249.

Sforcin, J.M., Missima, F., Orsatti, C.L., Pagliarone, A.C., & Kaneno, R. (2008). Propolis

effect on Th1/Th2 cytokine profile in melanoma-bearing mice submitted to stress.Scandinavian Journal of Immunology, 68, 216–217.

Sodhi, A., Tarang, S., & Kesherwani, V. (2007). Concanavalin A induced expression of

Toll-like receptors in murine peritoneal macrophages in vitro. InternationalImmunopharmacology, 7, 454–463.

Takeda, K., & Akira, S. (2005). Toll-like receptors in innate immunity. International

Immunology, 17, 1–14.Yang, H., Xu, Z., Iuvone, P.M., & Grossniklaus, H.E. (2006). Angiostatin decreases cell

migration and vascular endothelium growth factor (VEGF) to pigment epitheliumderived factor (PEDF) RNA ratio in vitro and in a murine ocular melanoma model.

Molecular Vision, 12, 511–517.

Natural Product Research 453

Dow

nloa

ded

by [

Flor

ida

Atla

ntic

Uni

vers

ity]

at 0

5:29

16

Aug

ust 2

013