project- Liron Schwartz
-
Upload
liron-schwartz -
Category
Documents
-
view
146 -
download
3
Transcript of project- Liron Schwartz
1
The Presence of Thioredoxin Gene
in Cyanopodoviruses
Presented By: Liron Schwartz 305022998
Supervisors: Prof. Debbie Lindell & Shay Kirzner
Date: 04/08/2013
Photograph was taken from Dekel-Bird et al., 2013.
2
Introduction
Marine cyanobacteria of the genera Prochlorochoccus and Synechococcus are highly
abundant organisms in oceanic waters1. Since they are oxygenic phototrophs and do
photosynthesis, they have a great contribution to the global primary productivity2. Viruses that
infect cyanobacteria (cyanophages) are the most abundant particles in marine ecosystems3,
therefore they have a strong impact on both host abundance3,4
and diversity5–7
.
These
bacteriophages belong to the Caudovirales order, in which a virion is composed of an
icosohedral head, that contains the double-stranded DNA viral genome, and a flexible tail7–12
.
These bacteriophages are divided into three families according to tail morphology: The
T7-like Podoviridae with short tails
13–15, the T4-like and TIM5-like Myoviridae with contractile
tails16
and a diverse cyanophage group Siphoviridae with long non-contractile tails17,18
. The
cyanopodoviruses and cyanomyoviruses genomes range from 42kb to 47kb and 161kb to
252kb, respectively13–15,19,20
. The cyanosiphoviruses genomes range from 30kb to 108kb18
.
The cyanopodoviruse genome is similar to that of T7 phage in both gene content and
genomic architecture14
. It's genome is organized into three functional clusters that contain
putative host take-over genes, DNA replication genes and phage particle formation genes13–
15,19.
Some cyanopodophages encode host-like genes which they have acquired from their
hosts through co-evolution14,16,20–22
. These genes participate in oxygenic photosynthesis,
metabolic pathways and stress-response14,23–26
. For example, photosystem II reaction center
gene (psbA), which takes part in the light reactions of photosynthesis23,25,26
; high light inducible
stress response gene (hli)27
; transaldolase (talC) and ribo-nucleotide reductase (nrd)25
. While
talC inhibits Calvin's cycle it activates the pentose-phosphate cycle which produces NADPH
and carbon substrates required for nucleotide and DNA synthesis28
. The genes nrd, hli and
psbA are situated in cluster II whereas talC is located at the end of the genome in cluster III14
.
Despite the different positions of these genes, all of them are expressed during infection and are
transcribed together with DNA replication genes24
. It has been hypothesized accordingly that
they function together to produce carbonic compounds and energy during photosynthesis
thereby improving phage fitness24
.
P60-like clade cyanopodoviruses can be divided into two sub clades by DNA
polymerase gene diversity: MPP-A (marine picocyanopodoviruse A) and MPP-B (marine
picocyanopodoviruse B)19,29,30
. There are some differences between the two groups: clade A
phages infect primarily Synechococcus and have no psbA, hli and talC genes whereas clade B
phages infect either Synechococcus or Prochlorochoccus and almost all of them encode psbA,
hli and talC gene14,16,23,26,29,31–34
. Moreover, the phages associated to clade B have greater
diversity than of clade A phages29
. Currently, fourteen marine cyanopodoviruses genomes are
known13–15,19,35,36
.
Recent unpublished work has showed that clade A phages are more virulent and take
over the host faster than clade B phages. Furthermore, clade A phages replicate faster and
create bigger plaques soon after the infection than clade B phages (unpublished results).
3
In this study we wanted to deepen our understanding of why clade A phages are more
virulent than clade B phages? Specifically, we wished to discover the gene (or genes) in clade
A phages that causes the noted difference in the virulence.
There are a few possible hypotheses. One possible hypothesis is that variation in
encoding psbA, hli and talC genes in each clade may lead to different replication rates.
Additionally, gene interactions can influence the replication rate and virulence.
Another possible hypothesis is that variation in encoding thioredoxin (trx) gene exists.
Trx (also called gp25) is a 294bp long15
, known in T7 phages. In the replication system of T7
phages, the protein encoded by trx forms a complex with gp5 which binds to the DNA
replication fork and to helicase37
. Trx increases the replication rate and the processivity of DNA
polymerase38–42
. While P60 and Syn5 encode trx13,15
TIP37 doesn't (unpublished results),
suggesting that some clade A cyanophages probably encode trx while clade B cyanophages
don't. The goal of this study is to check this hypothesis and examine a specific locus in the
genome of clade A and B phages for the presence of the trx gene.
Experimental Procedures
We focused on a specific locus in cluster II at the genome, from primase/helicase
(pri/hel) to DNA polymerase (Dpol) genes. Syn5 and TIP37 were used as positive and negative
controls of encoding trx, respectively. Trx presence was studied with lysates that had only
cyanopodoviruses (no contamination). Syn9 (a known cyanomyoviruse20
) was used as a
negative control for identification of cyanopodoviruses.
Four cyanopodoviruses from clade A (P-SSP9, TIP28, TIP33, TIP30) and eleven from
clade B (TIP45, TIP46, P-GSP1, P-SSP3, P-SSP2, P-SSP6, TIP39, TIP42, P-RSP1, TIP41 and
TIP67) were examined. The samples to be sequenced were chosen based on PCR results. Bands
from clade A lysates that supported the presence of trx (TIP28 in Trx-R, TIP28 in Pri-
Hel/Dpol, TIP33 in Trx-R) as well as unexpected bands from clade B lysates (TIP41 in Trx-L)
were sent to sequencing.
In order to perform sequencing of the desired fragments, we first needed to amplify the
DNA amount of each sample. We prepared several duplicates of each fragment (Table 1), with
the same PCR conditions. The amplified DNA fragments were cloned and then sent for
sequencing (Table 1). The primers used for sequencing were either SP6 or T7. We calculated
the coverage percentage of each homologues region from their homologues genes by dividing
the number of amino acids of the homologues region by the length of homologues proteins.
This index indicates the reliability of the results. Higher coverage percentage indicates stronger
similarity of the homologues region to the protein.
PCR primer design
The degenerate primers used for identification of cyanopodoviruses were known primers
complementary to the DNA polymerase gene: Dpol 143-F and 534-R10,30,32,43,44.
4
The identification of cyanomyoviruses was carried by g20 (a conserved T4-like viral
capsid assembly gene45
) primers46
.
Four different degenerate primers, Pri/Hel_F, Trx-R, Trx-F and Dpol_R, were designed
to explore the existence of trx. The melting temperatures of the primers were: 35.60C, 66.5
0C,
66.50C and 42.4
0C, respectively. These primers correspond to three locations along the
investigated locus: Pri/Hel Dpol, Trx-Right (Trx-R) and Trx-Left (Trx-L). Pri/Hel Dpol
segment contains the whole locus between primase/helicase and DNA polymerase. Trx-R
segment contains the right half of trx and Dpol and Trx-L segment contains the locus between
the left half of trx and pri/hel, as illustrated in Figure 1. Syn5 and TIP37 have different Pri/Hel
Dpol locus content15
(the information about TIP37 is derived from unpublished results). Clade
A and B phages are expected to have similar Pri/Hel Dpol content as Syn5 and TIP37,
respectively (Figure 1). The expected PCR fragments are presented in Table 2.
PCR conditions
PCRs were carried out in a total volume of 25 µl, including 2µM forward and reverse primers,
0.2mM dNTPs, 1X reaction buffer, 0.08 u/µl BIO-X-ACT DNA polymerase and 1 µl phage
lysate as template. All PCRs had the same cycling conditions with different annealing
temperatures (Table 3). The conditions included an initial 5 min denaturing step at 95°C
followed by 40 cycles of denaturation at 95°C for 45 sec, annealing at 35–500C for 0.75-1 min,
elongation at 70°C for 45 sec, and a final elongation step at 70°C for 10 min.
Gel electrophoresis
All tests were carried on 2% agarose gel. The gel consisted of TAE buffer that was also used as
a running buffer. A 100bp ladder was used for the PCR products runs.
In order to check plasmid insertion, it was cleaved by EcoR-I endonuclease, and
fragments were separated by length in gel electrophoresis. A 1kb ladder was used to distinguish
between samples containing an insert and samples with plasmid only. A closed empty plasmid
was used as a control. One ladder was used for several clones.
DNA extraction from the gel
PCR fragments were excised from the gel and purified with the MinElute gel extraction kit
(Qiagen). The extracted DNA concentration was measured by nano-drop analysis.
Cloning
The gel purified fragments were inserted into pCRII-TOPO (Invitrogen) cloning vectors with
an ampicillin resistance gene and a β-galactosidase marker. The plasmids were transformed
into E. coli DH5α for blue/white screening. This strain has deletions of β-galactosidase (lacZ)
gene, so colonies containing an empty plasmid will turn blue. Colonies containing a plasmid
with an insert will turn white since it disrupts the lacZ expression. Ampicillin was added to the
growth medium in order to prevent the growth of bacteria that didn't take up the plasmid during
5
B.
Pri/Hel DNA Polymerase
~0.5kb
the transformation. Finally, plasmids were extracted from the bacteria using the QIAprep
Miniprep Kit (Qiagen).
Comparative genomics
The sequences of the primers and plasmids were excluded from the sequencing results.
Sequences of the inserts were compared (at the nucleotide level) with a nucleotide collection
database using TBLASTX program (NCBI).
Figure 1. Illustration of the Pri/Hel Dpol locus in cluster A and B phages with the
designed primers. (A) Pri/Hel Dpol locus of clade A phages, based on Syn5 known locus;
(B) Pri/Hel Dpol locus of clade B phages, based on TIP37 known locus. Arrows represent
the primers and their positions on the genome. The gray primers confine the whole Pri/Hel
Dpol segment, whereas the gray-red couples define the Trx-L and Trx-R segments.
Table 1. Data on PCR repeats and clones.
Sequence region PCR repeats Number of clones Number of clones sent for sequencing
TIP28 Trx-R 5 2 2
TIP33 Trx-R 8 2 1
TIP28 Pri-Hel/Dpol 4 3 1
TIP41 Trx-L 6 5 1
The number of PCR repeats ranged from 4 to 8 and the number of clones from 2 to 5.
Only one or two clones were sent for sequencing as it was sufficient for our analysis.
Table 2. The expected PCR fragments of Pri-Hel/Dpol, Trx-L and Trx-R.
Ø Pri-Hel/Dpol Trx-L Trx-R
Clade A ~1kb ~250bp ~800bp
Clade B ~0.5kb / ? - -
Since there is no previous information on the Pri-Hel/Dpol segment of cluster B phages,
there are two possible options. If trx is present in the segment, we expect to see a ~0.5kb
band. If not, the band length depends on the existence of other genes. If there are no genes
between Pri/Hel and DNA polymerase then no bands are expected. Otherwise, band length
will be correlated to the size of the genes present.
~250bp ~800bp
Pri/Hel trx gp 26 DNA Polymerase
~3kbp
A.
6
Table 3. Primers annealing duration and temperature.
Primers Annealing temperatures Annealing
duration
Dpol 500C 45sec
g20 350C 1min
Pri/Hel Dpol 400C* 1min
Trx-R 500C 45sec
Trx-L 400C 1min
The annealing temperatures of the primers ranged from 350-50
0C and the annealing duration
ranged from 0.75-1min. *In order to increase the specificity of the Pri/Hel Dpol primers, a
few tests were performed in 450-50
0C annealing temperatures.
Results
The identification of cyanopodoviruses results indicated that P-SSP9 and P-RSP1 lysates had
cyanomyoviruses (bands appeared for g20 primers) and therefore these lysates were excluded from the next
tests. Samples TIP45, TIP46 and TIP67 in Trx-L fragment weren't analyzed in PCR. The gel
electrophoresis results of PCR products are presented in Table 4.
Gel electrophoresis results of TIP28 in the Trx-R segment, TIP33 in the Trx-R segment and TIP28
in Pri/Hel Dpol fragment are presented in Figures 2A, 4 and 6A, respectively.
Verification of incorporation of TIP28 in the Trx-R segment, TIP28 in Pri/Hel Dpol fragment and
TIP41 in Trx-L segment inserts is presented in Figures 2B, 6B and 7, respectively.
The lengths of the obtained sequences of inserts are presented in Table 5.
The sequencing results indicated that TIP28 in the Trx-R segment contained 3 homologues regions to
Syn5: DNA polymerase, gp26 and trx (Figure 3). The lengths of these proteins are: 583, 83 and 99 amino
acids respectively. TIP33 in the Trx-R segment contained 3 homologous regions to Syn5: gp5, gp6 and gp7
(Figure 5). The lengths of these proteins are: 114, 54 and 60 amino acids respectively. TIP28 in Pri/Hel
Dpol fragment showed no common homologues areas to known phages. TIP41 in Trx-L segment contained
homologous region to KBS-P-1A cyanophage: hypothetical protein containing 154 amino acids (Figure 8).
7
Table 4. The gel electrophoresis results of PCR products of Pri-Hel/Dpol, Trx-L and Trx-R
segments.
Ø Host Pri-Hel/Dpol Trx-L Trx-R
TIP28 CC9605 ~1kb ~300bp ~800bp
Syn5 WH8109 ~1kb ~250bp ~800bp
TIP33 WH8109 ~0.5kb (1/2) / - (1/2) - ~800bp (3/4) / - (1/4)
TIP30 WH8109 - - ~800bp (1/4) / - (3/4)
TIP37 WH8109 ~0.5kb - -
TIP45 WH8109 - -
TIP 46 RCC307 - -
P-GSP1 MED4 - - -
P-SSP3 MIT9312 - - -
P-SSP2 MIT9312 - - -
P-SSP6 MIT9515 - - -
TIP39 MIT9215 - - ~0.5kb (1/2) / - (1/2)
TIP42 MED4 - - -
TIP41 CC9605 - ~0.5kb ~0.5kb (1/2) / - (1/2)
TIP67 CC9605 - -
Clade A phages are labeled in red, clade B phages in blue. The host of each phage is presented.
'-' denotes that no bands were received and '/' separates between two conflicting experimental
results. In brackets is the ratio of number of presented result per all executed trials.
For all segments, the controls (Syn5 and TIP37) gave the expected bands (Table 2). Most of
type B phages didn't show bands related to trx presence. Some of clade A phages results
supported trx presence whereas others didn't.
Table 5. Sequencing results: lengths of inserts of the sequenced regions.
The primers used were either SP6 or T7. The lengths of inserts ranged from ~500bp to ~1kb.
Sequence region Primers of the clones Length of insert (bp)
TIP28 Trx-R
clone I-SP6 763
clone I-T7 924
clone II-SP6 931
clone II-T7 940
TIP33 Trx-R clone I-SP6 493
clone I-T7 604
TIP28 Pri Hel/Dpol clone I-SP6 947
TIP41 Trx-L clone I-SP6 668
8
Figure 2. Samples of TIP28 in Trx-R segment.
(A) Gel electrophoresis results of TIP28 with Trx-R primers. Almost all the samples gave
~800bp band, similar to Syn5. (B) Verification of incorporation of TIP28 insert to plasmid.
All samples had 4kb (plasmid) and ~1kb bands.
Figure 3. Homologues regions analyses of TIP28 in Trx-R
fragment to Syn5.
The homology regions with SP6 primers that were depicted: (A) DNA polymerase; (B)
gp26; with T7 primers: (C) trx. Bit score ranged from 74 to 203 and the identities score
A.
hom
B.
C.
9
ranged from 53% to 77%. The coverage percentage of the homologues regions of the
homologues genes were 20%, 94% and 50%, respectively.
Figure 4. Samples of TIP33 in Trx-R segment.
All samples had ~800bp intense band, similar to Syn5.
Figure 5. Homologues regions analyses of TIP33 in Trx-R fragment to Syn5.
The homology region with T7 primers that were depicted: (A) gp5; and with SP6 primers:
(B) gp5, gp6 and gp7. Bit score ranged from 137 to 162 and the identities score ranged
from 69% to 79%. The coverage percentage of the homologues regions of the homologues
genes were 76% and 37%, respectively.
A.
B.
10
Figure 6. Samples of TIP28 in Pri/Hel Dpol fragment.
(A) Gel electrophoresis results of TIP28 fragments generated by Pri/Hel Dpol primers.
Almost all samples gave ~1kb band, similar to Syn5. (B) Verification of incorporation of
TIP28 insert to plasmid. All samples had 4kb (plasmid) and ~1kb bands.
Figure 7. Verification of incorporation of TIP41 in Trx-L insert.
Most samples and the closed empty plasmid contained ~700bp insert.
Figure 8. Homologues regions analyses of TIP41 in Trx-L fragment to KBS-P-1A.
The homology region consisted of hypothetical protein. The coverage percentage of the
homologues region of the homologues gene was 60%.
11
Discussion
The PCR results (Table 4) exhibited similar bands to the expected ones (Table 2)
and support the hypothesis that clade A phages encode trx while clade B phages don't.
Nevertheless, there were some exceptional results: missing bands, variability in results and
appearance of unexpected bands. Lack of bands, for example in all clade B phages and
TIP30 in Pri-Hel/Dpol segment (Table 4), might have been caused by a mismatch of
primer sequence to the phage genome (in which trx might still be present) or indicates the
absence of trx in the phage genome.
Some samples gave varied results with different frequencies. In the case of TIP33 in Pri-
Hel/Dpol segment, since many samples in this fragment didn't show bands as expected, the
most likely reason is lack of proper annealing of primers to the fragments. In the case of
TIP33 and TIP30 in Trx-R fragment, when bands were received, they were similar to the
positive control (~800bp) corroborating trx presence. On the contrary, the analyses of
TIP41 and TIP39 in Trx-R fragment should be repeated since the results were not
conclusive. TIP41 in Trx-L fragment showed an unexpected band (~0.5kb), probably due
to low specificity of the primers (caused by low annealing temperature) which can result in
unspecific binding to irrelevant sequences.
There are many possible sources for error such as human inaccuracies in pipetting
and handling samples, measurement errors, drift of samples during gel loading and more.
The sequencing results indicate that TIP28 had homologous regions to trx with
high identities score (>20%, see Figure 3), implying similarity of trx function. The
coverage percentage of the homologues region was 50% (Figure 3C) namely
approximately fifty percent of TIP28 encoded protein amino-acids sequence is similar to
trx protein. In Pri-Hel/Dpol segment no homologous regions were found, probably
because a nearby band was mistakenly excised from the gel and cloned. TIP33 had
homologous regions to gp5, gp6 and gp7 with high identities score (Figure 5). These genes
are preliminary host-take over genes positioned at cluster I at the genome of Syn515
. Thus,
they might also influence and contribute to high virulence. Gp5 is known to form a
complex with trx during replication in T7 phages37
hence, its presence supports the
assumption that trx mechanism does exist in clade A phages. Trx was not found in TIP41
in Trx-L segment (Figure 8).
In this work, trx presence was examined only in the specific locus of Pri/Hel Dpol,
though potentially it may be found at other loci in the genome. Our conclusions should be
critically assessed since the absence of trx from the locus does not necessarily rule out its
presence in the whole genome.
In addition to experimental sequencing analysis, we used two-way BLAST
program to compare between trx sequence and known clade B phages genomes (P-SSP11,
P-SSP10, P-HP1, P-GSP1, P-SSP7,P-SSP3, P-SSP2 and P-RSP5). No homologues regions
were found in any of the examined genomes. Moreover, the same method was used on
clade A phage strain P-SSP9 and also no homology was received.
12
To conclude, our findings corroborate the assumption that some of cluster A phages
encode trx while all of cluster B phages don't. Furthermore, we discovered the existence of
several other genes – gp5, gp6 and gp7 – potentially also related to clade A phages
increased virulence.
As mentioned above, some of our results were equivocal, thus further analyses are
recommended. The most accurate and easiest way to know whether trx is present in a
phage genome is to sequence the genome and use two-way BLAST analysis. However, this
procedure is cumbersome and laborious since it requires finding specific primers for each
phage. Another possible method is to perform PCR procedures with primers other than the
ones used in this assay. The chosen primers should have a more extensive region of Pri-
Hel/Dpol segment and preferably more appropriate annealing temperatures in order to
increase the specificity. Because gp5 has a role in the trx mechanism, a more extensive
research on this gene is advocated. To fully understand the difference in virulence between
clade A and B cyanopodophages, other hypotheses, such as the presence of psbA, hli and
talc genes, should be studied and explored.
13
References
1. Fuller, N. J. et al. Clade-Specific 16S Ribosomal DNA Oligonucleotides Reveal the Predominance of a Single Marine Synechococcus Clade throughout a Stratified Water Column in the Red Sea. Appl. Environ. Microbiol. 69, 2430–2443 (2003).
2. Whitman, W. B., Coleman, D. C. & Wiebe, W. J. Prokaryotes: the unseen majority. Proc. Natl. Acad. Sci. 95, 6578–6583 (1998).
3. Fuhrman, J. A. Marine viruses and their biogeochemical and ecological effects. Nature 399, 541–548 (1999).
4. Suttle, C. A. Marine viruses — major players in the global ecosystem. Nat. Rev. Microbiol. 5, 801–812 (2007).
5. Avrani, S., Wurtzel, O., Sharon, I., Sorek, R. & Lindell, D. Genomic island variability facilitates Prochlorococcus-virus coexistence. Nature 474, 604–608 (2011).
6. Marston, M. F. et al. Rapid diversification of coevolving marine Synechococcus and a virus. Proc. Natl. Acad. Sci. 109, 4544–4549 (2012).
7. Sullivan, M. B., Waterbury, J. B. & Chisholm, S. W. Cyanophages infecting the oceanic cyanobacterium Prochlorococcus. Nature 424, 1047–1051 (2003).
8. Waterbury, J. B. & Valois, F. W. Resistance to Co-Occurring Phages Enables Marine Synechococcus Communities To Coexist with Cyanophages Abundant in Seawater. Appl. Environ. Microbiol. 59, 3393–3399 (1993).
9. McDaniel, L. D., delaRosa, M. & Paul, J. H. Temperate and lytic cyanophages from the Gulf of Mexico. J. Mar. Biol. Assoc. United Kingd. 86, 517–527 (2006).
10. Wang, K. & Chen, F. Prevalence of highly host-specific cyanophages in the estuarine environment. Environ. Microbiol. 10, 300–312 (2008).
11. Millard, A. D. & Mann, N. H. A temporal and spatial investigation of cyanophage abundance in the Gulf of Aqaba, Red Sea. J. Mar. Biol. Assoc. United Kingd. 86, 507–515 (2006).
12. SUTTLE, C. A. Marine cyanophages infecting oceanic and coastal strains of Synechococcus : abundance, morphology, cross-infectivity and growth characteristics. Mar Ecol Prog Ser 92, 99–109 (1993).
13. Chen, F. & Lu, J. Genomic Sequence and Evolution of Marine Cyanophage P60: a New Insight on Lytic and Lysogenic Phages. Appl. Environ. Microbiol. 68, 2589–2594 (2002).
14. Sullivan, M. B., Coleman, M. L., Weigele, P., Rohwer, F. & Chisholm, S. W. Three Prochlorococcus Cyanophage Genomes: Signature Features and Ecological Interpretations. PLoS Biol 3, e144 (2005).
15. Pope, W. H. et al. Genome Sequence, Structural Proteins, and Capsid Organization of the Cyanophage Syn5: A ‘Horned’ Bacteriophage of Marine Synechococcus. J. Mol. Biol. 368, 966–981 (2007).
16. Sabehi, G. et al. A novel lineage of myoviruses infecting cyanobacteria is widespread in the oceans. Proc. Natl. Acad. Sci. 109, 2037–2042 (2012).
17. Sullivan, M. B. et al. The genome and structural proteome of an ocean siphovirus: a new window into the cyanobacterial ‘mobilome’. Environ. Microbiol. 11, 2935–2951 (2009).
18. Huang, S., Wang, K., Jiao, N. & Chen, F. Genome sequences of siphoviruses infecting marine Synechococcus unveil a diverse cyanophage group and extensive phage–host genetic exchanges. Environ. Microbiol. 14, 540–558 (2012).
19. Labrie, S. J. et al. Genomes of marine cyanopodoviruses reveal multiple origins of diversity. Environ. Microbiol. 15, 1356–1376 (2013).
20. Weigele, P. R. et al. Genomic and structural analysis of Syn9, a cyanophage infecting marine Prochlorococcus and Synechococcus. Environ. Microbiol. 9, 1675–1695 (2007).
14
21. Mann, N. H. et al. The Genome of S-PM2, a ‘Photosynthetic’ T4-Type Bacteriophage That Infects Marine Synechococcus Strains. J. Bacteriol. 187, 3188–3200 (2005).
22. Millard, A. D., Zwirglmaier, K., Downey, M. J., Mann, N. H. & Scanlan, D. J. Comparative genomics of marine cyanomyoviruses reveals the widespread occurrence of Synechococcus host genes localized to a hyperplastic region: implications for mechanisms of cyanophage evolution. Environ. Microbiol. 11, 2370–2387 (2009).
23. Lindell, D. et al. Transfer of photosynthesis genes to and from Prochlorococcus viruses. Proc. Natl. Acad. Sci. U. S. A. 101, 11013–11018 (2004).
24. Lindell, D. et al. Genome-wide expression dynamics of a marine virus and host reveal features of co-evolution. Nature 449, 83–86 (2007).
25. Millard, A., Clokie, M. R. J., Shub, D. A. & Mann, N. H. Genetic organization of the psbAD region in phages infecting marine Synechococcus strains. Proc. Natl. Acad. Sci. U. S. A. 101, 11007–11012 (2004).
26. Sullivan, M. B. et al. Prevalence and Evolution of Core Photosystem II Genes in Marine Cyanobacterial Viruses and Their Hosts. PLoS Biol 4, e234 (2006).
27. Jansson, S., Andersson, J., Kim, S. J. & Jackowski, G. An Arabidopsis thaliana protein homologous to cyanobacterial high-light-inducible proteins. Plant Mol. Biol. 42, 345–351 (2000).
28. Sprenger, G. A. Genetics of pentose-phosphate pathway enzymes ofEscherichia coli K-12. Arch. Microbiol. 164, 324–330 (1995).
29. Dekel-Bird, N. P. et al. Diversity and evolutionary relationships of T7-like podoviruses infecting marine cyanobacteria. Environ. Microbiol. 15, 1476–1491 (2013).
30. Chen, F. et al. Diverse and dynamic populations of cyanobacterial podoviruses in the Chesapeake Bay unveiled through DNA polymerase gene sequences. Environ. Microbiol. 11, 2884–2892 (2009).
31. Lindell, D., Jaffe, J. D., Johnson, Z. I., Church, G. M. & Chisholm, S. W. Photosynthesis genes in marine viruses yield proteins during host infection. Nature 438, 86–89 (2005).
32. Sullivan, M. B. et al. Genomic analysis of oceanic cyanobacterial myoviruses compared with T4-like myoviruses from diverse hosts and environments. Environ. Microbiol. 12, 3035–3056 (2010).
33. Chénard, C. & Suttle, C. A. Phylogenetic Diversity of Sequences of Cyanophage Photosynthetic Gene psbA in Marine and Freshwaters. Appl. Environ. Microbiol. 74, 5317–5324 (2008).
34. Thompson, L. R. et al. Phage auxiliary metabolic genes and the redirection of cyanobacterial host carbon metabolism. Proc. Natl. Acad. Sci. 108, E757–E764 (2011).
35. Liu, X., Shi, M., Kong, S., Gao, Y. & An, C. Cyanophage Pf-WMP4, a T7-like phage infecting the freshwater cyanobacterium Phormidium foveolarum: Complete genome sequence and DNA translocation. Virology 366, 28–39 (2007).
36. Liu, X. et al. Genomic Analysis of Freshwater Cyanophage Pf-WMP3 Infecting Cyanobacterium Phormidium foveolarum: The Conserved Elements for a Phage. Microb. Ecol. 56, 671–680 (2008).
37. Mark, D. F. & Richardson, C. C. Escherichia coli thioredoxin: a subunit of bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. 73, 780–784 (1976).
38. Huber, H. E., Tabor, S. & Richardson, C. C. Escherichia coli thioredoxin stabilizes complexes of bacteriophage T7 DNA polymerase and primed templates. J. Biol. Chem. 262, 16224–16232 (1987).
39. Tabor, S., Huber, H. E. & Richardson, C. C. Escherichia coli thioredoxin confers processivity on the DNA polymerase activity of the gene 5 protein of bacteriophage T7. J. Biol. Chem. 262, 16212–16223 (1987).
15
40. Patel, S. S., Wong, I. & Johnson, K. A. Pre-steady-state kinetic analysis of processive DNA replication including complete characterization of an exonuclease-deficient mutant. Biochemistry (Mosc.) 30, 511–525 (1991).
41. Wuite, G. J. L., Smith, S. B., Young, M., Keller, D. & Bustamante, C. Single-molecule studies of the effect of template tension on T7 DNA polymerase activity. Nature 404, 103–106 (2000).
42. Etson, C. M., Hamdan, S. M., Richardson, C. C. & Oijen, A. M. van. Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA. Proc. Natl. Acad. Sci. 107, 1900–1905 (2010).
43. Labonte, J. M., Reid, K. E. & Suttle, C. A. Phylogenetic Analysis Indicates Evolutionary Diversity and Environmental Segregation of Marine Podovirus DNA Polymerase Gene Sequences. Appl. Environ. Microbiol. 75, 3634–3640 (2009).
44. Breitbart, M. Global distribution of nearly identical phage-encoded DNA sequences. FEMS Microbiol. Lett. 236, 249–256 (2004).
45. Fuller, N. J., Wilson, W. H., Joint, I. R. & Mann, N. H. Occurrence of a Sequence in Marine Cyanophages Similar to That of T4 g20 and Its Application to PCR-Based Detection and Quantification Techniques. Appl. Environ. Microbiol. 64, 2051–2060 (1998).
46. Zhong, Y., Chen, F., Wilhelm, S. W., Poorvin, L. & Hodson, R. E. Phylogenetic Diversity of Marine Cyanophage Isolates and Natural Virus Communities as Revealed by Sequences of Viral Capsid Assembly Protein Gene g20. Appl. Environ. Microbiol. 68, 1576–1584 (2002).
16
Supplementary Information
The discovered sequences of the different segments are presented below.
TIP28 in Trx-R segment with SP6 primer, clone I:
NNNNNNNNNNNNNNNNNNNNNTTGGTACCGANCNNGNNTCCNCTAGTAACGG
CCGCCNGTGTGCTGGAATTCGCCCTTCTCGAGGGAGTGGCGACCGTAAAGGTT
GGCGGGCATGTTGGCTGGTCGGGAGCGGAAGTCACGATCCAGCAGGTCGGTG
AAGAACAACCGCGAGAGGATGAGAGTGTCATAGGTCTGTCCTTTGAACTCCCA
GTTCGGATGGATCTTCTTGATGGCCTGGTAGTCATAACCAATAATGTTGTGACC
CCAGACCTCGTCTGCATCCTTCAGCATCTTTAGGCCCTTCTTGTAATCAGAAGG
ACCAAAGCGGTACTTAGTACCGTCGTCGATGTTGATCAGAACAATGCAGTGGA
TCTTGGTGAGATCCTGAAGGAGACCATCGGTCTCAATGTCAAACGCTAGACGC
ATTGAATAGCTTGGGTTTGATACGTCCGAAACCAGAACGGATCTCCAGCACGG
CATAGCCGGCGTCATGGAGGTGGTCGAAGATGTCAACCTGGCGGAATGCCCGG
ATGGCGGAGACTTTCTCCTTCTTCTTCCAGCTAGGTTTCTTGTATCGGACGAGG
TGGATATCGGAGGGAAGCTCAGCGTCGAGCTTCTTAAGCTTTTCGAGAGAGGT
ACTCTCGATGTGAATNANCACNGGATCCTTCATCGATTACGGAANTAGTNNNT
ATGGCGGTTGATAGTTGNNAGGAGATTCACGATGTTGNNCNNATNCNNTGNNN
ACCNNCGANGNNGNNNNNTN
TIP28 in Trx-R segment with T7 primer, clone I:
NNNNNNNCNNNNNNNNNTGCTCGNNCGGNNGNCNGTGTGATGGATATCTGCA
GAATTCGCCCTTAAGGAGAATCNTTGGGCACTTGTTGAGGCTTACCNGCTGGA
TCTCTTCCCGACCTTCCTGATCGTGGATGACCACGGTGAGGAGATCGACCGCCT
CGTTGGTGGTCAACGTATTCGCGACAACATCGTGAATCTCCTTACAACTATCAA
CCGCCATAACGACTACTTCCGTAATCGATGAAGGATCCTGTGATTATTCACATC
GAGAGTACCTCTCTCGAAAAGCTTAAGAAGCTCGACGCTGAGCTTCCCTCCGA
TATCCACCTCGTCCGATACAAGAAACCTAGCTGGAAGAAGAAGGAGAAAGTC
TCCGCCATCCGGGCATTCCGCCAGGTTGACATCTTCGACCACCTCCATGACGCC
GGCTATGCCGTGCTGGAGATCCGTTCTGGTTTCGGACGTATCAAACCCAAGCT
ATTCAATGCGTCTAGCGTTTGACATTGAGACCGATGGTCTCCTTCAGGATCTCA
CCAAGATCCACTGCATTGTTCTGATCAACATCGACGACGGTACTAAGTACCGC
TTTGGTCCTTCTGATTACAAGAAGGGCCTAAAGATGCTGAAGGATGCAGACGA
GGTCTGGGGTCACAACATTATTGGTTATGACTACCAGGCCATCAAGAAGATCC
ATCCGAACTGGGAGTTCAAAGGACAGACCTATGACACTCTCATCCTCTCGCGG
TTGTTCTTCACCGACCTGCTGGATCGTGACTTCCGCTCCCGACCAGCCAACATG
CCCGCCAACCTTTACNGTCGCCACTCCCTCGAGAAGGGCGAATTCCAGCACAC
TGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGCTTGATGCATAGCTT
GAGTATTCTATAGTGTNNN
17
TIP28 in Trx-R segment with SP6 primer, clone II:
NNNNNNNNNNGNNNNNNNTTGGTACCGANCTNGGNTCCNCTAGTAACGGCCG
CCNGTGTGCTGGAATTCGCCCTTTTCGAGGGTGTGGCGACCGTAAAGGTTGGC
GGGCATGTTGGCTGGTCGGGAGCGGAAGTCACGATCCAGCAGGTCGGTGAAG
AACAACCGCGAGAGGATGAGAGTGTCATAGGTCTGTCCTTTGAACTCCCAGTT
CGGATGGATCTTCTTGATGGTCTGGTAGTCATAACCAATAATGTTGTGACCCCA
GACCTCGTCTGCATCCTTCAGCATCTTTAGGCCCTTCTTGTAATCAGAAGGACC
AAAGCGGTACTTAGTACCGTCGTCGATGTTGATCAGAACAATGCAGTGGATCT
TGGTGAGATCCTGAAGGAGACCATCGGTCTCAATGTCAAACGCTAGACGCATT
GAATAGTTTGGGTTTGATACGTCCGAAACCAGAACGGATCTCCAGCACGGCAT
AGCCGGCGTCATGGAGGTGGTCGAAGATGTCAACCTGGCGGAATGCCCGGAT
GGCGGAGACTTTCTCCTTCTTCTTCCAGCTAGGTTTCTTGTATCGGACGAGGTG
GATATCGGAGGGAAGCTCAGCGTCGAGCTTCTTAAGCTTTTCNAGAGAGGTAC
TCTCGATGTGAATAATCACAGGATCCTTCATCGATTACGGAAGTAGTCGTTATG
GCGGTTGATAGTTGTAAGGAGATTCACGATGTTGTCGCGAATACGTTGACCAC
CAACGAGGCGGTCGATCTCCTCACCCGTGGTCATCCNCGATCAGGAAGGTCGG
GAANNAGATCCNGCTGGTAAGCCTCNACAAGTGCCCAATGATNCTCCTTNAGG
GCGAATTCTGCAGANATCCATCACACTGGCGGCCGNTNNNGCATGCATCNNAG
ANGGGCCCNATTNNCCCTATAGTGAGTCN
TIP28 in Trx-R segment with T7 primer, clone II:
NNNNNNNNGGNNCNNNNNNNNTGCTCGNNCGGCNGNCNGTGTGATGGATATC
TGCAGAATTCGCCCTTAAGGAGAATCNTTGGGCACTTGTTGAGGCTTACCAGC
TGGATCTCTTCCCGACCTTCCTGATCGTGGATGACCACGGTGAGGAGATCGAC
CGCCTCGTTGGTGGTCAACGTATTCGCGACAACATCGTGAATCTCCTTACAACT
ATCAACCGCCATAACGACTACTTCCGTAATCGATGAAGGATCCTGTGATTATTC
ACATCGAGAGTACCTCTCTCGAAAAGCTTAAGAAGCTCGACGCTGAGCTTCCC
TCCGATATCCACCTCGTCCGATACAAGAAACCTAGCTGGAAGAAGAAGGAGA
AAGTCTCCGCCATCCGGGCATTCCGCCAGGTTGACATCTTCGACCACCTCCATG
ACGCCGGCTATGCCGTGCTGGAGATCCGTTCTGGTTTCGGACGTATCAAACCC
AAACTATTCAATGCGTCTAGCGTTTGACATTGAGACCGATGGTCTCCTTCAGGA
TCTCACCAAGATCCACTGCATTGTTCTGATCAACATCGACGACGGTACTAAGT
ACCGCTTTGGTCCTTCTGATTACAAGAAGGGCCTAAAGATGCTGAAGGATGCA
GACGAGGTCTGGGGTCACAACATTATTGGTTATGACTACCAGACCATCAAGAA
GATCCATCCGAACTGGGAGTTCAAAGGACAGACCTATGACACTCTCATCCTCT
CGCGGTTGTTCTTCACCGACCTGCTGGATCGTGACTTCCGCTCCCGACCAGCCN
ACATGCCCGCCNNCCTTTACGGNCGCCACACCCTCGAAAAGGGCGAATTCCAG
CACACTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTNNCNAGCTTGATGCAT
AGCTTGNGTATTCTATAGTGNCACCNNAATAGCTTN
18
TIP33 in Trx-R segment with T7 primer
NNNNNNNNNNNNNNNNNNNNNNNNGNTNGNNNGGGNNNNAGNNGTGATGGA
TATCTGCAGAATTCGCCCTTAAGGAGAACCNTAGGGCATCATGAACACCTGGG
AATNCTGGAACACCACCACACTNGNNNCCNACNACCTGATCGAGTTCGACTGN
GAAGGGNTTGAAGAGGCAGCCACCCTCCTCTCTNAACAGACAGACATCGATCC
AACTGAATGGGAGCTCTTCTNAATCAACGGCAACATCGTCTGACCCACCCACC
ACAGTTCACCATCACGCCCCGGCCAACGCTGGGGTTTTTTCATGCGAGCTCATA
GCGAGCTCTTGCCCAGCCCTCCCAATGTAAAGACAATGTGAAGAGTGGCACAA
AAGGGTTGACCTACCCATCCAGCCCGTATACCTTAGGNACATCGGANGCAAAC
ACAGCACTCCGAACNNACAACTGAAGAGGGNNGGACCACCCACCAAGNCCAG
CTAAACTGCTNAAGCTGCNGACCGNNNNNNNGATAGAGCTGACCTTNCNNNT
NANGGAAAAGANGGGAGCCTGAGNNNATNACTAGNCAGTGGATCGNGGGNN
GAACCNNCACTNNGGCCTTGNGANNN
TIP33 in Trx-R segment with SP6 primer
NNNNNNNNNNNNNNNNNNNNNCTTGGTACCGAGCTCGGNNCCNCTAGTAACG
GCCGCCAGTGTGCTGGAATTCGCCCTTCTCTAAGGTGTGGCGGGGACTGTTGA
GTAACGCATGATCAGATGGAAGGGAAGGAGTGAGTAACCTTGGTGACATCGT
AACCGAGCTGCTGCAGGGATGCAACTGCTTGGTGTGCAGAGGTGGCCATTACC
GGCATCTCGTGGCTGGTGTAGTTCCGGTCACGGTAGGTGATGCGGTAGGTGCG
GATCTGATTGAAATTCATGGCGTGATGATGGTGATCAGTTGTCAGCTTCCCAGC
GGGCCACTGCTGCAGCGTAAGCATTAGCGTGATCCATCTGGGCTTGGAGGCGA
GCGCGGCGTGCAGCAGGGCTGAGTGACCGGCGCTTGGAGTGCAGGCTGCTGTA
TTGCTTGCCTGCTTTGCGTCCGTTGGCCTTGATCATTTGAAGAGGTGGGGATGG
GTTTGAGGNNNNNNNN
19
TIP28 in Pri-hel/dpol segment with SP6 primer
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGNNNNNNNNCTCGGNNCCCTN
GTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTCTCGAGGGTGTGGCGACAAC
ACCAGCTGAGTTCAGCAGATGCAGAGTCTTTTTAAAGTAGCCACTATCAGCAT
CAGAAGCAAACTCACTTCCGATATCTACATTCGTAAACGTAAGTTTATTTACGA
CTCCGACAAGCGTTGAGCCGCCAGTGAAGTGCAACTTAACGCCCGTACCGCAG
GCTTTGTTAGTCTTAGCGTGAATAACTAAATTAGAGATAGCGTAAGCCTGATT
GGGGTTAGGCGTGCCATCGTTATACAGGAGTCTAAGGAAGTCATCACCCTCGC
TAGCCGGATCAAATACGATCCGAGAAGCCTGGCCATCCCCATACATGTGGAGA
CCTTTGTTTTCAACAGTGATCGTCGAGGTGACCAGATAGGTACCTGCAGGAAA
GTAGACGCTACCGCCAAGCTGCAAAGCATTGTTGATAGCAGTAGTGTCATCGG
TTGAGCCGTTTCCTACAGCACCTAGATCTCTAACGTTAGTGTAGCCACTAGCGC
CTTCACCACTACCGCCACACCCTAGAAAAGGGCGAATTCTGCAGATATCCATC
ACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTG
AGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAAC
CCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGG
CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCT
GAATGGCGAATGGACGCGCCCTGTANCGGCGCATTAAGCGCGGCGGGTGTGG
TGGTNACGCGCANCGNNGNCCNNTNNACTTGNCNGCGCCCTANCGC
TIP41 in Trx-L segment with primer T7
NTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTC
AGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGC
GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG
GCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGG
CTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACA
ATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTATTTAGGTGACA
CTATAGAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCTCGGATCCACTAG
TAACGGCCGCCAGTGTGCTGGAATTCGCCCTTGCGCTGTGGTTTTCTTTTACTTT
TTCTAGGAAACCTTTGTTTCCTTCTTTTTTGTTAGCTTGCTCCATGTTTGTTTCAT
GATTGGTTTCATTATTGTGACCAGCCATTTAAATAAAGACGTAGCAGTTAGGGT
GGCGGCAACAGAAATAGTTGCTGTTGTAGCTGCTGTAGTCATAATAGTAGTTGT
TGGCATTGGTATTTCAATGTCCGTAAATGGAATCTCTACTATTTGAGCTTCAGGT
GGTAAATCTATATTGGGTTGTGCAGTCTGTTTTGTAGAAGTAGGTTTTTGTTCCT
CTGGGGGAGGACCATCTCCAACATTAATACCTTTAATACCTGGTGGTGGCTGTA
GTGTATTTGGTGGTACTACAAGCGGTTTGTAATTAGGTAAATCTGCCCGAGGCA
CCTCTAATACCGGAATTGGTAAATTAGGTGCATCAGGCAAAGATATGTAAGGTA
TTAAAGGAAAACCACCCTGCAAGGGCGAATTCTGCAGATATCCATCACACNGGC
GGCCG
20