Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic...
Transcript of Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic...
![Page 1: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/1.jpg)
Prognostic and Therapeutic Implications of TP53 Mutations
in WNT and Sonic-Hedgehog Medulloblastomas
by
Nataliya Zhukova
A thesis submitted in conformity with the requirements
for the degree of Masters of Science
Graduate Department of the Institute of Medical Science
University of Toronto
© Copyright by Nataliya Zhukova (2012)
![Page 2: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/2.jpg)
ii
Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog
Medulloblastomas
by
Nataliya Zhukova
Masters of Science, 2012
Graduate Department of the Institute of Medical Science
University of Toronto
ABSTRACT
Recent discoveries enabled us to divide medulloblastoma into molecular sub-groups and
uncover novel mutations in these tumors. However, except for superior survival of the WNT
sub-group, the prognostic and therapeutic implications of these observations remain unclear.
TP53 mutations which confer radioresistance revealed conflicting clinical relevance in different
studies.
We hypothesized that the effect of TP53 mutations on survival is modulated through molecular
sub-grouping. This is especially important since therapeutic targeting of WNT can be achieved
with administration of lithium.
Here we first confirmed that TP53 mutant tumors confers unfavorable outcome only in SHH
subgroup, but not in WNT. We demonstrated that while TP53 mutations cause radioresistance,
activation of WNT/β-catenin signaling radiosensitizes medulloblastoma cells. We demonstrated
that lithium activates the WNT pathway and effectively sensitize medulloblastoma cells to
radiation. Furthermore, lithium did not sensitize normal neural stem cells to radiation,
suggesting its potential as an effective radiosensitizer for medulloblastoma.
![Page 3: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/3.jpg)
iii
ACKNOWLEDGEMENTS
First and foremost, I would like to sincerely thank my supervisor Dr. Uri Tabori for accepting
me as his first graduate student and for providing me with guidance and support throughout my
entire academic training. Dr. Tabori provided many opportunities for my academic advancement
and was genuinely interested in and supportive of my pursuit of my personal goals in the field of
healthcare. His constant encouragement and advice greatly contributed to a pleasant and
productive graduate experience.
I would also like to thank the members of my program advisory committee, Dr. David Malkin,
Dr. Rob Bristow and Dr. Benjamin Alman for expertise provided to me throughout my training,
for their guidance and support during these two years.
A tremendous thank you extends to our SickKids and international collaborators and their
teams, Dr. Michael Taylor, SickKids, Dr. Vijay Ramaswamy, SickKids, Dr. Steve Clifford,
Northern Institute for Cancer Research, Newcastle upon Tyne, UK and Dr. Stefan Pfister,
German Cancer Research Center, University Hospital Heidelberg, Heidelberg and University
Medical Center, Hamburg-Eppendorf, Hamburg, Germany for their contributions to the
evolution of this project.
I also want to thank Dr. Berivan Baskin and the staff from the Division of Molecular Genetics,
Department of Paediatric Laboratory Medicine, SickKids, for their contribution to this project.
Many thanks are due to Dr. Eric Bouffet for his mentorship during my academic training.
I would also like to mention our lab technician, Cindy Zhang for her constant support through
my work in the lab. She provided an enormous amount of her time and her extensive expertise
in working with stem cells to perform normal neuronal stem cell experiments. In addition she
never fails to step forward and offer help to troubleshoot an experiment or to advise on a better
technique to use.
![Page 4: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/4.jpg)
iv
Many thanks are due to the past and present members of the Tabori and Malkin Labs, who have
created a stimulating and challenging environment to work in and provided me with their
support and unique expertise both at the bench and in the office and made each day in the lab
enjoyable.
I am very grateful to my wonderful husband for his confidence in my abilities, constant
encouragement, sound advice, but moreover for his never-ending love and support for
everything I brave myself to.
![Page 5: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/5.jpg)
v
DATA ATRIBUTION
This thesis consists from two parts: clinical part and biological. This work represents a
collaborative effort on behalf of a number of individuals.
For the clinical part of the thesis, data collection, cohort assembly, statistical analysis and
interpretation of the results were performed by Nataliya Zhukova. Clinical and biological data
on individual patients used in this study were provided by Dr. Clifford, Northern Institute for
Cancer Research, Newcastle upon Tyne, UK; Dr. Pfister German Cancer Research Center,
University Hospital Heidelberg, Heidelberg, Germany; and Dr. Taylor, The Hospital for Sick
Children, Toronto, Canada. Medulloblastoma subgroup analysis for The Hospital for Sick
Children patients was performed by Dr. Ramaswamy, SickKids.
Conceptualization of the thesis, experimental design and execution of all biological
experiments, except normal neuronal stem cell experiments, and all data analysis and
interpretation were performed by Nataliya Zhukova.
Cindy Zhang, laboratory technician, performed normal neuronal stem cell work.
![Page 6: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/6.jpg)
vi
TABLE OF CONTENTS
Abstract................................................................................................................................
ii
Acknowledgements...............................................................................................................
iii
Data Attribution...................................................................................................................
v
Table of contents..................................................................................................................
vi
List of figures.......................................................................................................................
x
List of abbreviations............................................................................................................
xii
CHAPTER 1: INTRODUCTION....................................................................................
1
1.0 Medulloblastoma: incidence, classification, clinical management and
Survival.........................................................................................................................
1
1.0.1. Risk stratification of medulloblastoma patients..................................................
1
1.0.2. Role of craniospinal radiation in treatment of medulloblastoma........................
1
1.0.3. Current management of medulloblastoma...........................................................
2
1.0.4. Treatment of infantile medulloblastoma..............................................................
2
1.1. Medulloblastoma: molecular biology of the tumor, molecular classification, clinical
implications..........................................................................................................................
3
1.1.1. Hereditary cancer syndromes and medulloblastoma...........................................
4
1.1.2. Early molecular studies.......................................................................................
4
1.1.3. Molecular subgroups of medulloblastoma..........................................................
5
1.2. Role of TP53 mutations in the progression and survival of
medulloblastoma..................................................................................................................
7
1.3. TP53 and its role in cellular radiation resistance..........................................................
10
1.4. Role of WNT pathway and CTNNB1 (β-catenin) mutations in the progression and
survival of medulloblastoma................................................................................................
12
1.5. WNT/β-catenin signalling pathway in development and cancer...................................
13
![Page 7: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/7.jpg)
vii
1.5.1. Role of WNT signaling in embryonal development.............................................
13
1.5.2. WNT activation and stabilization of β-catenin in cancer......................................
14
1.5.3. Activation of WNT/β-catenin signaling as a prognostic marker in
cancer...................................................................................................................................
16
1.6. Role of WNT/β-catenin in radiation response...............................................................
18
1.7. Role of Lithium in mimicking WNT subtype of medulloblastoma..............................
19
1.8. Crosstalk between β-catenin and p53...........................................................................
20
PROJECT RATIONALE AND HYPOTHESIS............................................................
22
CHAPTER 2: MATERIALS AND METHODS............................................................
24
2.1. Patient cohort...............................................................................................................
24
2.1.1. Clinical data........................................................................................................
24
2.1.2. Statistical analysis..............................................................................................
24
2.2. Cell lines......................................................................................................................
24
2.3. TP53 and CTNNB1 sequencing...................................................................................
25
2.3 Chemicals.....................................................................................................................
26
2.4. Irradiation....................................................................................................................
26
2.5. Clonogenic experiments..............................................................................................
26
2.6. Transfection experiments............................................................................................
27
2.7. Combination of Lithium and radiation treatment........................................................
27
2.7.1. Lithium toxicity curves.......................................................................................
27
2.7.2. Clonogenic experiments with combination of lithium and radiation
exposure..............................................................................................................................
28
2.8. Western blot analysis...................................................................................................
28
2.9. β-catenin luciferase reporter assay...............................................................................
29
![Page 8: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/8.jpg)
viii
2.10. Immunofluorescence – β-catenin nuclear translocation............................................ 29
2.10.1. β-catenin nuclear translocation.........................................................................
29
2.11. Normal neuronal stem cell viability experiments......................................................
30
2.12. Statistical Analysis..............................................................................................
30
CHAPTER 3: RESULTS................................................................................................
31
3.1. Survival of medulloblastoma patients with somatic TP53 mutations depends on
molecular subgroup...........................................................................................................
31
3.1.1. Distribution of TP53 mutations in subgroups....................................................
31
3.1.2. Patient characteristics and survival analysis......................................................
32
3.1.3. Validation of initial observations.......................................................................
36
3.2. TP53 mutant medulloblastoma cell lines are more resistant to radiation..................
38
3.3. CTNNB1 mutation (S33Y) sensitizes TP53 mutant medulloblastoma cells to
radiation............................................................................................................................
39
3.4. Lithium sensitises medulloblastoma cells to radiation..............................................
40
3.4.1. Medulloblastoma cells tolerate physiological doses of lithium.......................
45
3.4.2. Lithium radiosensitized medulloblastoma cells...............................................
45
3.4.3. Lithium phosphorylates GSK3β on Ser9..........................................................
47
3.4.4. Lithium results in nuclear translocation of β-catenin.......................................
47
3.4.5. Lithium constitutively activates canonical WNT signaling..............................
47
3.5. Lithium does not sensitize normal neuronal stem cells to radiation........................
50
3.5.1. Lithium does not decrease survival of normal neuronal stem cells.................
50
3.5.2. Normal neuronal stem cells treated with lithium do not demonstrate nuclear
translocation of β-catenin.................................................................................................
51
CHAPTER 4: DISCUSSION..........................................................................................
54
4.1. TP53 mutations are predictive of inferior survival in SHH, but not WNT
![Page 9: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/9.jpg)
ix
medulloblastomas.............................................................................................................. 54
4.2. TP53 mutations in medulloblastomas confer resistance to radiation while activation
of canonical WNT signaling radiosensitizes medulloblastoma cells..................................
57
CHAPTER 5: CONCLUSIONS......................................................................................
61
CHAPTER 6: FUTURE DIRECTIONS.........................................................................
62
1) How does activation of WNT/β-catenin signalling offer a survival advantage?
............................................................................................................................................
62
2) Determining of mechanism of lithium action...........................................................
62
APPENDIX A: Phospho-histone H2AX (γH2AX) foci immunofluorescent microscopy
and imaging........................................................................................................................
68
CITATIONS.....................................................................................................................
69
![Page 10: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/10.jpg)
x
LIST OF FIGURES
CHAPTER 1: INTRODUCTION
Figure 1.1. Comparison of the various subgroups of medulloblastoma.................
8
Figure 1.2. Figure (a) OS analysis of molecular subgroups among all MB
patients...................................................................................................................
10
Figure 1.3. Canonical WNT/β-catenin signaling in normal and cancer cell............
16
Figure 1.4. Activation of canonical WNT/β-catenin signaling by lithium.................
23
CHAPTER 3: RESULTS
Figure 3.1.1. TP53 mutation spectrum...................................................................
36
Figure 3.1.2. Overall and progression-free survival for TP53 mutant and TP53 wild-type
patients...................................................................................................
39
Figure 3.1.3. Overall (OS) survival for TP53 mutant and TP53 wild-type patients,
MAGIC cohort........................................................................................................
41
Figure 3.2.1. TP53 mutation spectrum and distribution over functional domains in
medulloblastoma cell lines.................................................................................
44
Figure 3.2.2. TP53mut MB cells are more resistant to radiation............................
45
Figure 3.3.1. Nuclear translocation of β-catenin in CTNNB1-S33Y mutant cells...
47
Figure 3.3.2. Activation of WNT pathway signalling via S33Y-CTNNB1 mutation
radiosensitizes TP53 mutant cells..........................................................................
48
Figure 3.4.2. Lithium radiosensitizes both TP53wt and TP53mut medulloblastoma
cells............................................................................................
51
Figure 3.4.3. Lithium phosphorylates GSK3β on Ser9...........................................
52
Figure 3.4.4. Treatment with Lithium results in nuclear translocation of β-catenin in
both TP53 wt and TP53 mut cells.......................................................................
53
Figure 3.4.5. Lithium activates WNT/β-catenin transcriptional activity...................
55
Figure 3.5.1. Treatment with Lithium does not radiosensitize NNSC.....................
57
![Page 11: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/11.jpg)
xi
CHAPTER 4: DISCUSSION
Figure 4.1. Clinicopathological flow chard for decision making in newly diagnosed MB
patients...........................................................................................
61
Figure 4.2. Relationship between β-catenin and p53 levels...................................
63
CHAPTER 6: FUTURE DIRECTIONS
Figure 6.1.A. Treatment with lithium increases number of γH2AX foci in TP53 wild-
type MB cells...................................................................................................
69
Figure 6.1.B. Treatment with lithium increases number of γH2AX foci in TP53 mutant
MB cells......................................................................................................
70
Figure 6.1.C. Treatment with lithium does not increase number of γH2AX foci in
NNSC.....................................................................................................................
71
![Page 12: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/12.jpg)
xii
LIST OF ABREVIATIONS
APC Adematous polyposis coli
ATM Ataxia telangiectasia mutated
CHK2 Checkpoint kinase 2
CKIα Casein kinase Iα
CNS Central nervous system
CSC Cancer stem cell
CSI Craniospinal irradiation
CTNNB1 Cadherin-associated protein beta 1
DPLM Department of Paediatric Laboratory Medicine
DSB DNA double strand break
DSH Dishevelled protein
erbB-2 Erythroblastic leukemia viral oncogene homolog 2
FAP Familial adenomatous polyposis
FZ Frizzled receptor
GBM Glioblastoma multiforme
GFP Green fluorescent protein
GSK3β Glycogen synthase kinase 3β
HER2 Human Epidermal Growth Factor Receptor 2
HIC-1 Hypermethylated in cancer 1 protein
IARC International Agency for research of Cancer
IgG Immunoglobulin G
![Page 13: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/13.jpg)
xiii
JNK c-Jun N-terminal kinase
LFS Li-Fraumeni Syndrome
LiCl Lithium Chloride
MAGIC Medulloblastoma Advanced Genomics International Consortium
MB Medulloblastoma
mdm2 Murine double minute 2
miRNA microRNA
MLPA Multiple ligation-dependant probe amplification
MYC-N Myelocytomatosis viral related oncogene, neuroblastoma derived
NNSC Normal neuronal stem cells
OS Overall survival
PCP Planar cell polarity
PCR Polymerase chain reaction
PFS Progression free survival
PTCH Patched 2
SER Sensitizer enhancement ratio
SF2 Survival fraction at 2GY
SHH Sonic Hedgehog
siRNA Small interfering RNA
TCF/LEF T-cell factor / Lymphoid enhancer-binding factor
TCF4 Transcription factor 4
![Page 14: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/14.jpg)
xiv
TP53 Tumour protein 53
trkC Tyrosine kinase receptor
WNT WNT-Wingless pathway
yH2AX Phospho-histone H2AX
β-TrCP β-transducin repeat containing protein
![Page 15: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/15.jpg)
CHAPTER 1: INTRODUCTION
1.0 Medulloblastoma: incidence, classification, clinical management and survival
Medulloblastomas (MB) are the most common malignant central nervous system (CNS)
tumours of childhood. They occur at all ages; however, peak incidence is between 3 and 9 years
of age. In adults, medulloblastomas arise most commonly in the 30’s and 40’s and comprise 1-
2% of all brain tumours [1]. Overall males are 1.5 times more likely to be affected than females
[2-3].
Tumours which arise from the posterior fossa are called medulloblastomas; other histologically
similar embryonal tumours which originate from the pineal region or cerebrum are no longer
classified as medulloblastomas as they are molecularly distinct entities [1, 4]. Histologically
medulloblastoma appears as densely packed round cells with hyperchromatic nuclei and scanty
cytoplasm and as such belongs to the family of so-called “small round blue-cell tumours”.
Currently three histopathological variants of the tumour are recognised: 1) classic; 2)
anaplastic/large cell variant; and 3) desmoplastic with extensive nodularity [5].
1.0.1. Risk stratification of medulloblastoma patients
Risk stratification of patients has been developed as a result of multiple prospective, multicenter
randomised trials from Europe and North America and currently encompasses two groups: high-
risk patients who have disseminated disease at presentation or post-operative residual disease
more than 1.5 cm, and average-risk patients who have non-disseminated disease with total or
near-total resection of the primary tumour [1-2, 6]. Tumour histology is not universally included
in the risk stratification, however it is recognized that desmoplastic tumours of infancy have
better outcomes [1, 7]. Anaplastic histology is also widely accepted as a poor prognostic factor;
currently, in the US and Canada, all patients with anaplastic tumours regardless of the
dissemination of the disease or extent of the resection are assigned to a high-risk group [1, 8].
1.0.2. Role of craniospinal irradiation in treatment of medulloblastoma
Surgical resection alone of medulloblastoma is not curative. As was described by Cushing in the
1930s only 1 out of 63 patients survived with surgical resection alone in his series [9].
Recognition that medulloblastoma cells are sensitive to radiation, with 18 to 44% of cells
1
![Page 16: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/16.jpg)
surviving a dose of 2Gy [10], led to incorporation of radiotherapy into treatment protocols.
However, local radiation to the tumour site did not improve outcome [11]. Poor outcome for
children treated without cranio-spinal radiation (CSI) was related to a high proportion of
patients developing disseminated disease at recurrence [12]. The introduction of CSI allowed for
a dramatic increase in survival of medulloblastoma patients up to 50% of those treated. Edith
Paterson first demonstrated survival in 5 out of 12 children with medulloblastoma treated with
CSI in 1932 – 1947, followed by survival of 8 out of 15 patients treated with CSI in Toronto in
the 1950s; all 16 patients who did not receive CSI died [13]. Later, consistent survival rates
ranging from 27 to 40% have been demonstrated by multiple groups [9]. For many years the
standard dose of radiation was 36 Gy to the whole neural axis with a boost to the posterior fossa
to a total dose of 55 Gy to improve local control [14]. Detrimental long-term effects of radiation
to the developing brain resulted in attempts to reduce CSI to 24 Gy with the retention of the
posterior fossa boost at 55 Gy. Decrease of CSI radiation dose without addition of
chemotherapy resulted in both higher local relapse rate and higher rate of disseminated disease
at relapse [6, 15-16]. Addition of cis-platinum based chemotherapy to the treatment protocol
allowed for decrease of the CSI dose to 24 Gy in average-risk patients without compromising
survival [12, 17]. It is also recognised that inferior survival in infants and children less than
three years old is greatly related to avoidance / delay in CSI in order to minimize radiation
toxicity to the developing brain [18].
1.0.3. Current management of medulloblastoma
Treatment of medulloblastoma currently involves surgical tumour removal, radiation therapy
and adjuvant chemotherapy. As discussed above, treatment with radiation alone yields inferior
5-year and overall survival (OS) as well as progression free survival (PFS) (60%) in multiple
studies in average risk patients. Implementation of risk adapted therapy with high-dose adjuvant
chemotherapy and hematopoietic stem cell rescue in addition to radiation allowed for improved
tumour control with 5 year OS of 85% and 70% for average- and high-risk patients, respectively
[19-21].
1.0.4. Treatment of infantile medulloblastoma
Treatment of infantile medulloblastoma is highly problematic as use of cranio-spinal radiation
therapy is limited by significant neuro-cognitive impairment following irradiation of the
2
![Page 17: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/17.jpg)
immature brain. Thus, treatment in patients less than 3 years of age and in some studies less than
5 years of age is limited to chemotherapy-only regimens to avoid or delay cranio-spinal
radiation. The results of such trials are mixed [2, 6-7, 22-24]. Duffner et.al. showed that patients
younger than 3 years can be treated with chemotherapy only until they reach 3 years of age and
then receive cranio-spinal radiation with survival rates of 40% or less. However survival was
limited predominantly to patients with non-disseminated disease and was accompanied by a
significant neurocognitive decline secondary to radiation [23]. In subsequent studies, attempts
were made to intensify chemotherapy and avoid radiation, which resulted in 5-year PFS of 32%
and OS of 43% with almost 58% of children being able to avoid radiation [22]. Addition of
intravenous and intraventricular Methotrexate has significantly improved PFS and OS in non-
disseminated completely resected disease (82% and 93%, respectively). However, although
improved slightly for patients with residual disease (50% and 56%, respectively), outcomes
remained inferior for infants with disseminated disease (33% and 38%, respectively). In all
patients in this series IQ was lower than in healthy peers, however, markedly higher compared
to children received cranio-spinal radiation. Desmoplastic histology was determined to be an
independent prognostic factor for better survival in those series [7]. In addition, improved
outcomes could be partially attributed to better differential diagnostics. In particular, in recent
studies, 15-20% of infants who would have been diagnosed with medulloblastomas are now
diagnosed using immunohistochemical and molecular/genetic techniques with atypical
teratoid/rhabdoid tumours associated with extremely poor survival and are removed from the
analysis of the medulloblastoma study population [1]. Furthermore, most of the patients with
favorable outcome in infant studies have desmoplastic pathology. Together, these clinical
observations of inferior outcome for children treated with radiation sparing protocols further
support the central role of radiation therapy in survival of childhood medulloblastoma.
1.1. Medulloblastoma: molecular biology of the tumour, molecular classification,
clinical implications
The increase in understanding of molecular biology of cancer, and of medulloblastoma in
particular, led to multiple studies to improve diagnostics, risk stratification and better tailoring
of treatment based on tumour molecular and genetic alterations.
3
![Page 18: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/18.jpg)
1.1.1. Hereditary cancer syndromes and medulloblastoma
Several hereditary cancer syndromes have higher frequencies of medulloblastoma. These
include Turcot (WNT pathway and APC alterations) [25], Gorlin (Sonic Hedgehog pathway and
PTCH mutations) [26-27] Li-Fraumeni (TP53 germline mutations) and several DNA damage
repair syndromes. These genetic predisposition syndromes have pointed to the importance of
these pathways and gene alterations in the origin, development and clinical course of
medulloblastomas. Approximately 4% of Gorlin syndrome (nevoid basal cell carcinoma)
patients develop medulloblastomas; 8-10% of sporadic medulloblastomas, primarily of
desmoplastic variant, have been shown to have a somatic PTCH mutation, 9q22.3 alterations
and Sonic Hedgehog pathway activation as in Gorlin syndrome patients. Interestingly, PTCH
mutations in medulloblastoma have been correlated to favorable outcome [2, 26]. As detailed
below, these pathways, specifically WNT, SHH and TP53 will play a major role in the
classification and prognosis of medulloblastomas.
1.1.2. Early molecular studies
Early studies have shown overexpression of neurotropin-3 receptor trkC which is involved in
cell differentiation, growth and apoptotic response being a favorable prognostic marker [2, 28-
29]. trkC was found in approximately 48% of tumours; patients with high levels of trkC
demonstrated higher 5-year survival rates with longer PFS time compared to those with low
levels, 89% vs. 46% respectively [29].
In contrast, high expression of the erbB-2 oncogene correlated with poor prognosis with 10-year
OS of 10% vs. 48% in non-overexpressing tumours [30]; HER2-HER4 receptor heterodimer
overexpression was associated with poor survival, despite individual overexpression of either
HER2 or HER4 being not prognostic [31].
Prognostic value of MYC remains controversial. Grotzer et.al. has shown that expression levels
of MYC do not always correlate with MYC gene amplification, however low MYC expression
levels are a powerful independent predictor of better survival [32]. MYC-C amplifications have
been found in 5-10% of medulloblastomas [5, 33]. High MYC-C amplification was reported to
correlate with clinically aggressive tumours with short progression free survival times and
tendency to disseminate [33]. A recent study done by Pfister et.al. has demonstrated that both
MYC-C and MYC-N are associated with poor prognosis [5]. Interestingly, Northcott et.al. has
4
![Page 19: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/19.jpg)
shown differential distribution of MYC-C and MYC-N within molecular subgroups with MYC-C
being found exclusively in Group C (Group 3) medulloblastomas with the most aggressive
behavior and MYC-N being equally distributed between SHH, Group C (Group 3) and Group D
(Group 4) tumours [34]. A recent study has demonstrated that MYC-C amplifications define an
aggressive subgroup of medulloblastoma which is consistent with previous findings; in turn,
MYC-N amplifications are clustered within two subgroups: SHH – 38% of cases where half of
MYC-N tumours also have TP53 mutations and Group D (Group 4) – 62% of cases and
associated with worse prognosis [35].
Loss of 17p with isochromosome 17q has been described as the most common genetic
aberration in medulloblastoma, which is present in 35-50% of tumours, and has been associated
with poor prognosis in multiple studies [36-40]. HIC-1 which encodes a zinc finger
transcriptional repressor is most often disrupted by the 17p deletion. Under normal conditions,
HIC-1 is upregulated by TP53 and silenced by hypermethylation [2]; Hypermethylation of HIC-
1 is frequent in medulloblastomas with intact 17p and is predictive of poor outcome [41].
In addition to frequent 17p deletion and iso-17q, unbalanced translocations or deletions of
chromosomes 8, 10q, 11p and 16q are common in medulloblastomas [42], whereas deletions of
chromosomes 1, 2, 9q, 6q are less prevalent [5, 42]. Medulloblastomas typically have gains of
chromosomes 4, 7, 8 and 18, with less frequent gains of 6q. The prognostic value of these
genomic alterations is uncertain, except for the 6q aberrations: deletion of 6q is strongly
correlated with excellent survival, while 6q gain is associated with poor outcome [5]. Together,
these exciting molecular and genetic determinants fail to produce reliable results in larger
studies and therefore are not currently used in clinical stratification of medulloblastoma.
1.1.3. Molecular subgroups of medulloblastoma
Multiple studies describing roles of molecular markers and genetic aberrations, discussed in
detail above, suggest the existence of several subtypes within the single diagnosis of
medulloblastoma. Development of computational biology and high-throughput methods of
genomic data processing and analysis coupled with access to large patient cohorts through
establishment of international collaborations and multicenter studies, have made it possible to
study transcriptional and copy number changes across whole genome, allowing for the
publications of multiple studies describing molecular subtypes in both paediatric and adult
5
![Page 20: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/20.jpg)
medulloblastoma. In 2006 Thomson and colleagues demonstrated among 46 patient samples the
existence of five medulloblastoma subgroups, named A through E, with unique gene expression
signatures. As part of this study, he identified WNT activating/6q deleted tumours as group B
and SHH tumours as group D [43]. These findings were supported by Kool et.al. who, in a study
of 62 patients, identified five molecular variants within medulloblastoma including WNT and
SHH subtypes along with subtypes expressing neuronal differentiation genes (groups C and D)
and photoreceptor genes (group D and E). He has also demonstrated that identified groups are
different in demographics, presence of metastatic disease, age at presentation and histology [44].
Later, Fattet and colleagues correlated CTNNB1 mutations and nuclear translocation of β-
catenin in 72 paediatric medulloblastomas with strong expression profile of WNT activation and
demonstrated that this group of patients have superior survival [45]. In 2010 Northcott and
colleagues, using 103 samples, demonstrated that four medulloblastoma subgroups, named
WNT, SHH, group C and group D, distinguished by their demographics, clinical presentation
and survival outcomes, can be identified using their expression signatures. They subsequently
demonstrated that immunohistochemical techniques can be successfully implemented to identify
them robustly [34]. Six molecular subgroups were identified by Cho and colleagues using a
correlation between clinical characteristics and a unique combination of structural chromosomal
aberrations together with copy number variations and miRNA profiles in 194 patients [46].
Similar work was done in adult medulloblastoma where three groups, WNT, SHH and group D,
were identified on 28 patients using transcriptome analysis and then validated on an independent
cohort of 103 patients using tissue microarray. These subgroups demonstrated distinct
differences in demographics, clinical behaviour, histology as well as survival [47]. At the same
time Al-Halabi and colleagues demonstrated that although a SHH subset of tumours was
identified within adult medulloblastomas those tumours bore some notable differences in
molecular profile compared to paediatric SHH medulloblastomas. In addition, they were not
associated with favorable prognosis [48].
In summary, multiple research groups have demonstrated that medulloblastoma indeed is not a
homogeneous disease, but rather is comprised of several molecular subgroups. However, there
is a lack of uniformity in the number of subgroups reported and the criteria by which those
subgroups were characterized. In order to rectify this problem a consensus meeting, involving
all major medulloblastoma study groups was held in Boston in 2010. Recommendations were
adopted for universal use for clinical and research purposes of four subgroups of
6
![Page 21: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/21.jpg)
medulloblastoma: WNT and SHH, named after major pathways affected in those tumours, and
Group 3 and Group 4, in which no specific pathway alterations were yet identified based on
expression profiling. The major differences in clinical, molecular and genetic characteristics
between those groups are described in Figure 1.1. [49].
In addition, meta-analysis performed by Kool and colleagues in 2012 on 550 pooled samples
from 7 previous studies clearly demonstrated that medulloblastoma consists of the four
subgroups identified previously. These subgroups exhibit major differences in demographics,
clinical representation, genetic alterations and have unique transcription profiles [3].
Importantly, despite striking differences allowing reliable subgroup segregation, molecular
profiling fails to provide a robust instrument for patient risk-stratification. As it is evident from
Figure 1.2. only WNT tumours were identified as a favorable prognostic group, while the rest of
the subgroups demonstrated inferior survival without significant intergroup differences [3].
Therefore, the need still exists for development of better more robust prognostic markers that
use universally available techniques.
1.2. Role of TP53 mutations in the progression and survival of medulloblastoma
Medulloblastomas are among three brain tumours commonly found in patients who harbour
TP53 germline mutations (the other two are high grade gliomas and choroid plexus carcinomas)
and are defined as a major component tumour of the Li-Fraumeni syndrome (LFS) [50-51]. In
addition, as discussed above, multiple cytogenetic studies have demonstrated somatic non-
random loss of chromosome 17p, suggesting that TP53 (located on chromosome17p.13) may
have a role in medulloblastoma development and progression. The prognostic role of TP53
mutations in medulloblastoma remains unclear. The prevalence of somatic TP53 mutations in
medulloblastoma patients is less than 10% [52]. Despite frequent 17p monosomy, genetic events
specific to TP53 function, such as inactivating mutations or small deletions of TP53 itself or
alterations in mdm2 are rare events with unknown prognostic implications [40, 53-55]. On the
other hand, loss of TP53 function has been attributed to an increased incidence and earlier
development of medulloblastoma in mice heterozygously deficient for PTCH [56] suggesting
that it plays an important role in the aggressiveness of the disease. Strong association of nuclear
p53 immunopositivity in medulloblastoma samples with poor survival has been demonstrated by
several more recent studies [57-58].
7
![Page 22: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/22.jpg)
Taylor et.al. Acta Neuropathol 2012
Figure 1.1. Comparison of the various subgroups of medulloblastoma including their affiliations with previously published papers on medulloblastoma molecular subgroup. (LCA – large cell anaplastic, M+ -
metastatic disease, CTNNB1- β-catenin)
8
![Page 23: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/23.jpg)
Figure 1.2. Figure (a) OS analysis of molecular subgroups among
all patients from Kool et.al. Acta Neuropathol 2012. Overall survival
(OS) analyses of molecular, clinical, and histological subgroups
within the gene expression profiling cohort using Kaplan – Meier
plots and log-rank tests.
Kool et.al. Acta Neuropathol 2012
Months
9
![Page 24: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/24.jpg)
Clinical data utilizing TP53 mutations as a prognostic marker for recurrence and survival of
medulloblastoma patients revealed contradictory results. Correlation of clinical and survival
data with tumour biology obtained for 119 medulloblastoma patients who underwent treatment
at The Hospital for Sick Children between 1985 and 2001 demonstrated that tissue immuno-
positivity for p53 protein is among four of the strongest predictors of survival, with p53
immuno-positive patients having worse survival compared to their immuno-negative
counterparts [57]. Tabori et.al. has reported rapid recurrence and death in all (8/52) of the TP53
mutant patients in their series [59]. This was supported by Pietsch and colleagues who
correlated inferior survival with p53 immuno-positive tumours [60] in metastatic patients. In
contrast, Pfaff et.al. has demonstrated no difference in 5-year overall survival between mutant
and non-mutant TP53 patients in their cohort [61]. Similarly, no adverse survival in TP53
mutant patients was demonstrated by Clifford and colleagues. Specifically three out of four
patients in the WNT subgroup had durable remission. The only patient who succumbed to
disease in this cohort had a germline TP53 mutation [62]. Interestingly, both Pfaff and Clifford
observed cohort enrichment of the TP53 mutant population in the WNT subgroup tumours [61-
62], while the SickKids cohort had a higher proportion of the SHH subtype (personal
communication, Dr. M. Taylor, The Hospital for Sick Children, Toronto).
In summary, conflicting reports regarding the role of TP53 mutations in disease progression and
patient survival coupled with variation in TP53 mutation distribution in WNT and SHH
molecular subgroups between cohorts suggest the presence of possible biological modulating
factors and warrant further investigation.
1.3. TP53 and its role in cellular radiation resistance
TP53 is a tumour suppressor gene whose biological function and role in tissue radiation
response has been intensively studied for the last three decades. TP53 is mutated or deleted in
over 50% human cancers [63]; in cancers which retain wild type TP53 the function of p53
protein is often silenced by other mechanisms which include complex formations with viral
(large T antigen of SV40 virus) or cellular proteins or alterations of genes up or downstream of
TP53 to abrogate p53 associated apoptosis, cell cycle arrest or DNA brake/repair response [64].
Missense mutations which result in altered amino acid sequence, protein structure and function
account for more than 85% of genetic alterations in TP53. The majority of mutations are located
10
![Page 25: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/25.jpg)
in the DNA binding domain and affect p53 transcriptional function. Codons 175, 245, 248, 273
and 283 are hot-spots for mutations and are overrepresented in all tumours due to their
susceptibility to spontaneous mutagenesis and slower repair rates in the core domain [65]. In
addition, these particular codons are part of promoter-specific structures essential for p53
transcriptional function [66]. The role of p53 in mediation of apoptosis, cell cycle arrest and
DNA damage response to radiation is well described in the literature. Apoptosis and cell cycle
arrest are tissue and tumour specific and are not entirely mutually exclusive. In haematopoietic
cells (thymocytes, lymphocytes) and other cells sensitive to radiation (germ cells) p53 induce
apoptosis, preventing potentially oncogenic cells from proliferation. In fibroblasts and epithelial
cells, p53 induces cell cycle arrest in G1 and G2/M phases of the cell cycle. Cell cycle arrest
can be transient or permanent depending on the extent of DNA damage [67]. Wild-type p53 is
phosphorylated directly by ataxia telagiectasia mutated (ATM) and indirectly by ATM activated
Chk2 in response to DNA damage. Phosphorylation of p53 leads to disruption of its interaction
with mdm2, resulting in stable p53 protein, and also facilitates nuclear accumulation of
transcriptionally active protein by inhibiting nuclear export. Stable p53 becomes actively
engaged in transcription of downstream targets modulating tissue specific cellular responses to
radiation: cell cycle arrest, apoptosis and facilitating DNA damage repair [67-70].
Multiple studies have demonstrated that loss of p53 wild-type function confers resistance to
ionizing radiation. The role of p53 in resistance to radiation has been discussed in numerous
reviews; loss of G1 check point control, associated with TP53 mutations, was shown to result in
resistance to radiation in vitro [65, 71]. Williams and colleagues have shown on an extensive
panel of cancerous cell lines that mutant p53 cells are more resistant to radiation than wild-type
p53 cells at both low and high radiation doses and argue that TP53 status can be used as a
marker of tumour radiosensitivity [72-73]. Interestingly, there have been several reports
correlating TP53 mutations with radiosensitive phenotype. Matsui and colleagues demonstrated
that both murine and human fibroblasts containing engineered TP53 mutations on a p53 null
background were more sensitive to radiation, despite retention of impaired G1 check point, than
the TP53 wild-type or TP53 null counterparts [74]. Similarly, Servomaa et al. has shown that
p53 wild-type squamous cell carcinoma cell lines are more radiosensitive than ones bearing
TP53 mutations [75]. The existing controversy is partially explained by tissue specific cellular
response to radiation, modulated through other cross-talking pathways as well as multiplicity of
p53 functions in the cell.
11
![Page 26: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/26.jpg)
The role of TP53 mutations in radioresistance of medulloblastoma cells has not been extensively
studied. Salaroli et. al. have demonstrated increased resistance to ionizing radiation in TP53
mutant medulloblastoma cells [76]. Craniospinal radiation therapy remains the main medical
treatment for patients with medulloblastoma; in light of recent studies which demonstrate
association of clinical outcomes with the TP53 mutation status, greater understanding of p53-
mediated cellular response to radiation, specific to medulloblastoma, is crucial in order to
improve therapies.
1.4. Role of WNT pathway and CTNNB1 (β-catenin) mutations in the progression and
survival of medulloblastoma
Activation of the WNT/β-catenin pathway is present in 15-25% of medulloblastomas [45, 52,
77]. Activation of WNT signalling was first described as a germline mutation in the APC gene in
Turcot syndrome [25], which led to speculation about the role of the pathway in
medulloblastoma development. In sporadic medulloblastomas, APC is intact, however somatic
pathway-activating mutations in the CTNNB1 (β-catenin) gene were described by several groups
[45, 49, 78-79]. Currently the WNT subgroup is identified by expression profile demonstrating
WNT/β-catenin pathway activation; an overwhelming majority of these tumours have CTNNB1
mutations in exon 3 [34, 44, 49]. However, expression profiles do not provide an unequivocal
subgroup assignment. Overexpression of some of the WNT signature genes was identified in
SHH and Group 3 tumours as well [34] in addition to a single case with both CTNNB1 and
PTCH mutations [49].
Multiple studies have demonstrated a strong correlation of widespread nuclear immunopositivity
for β-catenin with presence of exon 3 mutations in CTNNB1; at the same time none of the
immunonegative samples or samples having focal nuclear immunopositivity were identified as
having CTNNB1 (β-catenin) mutations [21, 45, 79-80]. This strong correlation of the nuclear
immunopositivity for β-catenin with presence of mutation in CTNNB1 in combination with
available reliable antibodies allows for use of the immunohistochemical staining in clinical
setting providing quick, inexpensive and reliable marker for CTNNB1 mutation.
Ellison and colleagues first correlated immunopositivity for β-catenin with significantly
improved survival. Activating mutations in β-catenin have been determined to be a universal
favorable prognostic marker for both average and high risk patients; notably, all metastatic
12
![Page 27: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/27.jpg)
patients within this subgroup are alive at least 5 years post-diagnosis [79]. Superior outcome for
this group has been confirmed by several other studies citing long-term survival for WNT
subgroup patients exceeding 90% [3, 21, 34, 44-45, 49, 77, 80-81]. However there is no
literature elucidating biological mechanism responsible for better survival in WNT
medulloblastomas.
1.5. WNT/β-catenin signalling pathway in development and cancer
1.5.1. Role of WNT signaling in embryonal development
The WNT pathway is highly conserved from Drosophila to humans. It plays important roles in
both embryogenesis and cancer. WNT proteins are key players in cell fate determination and
patterning during embryonic development [82]. Defects of this pathway result in severe
developmental abnormalities and defects of embryogenesis [82-84]. WNT signalling is involved
in regulation of cell proliferation, differentiation and epithelial-mesenchymal interactions in a
variety of tissues, from formation of body axes during the early stages of development to tissue
differentiation during organ development, including the brain [84]. The WNT pathway plays
important roles in nervous system development, including differentiation and axon growth,
synaptic formation and myelination. Mutations in WNT1 result in severe midbrain, hindbrain
and spinal cord abnormalities. Interestingly, prolonged activation of WNT and/or
overexpression of ectopic β-catenin results in expansion of the neuronal progenitor cell pool and
enlargement of the forebrain and spinal cord, and increased proliferation of the ventricular zone
accompanied by defects of glial and neuronal differentiation [85]. In adults, WNT signalling
plays a role in maintenance of the stem cell population in highly proliferative tissues [84].
Currently, more than 19 WNT proteins and more than 10 Frizzled receptors are described in
WNT pathway. Major effector branches of the pathway depend on a combination of a particular
WNT ligand and Frizzled receptor and are subdivided into three major streams: 1) canonical
WNT/β-catenin pathway which predominantly regulates cell proliferation and differentiation
through β-catenin TCF/LEF mediated transcriptional activation of target genes and is implicated
in cancer [82-84]; 2) WNT/Ca++
branch which regulates cell adhesion and cell motility [84]; and
3) planar cell polarity (PCP) pathway which is involved in cell morphogenesis and cell polarity
via JNK [84].
13
![Page 28: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/28.jpg)
The key event in canonical WNT/β-catenin signaling is accumulation of the active β-catenin in
the cytoplasm, its subsequent translocation to the nucleus and activation of the downstream
effectors. The WNT/β-catenin signalling in normal and tumour cells is outlined in Figure 1.3.
In normal cells, the absence of WNT ligand results in low β-catenin levels both in the cytoplasm
and nucleus. Endogenous β-catenin is found in cell-cell junctions forming complexes with
cadherin-associated proteins to execute adhesion function. Free β-catenin is constantly
destroyed by the protein complex consisting of glycogen synthase kinase 3β (GSK3β), Axin,
adematous polyposis coli (APC) protein and casein kinase Iα (CKIα). Phosphorylation of β-
catenin on serine-45 (Ser45) enables its subsequent phosphorylation on serine-33, 37 (Ser33,
Ser37) and threonine-41 (Thr41). Phosphorylated β-catenin is ubiquitinated by β-transducin
repeat containing protein (β-TrCP) and degraded in the proteosome [83-84, 86]. At the same
time in the nucleus WNT targets are silenced by T-cell factor (TCF) and lymphoid enhancer-
binding protein (LEF) transcription factors [83]. Activation of the pathway begins with the
binding of WNT ligand to the corresponding Frizzled (FZ) receptor. Frizzled recruits dishevelled
protein (DSH) to the plasma membrane; phosphorylated DSH through interaction with Axin
prevents GSK3β by its phosphorylation on serine-9 (Ser9) from phosphorylation of β-catenin.
This leads to stabilization of β-catenin, its cytoplasmic accumulation and subsequent nuclear
translocation. In the nucleus, β-catenin couples and interacts with TCF/LEF complexes allowing
for transcriptional activation of downstream targets such as Cyclin D1, MYC and others [84, 86].
1.5.2. WNT activation and stabilization of β-catenin in cancer
In tumour cells, WNT activation and β-catenin stabilization are commonly achieved by
deactivating mutations in APC and activating mutations in CTNNB1 (β-catenin) [25, 78, 82, 87].
In the case of medulloblastoma, CTNNB1 mutations are the predominant way to activate WNT
pathway. In this case in the continuous absence of WNT signal, mutations in Ser45, Ser33, Ser37
and Thr41 act to prevent GSK3β from phosphorylation of β-catenin; they result in accumulation
of stable β-catenin in the cytoplasm and its translocation to the nucleus with subsequent
transcriptional activation of downstream targets via interaction with TCF/LEF [82-84, 86, 88-
90].
Inappropriate activation of the WNT pathway is implicated in cancer development.
Overexpression of WNT1 has been linked to development of mouse mammary carcinomas.
14
![Page 29: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/29.jpg)
Figure 1.3. Canonical WNT/β-catenin signaling in normal andcancer cell. (A) Phosphorylation of β-catenin by GSK3β resulted in
proteosomal degradation of the β-catenin protein; Canonical WNT
activation (B) – binding of multiple WNT ligands to Fz receptor
subsequently inhibits GSK3β via DSH, this results in stabilization of β-
catenin, it’s nuclear translocation and activation of TCF/LEF mediated
signaling;
(C) Mutation in β-catenin prevents GSK3β from phosphorylation and
targeting β-catenin for degradation, resulting in nuclear translocation of
β-catenin and initiation of TCF/LEF mediated transcription; Presence of
mutation constitutively activates WNT/β-catenin signalling similar to
canonical WNT signaling in normal cell.
A B C
15
![Page 30: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/30.jpg)
WNT1, WNT2 and WNT3 proteins are known to have high transforming potential and conduct
their signal through the canonical β-catenin pathway. Transfection of normal epithelial cells
with these WNT family proteins results in high rates of transformation [82]. In addition,
mutations in downstream members of the WNT pathway are detected in multiple cancers. APC
mutations are a key genetic event defining familial adenomatous polyposis (FAP) and are also
present in 80% of sporadic colon cancers [91-92]. Mutations in CTNNB1 are rare in colon
cancer and are always mutually exclusive with APC mutations [82]. Nuclear translocation of β-
catenin is observed in a third of primary melanoma samples [93]. Despite the fact that activating
mutations in CTNNB1 or deactivating mutations of APC are frequently found in melanoma cell
lines [94], they are rare events in primary tumours, suggesting a different mode of WNT
activation [93]. In prostate cancer, β-catenin mutations are found only in 5% of cases [95],
however transcriptionally active β-catenin has been shown to interact with androgen receptors
contributing to hormone resistance during prostate cancer progression [82, 96-97]. WNT
pathway activation is also implicated in thyroid, liver, ovarian and endometrial cancers [82, 84,
86]. In gliomas, levels of β-catenin in the tumour tissue and its nuclear accumulation correlate
with World Health Organization (WHO) grading of these tumours with higher level of nuclear
β-catenin being the feature of high grade gliomas [98]. Aberrations in WNT signalling are
described in paediatric embryonal solid tumours: 75% of hepatoblastoma cases have activating
CTNNB1 alterations – mutations and small frame shift deletions; 15% nephroblastomas have
aberrant activation of WNT through mutations in CTNNB1, predominantly affecting codon 45;
62% of pancreatoblastomas have activating mutations in CTNNB1. However, no correlation
with tumour progression or survival has been studied. Approximately 15-25% of sporadic
medulloblastomas demonstrate activation of WNT signalling with presence of CTNNB1
mutations. While mutations in APC are extremely rare in sporadic tumours [99-100][78, 84], as
mentioned before, germline APC mutations are found in patients with Turcot syndrome, a form
of familial adenomatous polyposis (FAP) with high incidence of medulloblastomas [25].
1.5.3. Activation of WNT/β-catenin signaling as a prognostic marker in cancer
The effects of WNT/β-catenin pathway activation are tissue and cell type dependent. Nuclear
accumulation of transcriptionally active β-catenin can promote aggressive behaviour in some
cells and apoptosis / cell growth arrest in the others [76]. In colorectal carcinomas, specific
mutations in the APC gene which prevent proper APC – β-catenin interactions have been
16
![Page 31: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/31.jpg)
predictive of poor survival [101]. In both colorectal cancer and hepatocellular carcinoma, β-
catenin nuclear accumulation has been correlated with reduced survival associated with
metastatic disease and aggressive tumour behaviour; in hepatocellular carcinomas nuclear β-
catenin accumulation has been correlated with high levels of Ki67, suggestive of increased cell
proliferation and tumour progression [86, 102-103]. Similarly, in breast cancer transcriptionally
active β-catenin is associated with overexpression of Cyclin D1 and poor survival [104].
Interestingly, some studies have shown that accumulation of mutant β-catenin in the nucleus is
associated with non-invasive tumours and better prognosis, suggesting that accumulation of wild
type β-catenin due to upstream pathway alterations and mutant β-catenin may have different
roles in tumour progression [86]. Activation of WNT/β-catenin signalling with nuclear
accumulation of β-catenin has been shown to decrease tumour size in melanoma both in patients
and in animal models [105]. Several reports link overexpression / accumulation of
transcriptionally active β-catenin to apoptosis and /or growth arrest: in kidney cell lines (COS7
and 293) β-catenin appears to be a mediator of apoptosis [106]. In turn, Julling and colleagues
have demonstrated in an osteosarcoma model that overexpression of β-catenin induces apoptosis
through a p53-independent pathway [107] . In retinoblastoma, activation of the WNT pathway
significantly reduces cell viability via induction of cell cycle arrest in cell lines. In primary
tumour tissues and mouse models canonical WNT signalling is suppressed, suggesting that at
least in retinoblastoma WNT acts as tumour suppressor [108]. In medulloblastoma, multiple
studies have shown that WNT pathway activation is associated with accumulation of
transcriptionally active β-catenin in the nucleus and is associated with improved survival as
described above [45, 79-80].
In summary, the role of WNT/β-catenin activation in both development and cancer has been
extensively studied and multiple reports exist, associating WNT activation and presence of
nuclear β-catenin with cancer phenotype. It is clearly evident that in a large number of cancers,
notably mostly in adults, WNT activation and nuclear β-catenin are associated with an
aggressive tumour phenotype, presence of metastatic disease and poor prognosis. At the same
time, in melanoma and two major paediatric cancers, retinoblastoma and medulloblastoma,
activation of WNT/β-catenin signalling was clearly associated with favorable disease outcome.
17
![Page 32: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/32.jpg)
1.6. Role of WNT/β-catenin in radiation response
Involvement of β-catenin in response to radiation is poorly studied. In the limited published
literature it has been shown that WNT/β-catenin mediates radiation resistance in both mouse
mammary progenitor cells and human breast cancer cell lines. [109-110]. Recent studies suggest
that aberrant activation of WNT/β-catenin signalling may contribute to radiation resistance of the
cancer stem cell (CSC) population. Exact mechanisms of radioresistance in CSC are yet to be
elucidated, however speculations have been made that excessive WNT/β-catenin signalling
results in chromosomal instability via deregulation of mitotic spindles and high tolerance to
DNA damage [111]. Contribution of aberrantly activated WNT/β-catenin pathway to
radioresistance was also described in oesophageal and colorectal cancers [112-113].
Interestingly, in colorectal cancer WNT involvement was independent of active β-catenin
accumulation and limited to tumours with overexpression of TCF4 [113]. In glioblastomas
multiforme (GBM) WNT/β-catenin pathway is activated in post-radiated tissues. In both cell
lines and in vivo mouse models enrichment for stem cell like populations resistant to radiation
was observed after irradiation with cells positive for transcriptionally active β-catenin,
suggesting that WNT/β-catenin activation contributes to radiation resistance. In addition,
pharmacological and/or siRNA inhibition of WNT signalling resulted in radiosensitisation of
tumour cells and depletion of β-catenin positive subpopulations [114].
Salaroli and colleagues first showed that in medulloblastoma cell lines radiation triggers WNT
activation. Subsequent activation of cell cycle arrest and apoptosis in both TP53 wild type and
mutant cells suggests that in TP53 deficient medulloblastoma cells, growth arrest and apoptosis
may be mediated through WNT/β-catenin bypassing p53 pathway.
In summary, a significant body of literature demonstrates that WNT plays an important role in
cellular radiation response and activation of WNT/β-catenin signalling promotes resistance to
radiation in a number of cancers. Association of WNT activation with highly favorable patient
survival in radiation-sensitive tumours provide grounds to suggest that the role of WNT/β-
catenin radiation resistance is cell type dependent and that in medulloblastoma it may confer
sensitivity to radiation.
18
![Page 33: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/33.jpg)
1.7. Role of Lithium in mimicking WNT subtype of medulloblastoma
Lithium has been used to treat bipolar disorder for more than 50 years [115], however its
mechanism of action is largely unknown. Lithium has been shown to affect embryonic
development in a manner consistent with WNT pathway activation, affect metabolism through
stimulating glycogen synthesis by activating glycogen synthase, modulate neurotransmitters and
alter neuronal communication, increase cell proliferation and stimulate hematopoiesis [116].
Two main lithium sensitive pathways have been identified to date: 1) depletion of inositol via
inhibition of inositol monophosphatase which results in a decrease of neurotransmitter
signalling and is thought to be mainly involved in lithium antipsychotic effects; 2) inhibition of
GSK3β, a negative regulator of WNT pathway, mimicking canonical WNT signalling. GSK3β is
known to be involved in multiple complex cellular processes both as a part of canonical WNT
signalling pathway and outside it: embryonal development, cell cycle progression regulation,
apoptosis and survival mediation, cellular metabolism, transcription and cytokinetics. The role
of GSK3β and WNT signalling in tumourogenesis was discussed above. Inhibition of GSK3β by
lithium is non-competitive and specific, as it does not affect other protein kinases [117]. It has
been demonstrated that both radiation exposure and lithium inhibit GSK3β by phosphorylation
on Ser9 [118-119]. Multiple studies have demonstrated that, by inhibition of GSK3β, lithium
activates downstream components of the WNT pathway and results in constitutive activation of
the pathway marked by nuclear accumulation of β-catenin [116, 120].
The effects of lithium are cell type specific. Lithium stimulated cell proliferation and invasion in
mammary tumour cells [76] and contributes to radiation resistance in pancreatic cancer models
[121]. Lithium also inhibits cell proliferation in melanoma, hepatocellular carcinoma and
prostate cancer [76], and inhibits cell invasion and migration in glioma [122]. Lithium, in
physiological concentration, has been shown to induce apoptosis in rat immature cerebellar
granular cells but, interestingly, at the same time promotes survival in mature neurons in in vitro
models [123]. It has also been reported that lithium has neuroprotective effects on hypocampal
neurons against radiation in mouse models [124-125].
Activation of the WNT pathway marked by presence of a CTNNB1 mutation resulting in nuclear
accumulation of β-catenin is the hallmark of WNT subgroup of medulloblastoma, the most
prognostically favorable variant of the disease [3, 21, 34, 44, 49, 77, 79]. As discussed above,
19
![Page 34: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/34.jpg)
administration of lithium is consistent with GSK3β-mediated activation of the canonical WNT
pathway and can be defined by nuclear β-catenin translocation and transcriptional activation of
β-catenin downstream targets. Thus, lithium can be used to mimic WNT subgroup
medulloblastoma in vitro. Activation of the WNT pathway by lithium is shown in Figure 1.4.
This model has certain limitations due to possible undescribed off-target effects of lithium
occurring both through inhibition of GSK3β and/or other pathways.
1.8. Crosstalk between β-catenin and p53
Aberrant activation of WNT/β-catenin signalling with accumulation of excessive
transcriptionally active β-catenin is strongly implicated in development of multiple cancers,
suggesting that it has an oncogenic role. The TP53 tumour suppressor gene plays a critical role
in prevention of malignancies safeguarding propagation of cells with deregulated proliferative
properties; TP53 is a frequent target for inactivation in many cancers [126]. In addition to its
oncogenic properties β-catenin has been shown to increase transcriptionally active p53 through
both mdm2 dependent and independent pathways associated with senescence phenotype in colon
cancer cells and fibroblasts [126-128]. It was also found that not only β-catenin can affect levels
of p53, but p53 in turn can modulate levels of β-catenin – thus activation of p53 in response to
genotoxic stress can result in increased proteosomic degradation of β-catenin possibly through a
GSK3β mediated mechanism. In the absence of a functional p53 pathway, β-catenin is free to
exert its oncogenic functions; interestingly, wild type TP53 is not able to down regulate mutant
β-catenin [126, 129]. It is not known if similar cross talk between β-catenin and p53 exists in
medulloblastomas.
20
![Page 35: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/35.jpg)
Figure 1.4. Activation of canonical WNT/β-catenin signaling bylithium. Treatment with Lithium inhibits GSK3β activity by Ser9
phosphorylation GSK3β. Inactivation of GSK3β results in impaired
phosphorylation of β-catenin and failed β-catenin degradation.
As a result of increased cytoplasmic levels, β-catenin translocates
to the nucleus, where it activates TCF/LEF mediated transcription,
constitutively activating canonical WNT signaling.
21
![Page 36: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/36.jpg)
PROJECT RATIONALE AND HYPOTHESIS
Although survival of children with medulloblastoma has significantly improved over the last
years with introduction of radiation and adjuvant chemotherapy, up to 30% of children will
experience recurrence and ultimately die from their disease.
Currently, medulloblastomas are stratified based on clinical criteria alone, which include age of
onset, metastatic spread and residual tumour after surgery. These clinical risk criteria and the
establishment of large cooperative clinical trials resulted in improved survival for these
individuals. However, the high morbidity associated with aggressive multimodal treatment
protocols which may be unnecessary for some patients with favorable tumours and the lack of
ability to predict recurrence in each clinical risk group resulted in efforts for genetic and
molecular stratification of the disease. As of today, none of the known molecular markers are
routinely used in the clinic or as a part of clinical trials. We have reported previously, using the
Toronto cohort, that survival is poor for children with medulloblastoma harboring TP53
mutations. However, a similar analysis of patients from the Heidelberg cohort failed to
demonstrate unfavorable prognosis of TP53 mutated tumours particularly those harbouring
concomitant mutations in CTNNB1 (β-catenin). Moreover, reports from an English cohort and
an additional German cohort revealed mixed findings suggesting that the role of TP53
alterations in medulloblastoma remains uncertain. Recently, several groups were able to
demonstrate that although morphologically similar, medulloblastomas could be divided into four
subtypes, named WNT, SHH and Group 3 and Group 4 based on their expression profile, and
genetic and cytogenetic markers. However, except for the WNT subgroup which is consistently
associated with improved survival, SHH tumours, group 3 and group 4 show heterogeneous, but
consistently inferior outcomes. Recent meta-analysis revealed no statistical difference in the
overall survival (OS) between the latter 3 groups. Our research group was recently able to
observe a unique association of SHH/TP53 mutant tumours with poor survival, as well as
enrichment in the Heidelberg cohort for WNT/TP53 mutant tumours with favorable outcome, we
hypothesize that the adverse poor survival associated with TP53 mutations is modulated by
other genetic alterations, such as activation of WNT or SHH signalling. This is especially
important since WNT activation can be achieved with administration of lithium, which presents
a feasible opportunity for pathway targeted therapy. Knowing that radiation therapy is a key
medical treatment for medulloblastoma patients leading to cure in the majority of patients we
22
![Page 37: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/37.jpg)
further hypothesise that constitutive activation of WNT/β-catenin signaling pathway with lithium
will rescue radiation resistance of the TP53 mutation-associated phenotype and sensitize
medulloblastoma cells to radiation thus providing the basis for novel therapy for this disease.
Therefore, the objectives of this thesis were:
1) To determine whether adverse survival in patients with TP53 mutant medulloblastoma is
subgroup dependent.
2) To determine whether WNT/β-catenin activation with lithium can sensitize
medulloblastoma cells to radiation
In order to clarify the prognostic role of TP53 mutations, we assembled all new data from recent
studies focusing on clinico-pathological associations of TP53 mutations with molecular
subgroups (discovery cohort). In order to confirm our observations, we sequenced a large,
independent validation cohort for which both clinical and molecular subgroup information was
available.
In order to investigate effect of WNT activation and lithium treatment on medulloblastoma
radiation response, we performed a series of clonogenic assays to assess cell viability and
clonogenicity in both TP53 wild-type and mutant medulloblastoma cells. Functional studies
were performed to evaluate WNT/β-catenin pathway involvement in radiation response.
23
![Page 38: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/38.jpg)
CHAPTER 2: MATERIALS AND METHODS
2.1. Patient cohort
2.1.1. Clinical data
Patient data, both clinical and biological, were obtained through a collaborative effort of several
international groups in Germany, the United Kingdom and Canada. Subgroup assignment,
CTNNB1, and TP53 sequencing was performed in house separately for each study. Briefly, for
the Newcastle group, patients with the WNT subgroup were identified by presence of a CTNNB1
mutation in exon 3, patients with SHH subgroup were identified using transcriptional profile,
and TP53 mutation status was determined using standard PCR-based DNA sequence analysis of
exons 4 to 9 [62, 77, 130]; For the Heidelberg group, mutation status was determined using
standard PCR-based DNA sequence analysis of exon 3 for CTNNB1 and exons 2 to 11,
including exon-intron boundaries, for TP53 [61], and subgroups were identified using antibody
panel as previously described [34]. For The Hospital for Sick Children group and MAGIC
cohort, mutation status of the CTNNB1 gene was determined using standard PCR-based DNA
sequence analysis of exon 3, TP53 gene was sequenced exon 2 to 11 and through the spanning
intron-exon junctions as previously published [131]. Specific medulloblastoma subgroups were
determined by expression levels of the 25 subgroup specific signature genes (CodeSet) using
nanoString nCounter Technology as previously described [132].
2.1.2. Statistical analysis
Overall and progression free survival were estimated using the Kaplan-Meier method with
significance (α=0.05) based on long-rank test, using GraphPad Prism version 5.00 for Windows,
GraphPad Software, San Diego California USA, www.graphpad.com. Overall survival was
defined as date of diagnosis to death of any cause or to the date of the last follow-up visit.
Progression-free survival was defined as date of diagnosis to date of first progression, relapse,
death of any cause or last date of follow-up. For correlative studies, Fisher exact test was used
when appropriate.
2.2. Cell lines
Human MB wild-type TP53 cells lines: ONS76, D283, Med8a, D458 and TP53 mutant cell
lines: UW228, RES256, D425 and Daoy were obtained as a courtesy of Drs. Michael Taylor and
24
![Page 39: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/39.jpg)
Annie Huang, The Hospital for Sick Children, Toronto. ONS76, UW228 cells were cultured in a
monolayer in Dulbecco’s Modified Eagle’s medium (DMEM) (Wisent, 319-005-CL)
supplemented with 10% of Fetal Bovine Serum (FBS) (Wisent, 080450) and 1% of Penicillin /
Streptomycin / Amphotericine (Pen/Strep/Am) (Wisent, 450-115-EL); Daoy, D283 and Med8a
cells were cultured in a monolayer in Alpha Modification of Eagle’s medium (AMEM) (Wisent,
310-010-CL), supplemented with 10% FBS and 1% Pen/Strep/Am solution; RES256 was
cultured in a monolayer in DMEM/F12 medium (Wisent, 219-095-QK), supplemented with
10% FBS and 1% Pen/Strep/Am solution; D425 and D458 were cultured as a suspension culture
in DMEM supplemented with 10% FBS, 1% Pen/Strep/Am solution and non-essential amino
acids (Wisent, 321-012). All cells were grown in a humidified atmosphere containing 5% CO2 at
37°C. 0.25% Trypsin EDTA (Wisent, 325-042-EL) was used to detach cells for passaging.
Normal fetal neural stem cells Hf5205 were obtained as courtesy of Dr. Peter Dirks, the
Hospital for Sick Children, Toronto; cells were isolated by Dr. Dirks’ group (Unpublished data)
and cultured as previously described [133]. In brief, Hf5205 cells were cultured in NeuroCult
NS-A Basal Medium (StemCell Technologies, 05750), supplemented with Glutamax (Wisent,
2mM), N2, B27 (Life Technologies, Invitrogen), EGF, FGF (10ng/ml, PeproTech) and Heparin
(2 μg/ml, Sigma). All culture vessels were coated with Laminin in PBS (2 μg/ml, Sigma) for 3
hours at 37C prior to use. Cells were grown in a monolayer at 37°C in a humidified atmosphere
containing 5% CO2 and the medium was replaced every 3-4 days. Accutase (Sigma) was used
to detach or dissociate cells before passaging or seeding.
2.3. TP53 and CTNNB1 sequencing
The TP53 mutation status of the cell lines was determined in the Department of Paediatric
Laboratory Medicine (DPLM) at The Hospital for Sick Children by direct sequence analysis of
exons and intron/exon boundaries of TP53 gene and by multiple ligation-dependent probe
amplification (MLPA) methods to detect deletions of the TP53 gene.
Sequencing of CTNNB1 gene was performed by in our lab. Primers were designed using
Primer3Plus Version 2.3.0 software [134] to sequence exon 3. Following primers were used:
5’TGATTTGATGGAGTTGGACA’ and 3’GCTACTTGTTCTTGAGTGAAG’ PCR
conditions: initiation of denaturation – 95°C, 15 min - 1 cycle, denaturation – 94°C, 30 sec,
annealing – 55°C, 30 sec, elongation – 72°C 50 sec and final elongation – 72°C, 7 min – 35
25
![Page 40: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/40.jpg)
cycles. Sanger sequencing was performed by The Centre for Applied Genomics, The Hospital
for Sick Children, Toronto, Canada. Sequence was analysed using FinchTV 4.1 software
(PerkinElmer, Inc. USA) Human Genome Assembly 2009 UCSC (Center for Biomolecular
Science and Engineering, Santa Cruz, USA).
2.3 Chemicals
Lithium Chloride (Sigma, 02685-1EA), was dissolved in sterile water to prepare a stock solution
of 500mM, sterilized by filtration. Working solution of 2mM used for cell treatment was
prepared by dissolving stock solution in regular growth medium at the time of treatment.
2.4. Irradiation
Radiation exposure was performed using a Nordion Gammacell 40 irradiator with the central
dose rate 1.24 Gy/min. Single discrete doses of 1 to 10 Gy were delivered according to
experimental design.
2.5. Clonogenic experiments
Radiation sensitivity curves: ONS76, Med8a, D283, Daoy and UW228 cells were maintained in
T-75 flasks until 80% confluent, trypsinized to generate a single-cell suspension, counted using
a haemocytometer and seeded at specific numbers in triplicates into 10 cm dishes to yield
between 50 and 150 colonies after. Cells were allowed to adhere overnight and then irradiated
with the range of doses from 1 to 5 Gy single doses. The medium was changed after irradiation
and cells were maintained at 37°C for 14 days to allow colonies of more than 50 cells per
colony to form. The colonies were then fixed and stained with Crystal violet (0.1%) and counted
manually. The surviving fractions were calculated after adjustment for plating efficiency of non-
irradiated controls as follows:
SF (survival fraction) = [(number of colonies observed) / (number of cells plated)] / PE (plating
efficiency of control)
PE (plating efficiency of control) = (number of colonies observed in non-irradiated sample) /
(number of cells plated)
26
![Page 41: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/41.jpg)
Data from 3 independent experiments with triplicates were each plotted as a function of
radiation dose on a semi-logarithmic plot.
2.6. Transfection experiments
For each cell line 3x105 cells were transiently transfected in parallel with 2µg of plasmid-of-
interest DNA or 2ug pcDNA3 plasmid as control by Nucleoporation, Lonza, as per the
manufacturer’s instructions using Amaxa Mouse Neural Stem Cell Kit (Nucleofector, VPG-
1004) and X001 program. After transfection, medium was replaced with normal growth medium
and cells were transferred to 35 mm dishes and left for 24 hr. Subsequently cells were
trypsinized, counted, and plated in 10 cm dishes for clonogenic assay as described above.
Plasmids used: pcDNA3-TP53R175H, pcDNA3 (courtesy of Dr. David Malkin, The Hospital for
Sick Children, Toronto), pcDNA3-S33Y β-catenin [135] obtained through Addgene web-site:
http://www.addgene.org/. The figure was plotted from 3 independent experiments with
triplicates each; data was plotted as a function of radiation dose on a semi-logarithmic plot.
Transfection efficiency was estimated for the pcDNA3-TP53R175H/pcDNA3 plasmid
combination by co-transfection with the pcDNA3-GFP plasmid. The proportion of GFP-positive
cells was estimated by manual cell counting under fluorescence microscopy.
Transfection efficiency for the pcDNA3-S33Y plasmid was estimated by immunofluorescent
microscopy for FLAG-tag. Transfected cells were plated on cover slips and further processed as
described in section 2.10 and proportion of FLAG-positive cells was obtained by manual
counting.
2.7. Combination of Lithium and radiation treatment
2.7.1. Lithium toxicity curves
ONS76 and UW228 cells were trypsinized and plated for clonogenics as described above. Cells
were treated with 0.1mM, 0.5mM, 1mM, 2mM and 10mM of lithium chloride for 24 hours.
Drug-containing medium was then replaced by regular culture medium and cells were
maintained as described above until colonies of 50 or more cells appear (approximately 14
days), then fixed, stained with Crystal Violet (0.1%) and manually counted. Survival curves
were generated as described above. Data from 3 independent experiments, each in triplicate,
were plotted on a linear plot.
27
![Page 42: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/42.jpg)
2.7.2. Clonogenic experiments with combination of Lithium and radiation exposure
ONS76 and UW228 cells were cultured, trypsinised, counted and plated at specific densities and
kept overnight to adhere as described above. Cells were exposed to lithium chloride 2mM for 24
hours, and then irradiated with the range of doses from 2 to 8 Gy single doses. Drug-containing
medium was aspirated and replaced with normal growth medium. Cells were maintained as
described above until colonies of 50 or more cells appear (approximately 14 days), then fixed,
stained with Crystal Violet (0.1%) and manually counted. The surviving fractions were
calculated as described above, and survival curves were generated after normalizing for the
amount of lithium chloride that induced death. The survival fraction at 2 Gy (SF2 value) was
calculated for each curve; SF2 value has been shown to be the best discriminator of the cellular
radiosensitivity in vitro and represents the clinically relevant low-dose portion of radiation
survival curve [136]. Survival fractions at higher doses of radiation, SF4, SF5, Sf6 and SF8
were calculated when appropriate. The sensitizer enhancement ratio (SER) at 10% survival for
lithium chloride was calculated as following, where D is the dose of radiation [137]:
SER10 = D10 (without drug) / D10 (lithium chloride)
Data from 3 independent experiments, each in triplicates, were plotted as a function of radiation
dose on a semi-logarithmic plot.
2.8. Western blot analysis
Protein expression levels were determined by western blot analysis. Cells were lysed after 24 hr
of exposure to 2mM of lithium chloride or after 4 hr post 5 Gy of single dose irradiation;
untreated cells were used as control. Protein extraction was performed using RIPA extraction
buffer [138]. Protein quantification was done using BioRad Protein Assay (BioRad, 500-0006).
30µg of protein were used for the assay. Whole cell lysates were separated on 12%
polyacrylomide gel and transferred to PVDF membrane. Membranes were incubated with
appropriate blocking buffer and primary/secondary antibodies; imaging was done using the
LiCor Odyssey imaging system, LICOR Bioscience. Primary antibodies were the following:
Rabbit anti-GSK3β-total (Cell Signalling, 9315L) 1:1000, Rabbit anti-Phospho-Ser9-GSK3β
(Cell Signalling, 5558S) 1:1000, Rabbit anti-β-actin (Abcam, ab8227) 1:2000 and mouse anti-β-
catenin (BD Transduction Labs, 6101153) 1:1000. Experiments were done at least 3 times.
28
![Page 43: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/43.jpg)
2.9. β-catenin luciferase reporter assay
For the reporter assay, 1x105 cells were plated in 24-well plates in triplicate per sample and left
to attach overnight. Cells were transiently transfected in parallel with either 0.5µg of the TCF-
reporter construct (M50 Super 8x TOPFlash) DNA or 0.5µg of the mutated reporter construct
(M51 Super 8x FOPFlash) DNA [139] together with 1ng of Renilla DNA. Plasmids were
obtained through the Addgene web-site: http://www.addgene.org/. Transfections were
performed using Lipofectamine 2000 (Invitrogen, 11668-027) according to manufacturer’s
protocol. After 4 hr post transfection medium was replaced with the regular growth medium and
cells were treated with 2mM of lithium chloride for 24 hr. TCF-mediated transcriptional activity
was determined by the ration of TOPFlash/FOPFlash luciferase activity, normalized to the
Renilla luciferase activity using Promega Dual Luciferase Reporter Assay System, (Promega,
E1960). 3 independent experiments were done.
2.10. Immunofluorescence – β-catenin nuclear translocation
Cells were cultured on cover slips in 6-well dishes, then fixed using 4% paraformaldehyde/0.2%
Triton X-100, 20 min at RT followed by 20 min in 0.5% NP40. Cells were exposed to 2%
Bovine Serum Albumin (BSA) / 1% donkey serum in PBS blocking solution for 1 hr at RT.
After this, cells were incubated with appropriate primary antibodies at 4°C overnight followed
by secondary antibodies at room temperature over 1 hour. Cover slips were mounted on slides
using “Vectashield” mounting medium for Fluorescence (Vector laboratories, H-1000). Slides
were stored at 4°C in the dark. Images and quantifications were performed using Quorum
Spinning Disk Confocal Microscope and Perkin Elmer Velocity 6.0.1 software (Perkin Elmer,
USA).
Primary antibodies: Mouse anti-β-catenin (BD Transduction Labs, 6101153) 1:500, Secondary
antibodies: Alexa Fluor 488 donkey-anti-mouse IgG (Invitrogen, A21202) 1:500.
2.10.1. β-catenin nuclear translocation
For β-catenin nuclear translocation, cells were pre-treated with 2mM of lithium chloride for 24
hr and then fixed according to the protocol above. Untreated cells were used as control.
29
![Page 44: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/44.jpg)
For β-catenin nuclear translocation, following introduction of the S33Y-CTNNB1 mutation cells
were transfected on cover slips and then fixed 48 hr post transfection. Both untransfected cells
and cells transfected with pcDNA3 were used as controls.
All experiments were repeated 3 times.
2.11. Normal neuronal stem cell viability experiments
Normal neuronal stem cells (Hf5205) were seeded at 4x104 cells per well in 6-well plates and
treated with lithium chloride (2mM, Sigma) for 24hrs before radiation; radiated with 2-8Gy
single dose. Cells were counted 5 days after radiation using Cell Viability Analyzer (Vi-Cell
XR, Beckman Coulter). Survival curves were generated as described above. The figure was
plotted from three independent experiments with triplicate each.
2.12. Statistical Analysis
Results were expressed as the mean ± SE of 3 or more independent experiments. Statistically
significant differences between samples were determined using Student 2-tailed t-test and two-
way ANOVA with Bonferroni correction method when appropriate using GraphPad Prism
version 5.00 for Windows, GraphPad Software, San Diego California USA,
www.graphpad.com; p value < 0.05 was considered significant. The error bars in the figures
represent SEs.
30
![Page 45: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/45.jpg)
CHAPTER 3: RESULTS
3.1. Survival of medulloblastoma patients with somatic TP53 mutations depends on
molecular subgroup
Clinical data, TP53 and CTNNB1 status and subgroup were available for 183 patients. This data
was obtained as a collaborative effort of 3 research groups and was originally published
separately as parts of three independent peer reviewed publications: 20 patients from Northern
Institute for Cancer Research, Newcastle upon Tyne, UK [62]; 95 patients from The Hospital for
Sick Children, Toronto, Canada [59] and 68 patients from Heidelberg Group, German Cancer
Research Center, University Hospital Heidelberg, Heidelberg and University Medical Center,
Hamburg-Eppendorf, Hamburg, Germany [61].
3.1.1. Distribution of TP53 mutations in subgroups
Mutation analysis was done on the pooled cohort of patients, which included 183 patients from
our discovery cohort and 156 patients from the validation cohort described below. For this
analysis patients of all ages were included. We did not have compete data on all of 339 patients,
therefore, patients who either did not have a group assigned or who had TP53 status determined
by immunohistochemical staining for p53 protein, but not by sequencing were excluded (n=40).
The total number of patients we analysed was 299; out of whom WNT were 93 patients (78 were
TP53 wild-type, and 15 were TP53 mutant), SHH were 170 patients (136 of those patients were
TP53 wild-type and 34 were TP53 mutant) Group 3 had 13 patients (all patients were TP53
wild-type) Group 4 had 23 patients (16 TP53 wild-type and 7 were TP53 mutant).
We did not attempt to estimate frequency of TP53 mutations in our population. This analysis
was not possible because data was collected with a bias towards WNT and SHH subgroups and
patients bearing TP53 mutations, and information on other subgroups was limited, because only
TP53 mutant data was available for WNT and SHH subgroups from our collaborators. However,
recognising limitations of our study we attempted to analyse distribution of TP53 mutations by
molecular subgroups. We found that TP53 mutations are present in higher proportion in Group 4
and in SHH subgroup and are completely absent in Group 3 patients (30.4%, 20% and 0%
respectively); the WNT subgroup had 16.1% of tumours mutated for TP53 (Figure 3.1.1.D).
31
![Page 46: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/46.jpg)
In both discovery and validation cohorts we found a total of 57 TP53 mutations: 26 mutations
were homozygous, 19 were heterozygous and 1 was a compound heterozygote; 11 patients with
TP53 mutations have missing information about the type of the mutation. The majority of
mutations were found in the DNA-binding domain (exons 5 to 8), with 2 mutations each in the
transactivation and proline-rich domains (exon 2 to 4), one mutation in the tetramerization
domain (exon 10), and one mutation was found in exon 11. No clustering of mutations with
respect to molecular subgroup was observed. Figure 3.1.1.A shows a schematic representation
of TP53 mutations. Interestingly, we found that the majority of the TP53 mutations in WNT
tumours are heterozygous: 8 (75.3%) vs. 4 (26.7%) out of 12 patients. In contrast, SHH tumours
bear predominantly homozygous alterations in TP53 (19 (55.9%) vs. 7 (20.6%)) out of 34
patients (p<0.05). In addition, 20.6% SHH tumours have other genetic alterations in the TP53
gene, such as insertions and deletions (n=5). The presence of more than 1 TP53 mutation per
tumour was also described (n=2) and only 1 WNT tumour has disruption of TP53 function by
homozygous duplication (6.7%) (Figure 3.1.1.B&C). Interestingly, this patient had metastatic
disease, but survived. Together, these observations suggest higher degree of genomic instability
and possible aggressive phenotype in SHH TP53 mutant medulloblastomas when compared to
WNT ones.
3.1.2. Patient characteristics and survival analysis
For survival analysis, we considered only patients over 3 years old who received the treatment
protocol, which included radiation therapy. Of the total 183 patients, 62 patients were in WNT
subgroup, 51 patient in the SHH subgroup, 18 patients in group 3 and 38 patients in group 4.
Fifteen patients had undetermined group due to technical difficulties or lack of available tissue
and were excluded from further analysis. Twenty-one patients younger than 3 years of age were
further excluded. These were: 10 from SHH subgroup, 6 from group 3, and 5 were missing
subgroup assignment. All the patients in WNT subgroup were older than 3 years of age. Out of
21 excluded patients, 1 had a TP53 mutation and 7 did not have TP53 mutation status other than
by immunohistochemical staining for p53 protein (5 tumours were p53-positive including 1
sample which also was found to have TP53 mutation). The discovery cohort for this specific
thesis therefore included n=139 patients. Characteristics by subgroups are presented below.
WNT subgroup had 62 patients (n=62), 48 patients were TP53 wild-type and 10 patients were
TP53 mutant. Median age was 10.6 years (range 5 to 30 years old). Median observed time to last
32
![Page 47: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/47.jpg)
follow up was 85 months (range from 16 to 192 months). The SHH subgroup had 41 patients
(n=41), 18 patients were TP53 wild-type, 21 patient was TP53 mutant. Median age was 10.1
years (range 3 to 45 years of age). Median observed time to last follow up was 35 months (range
from less than 1 month to 185 months). For Group 3, we had 13 patients, all of them were TP53
wild-type with median age of 4.99 years old (range from 2.1 to 11.5 years). Median observed
time to last follow up was 77.1 months (range from 5.1 to 164 months). Twenty-three patients
were group 4, with 16 being TP53 wild-type and 7 being TP53 mutant. Median age was 8 years
(range from 3.24 to 17 years). Median observed time to last follow up was 79.2 months (range
from 16.5 to 179 months).
Both overall (Figure 3.1.2.A) and progression-free survival (Figure 3.1.2.B) were significantly
worse for TP53 mutant patients comparing to patients with TP53 wild-type tumours (p<0.0001
for both analyses). Accordingly, overall survival was 48.7% for TP53 mutant patients. Five year
OS for TP53 wild-type patients exceeded 75%, with median survival time of 76 months for
TP53 mutant patients. Median time to progression was 54.7 and 179.0 months for TP53 mutant
and TP53 wild-type patients, respectively (p<0.001).
Interestingly, separate survival analysis of the WNT and SHH subgroups revealed marked
differences in the role of TP53 mutation on survival. In the WNT subgroup overall and
progression free survival (Figure 3.1.2.C&D) for patients with TP53 mutant tumours was not
significantly different than for patient with TP53 wild-type tumours. Overall survival was 76.4%
and 87.5% for TP53 mutant and TP53 wild-type patients, respectively (p=0.27 and p=0.22,
respectively). Progression-free survival for TP53 mutant patients was 72.9% and 76.2% for
TP53 wild-type patients.
In contrast, in the SHH subgroup we observed a significant decrease in overall survival in TP53
mutant patients – 16.7%, compared to TP53 wild-type patients 88.9 % (p<0.001) (Figure
3.1.2.E), with median survival time of 43 months for TP53 mutant patients; 14/21 TP53 mutant
patients are dead of their disease while only 2/18 in TP53 wild-type group. We observed a
significant difference in progression-free survival between TP53 mutant and TP53 wild-type
patients (p<0.001) (Figure 3.1.2.F); 16 out of 21 TP53 mutant patients progressed, with median
progression time of 19.1 months; only 4 patients progressed in the TP53 wild-type group.
Overall, in the discovery cohort, most deaths in the SHH group were attributed to TP53
mutations.
33
![Page 48: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/48.jpg)
0%
20%
40%
60%
80%
100%
WNT SHH
HOM
HET
0%
20%
40%
60%
80%
100%
WNT SHH
Other genetic
events
Point
mutation
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
WNT SHH Group 3 Group 4
TP53wt
TP53mut
Figure 3.1.1. TP53 mutation spectrum. (A) Distribution of TP53
mutations in functional domains according to subgroups: WNT – red,
SHH – blue, Group 4 - green; (B) Percentage of homozygous (HOM)
and heterozygous (HET) TP53 mutations in WNT and SHH subgroups;
(C) Percentage of other than point mutations genetic events
(deletions/insertions and complex mutations) disrupting TP53 function
in WNT and SHH medulloblastomas; (D) Percentage of TP53
mutations in medulloblastoma subgroups in discovery and validation
cohort together.
D
CB
A
34
![Page 49: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/49.jpg)
Figure 3.1.2. Overall and progression-free survival for TP53 mutant and
TP53 wild-type patients. Kaplan-Meier estimates of survival for patients with
TP53 mutant and TP53 wild-type medulloblastomas; Overall (OS) (A) and
progression-free (PFS) (B) survival by TP53 mutation status for all patients
age 3+ years, p<0.0001 for both analyses; OS (C) and PFS (D) by TP53
status for WNT patients, p=0.27 and p=0.22 respectively; OS (E) and PFS (F)
by TP53 status for SHH patients, p<0.001 for both analyses.
35
![Page 50: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/50.jpg)
3.1.3. Validation of initial observations
To validate our findings we used a separate non-overlapping cohort of 156 patients from
MAGIC (Medulloblastoma Advanced Genomics International Consortium) study which
comprises data on MB patients collected as a part of an international collaboration in multiple
countries in Western and Eastern Europe, Asia, United States and Canada [140]. This validation
cohort consisted of WNT and SHH patients only. The access to this data was a courtesy of Dr.
Michael Taylor, The Hospital for Sick Children, Toronto. For the purpose of this thesis, we
excluded all patients younger than 3 years of age (n=44, among those all but 1 patients were
from SHH subgroup. Only 1 patient, also SHH, had TP53 mutation). The final analysis included
112 patients older than 3 years of age Ninety-three patients (83%) were TP53 wild-type and 16
(14.3%) were TP53 mutant. The WNT subgroup consisted of 34 patients: 29 were TP53 wild-
type and 5 were TP53 mutant. Their median age was 9.33 years (range: 3 – 56.3 years) and
median observed time to the last follow up was 60.5 months (range: 3 – 252 months). The SHH
cohort consisted of 78 patients, of whom 11 were TP53 mutant and 67 were TP53 wild-type.
Their median age was 11.5 years (range: 3 – 33 years), with a median observed time to last
follow up of 40.5 months (range: < 1 month – 300 months).
Overall survival for TP53 mutant patients was significantly worse than for TP53 wild-type
patients, being 27.3% and 62.7%, respectively (p=0.01), with a median survival of 81 months
for TP53 mutant patients. In the WNT subgroup, overall survival did not differ between TP53
mutant and TP53 wild-type patients, being 80% and 71.9%, respectively (p=0.17). However, in
the SHH subgroup TP53 mutant patients had marked reduced overall survival compared to TP53
wild-type patients (20.5% vs. 63.3%, respectively (p=0.01)) with a median survival for TP53
mutant patients of 45 months (Figure 3.1.3.A,B&C). These results were strikingly similar to
results obtained from our discovery cohort.
In conclusion of this part, these findings reveal a strong association of TP53 mutations with
inferior survival in SHH subgroup; in contrast WNT MB exhibit no difference in survival with
respect to TP53 mutation status, suggesting that adverse effects of TP53 mutations can be
modulated by a pathway, specific to WNT tumours which is yet to be determined.
36
![Page 51: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/51.jpg)
OS All patients
OS WNT
OS SHH
Figure 3.1.3. Overall (OS)survival for TP53 mutantand TP53 wild-type
patients, MAGIC cohort.
Kaplan-Meier estimates of
survival for patients with
TP53 mutant and TP53 wild-
type MB; OS (A) survival by
TP53 mutation status for all
patients age 3+ years
(p=0.01); (B) OS by TP53
status for WNT MB patients
(p=0.17); (C) OS by TP53
status for SHH MB patients,
(p=0.01).
A
B
C
37
![Page 52: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/52.jpg)
Since we hypothesized that these differences between subgroups are a result of difference in
radiosensitivity modulated by TP53 status in each molecular background, we performed the
following experiments to test our hypothesis:
3.2. TP53 mutant medulloblastoma cell lines are more resistant to radiation
To determine the role of TP53 in radiation resistance in MB cells we used two different
methods: 1) we performed a series of clonogenic assays using a panel of TP53 wild-type and
TP53 mutant cell lines; 2) we used TP53 wild-type cell line and transiently transfected it with a
plasmid containing R175H TP53 mutation; clonogenic assays were subsequently performed to
assess survival.
Sequencing analysis of 8 MB cell lines revealed 4 TP53 mutant cell lines, of which 3 had point
mutations and one had simultaneous deletion/insertion of two base pairs resulting in an amino
acid change at codon 274. All three mutations were missense, homozygous and were located in
the DNA-binding domain resulting in non-functional protein. All mutations were described as
somatic mutations in multiple cancers (IARC TP53 Database http://www-p53.iarc.fr). The list
and distribution of mutations over the TP53 functional domains is shown in Figure 3.2.1. All
cell lines were wild-type for the CTNNB1 gene as determined by sequencing of exon 3
performed in our laboratory as described above.
The following medulloblastoma cell lines: ONS76 (TP53 wild-type), Med8A (TP53 wild-type),
D283 (TP53 wild-type), UW228 (TP53 mutant) and Daoy (TP53 mutant) were further used in
this project. Three cell lines were excluded: D425 (TP53 mutant) and D458 (TP53 wild-type)
cells grow as a suspension culture and were not suitable for clonogenic assay; and RES256 did
not yield consistent numbers of colonies on multiple attempts. The clonogenic assays were
performed and clonogenic survival curves were generated to assess whether resistance to
radiation depends on TP53 status, with doses ranging from 2 to 5 Gy. Irradiated samples were
compared to non-irradiated controls. As expected, we observed significantly higher survival in
response to radiation treatment in TP53 mutant cell lines Daoy and UW228 compared to TP53
wild-type cell lines, ONS76, Med8a and D283 (p<0.01) (Fig.3.2.2A). Specifically, minimal
survival differences at physiologically relevant radiation doses of 2 Gy was 3% between the
Daoy and ONS76 cell lines and a maximum difference was 43% between the UW228 and
Med8A cells. Survival fraction was distributed as following: 76% +/-2.5% for UW228, 67% +/-
38
![Page 53: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/53.jpg)
4.7% for Daoy, 64% +/- 2.2% for ONS76, 54% +/-4.7% for D283 and 33% +/-9.9% for Med8A
cells. With increase of radiation dose TP53 mutant cells retain their survival advantage. At a
dose of 5 Gy the minimal difference in survival was 15% between Daoy and ONS76 and the
maximum difference was 43% between UW228 and Med8A cells with the following
distribution of survival fractions: 48% +/-8% for UW228, 35% +/-6.5% for Daoy, 19.8% +/-
1.2% for ONS76, 16.4% +/-3.9% and 5.4% +/-2.8% for Med8A cells.
Since cell lines in the panel were not isogenic, other genetic alterations, which were unknown to
us, may have contributed to the survival differences described above. In order to further confirm
the pro-survival effect of TP53 mutation under the radiation exposure, the wild-type TP53 cell
lines D283 and ONS76 were transiently transfected with known dominant-negative TP53
R175H mutation. Transfection efficiency was estimated based on co-transfection of a GFP-
expressing plasmid using immunofluorescent microscopy; percentage of GFP-positive cells was
obtained and transfection efficiency was calculated: 59.85% +/-12.3% (Figure 3.2.2.F).
Transfection of the ONS76 TP53 wild-type cells with TP53 R175H mutation resulted in a
significant increase in radiation resistance in transfected cells compared to the empty-vector
control (p<0.01) (Figure 3.2.2B). In order to assess the effect of TP53 mutation on cell survival
at lower, clinically relevant, radiation dose, survival fraction at 2 Gy (SF2) was calculated: 89%
+/- 2% and 57.4% +/- 1.8% for TP53 R175H and TP53 wild-type cells respectively; with a 32%
survival advantage for TP53 mutant cells (p< 0.0001). At a higher dose of radiation, (6 Gy),
TP53 mutant cells demonstrated 6.8% better survival compared to wild-type counterparts
(p<0.001) with survival fraction at 6Gy (SF6) calculated as following: 20% +/-0.9% and 13.2%
+/- 0.7%, respectively. (Figure 3.2.2.C&D). For D283, only survival at 5 Gy (SF5) was
estimated. SF5 was 24% +/-0.6% and 15.5% +/- 0.4% for TP53 R175H and TP53 wild-type
respectively, with 8.5% survival advantage of the mutant cells (p<0.05) (Figure 3.2.2.E).
From the above observations we conclude that TP53 mutations confer radiation resistance in
MB cell lines.
3.3. CTNNB1 mutation (S33Y) sensitizes TP53 mutant medulloblastoma cells to radiation.
Since we hypothesized that improved survival of patients with WNT tumours are a result of
higher radiosensitivity, we examined the role of activating mutations and subsequent WNT
pathway activation in sensitizing TP53 mutant MB cells to radiation. We transfected our wild-
39
![Page 54: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/54.jpg)
type CTNNB1 MB cells with the S33Y mutation. UW228 TP53 mutant cells were transfected as
described above. The CTNNB1-S33Y plasmid was FLAG-tagged. Transfection efficiency was
evaluated using immunofluorescence microscopy; percentage of the FLAG-positive cells was
estimated at 24, 48 and 72 hours post transfection: CTNNB1-S33Y transfected cells
demonstrated a maximum nuclear immunopositivity of close to 90% at 24 hr with almost
complete resolution of FLAG-expression by 72hr. Cells were irradiated between 24 and 48
hours post transfection.
Nuclear translocation of β-catenin was demonstrated in CTNNB1-S33Y cells compared to cells
bearing wild type CTNNB1 by immunofluorescent imaging. Indeed, β-catenin mutation
facilitates nuclear translocation of the protein (Figure 3.3.1.).
Clonogenic survival curves were generated to assess whether TP53 mutation-associated
resistance to radiation is counteracted by presence of the CTNNB1-S33Y mutation. Cells were
exposed to a range of radiation doses of 2 to 8 Gy.
We observed that presence of the CTNNB1-S33Y mutation radiosensitizes TP53 mutant MB
cells (p<0.05) compared to empty vector control. Although the difference in survival at 2 Gy
(SF2) did not achieve statistical significance and was calculated as 12% with 56% +/-5.9% and
44.4% +/-6.2% for UW228/pcDNA3 cells and UW228/S33Y cells respectively (p>0.05), this
radiosensitizing effect was more pronounced at higher radiation doses, with SF5 being 26.7%
+/-1.2% and 17% +/-1.6%, respectively, where a 10% survival difference between CTNNB1
wild type and mutant cells was achieved (p<0.001) (Figure 3.3.2.A&B).
We therefore conclude that introduction of a CTNNB1-S33Y mutation into TP53 mutant MB
cells results in both activation of WNT signaling and sensitization of the cells to radiation,
suggesting that WNT signalling activation in MB may abrogate resistance to radiation associated
with TP53 mutations.
3.4. Lithium sensitises medulloblastoma cells to radiation:
Lithium is a known inhibitor of GSK3β. We took advantage of this property of lithium to mimic
constitutive activation of the WNT pathway by CTNNB1 mutation in order to test its ability to
reverse the radioresistance caused by TP53 mutations in MB.
40
![Page 55: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/55.jpg)
Figure 3.2.1. TP53 mutation spectrum and distribution overfunctional domains in medulloblastoma cell lines. (A) List of
TP53 mutations obtained through sequencing of MB cell lines; all
the mutations are homozygous and all except one result in non-
functional protein. All, except one, mutations are described in
multiple sporadic cancers; two of the mutations are also described
in LFS families. (B) All mutations are in the DNA-binding domain of
TP53 gene.
A
B
41
![Page 56: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/56.jpg)
Figure 3.2.2. TP53mut MB cells are more resistant to radiation. (A)
Survival curves for MB cell lines given different radiation doses. Red circles
represent UW228 TP53mut cell line, red triangles – Daoy TP53mut, blue
triangles – D283 TP53wt, blue squares – ONS76 TP53wt and blue circles –
Med8a TP53wt. (B) Transfection of ONS76 TP53wt cells with dominant-
negative R175H TP53 mutation resulted in increased radiation resistance of
cells. Blue circles – empty vector control, red circles – cells transfected with
R175H plasmid. (C-D) Bar graph of ONS76 TP53wt cells transfected with
R175H mutation showing the quantification of the surviving fraction
following 2Gy (SF2) and 6Gy (SF6) irradiation (**p<0.01). (E) Bar graph of
D283 TP53wt cells transfected with R175H mutation showing the
quantification of the surviving fraction following 5Gy (SF5) irradiation
(**p<0.01). (F) GFP-positive cells 24 hr post transfection, right – bright field
microscopy, left – immunofluorescent microscopy of the same field,
representative image.
IR Dose (Gy)IR Dose (Gy)** **
**
42
![Page 57: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/57.jpg)
Figure 3.3.1. Nuclear translocation of β-catenin in CTNNB1-
S33Y mutant cells.Transfection of TP53 mutant MB cells with mutant β-catenin
construct results in nuclear translocation of β-catenin (green),
nucleus (red), co-localization of β-catenin to nucleus (yellow).
43
![Page 58: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/58.jpg)
Figure 3.3.2. Activation of WNT pathway signalling via S33Y-CTNNB1
mutation radiosensitizes TP53 mutant cells. (A) Transfection of UW228
TP53mut cells with S33Y-CTNNB1 mutation resulted in moderate sensitization of
cells to radiation (*p<0.05). Survival curves for cells given increased dose of
radiation; empty vector control (pcDNA3) – blue circles, cells transfected with
pcDNA3-S33Y-CTNNB1 plasmid – red circles. (B) Bar graph of UW228 TP53mut
cells transfected with S33Y-CTNNB1 mutation showing the quantification of the
surviving fraction following 2Gy (SF2) (p=0.5) and 5Gy (SF5) irradiation
(**p<0.01).
* *
*
UW228
TP53mut/
S33Y
UW228
TP53mut/
pcDNA3
UW228
TP53mut/
S33Y
UW228
TP53mut/
pcDNA3
A B
Su
rviv
al
Fra
cti
on
, 2G
y
Su
rviv
al
Fra
cti
on
, 5G
y
Su
rviv
al
Fra
cti
on
44
![Page 59: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/59.jpg)
3.4.1. Medulloblastoma cells tolerate physiological doses of lithium
First, we estimated whether MB cells tolerate physiological dose of lithium (1-2mM) and also
the cytotoxic dose. Clonogenic assays were performed and survival curves were generated for
the ONS76 TP53 wild-type and UW228 TP53 mutant cells with lithium doses between 0.1 and
10 mM.
Our results indicate that 24 hour exposure to lithium does not result in the different toxicity in
MB cells with respect to their TP53 status; both TP53 wild-type and TP53 mutant cells were
responding to increasing doses of lithium in a similar pattern. We observed that in both ONS76
and UW228 24 hour treatment with 2mM of lithium does not cause marked cytotoxicity
compared to non-treated samples 100% ± 17% vs. 130% ± 30% (p=0.1) for ONS76 and 100% ±
44% vs. 130% ± 44% (p=0.35) for UW228, respectively. Up to 50% decreased colony
formation was observed at 10mM in both cell lines.
A concentration of 2mM was chosen as optimal to further investigate lithium as a radiosensitizer
in combination treatment, because it does not produce additional cell death. In addition 2mM, is
at the high end of the tolerable dose used in clinical practice without inflicting major toxicity.
3.4.2. Lithium radiosensitized medulloblastoma cells
To examine the effects of lithium on the radiosensitivity of MB cells, we performed clonogenic
assays using ONS76 and UW228 cell lines. In this combination protocol after 24 hours of
lithium treatment, cells were irradiated and colony forming efficiency was determined 14 days
later. Pre-treatment with lithium resulted in increased radiation sensitivity in both wild-type and
mutant TP53 cell lines (p<0.01) (Figure 3.4.1.A&B).
Survival fraction for lithium treated cells at 2 Gy (SF2) was calculated for ONS76 and UW228
cell lines as 33.5% ±3.5% and 43.5% ±1.5% respectively, which was significantly different
from untreated samples, 55.1% ±6.5% and 56.6% ±3% respectively (p<0.01) with 21.6%
decrease in survival for TP53 wild-type cells and 13.1% for TP53 mutant cells (Figure
3.4.1.C&E). The difference in survival was consistent at higher doses of radiation, 6 Gy (SF6),
as well: 1.7% +/-0.3% and 3.9% +/- 0.8% for lithium treated cells compared to 10% +/- 2% and
8.9% +/- 0.7% in untreated controls for ONS76 and UW228, respectively (Figure 3.4.1.D&F)
with an 8.3% decrease in survival for ONS76 and 5% for UW228.
45
![Page 60: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/60.jpg)
ONS76 Lithium
ONS76 No Lithium
ONS76 Lithium
Surv
ival
Fra
ctio
n, 2
Gy
Surv
ival
Fra
ctio
n, 6
Gy
** *
ONS76 No Lithium
Surv
ival
Fra
ctio
n, 2
Gy
UW228 No Lithium
UW228 Lithium
Surv
ival
Fra
ctio
n, 6
Gy
UW228 No Lithium
UW228 Lithium
**
C D E F
B A
Figure 3.4.1. Lithium radiosensitizes both TP53wt and TP53mut medulloblastoma cells. Treatment with Lithium sensitizes MB cells to radiation (**p<0.01). Survival curves for ONS76 TP53wt (A) and UW228 TP53mut (B) cells given increasing radiation doses following 24 hr of treatment with Lithium (red circles) and untreated control (blue circles). Bar graph of ONS76 (C) and UW228 (E) cells showing the quantification of the surviving fraction of Lithium treated (red) and untreated (blue) cells following 2Gy irradiation; 21% for ONS76 (*p<0.05) and 13.1% for UW228 decrease in survival (**p<0.01). Bar graph of ONS76 (D) and UW228 (F) cells showing the quantification of the surviving fraction following higher radiation dose (6Gy); 8.3% for ONS76 (**p<0.01) and 5% for UW228 decrease in survival (**p<0.01).
**
46
![Page 61: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/61.jpg)
Treatment with lithium resulted in sensitizer enhancement ratios of 1.5 for ONS76 and 1.3 for
UW228 at a surviving fraction of 0.10.
In order to evaluate the role of lithium in the activation of WNT/β-catenin signaling and
determine whether Lithium exerts its radiosensetisation effects through activation of this
pathway we performed a series of functional assays.
3.4.3. Lithium phosphorylates GSK3β on Ser9
We analysed protein expression by western blotting to determine whether treatment with lithium
resulted in phosphorylation of GSK3β on Ser9 and therefore inhibition of GSK3β as described in
the literature [119]. Indeed we observed phosphorylation of GSK3β by lithium. Interestingly, we
were not able to demonstrate Ser9 phosphorylation of GSK3β with a 2 Gy dose of radiation
(Figure 3.4.2.).
3.4.4. Lithium results in nuclear translocation of β-catenin
To confirm activation of WNT signalling by lithium treatment we performed
immunofluorescence microscopy to assess nuclear translocation of β-catenin (which is a sign of
WNT activation). After 24 hour pre-treatment of both TP53 wild-type (ONS76) and TP53
mutant (UW228) cells with lithium we observed translocation of β-catenin to the nucleus.
Interestingly, TP53 mutant cells demonstrated a significantly greater increase in translocation of
β-catenin to the nucleus than TP53 wild-type cells (Figure 3.4.3.A&B).
3.4.5. Lithium constitutively activates canonical WNT signaling
In order to assess whether treatment with lithium results in activation of WNT signalling through
β-catenin activation we examined the transcriptional activation of β-catenin downstream
signalling by performing a dual luciferase reporter assay using the Super 8x TOPFlash / Super
8x FOPFlash β-catenin reporter system. TP53 wild-type ONS76 and TP53 mutant UW228 cells
were transfected with Super 8x TOPFlash β-catenin reporter plasmid. Transfection with Super
8x FOPFlash bearing mutant TCF/LEF, unable to activate luciferase transcription, was used to
control for transfection effect. After normalization for transfection with Renilla luciferase both
TP53 wild-type and mutant cells transfected with Super 8x TOPFlash reporter gene
47
![Page 62: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/62.jpg)
Figure 3.4.2. Lithium phosphorylates GSK3β on Ser9. Western blot protein analysis; marked increase of the amount of the phospo-Ser9-GSK3β protein after treatment with Lithium comparing to untreated control, irradiation along does not result in increase in the amount of phospho-GSK3β protein. Neither treatment with Lithium nor irradiation affects quantities of the total GSK3β protein. Loading control: β-actin.
48
![Page 63: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/63.jpg)
Figure 3.4.3. Treatment with Lithium results in nuclear translocation of β-catenin in both TP53 wt and TP53 mut cells. (A) Immunofluorescent imaging of the nuclear translocation of β-catenin (green), nucleus (DAPI-red), co-localization (yellow) following 24 hr exposure to Lithium. (B) Bar graph showing percentage of cell positive for nuclear β-catenin (n=1).
49
![Page 64: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/64.jpg)
demonstrated activation of β-catenin-TCF/LEF transcription upon treatment with lithium
compared to cells transfected with mutant TCF/LEF control plasmid. TP53 wild-type cells
demonstrated 144-fold increase in luciferase activity (p<0.01). At the same time, lithium
treatment resulted in only 43-fold increase of luciferase activity in TP53 mutant cells (p<0.01)
(Figure 3.4.4.A&B).
Each experiment was performed 3 times. Since data from one experiment contained a high
proportion of outliers (likely resulting from poor transfection efficiency) these values were
excluded from the analysis. Subsequent analysis was performed on pooled data containing 6-9
technical replicates.
In summary, we were able to confirm that treatment with lithium phosphorylates GSK3β on
Ser9, which is consistent with what is described in literature. This is accompanied by nuclear
translocation of β-catenin and activation of transcription. Taken together these findings support
the premise that lithium acts through activation of WNT/β-catenin signalling.
3.5. Lithium does not sensitize normal neuronal stem cells to radiation
To address potential detrimental effects of lithium as a radiosensitizer on normal developing
brain tissue we used normal neuronal stem cells (NNSC) as a model to study cell survival and
DNA damage / repair response in treated and non-treated cells.
3.5.1. Lithium does not decrease survival of normal neuronal stem cells
Hf5205 NNSC are not able to form well defined colonies due to their extreme proliferative and
migratory capabilities. Therefore, to investigate the radiosensitizing effect of lithium on NNSC
we performed a cell survival assay as described above. In the combination protocol, cells were
pre-treated with 2mM of lithium for 24 hours, irradiated, and then cell number was counted and
survival curves generated 5 days after radiation exposure. Interestingly, pre-treatment with
lithium did not result in decreased survival or proliferation of NNSC compared to the untreated
control. On the contrary, pre-treated cells demonstrated slight, though not statistically significant
(p=0.15), survival advantage over their untreated counterparts (Figure 3.5.1.A). Survival
fraction at 2 Gy was calculated for both treated and untreated cells: 33% +/- 8% vs. 27% +/- 3%,
respectively. The observed difference did not quite reach statistical significance (p=0.0465). We
50
![Page 65: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/65.jpg)
also examined cell survival at high radiation doses and observed that the survival fraction at 8
Gy was 1.9% +/- 6.1% vs. 1.4% +/- 3.4% (p=0.064).
3.5.2. Normal neuronal stem cells treated with lithium do not demonstrate nuclear
translocation of β-catenin
To investigate whether lithium is able to activate canonical WNT signalling in NNSC we
performed immunofluorescent microscopy to assess nuclear translocation of β-catenin.
Surprisingly, our preliminary data demonstrates that in both pre-treated and untreated samples
β-catenin is located in the cytoplasm and not the nucleus (Figure 3.5.1.B).
51
![Page 66: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/66.jpg)
ONS76 No Lithium
ONS76 Lithium
UW228 No Lithium
UW222 Lithium
Fold
Indu
ctio
n
Fold
Indu
ctio
n
Figure 3.4.4. Lithium activates WNT/β-catenin transcriptional activity. Increase in luciferase activity (pTA-Luc/Super8xTOPFlash) over control (pGL3/Super8xFOPFlash) in both ONS76 TP53wt (A) and UW228 TP53mut (B) cells in response to treatment with Lithium (red); untreated cells have minimal endogenous WNT/β-catenin signalling (blue) (**p<0.01).
52
![Page 67: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/67.jpg)
Figure 3.5.1. Treatment with Lithium does not radiosensitizeNNSC. (A) Survival curves for Hf5205 normal neuronal stem cells
given increasing radiation doses following 24 hr of pre-treatment
with Lithium (red circles) and untreated control (blue circles)
(p=0.054). (B) Immunofluorescent imaging of Hf5205 cells;
absence of the nuclear translocation of β-catenin (green), nucleus
(DAPI-red), is observed in both control cells and following 24 hr
exposure to Lithium.
53
![Page 68: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/68.jpg)
CHAPTER 4: DISCUSSION
4.1. TP53 mutations are predictive of inferior survival in SHH, but not WNT
medulloblastomas
Medulloblastoma are the most common brain tumour in children. Although currently
medulloblastoma is considered one of the most curable malignant brain tumours and a prototype
of success in paediatric neurooncology, disease related mortality still ranges between 20 – 40%
depending on the clinical risk group at diagnosis. Although addition of radiation and adjuvant
high-dose chemotherapy can cure the majority of patients, they also result in devastating long-
term side effects and morbidity. Exposure to radiation can result in skeletal growth retardation,
pan-endocrine deficiencies, cognitive impairment with progressive decline in intellectual
function, psychiatric disorders and neurological deficits. In addition, high-dose chemotherapy
can impact cardiac function and fertility. With recent increased understanding of the genetics
and genomics of medulloblastoma, numerous attempts have been made to improve risk group
stratification and allow for a more personalized approach for treatment of these patients with the
hope to decrease the intensity of therapies, in particular radiation dose, in prognostically
favorable groups and improve survival in high risk patients.
International collaborations have resulted in novel subgroup classification of medulloblastoma
and the potential for targeted therapies for patients with specific molecular subgroups. WNT
signature tumours are recognized as a clinically favorable subgroup [34, 49]. However, even
with implementation of molecular profiling prognostication is still challenging for the SHH,
Group 3 and Group 4 patients, because the expression signature does not allow for survival
prediction [3]. There is a clear need for reliable, easy-to-use markers to predict survival and risk
stratification in the field of medulloblastoma. In addition, there is a lack of target specific
treatment options for known pathway driven tumours.
In this thesis we propose a novel approach to risk stratification of medulloblastoma patients
using a combination of molecular profiling with TP53 status. We also explore lithium as a
potential novel targeted therapeutic agent to improve survival in high-risk medulloblastoma
patients and possibly decrease radiation dose in the favorable subgroup.
54
![Page 69: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/69.jpg)
In this study examining correlation of OS and PFS outcome with subgroup and TP53 status in
139 primary medulloblastoma patients older than 3 years of age we have demonstrated that
presence of somatic TP53 mutation remains a strong predictor of inferior survival which is
consistent with previous reports [59-60]. Importantly, OS and PFS with respect to TP53 status
are dramatically different between WNT and SHH subgroups. In the WNT subgroup, TP53
mutation seems not to be a predictor of poor survival or risk of relapse; those patients
demonstrate superior survival regardless of TP53 status, comparing to all other subgroups. In
the SHH subgroup, in contrast, patients with TP53 mutations have significantly worse survival
compared to their TP53 wild-type counterparts; in addition, TP53 mutant patients are also more
likely to experience relapse. In fact, all our TP53 mutant SHH patients relapsed within 8 years
from diagnosis. We have validated our findings using an independent cohort comprised of the
medulloblastoma patients from different countries who received radiation therapy. In the
validation cohort we demonstrated OS survival outcomes similar to our initial observations for
patients in the WNT and SHH subgroups, with TP53 mutations resulting in marked decreased
survival in SHH subgroup and no significant negative effect in the WNT subgroup. Although the
validation cohort was collected over a long time span and was comprised from patients who
were treated on different protocols, the validation set still demonstrates similar findings to our
discovery cohort and allows us to suggest that there is lack of inherent bias and combination of
molecular group and TP53 status can be confidently used as a predictor of survival. Further
support to our findings is available by a recent independent study of whole genome sequencing
by Robinson and colleagues, who demonstrated that in a cohort of 14 SHH patients 3 deaths
occurred and these were exclusively in TP53 mutant patients [141]. Considering that the
outcome of TP53 mutant patients largely depends on the molecular subgroup in one hand and
the outcome of specific MB subgroups is significantly modulated by presence or absence of a
TP53 mutation on the other, we propose the following decision-making model for newly
diagnosed medulloblastoma patients (Figure 4.1.). In this model we propose upfront testing of
all patients for either TP53 mutation or to determine the molecular subgroup. In patients who
have wild-type TP53 no subsequent action will be needed and those patients will proceed to the
local standard-of-care protocols. Similarly if WNT, Group 3 or Group 4 is observed, those
patients will not require additional TP53 status determined. It will be increasingly important to
identify the combination of TP53 mutation with the SHH subgroup, as these patients have the
worst outcome and should be upgraded to high risk regardless of presence or absence of other
55
![Page 70: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/70.jpg)
Figure 4.1. Clinicopathological flow chard for decision makingin newly diagnosed MB patients. For accurate risk stratification it
is imperative to be able to either determine TP53 status or molecular
group of the MB patient. Presence of TP53 mutation warrants
subsequent molecular group assignment to identify SHH/TP53
mutation combination in order to upgrade patients too high risk
subgroup and offer the appropriate therapy; similarly, all SHH
patients have to be tested for TP53 mutation.
56
![Page 71: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/71.jpg)
high-risk criteria. Intensification of the therapy should be considered in this subgroup including
targeted therapy and SHH pathway inhibitors.
Although we were not able to observe any segregation by the type or domain localisation of
TP53 mutations according to subgroups, the high rate of LOH along with presence of deletions
and insertions in SHH tumours, but not WNT tumours, suggestive of higher genomic instability.
This is further supported by the finding that these tumours have high rate of chromosomal
shattering termed chromothripsis [142]. Together, these findings may provide plausible
explanation for poor survival in SHH/TP53 mutant patients.
4.2. TP53 mutations in medulloblastomas confer resistance to radiation while activation of
canonical WNT signaling radiosensitizes medulloblastoma cells.
Although the implication of TP53 mutations on cellular resistance to radiation and radiation
response in normal and cancer cells has been well-described in literature; the association of
TP53 mutations with resistance to radiation in medulloblastoma in particular has not been
addressed. In this study, using a heterogeneous panel of medulloblastoma cell lines, we have
demonstrated that TP53 mutant medulloblastomas are more resistant to radiation. We further
confirmed our results using an isogenic in vitro model, transfecting TP53 wild-type cells with a
known dominant-negative mutation. These findings are in agreement with previously published
data on other cancers, as discussed above.
Interestingly, introduction of a CTNNB1 activating mutation into medulloblastoma cells resulted
in sensitization of those cells to radiation, which contradicts published data of other cancers for
which there is an association between WNT signaling activation and increased resistance to
radiation [109-114]. Notably, all published reports on the association of radiation resistance with
either presence of CTNNB1 mutations or other pathway alterations, such as APC mutations, as
well as chemical inhibition of GSK3β, has been addressed in cancers other than
medulloblastoma.
Our finding that introduction of CTNNB1 mutations cause radiosensitivity in medulloblastoma
cells is in concordance with clinical observations that WNT subgroup patients, characterized by
the presence of CTNNB1 mutations, routinely treated with radiation, demonstrate superior
57
![Page 72: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/72.jpg)
survival [3, 21]. This has major implications on future protocols which may try to reduce/omit
radiation for patients with WNT medulloblastomas.
We further demonstrated that sensitization of medulloblastoma cells to radiation can be
achieved with administration of a clinically tolerable dose of lithium prior to radiation exposure.
In vitro experiments have shown that sensitization of both TP53 wild-type and TP53 mutant
medulloblastoma cells to radiation can be successfully achieved with 24 hours exposure to 2mM
of lithium. Decreased survival associated with treatment of medulloblastoma cells with lithium
was accompanied by inhibitory phosphorylation of GSK3β, nuclear translocation of β-catenin
and transcriptional activation of β-catenin TCF/LEF mediated signaling which are the hallmarks
of the WNT pathway activation. These findings are strongly suggestive of involvement of
WNT/β-catenin signaling in radiation response in medulloblastoma.
The fact that TP53 wild-type cells demonstrated greater decrease in clonogenic survival,
compared to TP53 mutant cells, supports the previously described model in which increased
levels of β-catenin stimulate accumulation of transcriptionally active p53 and provide negative
regulation for β-catenin. It is speculated that negative regulation of β-catenin by p53 is
accomplished via its GSK3β-mediated proteosomal degradation [128-129] (Figure 4.2.). We
think that presence of CTNNB1 mutation prevents GSK3β from executing its role in regulation
of β-catenin levels, which in turns results in diversion of the damaged cell to the death pathway
by stable p53. In cells treated with lithium, inhibition of GSK3β is achieved chemically, but
results in the same outcome.
Importantly, the fact that lithium sensitizes both TP53 wild-type and TP53 mutant cells to
radiation suggests that lithium may act through other p53-independent mechanisms yet to be
determined, and possibly through GSK3β. For example, decrease of tumour size in low grade
neuroendocrine tumours was achieved with lithium treatment and was associated with
previously described GSK3β inhibition [143]. Lithium was also described to decrease glioma
cell invasion through GSK3β inhibition [122]. The effect of other small metal molecules on
chromatin remodeling and reconstitution of wild-type configuration of mutant p53 protein have
recently been described [144-146]. These findings, together with recognition that lithium is
biologically necessary for healthy embryonal development and both physical and mental
functioning of mammals including humans [147] provide plausible grounds to examine role of
lithium in chromatin remodeling and/or reconstitution of wild-type p53 configuration as one of
58
![Page 73: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/73.jpg)
Figure 4.2. Relationship between β-catenin and p53 levels . Regulation
of β-catenin levels via GSK3β mediated negative feedback loop. (Adapted
from Damalas et.al. EMBO J 1999 & Sadot et.al. Mol Cell Biol 2001).
59
![Page 74: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/74.jpg)
the possible mechanisms of radiosensetisation. Understanding of the mechanisms behind lithium
radiosensetisation in medulloblastoma cells may also provide valuable insights into the
mechanisms behind favorable survival in WNT medulloblastomas and the basis for development
of novel therapeutics.
In addition, combination of lithium with small-molecule inhibitors of SHH pathway in SHH
subtype medulloblastomas may represent an attractive possibility of combine treatment where
the pathway is attacked from two different sides – inhibition of SHH pathway and enhancement
of WNT signalling.
The objective of any combination treatment is to achieve improvement in therapeutic outcomes
and minimize normal tissue damage; thus, no therapeutic improvement will be gained if a
proposed agent sensitizes both cancer and normal cells to radiation equally. Our preliminary
results from NNSC experiments demonstrate that lithium does not activate WNT signaling in
normal neuronal stem cells, nor does it sensitize them to radiation. Moreover, we were able to
observe marginal improvement in cell survival in lithium treated NNSC which is in agreement
with published reports demonstrating protective capacity of lithium against radiation in mouse
models [124-125]. To date we were not been able to demonstrate nuclear translocation of β-
catenin in response to lithium in NNSC; however these experiments require further development
and completion. The difference in response to lithium in normal and cancer tissues suggests that
it may act through different pathways. Alternatively, normal cells have strong tumour
suppressive mechanisms, including, but not limited to functional TP53, which are altered in
cancer cells. These pathways and mechanisms need to be investigated in further studies.
60
![Page 75: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/75.jpg)
CHAPTER 5: CONCLUSIONS
This study highlights how multicenter collaborative efforts can resolve discrepancies between
clinical reports on uncommon events in paediatric cancer, such as determining the role of TP53
mutations on survival in medulloblastomas.
In this study, we first demonstrated that successful combination of genetic and genomic
approaches in cancer can improve risk stratification in medulloblastoma patients. We were able
to demonstrate that although somatic TP53 mutations remain a prognostically unfavorable
marker, their effect is largely modulated by molecular subgroup and ranges from insignificant in
WNT to highly lethal in SHH driven tumours. We were able to identify a novel prognostically
unfavorable subgroup of medulloblastoma patients, namely SHH/TP53 mutant patients.
Moreover, we suggest a new clinicopathological approach for risk stratification of newly
diagnosed medulloblastoma patients which involves combination of testing for TP53 and
molecular group assignment.
Furthermore, we were able to replicate our clinical observation that WNT patients have
improved survival using an in vitro model and demonstrate that association of decreased tumour
survival with activation of WNT/β-catenin signaling is confirmed in our cell model. Our
findings of lithium significantly decreasing clonogenic capacity in both TP53 wild-type and
TP53 mutant medulloblastoma cell lines coupled with both lack of radiosensetisation in NNSC
and its known neuroprotective capacity suggests that lithium may be a safe and clinically
effective drug to use. We recognize that despite being safely used in humans for treatment of
psychiatric disorders, lithium needs further pre-clinical evaluation prior to administration to
humans for the purpose of medulloblastoma treatment. Indeed, a phase 1 trial of radiation
concomitant with lithium for children with medulloblastoma is currently planned based on our
observations.
61
![Page 76: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/76.jpg)
CHAPTER 6: FUTURE DIRECTIONS
Based on our findings further studies are required to investigate the biological mechanisms that
explain favorable survival of WNT subgroup patients and lithium radiosensitizing capacity.
1) How does activation of WNT/β-catenin signalling offer a survival advantage?
It is important to assess how activation of WNT/β-catenin signaling via presence of CTNNB1
mutation translates to decreased cell survival under conditions of radiation treatment.
Construction of a stable conditionally expressing mutant CTNNB1 protein cell line with TP53
wild-type and TP53 mutant background will allow performing a range of functional experiments
to investigate possible effects of mutation on cell cycle, DNA damage response and interaction
with other proteins including p53. Expression arrays comparing isogenic wild-type and
genetically engineered CTNNB1 mutant cell lines could identify altered pathways involved in
radiation response of WNT tumours.
2) Determining of mechanism of lithium action
As discussed above, the mechanism of lithium action is not completely understood. There are
several studies describing lithium as a GSK3β inhibitor [117, 120, 122]; however, the
downstream effects of this inhibition are not well known. It will be valuable to determine the
pathway involved in lithium mediated effects on cell survival which involve and do not involve
GSK3β. Expression arrays comparing lithium-treated and untreated medulloblastoma cells will
be an efficient and useful means to determine pathways involved in lithium action in
comprehensive and time-efficient manner. Alternatively, systematic knockdown of members of
the known WNT signaling pathway, together with some members of the other pathways, such as
p53 pathway, using siRNA can be used to investigate the role of each member of the pathway
with relation to lithium treatment and combination exposure to lithium and radiation therapy.
One of the most significant biological effects of radiation therapy is induction of DNA DSBs.
Unrepaired DNA DSBs can lead to cell death or chromosomal aberrations subsequently
incompatible with cell survival. A vast body of literature strongly correlate persistence of
unrepaired DNA DSBs with radiosensetisation of cancer cells [148-149]. To provide insight into
mechanism by which lithium may contribute to sensitization of medulloblastoma cells to
radiation we performed a series of DNA DSBs/repair immunofluorescence assays (Appendix A
62
![Page 77: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/77.jpg)
for Materials & Methods) which demonstrated a correlation of increased number of γH2AX foci
with lithium exposure prior to radiation. Our preliminary data has demonstrated that lithium
treatment combined with radiation results in increase DNA damage and decrease in DNA repair,
as assessed by development and persistence of γH2AX foci, in both TP53 wild-type and TP53
mutant medulloblastoma cells suggesting that lithium may be involved in modulation of the
DNA damage/repair pathway. Here we demonstrated that treatment with lithium alone did not
result in significant change in the number of foci compared to untreated samples in both TP53
wild-type and TP53 mutant cells. Importantly, in both TP53 mutant and TP53 wild-type cells we
observed a marked increase in the formation of γH2AX foci in samples pre-treated with lithium
(p<0.001) and presence of persistent residual foci beyond 24 hours post-radiation (Figure
6.1.A&B). Interestingly, we did not observe neither complete nor approaching baseline
resolution of γH2AX foci by 24 hours in any cell lines.
Surprisingly, treatment of NNSCs with lithium did not result in a significant difference in the
number of foci between pre-treated and non-treated cells (p=0.68). In addition, NNSC
demonstrated a classical pattern of formation and resolution of γH2AX foci as described in
literature with a rapid peak in foci shortly after radiation and close to complete resolution to the
baseline at 24 hours in both lithium-treated and untreated samples (Figure 6.1.C).
Our experiments allow us to suggest that in the cancer cell, lithium, in combination with
radiation, both enhances DNA damage and significantly hinder the ability of the cell to process
DNA DSBs, resulting in accumulation of intolerable DNA damage and subsequent cell death.
Presence of the residual γH2AX foci in lithium treated cells beyond 24 hours post radiation is
suggestive of impaired non-homologous end-joining (NHEJ) mechanism inflicted by lithium
[150-152]. The fact that lithium increases the number of γH2AX foci in both TP53 wild-type and
mutant cells supports the suggestion that it acts at least partially independent of the TP53
pathway.
Striking differences which we have observed in response to combined lithium and radiation
treatment between medulloblastoma and NNSC cells are intriguing and warrant further
investigation. The comet assay will be useful to confirm our findings with respect to the increase
in DNA DSBs and to assess the kinetics of DNA damage repair. A role for ATM and MRN
complex as targets for radiosensetisation therapy was recently described [153], as they play
pivotal roles in the DNA damage/repair response to radiation. Thus, it will be important to
63
![Page 78: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/78.jpg)
investigate the other members of DNA damage/repair pathway, such as ATM, Rad50, Mre11,
NBS1 and checkpoint proteins employing functional studies. In addition, to elucidate
mechanisms of radiosensetisation through lithium we plan to study whether lithium has an effect
on cell cycle and apoptosis in medulloblastoma and NNSC. Annexin apoptosis assay and cell
cycle analysis using flow cytometry will be valuable techniques to address these questions.
64
![Page 79: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/79.jpg)
Figure 6.1.A. Treatment with lithium increases number of γH2AX foci inTP53 wild-type MB cells. (A) Bar graph – quantification of the number of γH2AX
foci expressed per nucleus at 30 min, 4 and 24 hr after radiation compared to
non-treated control and cells treated only with lithium (**p<0.0001). (B)
Immunofluorescence of ONS76 TP53wt cells at 30 min, 4 and 24 hr after
exposure to 5 Gy single dose of radiation. Untreated control (top panel) has
significantly less γH2AX foci per cell compared to cells pre-treated for 24 hr with
lithium (bottom panel). Nucleus – DAPI-blue, γH2AX foci - green.
A
B
65
![Page 80: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/80.jpg)
A
B
Figure 6.1.B. Treatment with lithium increases number of γH2AX foci inTP53 mutant MB cells. (A) Bar graph – quantification of the number of γH2AX
foci expressed per nucleus at 30 min, 4 and 24 hr after radiation compared to
non-treated control and cells treated only with lithium (**p<0.0001).
(B) Immunofluorescence of UW228 TP53mut cells at 30 min, 4 and 24 hr after
exposure to 5 Gy single dose of radiation. Untreated control (top panel) has
significantly less γH2AX foci per cell compared to cells pre-treated for 24 hr
with lithium (bottom panel). Nucleus – DAPI-blue, γH2AX foci - green.
66
![Page 81: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/81.jpg)
Figure 6.1.C. Treatment with lithium does not increases number of
γH2AX foci in NNSC. (A) Bar graph – quantification of the number of γH2AX
foci expressed per nucleus at 30 min (p=0.53), 4 hr (p=0.84) and 24 hr
(p=0.48) after radiation compared to non-treated control and cells treated only
with lithium. (B) Immunofluorescence of Hf5205 cells at 30 min, 4 and 24 hr
after exposure to 5 Gy single dose of radiation. Both untreated control (top
panel) and cells pre-treated for 24 hr with lithium (bottom panel) have similar
number of γH2AX foci per nucleus. Nucleus – DAPI-blue, γH2AX foci -
green.
A
B
67
![Page 82: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/82.jpg)
APPENDIX A
Phospho-histone H2AX (γH2AX) foci immunofluorescent microscopy and imaging
Medulloblastoma and NNSC were cells were cultured on cover slips in 6-well dishes and fixed
as described above.
Primary antibodies: mouse anti-phospho-histone-H2AX (Ser139) (Millipore, 05-636) 1:800.
Secondary antibodies: Alexa Fluor 488 donkey-anti-mouse IgG (Invitrogen, A21202) 1:500.
For phospho-histone H2AX (γH2AX) foci formation, cells were pre-treated with 2mM lithium
Chloride for 24 hr and then exposed to 5 Gy single dose of radiation. Untreated and non-
irradiated cells were used as control. Specimens were collected at 30 min, 4 hr and 4 hr post
radiation. At appropriate time points, cells were fixed and processed as described above.
For quantification of γH2AX foci 3 independent experiments were performed. Between 100 and
250 nuclei were examined and foci were counted using Perkin Elmer Velocity 6.0.1 software
(Perkin Elmer, USA) with 0.2um cut off for foci size. The following procedure was applied to
decrease inter-experimental variability: 1) all 3 experiments were pooled together and individual
values were used for analysis [154]; 2) average number of foci per nucleus was calculated; 3)
outliers, which were estimated as nuclei containing > 2 standard deviation (2 SD) from the
average for the treatment subgroup, were eliminated; 4) baseline number of foci per nucleus was
estimated in the untreated sample as average plus 2 SD; 5) to remove background noise nuclei
with baseline or less number of foci were eliminated from experimental samples and the
remaining nuclei were considered γH2AX-positive for further calculations; 6) number of foci in
γH2AX-positive nuclei was calculated and expressed as an average number of foci per nuclei; 7)
comparison was done between treatments using average number of foci per nucleus and number
of γH2AX-positive cells as defined above.
68
![Page 83: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/83.jpg)
CITATIONS:
1. Packer, R.J. and G. Vezina, Management of and prognosis with medulloblastoma:
therapy at a crossroads. Arch Neurol, 2008. 65(11): p. 1419-24.
2. MacDonald, T.J., et al., Advances in the diagnosis, molecular genetics, and treatment of
pediatric embryonal CNS tumours. Oncologist, 2003. 8(2): p. 174-86.
3. Kool, M., et al., Molecular subgroups of medulloblastoma: an international meta-
analysis of transcriptome, genetic aberrations, and clinical data of WNT, SHH, Group 3,
and Group 4 medulloblastomas. Acta Neuropathol, 2012. 123(4): p. 473-84.
4. Pomeroy, S.L., et al., Prediction of central nervous system embryonal tumour outcome
based on gene expression. Nature, 2002. 415(6870): p. 436-42.
5. Pfister, S., C. Hartmann, and A. Korshunov, Histology and molecular pathology of
pediatric brain tumours. J Child Neurol, 2009. 24(11): p. 1375-86.
6. Packer, R.J., et al., Medulloblastoma: clinical and biologic aspects. Neuro Oncol, 1999.
1(3): p. 232-50.
7. Rutkowski, S., et al., Treatment of early childhood medulloblastoma by postoperative
chemotherapy alone. N Engl J Med, 2005. 352(10): p. 978-86.
8. Eberhart, C.G., et al., Histopathological and molecular prognostic markers in
medulloblastoma: c-myc, N-myc, TrkC, and anaplasia. J Neuropathol Exp Neurol, 2004.
63(5): p. 441-9.
9. Habrand, J.L. and R. De Crevoisier, Radiation therapy in the management of childhood
brain tumours. Childs Nerv Syst, 2001. 17(3): p. 121-33.
10. Powell, S.N., T.J. McMillan, and G.G. Steel, In vitro radiosensitivity of human
medulloblastoma cell lines. J Neurooncol, 1993. 15(1): p. 91-2.
11. Jenkin, R.D., Medulloblastoma in childhood: radiation therapy. Can Med Assoc J, 1969.
100(2): p. 51-3.
69
![Page 84: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/84.jpg)
12. Packer, R.J., Childhood medulloblastoma: progress and future challenges. Brain Dev,
1999. 21(2): p. 75-81.
13. Jenkin, D., The radiation treatment of medulloblastoma. J Neurooncol, 1996. 29(1): p.
45-54.
14. Liu, Y., et al., Radiation treatment for medulloblastoma: a review of 64 cases at a single
institute. Jpn J Clin Oncol, 2005. 35(3): p. 111-5.
15. Deutsch, M., et al., Results of a prospective randomized trial comparing standard dose
neuraxis irradiation (3,600 cGy/20) with reduced neuraxis irradiation (2,340 cGy/13) in
patients with low-stage medulloblastoma. A Combined Children's Cancer Group-
Pediatric Oncology Group Study. Pediatr Neurosurg, 1996. 24(4): p. 167-176;
discussion 176-7.
16. Thomas, P.R., et al., Low-stage medulloblastoma: final analysis of trial comparing
standard-dose with reduced-dose neuraxis irradiation. J Clin Oncol, 2000. 18(16): p.
3004-11.
17. Packer, R.J., et al., Outcome for children with medulloblastoma treated with radiation
and cisplatin, CCNU, and vincristine chemotherapy. J Neurosurg, 1994. 81(5): p. 690-8.
18. Rood, B.R., T.J. Macdonald, and R.J. Packer, Current treatment of medulloblastoma:
recent advances and future challenges. Semin Oncol, 2004. 31(5): p. 666-75.
19. Jakacki, R.I., et al., Outcome of Children With Metastatic Medulloblastoma Treated
With Carboplatin During Craniospinal Radiotherapy: A Children's Oncology Group
Phase I/II Study. J Clin Oncol, 2012. 30(21): p. 2648-53.
20. Packer, R.J., et al., Phase III study of craniospinal radiation therapy followed by
adjuvant chemotherapy for newly diagnosed average-risk medulloblastoma. J Clin
Oncol, 2006. 24(25): p. 4202-8.
21. Gajjar, A., et al., Risk-adapted craniospinal radiotherapy followed by high-dose
chemotherapy and stem-cell rescue in children with newly diagnosed medulloblastoma
70
![Page 85: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/85.jpg)
(St Jude Medulloblastoma-96): long-term results from a prospective, multicentre trial.
Lancet Oncol, 2006. 7(10): p. 813-20.
22. Geyer, J.R., et al., Multiagent chemotherapy and deferred radiotherapy in infants with
malignant brain tumours: a report from the Children's Cancer Group. J Clin Oncol,
2005. 23(30): p. 7621-31.
23. Duffner, P.K., et al., Postoperative chemotherapy and delayed radiation in children less
than three years of age with malignant brain tumours. N Engl J Med, 1993. 328(24): p.
1725-31.
24. Thorarinsdottir, H.K., et al., Outcome for children <4 years of age with malignant
central nervous system tumours treated with high-dose chemotherapy and autologous
stem cell rescue. Pediatr Blood Cancer, 2007. 48(3): p. 278-84.
25. Hamilton, S.R., et al., The molecular basis of Turcot's syndrome. N Engl J Med, 1995.
332(13): p. 839-47.
26. Raffel, C., et al., Sporadic medulloblastomas contain PTCH mutations. Cancer Res,
1997. 57(5): p. 842-5.
27. Gorlin, R.J., Nevoid basal cell carcinoma (Gorlin) syndrome. Genet Med, 2004. 6(6): p.
530-9.
28. Grotzer, M.A., et al., TrkC expression predicts good clinical outcome in primitive
neuroectodermal brain tumours. J Clin Oncol, 2000. 18(5): p. 1027-35.
29. Segal, R.A., et al., Expression of the neurotrophin receptor TrkC is linked to a favorable
outcome in medulloblastoma. Proc Natl Acad Sci U S A, 1994. 91(26): p. 12867-71.
30. Gilbertson, R.J., et al., Prognostic significance of the c-erbB-2 oncogene product in
childhood medulloblastoma. Br J Cancer, 1995. 71(3): p. 473-7.
31. Gilbertson, R.J., et al., Prognostic significance of HER2 and HER4 coexpression in
childhood medulloblastoma. Cancer Res, 1997. 57(15): p. 3272-80.
71
![Page 86: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/86.jpg)
32. Grotzer, M.A., et al., MYC messenger RNA expression predicts survival outcome in
childhood primitive neuroectodermal tumour/medulloblastoma. Clin Cancer Res, 2001.
7(8): p. 2425-33.
33. Aldosari, N., et al., MYCC and MYCN oncogene amplification in medulloblastoma. A
fluorescence in situ hybridization study on paraffin sections from the Children's
Oncology Group. Arch Pathol Lab Med, 2002. 126(5): p. 540-4.
34. Northcott, P.A., et al., Medulloblastoma comprises four distinct molecular variants. J
Clin Oncol, 2011. 29(11): p. 1408-14.
35. Korshunov, A., et al., Biological and clinical heterogeneity of MYCN-amplified
medulloblastoma. Acta Neuropathol, 2012. 123(4): p. 515-27.
36. Biegel, J.A., et al., Prognostic significance of chromosome 17p deletions in childhood
primitive neuroectodermal tumours (medulloblastomas) of the central nervous system.
Clin Cancer Res, 1997. 3(3): p. 473-8.
37. Cogen, P.H., Prognostic significance of molecular genetic markers in childhood brain
tumours. Pediatr Neurosurg, 1991. 17(5): p. 245-50.
38. Batra, S.K., et al., Prognostic implications of chromosome 17p deletions in human
medulloblastomas. J Neurooncol, 1995. 24(1): p. 39-45.
39. Cogen, P.H., et al., Involvement of multiple chromosome 17p loci in medulloblastoma
tumourigenesis. Am J Hum Genet, 1992. 50(3): p. 584-9.
40. Cogen, P.H. and J.D. McDonald, Tumour suppressor genes and medulloblastoma. J
Neurooncol, 1996. 29(1): p. 103-12.
41. Rood, B.R., et al., Hypermethylation of HIC-1 and 17p allelic loss in medulloblastoma.
Cancer Res, 2002. 62(13): p. 3794-7.
42. Biegel, J.A., Cytogenetics and molecular genetics of childhood brain tumours. Neuro
Oncol, 1999. 1(2): p. 139-51.
72
![Page 87: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/87.jpg)
43. Thompson, M.C., et al., Genomics identifies medulloblastoma subgroups that are
enriched for specific genetic alterations. J Clin Oncol, 2006. 24(12): p. 1924-31.
44. Kool, M., et al., Integrated genomics identifies five medulloblastoma subtypes with
distinct genetic profiles, pathway signatures and clinicopathological features. PLoS
One, 2008. 3(8): p. e3088.
45. Fattet, S., et al., Beta-catenin status in paediatric medulloblastomas: correlation of
immunohistochemical expression with mutational status, genetic profiles, and clinical
characteristics. J Pathol, 2009. 218(1): p. 86-94.
46. Cho, Y.J., et al., Integrative genomic analysis of medulloblastoma identifies a molecular
subgroup that drives poor clinical outcome. J Clin Oncol, 2011. 29(11): p. 1424-30.
47. Remke, M., et al., Adult medulloblastoma comprises three major molecular variants. J
Clin Oncol, 2011. 29(19): p. 2717-23.
48. Al-Halabi, H., et al., Preponderance of sonic hedgehog pathway activation characterizes
adult medulloblastoma. Acta Neuropathol, 2011. 121(2): p. 229-39.
49. Taylor, M.D., et al., Molecular subgroups of medulloblastoma: the current consensus.
Acta Neuropathol, 2012. 123(4): p. 465-72.
50. Villani, A., D. Malkin, and U. Tabori, Syndromes predisposing to pediatric central
nervous system tumours: lessons learned and new promises. Curr Neurol Neurosci Rep,
2012. 12(2): p. 153-64.
51. Birch, J.M., et al., Relative frequency and morphology of cancers in carriers of germline
TP53 mutations. Oncogene, 2001. 20(34): p. 4621-8.
52. Ellison, D., Classifying the medulloblastoma: insights from morphology and molecular
genetics. Neuropathol Appl Neurobiol, 2002. 28(4): p. 257-82.
53. Adesina, A.M., J. Nalbantoglu, and W.K. Cavenee, p53 gene mutation and mdm2 gene
amplification are uncommon in medulloblastoma. Cancer Res, 1994. 54(21): p. 5649-51.
73
![Page 88: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/88.jpg)
54. Saylors, R.L., 3rd, et al., Infrequent p53 gene mutations in medulloblastomas. Cancer
Res, 1991. 51(17): p. 4721-3.
55. Orellana, C., et al., Pediatric brain tumours: loss of heterozygosity at 17p and TP53
gene mutations. Cancer Genet Cytogenet, 1998. 102(2): p. 93-9.
56. Wetmore, C., D.E. Eberhart, and T. Curran, Loss of p53 but not ARF accelerates
medulloblastoma in mice heterozygous for patched. Cancer Res, 2001. 61(2): p. 513-6.
57. Ray, A., et al., A clinicobiological model predicting survival in medulloblastoma. Clin
Cancer Res, 2004. 10(22): p. 7613-20.
58. Woodburn, R.T., et al., Intense p53 staining is a valuable prognostic indicator for poor
prognosis in medulloblastoma/central nervous system primitive neuroectodermal
tumours. J Neurooncol, 2001. 52(1): p. 57-62.
59. Tabori, U., et al., Universal poor survival in children with medulloblastoma harboring
somatic TP53 mutations. J Clin Oncol, 2010. 28(8): p. 1345-50.
60. Gessi, M., et al., p53 expression predicts dismal outcome for medulloblastoma patients
with metastatic disease. J Neurooncol, 2012. 106(1): p. 135-41.
61. Pfaff, E., et al., TP53 mutation is frequently associated with CTNNB1 mutation or
MYCN amplification and is compatible with long-term survival in medulloblastoma. J
Clin Oncol, 2010. 28(35): p. 5188-96.
62. Lindsey, J.C., et al., TP53 mutations in favorable-risk Wnt/Wingless-subtype
medulloblastomas. J Clin Oncol, 2011. 29(12): p. e344-6; author reply e347-8.
63. Hainaut, P., et al., IARC Database of p53 gene mutations in human tumours and cell
lines: updated compilation, revised formats and new visualisation tools. Nucleic Acids
Res, 1998. 26(1): p. 205-13.
64. Levine, A.J., p53, the cellular gatekeeper for growth and division. Cell, 1997. 88(3): p.
323-31.
74
![Page 89: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/89.jpg)
65. Dahm-Daphi, J., p53: biology and role for cellular radiosensitivity. Strahlenther Onkol,
2000. 176(6): p. 278-85.
66. Cho, Y., et al., Crystal structure of a p53 tumour suppressor-DNA complex:
understanding tumourigenic mutations. Science, 1994. 265(5170): p. 346-55.
67. Cuddihy, A.R. and R.G. Bristow, The p53 protein family and radiation sensitivity: Yes
or no? Cancer Metastasis Rev, 2004. 23(3-4): p. 237-57.
68. Matsuoka, S., et al., Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in
vitro. Proc Natl Acad Sci U S A, 2000. 97(19): p. 10389-94.
69. Mah, L.J., A. El-Osta, and T.C. Karagiannis, gammaH2AX: a sensitive molecular
marker of DNA damage and repair. Leukemia, 2010. 24(4): p. 679-86.
70. Bakkenist, C.J. and M.B. Kastan, Initiating cellular stress responses. Cell, 2004. 118(1):
p. 9-17.
71. Bristow, R.G., S. Benchimol, and R.P. Hill, The p53 gene as a modifier of intrinsic
radiosensitivity: implications for radiotherapy. Radiother Oncol, 1996. 40(3): p. 197-
223.
72. Williams, J.R., et al., Overview of radiosensitivity of human tumour cells to low-dose-
rate irradiation. Int J Radiat Oncol Biol Phys, 2008. 72(3): p. 909-17.
73. Williams, J.R., et al., A quantitative overview of radiosensitivity of human tumour cells
across histological type and TP53 status. Int J Radiat Biol, 2008. 84(4): p. 253-64.
74. Matsui, Y., Y. Tsuchida, and P.C. Keng, Effects of p53 mutations on cellular sensitivity
to ionizing radiation. Am J Clin Oncol, 2001. 24(5): p. 486-90.
75. Servomaa, K., et al., p53 mutations associated with increased sensitivity to ionizing
radiation in human head and neck cancer cell lines. Cell Prolif, 1996. 29(5): p. 219-30.
76. Salaroli, R., et al., Radiobiologic response of medulloblastoma cell lines: involvement of
beta-catenin? J Neurooncol, 2008. 90(3): p. 243-51.
75
![Page 90: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/90.jpg)
77. Clifford, S.C., et al., Wnt/Wingless pathway activation and chromosome 6 loss
characterize a distinct molecular sub-group of medulloblastomas associated with a
favorable prognosis. Cell Cycle, 2006. 5(22): p. 2666-70.
78. Zurawel, R.H., et al., Sporadic medulloblastomas contain oncogenic beta-catenin
mutations. Cancer Res, 1998. 58(5): p. 896-9.
79. Ellison, D.W., et al., beta-Catenin status predicts a favorable outcome in childhood
medulloblastoma: the United Kingdom Children's Cancer Study Group Brain Tumour
Committee. J Clin Oncol, 2005. 23(31): p. 7951-7.
80. Ellison, D.W., et al., Medulloblastoma: clinicopathological correlates of SHH, WNT,
and non-SHH/WNT molecular subgroups. Acta Neuropathol, 2011. 121(3): p. 381-96.
81. Rogers, H.A., et al., An investigation of WNT pathway activation and association with
survival in central nervous system primitive neuroectodermal tumours (CNS PNET). Br
J Cancer, 2009. 100(8): p. 1292-302.
82. Morin, P.J. and A.T. Weeraratna, Wnt signaling in human cancer. Cancer Treat Res,
2003. 115: p. 169-87.
83. Moon, R.T., et al., WNT and beta-catenin signalling: diseases and therapies. Nat Rev
Genet, 2004. 5(9): p. 691-701.
84. Koesters, R. and M. von Knebel Doeberitz, The Wnt signaling pathway in solid
childhood tumours. Cancer Lett, 2003. 198(2): p. 123-38.
85. Pei, Y., et al., WNT signaling increases proliferation and impairs differentiation of stem
cells in the developing cerebellum. Development, 2012. 139(10): p. 1724-33.
86. Fatima, S., N.P. Lee, and J.M. Luk, Dickkopfs and Wnt/beta-catenin signalling in liver
cancer. World J Clin Oncol, 2011. 2(8): p. 311-25.
87. Taketo, M.M., Shutting down Wnt signal-activated cancer. Nat Genet, 2004. 36(4): p.
320-2.
76
![Page 91: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/91.jpg)
88. Eberhart, C.G., T. Tihan, and P.C. Burger, Nuclear localization and mutation of beta-
catenin in medulloblastomas. J Neuropathol Exp Neurol, 2000. 59(4): p. 333-7.
89. Marino, S., Medulloblastoma: developmental mechanisms out of control. Trends Mol
Med, 2005. 11(1): p. 17-22.
90. Gordon, M.D. and R. Nusse, Wnt signaling: multiple pathways, multiple receptors, and
multiple transcription factors. J Biol Chem, 2006. 281(32): p. 22429-33.
91. Kinzler, K.W. and B. Vogelstein, Lessons from hereditary colorectal cancer. Cell, 1996.
87(2): p. 159-70.
92. Korinek, V., et al., Constitutive transcriptional activation by a beta-catenin-Tcf complex
in APC-/- colon carcinoma. Science, 1997. 275(5307): p. 1784-7.
93. Rimm, D.L., et al., Frequent nuclear/cytoplasmic localization of beta-catenin without
exon 3 mutations in malignant melanoma. Am J Pathol, 1999. 154(2): p. 325-9.
94. Rubinfeld, B., et al., Stabilization of beta-catenin by genetic defects in melanoma cell
lines. Science, 1997. 275(5307): p. 1790-2.
95. Voeller, H.J., C.I. Truica, and E.P. Gelmann, Beta-catenin mutations in human prostate
cancer. Cancer Res, 1998. 58(12): p. 2520-3.
96. Yang, F., et al., Linking beta-catenin to androgen-signaling pathway. J Biol Chem,
2002. 277(13): p. 11336-44.
97. Truica, C.I., S. Byers, and E.P. Gelmann, Beta-catenin affects androgen receptor
transcriptional activity and ligand specificity. Cancer Res, 2000. 60(17): p. 4709-13.
98. Zhang, K., et al., Wnt/beta-Catenin Signaling in Glioma. J Neuroimmune Pharmacol,
2012.
99. Koch, A., et al., Somatic mutations of WNT/wingless signaling pathway components in
primitive neuroectodermal tumours. Int J Cancer, 2001. 93(3): p. 445-9.
100. Huang, H., et al., APC mutations in sporadic medulloblastomas. Am J Pathol, 2000.
156(2): p. 433-7.
77
![Page 92: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/92.jpg)
101. Walther, A., et al., Genetic prognostic and predictive markers in colorectal cancer. Nat
Rev Cancer, 2009. 9(7): p. 489-99.
102. Bondi, J., et al., Expression of non-membranous beta-catenin and gamma-catenin, c-Myc
and cyclin D1 in relation to patient outcome in human colon adenocarcinomas. APMIS,
2004. 112(1): p. 49-56.
103. Hugh, T.J., et al., Cadherin-catenin expression in primary colorectal cancer: a survival
analysis. Br J Cancer, 1999. 80(7): p. 1046-51.
104. Lin, S.Y., et al., Beta-catenin, a novel prognostic marker for breast cancer: its roles in
cyclin D1 expression and cancer progression. Proc Natl Acad Sci U S A, 2000. 97(8): p.
4262-6.
105. Chien, A.J., et al., Activated Wnt/beta-catenin signaling in melanoma is associated with
decreased proliferation in patient tumours and a murine melanoma model. Proc Natl
Acad Sci U S A, 2009. 106(4): p. 1193-8.
106. van Gijn, M.E., et al., Overexpression of components of the Frizzled-Dishevelled
cascade results in apoptotic cell death, mediated by beta-catenin. Exp Cell Res, 2001.
265(1): p. 46-53.
107. Jullig, M., et al., MG132 induced apoptosis is associated with p53-independent
induction of pro-apoptotic Noxa and transcriptional activity of beta-catenin. Apoptosis,
2006. 11(4): p. 627-41.
108. Tell, S., et al., The Wnt signaling pathway has tumour suppressor properties in
retinoblastoma. Biochem Biophys Res Commun, 2006. 349(1): p. 261-9.
109. Woodward, W.A., et al., WNT/beta-catenin mediates radiation resistance of mouse
mammary progenitor cells. Proc Natl Acad Sci U S A, 2007. 104(2): p. 618-23.
110. Chen, M.S., et al., Wnt/beta-catenin mediates radiation resistance of Sca1+ progenitors
in an immortalized mammary gland cell line. J Cell Sci, 2007. 120(Pt 3): p. 468-77.
111. Moncharmont, C., et al., Targeting a cornerstone of radiation resistance: Cancer stem
cell. Cancer Lett, 2012.
78
![Page 93: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/93.jpg)
112. Che, S.M., et al., The radiosensitization effect of NS398 on esophageal cancer stem cell-
like radioresistant cells. Dis Esophagus, 2011. 24(4): p. 265-73.
113. Kendziorra, E., et al., Silencing of the Wnt transcription factor TCF4 sensitizes
colorectal cancer cells to (chemo-) radiotherapy. Carcinogenesis, 2011. 32(12): p. 1824-
31.
114. Kim, Y., et al., Wnt activation is implicated in glioblastoma radioresistance. Lab Invest,
2012. 92(3): p. 466-73.
115. Cade, J.F., Lithium salts in the treatment of psychotic excitement. 1949. Bull World
Health Organ, 2000. 78(4): p. 518-20.
116. Phiel, C.J. and P.S. Klein, Molecular targets of lithium action. Annu Rev Pharmacol
Toxicol, 2001. 41: p. 789-813.
117. Stambolic, V., L. Ruel, and J.R. Woodgett, Lithium inhibits glycogen synthase kinase-3
activity and mimics wingless signalling in intact cells. Curr Biol, 1996. 6(12): p. 1664-8.
118. Spalding, A.C., et al., Inhibition of protein kinase Cbeta by enzastaurin enhances
radiation cytotoxicity in pancreatic cancer. Clin Cancer Res, 2007. 13(22 Pt 1): p. 6827-
33.
119. De Sarno, P., X. Li, and R.S. Jope, Regulation of Akt and glycogen synthase kinase-3
beta phosphorylation by sodium valproate and lithium. Neuropharmacology, 2002.
43(7): p. 1158-64.
120. Hedgepeth, C.M., et al., Activation of the Wnt signaling pathway: a molecular
mechanism for lithium action. Dev Biol, 1997. 185(1): p. 82-91.
121. Watson, R.L., et al., GSK3beta and beta-catenin modulate radiation cytotoxicity in
pancreatic cancer. Neoplasia, 2010. 12(5): p. 357-65.
122. Nowicki, M.O., et al., Lithium inhibits invasion of glioma cells; possible involvement of
glycogen synthase kinase-3. Neuro Oncol, 2008. 10(5): p. 690-9.
79
![Page 94: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/94.jpg)
123. D'Mello, S.R., R. Anelli, and P. Calissano, Lithium induces apoptosis in immature
cerebellar granule cells but promotes survival of mature neurons. Exp Cell Res, 1994.
211(2): p. 332-8.
124. Yazlovitskaya, E.M., et al., Lithium treatment prevents neurocognitive deficit resulting
from cranial irradiation. Cancer Res, 2006. 66(23): p. 11179-86.
125. Yang, E.S., et al., Lithium-mediated protection of hippocampal cells involves
enhancement of DNA-PK-dependent repair in mice. J Clin Invest, 2009. 119(5): p. 1124-
35.
126. Oren, M., Decision making by p53: life, death and cancer. Cell Death Differ, 2003.
10(4): p. 431-42.
127. Damalas, A., et al., Deregulated beta-catenin induces a p53- and ARF-dependent growth
arrest and cooperates with Ras in transformation. EMBO J, 2001. 20(17): p. 4912-22.
128. Damalas, A., et al., Excess beta-catenin promotes accumulation of transcriptionally
active p53. EMBO J, 1999. 18(11): p. 3054-63.
129. Sadot, E., et al., Down-regulation of beta-catenin by activated p53. Mol Cell Biol, 2001.
21(20): p. 6768-81.
130. Schwalbe, E.C., et al., Rapid diagnosis of medulloblastoma molecular subgroups. Clin
Cancer Res, 2011. 17(7): p. 1883-94.
131. Shlien, A., et al., Excessive genomic DNA copy number variation in the Li-Fraumeni
cancer predisposition syndrome. Proc Natl Acad Sci U S A, 2008. 105(32): p. 11264-9.
132. Northcott, P.A., et al., Rapid, reliable, and reproducible molecular sub-grouping of
clinical medulloblastoma samples. Acta Neuropathol, 2012. 123(4): p. 615-26.
133. Pollard, S.M., et al., Glioma stem cell lines expanded in adherent culture have tumour-
specific phenotypes and are suitable for chemical and genetic screens. Cell Stem Cell,
2009. 4(6): p. 568-80.
80
![Page 95: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/95.jpg)
134. Untergasser, A., et al., Primer3Plus, an enhanced web interface to Primer3. Nucleic
Acids Res, 2007. 35(Web Server issue): p. W71-4.
135. Kolligs, F.T., et al., Neoplastic transformation of RK3E by mutant beta-catenin requires
deregulation of Tcf/Lef transcription but not activation of c-myc expression. Mol Cell
Biol, 1999. 19(8): p. 5696-706.
136. Bristow, R.G., P.A. Hardy, and R.P. Hill, Comparison between in vitro radiosensitivity
and in vivo radioresponse of murine tumour cell lines. I: Parameters of in vitro
radiosensitivity and endogenous cellular glutathione levels. Int J Radiat Oncol Biol
Phys, 1990. 18(1): p. 133-45.
137. Senra, J.M., et al., Inhibition of PARP-1 by olaparib (AZD2281) increases the
radiosensitivity of a lung tumour xenograft. Mol Cancer Ther, 2011. 10(10): p. 1949-58.
138. Ngoka, L.C., Sample prep for proteomics of breast cancer: proteomics and gene
ontology reveal dramatic differences in protein solubilization preferences of
radioimmunoprecipitation assay and urea lysis buffers. Proteome Sci, 2008. 6: p. 30.
139. Veeman, M.T., et al., Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling,
regulates gastrulation movements. Curr Biol, 2003. 13(8): p. 680-5.
140. Northcott, P.A., et al., Subgroup-specific structural variation across 1,000
medulloblastoma genomes. Nature, 2012. 488(7409): p. 49-56.
141. Robinson, G., et al., Novel mutations target distinct subgroups of medulloblastoma.
Nature, 2012.
142. Rausch, T., et al., Genome sequencing of pediatric medulloblastoma links catastrophic
DNA rearrangements with TP53 mutations. Cell, 2012. 148(1-2): p. 59-71.
143. Lubner, S.J., et al., A preclinical and clinical study of lithium in low-grade
neuroendocrine tumours. Oncologist, 2011. 16(4): p. 452-7.
144. Puca, R., et al., Restoring p53 active conformation by zinc increases the response of
mutant p53 tumour cells to anticancer drugs. Cell Cycle, 2011. 10(10): p. 1679-89.
81
![Page 96: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/96.jpg)
145. Barraud, P., et al., An extended dsRBD with a novel zinc-binding motif mediates nuclear
retention of fission yeast Dicer. EMBO J, 2011. 30(20): p. 4223-35.
146. Schnekenburger, M., G. Talaska, and A. Puga, Chromium cross-links histone
deacetylase 1-DNA methyltransferase 1 complexes to chromatin, inhibiting histone-
remodeling marks critical for transcriptional activation. Mol Cell Biol, 2007. 27(20): p.
7089-101.
147. Schrauzer, G.N., Lithium: occurrence, dietary intakes, nutritional essentiality. J Am Coll
Nutr, 2002. 21(1): p. 14-21.
148. Lally, B.E., et al., Identification and biological evaluation of a novel and potent small
molecule radiation sensitizer via an unbiased screen of a chemical library. Cancer Res,
2007. 67(18): p. 8791-9.
149. Li, L.J., et al., beta-Elemene Radiosensitizes Lung Cancer A549 Cells by Enhancing
DNA Damage and Inhibiting DNA Repair. Phytother Res, 2011. 25(7): p. 1095-7.
150. Karanjawala, Z.E., et al., The nonhomologous DNA end joining pathway is important for
chromosome stability in primary fibroblasts. Curr Biol, 1999. 9(24): p. 1501-4.
151. Ferguson, D.O. and F.W. Alt, DNA double strand break repair and chromosomal
translocation: lessons from animal models. Oncogene, 2001. 20(40): p. 5572-9.
152. Ferguson, D.O., et al., The nonhomologous end-joining pathway of DNA repair is
required for genomic stability and the suppression of translocations. Proc Natl Acad Sci
U S A, 2000. 97(12): p. 6630-3.
153. Kuroda, S., Y. Urata, and T. Fujiwara, Ataxia-telangiectasia mutated and the Mre11-
Rad50-NBS1 complex: promising targets for radiosensitization. Acta Med Okayama,
2012. 66(2): p. 83-92.
154. Kumareswaran, R., et al., Chronic hypoxia compromises repair of DNA double-strand
breaks to drive genetic instability. J Cell Sci, 2012. 125(Pt 1): p. 189-99.
82
![Page 97: Prognostic and Therapeutic Implications of TP53 Mutations ... · ii Prognostic and Therapeutic Implications of TP53 Mutations in WNT and Sonic-Hedgehog Medulloblastomas by Nataliya](https://reader030.fdocuments.net/reader030/viewer/2022040700/5d54cd4d88c99313508b72e3/html5/thumbnails/97.jpg)
83