Production of Anti-Inflammatory Pyrrol Compound from ...2)16/1.pdf11 2Manal M. El-Naggar, Hanan M....

World Journal of Fish and Marine Sciences 8 (2): 74-84, 2016ISSN 2078-4589© IDOSI Publications, 2016DOI: 10.5829/idosi.wjfms.2016.8.2.10328

Corresponding Author: Manal M. El-Naggar, Microbiology Laboratory, Marine Environmental Division, National Institute ofOceanography and Fisheries, Alexandria, Egypt.

74

Production of Anti-Inflammatory Pyrrol Compound from Marine Bacillus baekryungensis AMHSU

Manal M. El-Naggar, Hanan M. Abd-Elnaby, Seham A. Abou-Shousha,1 1 2

Usama M. Abdul-Raouf and Ahmed E. Abouelwafa3 1

Microbiology Laboratory, Marine Environmental Division,1

National Institute of Oceanography and Fisheries, Alexandria, EgyptDepartment of Immunology &Allergy, Medical research Institute, Alexandria University, Egypt2

Department of Botany and Microbiology, Faculty of Science, Al-Azhar University, Assiut, Egypt3

Abstract: Working on marine microbial resources may lead to the discovery of an alternative anti-inflammatoryagent added to the commercial used ones. Marine bacterial isolates were screened for their ability to produceanti-inflammatory agent(s) using a preliminary screening test “inhibition of albumin denaturation assay” usingthe bovine serum albumin compared to diclofenac sodium (a standard anti-inflammatory drug). The obtainedresults indicated the isolation of a new marine bacterial strain from the western harbor of Alexandria, itidentified as Bacillus baekryungensis AMHSU using the 16S rRNA gene sequence. It showed the most potentanti-inflammatory activity 46.78±2.81% compared to the standard diclofenac sodium 28.56±1.15%. Theoptimization process was performed using the Plackett –Burman experimental design and the propagation ofthe anti-inflammatory activity was carried out through the adsorption immobilization technique using the luffapulp supporter. The optimized medium maximized the anti-inflammatory activity by 1.46 fold compared to thebasal medium (62.32%). While the adsorbed cells was efficiently maximize the anti-inflammatory activity(95.36±0.64). The chemical characterization of the ethyl-acetate extract was performed using the IR, NMR andGC Ms spectrophotometry, these analysis indicated the most probable effective compound as anti-inflammatoryagent according to the obtained data was pyrrolo [1, 2-a]pyrazine-1, 4-dione derivatives with a similarity of 91%.

Key words: Anti-Inflammatory Pyrrol Bacillus Bovine serum albumin Immobilization

INTRODUCTION macrophages both in vitro and in vivo, was reported in

Inflammation is part of the complex biological unique microhabitats on surfaces and internal spaces ofresponse of vascular tissues to harmful stimuli, such as marine invertebrates. The low amounts produced from thepathogens, damaged cells, or irritants. However, if the higher marine organisms as well as the striking structuralresponse is exaggerated, misdirected, or long term the similarities between some pharmaceutically active agentsinflammation can adversely affect health and give rise to and known microbial metabolites addressed a questionmany conditions such as inflammatory bowel disease, about their biosynthetic origin [3].rheumatoid arthritis, atherosclerosis, alzheimer’s, asthma, The application of statistically based experimentalpsoriasis and multiple sclerosis; many of these designs is a must to deal with the effect of differentinflammatory diseases are becoming common throughout culture variables in the same time. The Plackett-Burmanthe world [1]. designs are powerful tools for searching the most

There was a remarkable increase in marine anti- significant factors for bioactive compounds productioninflammatory pharmacology research nowadays. The [4]. Immobilization techniques mostly applied for themolecular mechanism of action of several marine natural production of secondary metabolites through cellproducts, which were shown in preclinical entrapment and cell adsorption on solid supporters.pharmacological studies to target neutrophils and The application of immobilized cells to study microbial

several publications [2]. Bacteria are regularly observed in

World J. Fish & Marine Sci., 8 (2): 74-84, 2016

75

processes is one of the main trends in modern Plackett-Burman Experimental Design: The Plackett-biotechnology. In addition, cell immobilization showsmany operational and economic advantages such asprolong metabolic activities, reuse of the biocatalyst,increase of cell concentration and preventing washing outof cells when high flow rates were applied [5].

MATERIALS AND METHODS

Isolation and In vitro Anti-inflammatory ActivityScreening: Thirty marine bacterial isolates obtained fromSeawater and sediment samples from Western Harbor,Alexandria, Egypt. The most potent isolate was identifiedusing 16S rRNA sequencing molecular technique.This process carried out at Molecular Biology Center,Assiut University, Egypt. These strains were cultured inmarine nutrient media slants for 24 hrs at 35°C to besubmitted in PCR detection.

Screening for the anti-inflammatory producers carriedout by using the simple economical assay; “in vitro”inhibition of protein denaturation technique.

The anti-inflammatory activity was studied by usingthe inhibition of albumin denaturation technique whichwas studied according to a modified method of Mizushimaand Kobayashi [6] and Sakat et al. [7]. The activity ofeach tested supernatant was compared with the standardcommercial anti-inflammatory agent “Diclofenac sodium”using different concentrations (100, 250, 500, 1000 µg/ml).

Optimization of Culture Conditions Affecting theAnti-Inflammatory ActivityEffect of Different Culture Media: Different culturalmedium; nutrient broth, potato dextrose medium, modifiedyeast-peptone medium and modified LB medium wereused to determine the best media for growth andproduction of the anti-inflammatory activity. The studywas done in 250ml flask using 50 ml of each media andkept in shaker incubator at 120 rpm and 30°C for 24 hrs.

Table 1: Factors examined as independent variables affecting the productionof the anti-inflammatory production by bacterial isolate Bacillusbaekryungensis strain AMHSU and its levels in the Plackett-Burman experiment

Levels------------------------------------------

Factor Symbol -1 0 +1Tryptone (g/l) TY 5 10 15Beef extract (g/l) BE 1.5 3 4.5Yeast extract (g/l) YE 1 2 3Inoculum Size (ml) IS 0.5 1 1.5Temperature (°C) TP 25 30 35pH pH 6 7 8Culture volume (ml) CV 25 50 75

Burman experimental design, a fractional factorial design[8] was applied in this study to reflect the relativeimportance of various nutritional and environmentalfactors on the production of anti-inflammatory agent(s).Seven independent variables illustrated in Table (1)representing components of LB medium plus some ofphysiological factors were screened in nine combinationsorganized according to the Plackett-Burman designmatrix. For each variable, a high (+) and low (-) level wastested. The factors tested were: tryptone (TY), beef extract(BE), yeast extract (YE), Inoculum size (IS), pH level (pH),temperature (TP) and the culture volume (CV).

All trials were performed in duplicates and theaverages of the anti-inflammatory activity (%) weretreated as the responses.

The main effect of each variable was determinedusing the following equation:

Exi= ( Mi – Mi ) /N+ -

where Exi is the variable main effect, Mi and Mi are the+ -

anti-inflammatory activity in trials were the independentvariables (Xi) was present in high and low levels,respectively and N is the number of trails divided by 2.A main effect figure with a positive sign indicate that thehigh level of these variable is nearer to optimum. UsingMicrosoft excel, statistical t-values for equal unpairedsamples were calculated for determination of variablesignificance [9].

Verification of Plackett-Burman Experiment: In order tovalidate the obtained results and to evaluate the accuracyof the applied Plackett-Burman statistical design, averification experiment was carried out in triplicates.According to the main effect results, the predicted nearoptimum and far from optimum levels of the independentvariables were examined and compared to the basalcondition settings [5].

Propagation Using AdsorbedImmobilization Technique:Different solid supporting materials were investigated asfollowing; luffa pulp, synthetic sponge and pumice stoneto absorb the Bacillus baekryungensis strain AMHSUcells. The different solid supports were about 2g in theform of particles about 0.5 mm in lengths. The adsorptionprocess was carried out as follows: Concentrated cellsuspension was prepared by centrifugation process of theactivated cells from culture medium after 48 hrs. The cellpellet was washed and re-suspended in a sterile saline


76

solution. The obtained cell suspension (100 ml) was (Trace DSQII MS), at the Marine pollution lab, Nationaladded to each 250 ml Erlenmeyer flasks which contain Institute of Oceanography and Fisheries, Alexandria,about 1g in weight from (10 - 20) particles or pieces of the Egypt.tested solid support. The flasks were shaken slowly atabout 100 rpm. Cell adsorption was monitored in each Nuclear Magnetic Resonance Spectra (NMR): Theflask at short time intervals by measuring the decrease in sample was dissolved in hydrated dimethylsulfooxide.turbidity (OD) of the cell suspension at nm. The The different functional group could be identified using550

solution was removed from the flasks leaving the NMR (JEOL ECA 500), at the Central Labs, Alexandriasupports and their absorbed bacterial cells. The University, Egypt.cultivation medium was added and cultivation was carried Statistical Analysis: Data are expressed as mean ±out [10]. standard deviation or Standard error and they were

Electron Microscope Investigation for Immobilized followed by post-hoc Tukey’s test for multipleBacterial Cells: Immobilized bacterial cells that adsorbed comparisons. The differences were considered significanton supported material was viewed in JEOL-JSM 5300 if the probability was associated with p<0.05.scanning electron microscope operated at 20 kV with abeam specimen angle of 45° were determined at the RESULTSelectron microscope unit of Alexandria University, Egypt.

Extraction, Purification and Identification of the Anti- their ability to produce anti-inflammatory agent(s) usingInflammatory Agent(s): Bacterial culture supernatant was a preliminary screening test “inhibition of albuminextracted with equal volume of either ethyl-acetate, denaturation assay”. The results presented in Table 2chloroform and/or N-hexane. showed that only 7 bacterial isolates were able to protect

Partial Purification and Physico-Chemical denaturation compared to diclofenac sodium (a standardCharacterization anti-inflammatory drug).According to the results of thePreparative High Performance Liquid Chromatography one-way ANOVA statistical analysis, the activity of the(HPLC): Ethyl acetate extract of Bacillus baekryungensis bacterial isolate 7S-2 was significantly higher than others,strain AMHSU was subjected for fractionation using with activity 46.78±2.81. The standard diclofenac sodiumpreparative HPLC. Agilent: ZORBAX SB-C18, 5µm, had shown 28.56±1.15% of anti-inflammatory effect at9.4x250mm, was used for the fractionation and 1 ml of the 250µg/ml.ethyl acetate extract was injected. All analyses were The bacterial isolate 7S-2 isolated from sediment, ofmonitored using a DED detector at 202 nm. Mobile phase Alexandria Western Harbor, was Gram-positive, butwas acetonitrile-water (20:80), 15 min. Before bioassay the Gram-variable in old cultures. Non-motile. Centralfractions were dried using drying oven at 40°C and a endospores are observed. Colonies are smooth, circular togentle stream of air blowing through each well. Each slightly irregular, slightly raised, orange in color andfraction was tested for the anti-inflammatory activity as 2–4 mm in diameter after 3 days cultivation at 30°C ondescribed previously. nutrient agar. Optimal growth temperature is 30–35°C.

Fourier-Transform Infrared Spectroscopy (FTIR) in the presence of seawater.Analysis: Using Peak Find-Memory-27spectrophotometer, at the marine pollution lab, National Genotypic Characterization: Bacterial isolate 7S-2wasInstitute of Oceanography and Fisheries, Alexandria, identified using 16S rRNA. Genomic DNA of the mostEgypt. The molecular structure of the anti-inflammatory potent bacterial isolate was extracted and the gene codingmaterial was partially identified. The measurements were for the 16S rRNA was partially amplified using the primerscarried out at infrared spectra between 400-4000 nm. (F9 and R1525 with sequence

Gas Chromatography- Mass Spectrophotometer (GC-MS) AGAAAGGAGGTGATCCAGCC respectively). TheAnalysis: Analysis was conducted using Gas amplified PCR fragments of the selected bacterial isolatesChromatography-Mass Spectrophotometer; GC-MS (approximately 1500 bp) was purified and detected using

analyzed by the one-way analysis of variance (ANOVA),

Thirty marine bacterial isolates were screened for

the tested protein (bovine serum albumin) from

Optimal pH for growth is 6.5–7.5. Optimal growth occurs

G A G T T T G A T C C T G G C T C A G a n d


77

Table 2: The preliminary screening process for anti-inflammatory activity of different marine bacterial isolates using inhibition of albumin denaturation assayBacterial category Isolates Code Site of collection Source Inhibition of protein denaturation (%)Gram (+ve) 1S-1 Western harbor Seawater 6.20±0.94 d

7S-2 Western harbor Sediment 46.78±2.81 a

7S-3 Western harbor Sediment 35.62±1.13 b

9S-1 Western harbor Sediment 7.84±2.20 d

JF-1 El-Shatby beach Jellyfish 27.73±0.78 c

Gram (-ve) 6W-1 Eastern harbor Sediment 5.61±0.76 d

7W-1 Eastern harbor Sediment 9.21±1.83 d

Reference agent Diclofenac sodium (250 µg/ml) 28.56±1.15c

- Un-inoculated marine nutrient broth medium was used as control -supernatant concentration was 250 µl/ml (v/v) -Means followed by the same letter(s) are not significant, but different letters are significant according to LSD procedure at 0.05 level of probability, LeastSignificant Difference (LSD) = 6.21

agarose gel electrophoresis. The full sequences of each medium) in addition to some of the physiologicalsample were then used to be blasted in via National conditions were optimized for a maximum anti-Center of Biotechnology Information (NCBI) to be inflammatory activity using the statistical method ofcompared with other known bacteria. Sequencing data Plackett-Burman design. were aligned against the 16S rRNA sequences of Through this study seven factors were examined as(http://blast.ncbi.nlm.nih.gov/Blast.cgi). independent variables affecting the anti-inflammatory

Isolate 7S-2 was identified as Bacillus activity of bioactive compound(s) produced by Bacillusbaekryungensis AMHSU with association #: KT876052 baekryungensis AMHSU. The responses in Table (3)deposited in the GenBank database. showed a wide variation in the anti-inflammatory activity,

Enhancement the Anti-Inflammatory Activity of Agent(s) combined effect of the seven parameters in their specificProduced by Bacillus baekryungensis AMHSU: ranges. For determination of variable significance,Enhancing the anti-inflammatory activity of theextracellular metabolites produced by Bacillusbaekryungensis AMHSU was carried out usingapplication of Plackett-Burman experimental design toreflect the relative importance of various growth mediacomponents, in addition to some of the physiologicalconditions on anti-inflammatory activity.

Effect of Different Culture Media: The influence ofdifferent culture media on the production of anti-inflammatory compound(s) by Bacillus baekryungensisAMHSU was recorded. Four different recommendedculture medium was tested. Among the tested culturemedia, modified LB medium increased the anti-inflammatory activity (65.98±0.97%) compared to the initialused media where the anti-inflammatory activity increasedfrom 41.48% by NB to 65.98% by LB media.

Plackett-Burman Experimental Design: Plackett- examined and compared to the basal and anti-optimizedBurman design, an efficient technique for mediumcomponent optimization, was employed to identify thesignificant variables that enhance the anti-inflammatoryactivity of bioactive metabolites from Bacillusbaekryungensis AMHSU and to find out their probableoptimal levels in a limited number of experiments. Thecomponents of the best culture medium (modified LB

ranging from 36.26 to 95.59% corresponding to the

statistical t-values for equal unpaired samples werecalculated with respect to observations. The main effectof each variable upon the anti-inflammatory activity wasestimated and presented graphically in Figure (1). Themain effect results of strain Bacillus baekryungensisAMHSU point out that high level of tryptone, beefextract, yeast extract, temperature and pH affectedpositively on the anti-inflammatory activity. This figurealso suggests that low levels of inoculum size and culturevolume would result in high the anti-inflammatory activity.Therefore, one could state that the anti-inflammatoryactivity of active metabolites produced by Bacillusbaekryungensis AMHSU was mainly dependent ontemperature and culture volume, i.e. the high temperature(35°C) and low culture volume (50 ml of medium in 250 mlconical flask).

Verification of Plackett-Burman Analysis: The data

media. As shown in Table (4), the results indicatehigh anti-inflammatory activity (91.08%) through theoptimized medium where the anti-optimized mediumgives lower anti-inflammatory activity (38.01%). Theoptimized medium maximized the anti-inflammatoryactivity by 1.46 fold maximization from the basal medium(62.32%).


78

Table 3: The applied Plackett-Burman experimental design matrix for seven variables and their anti-inflammatory activity responsesFactor--------------------------------------------------------------------------------------------------------------------------

Trial No. TY BE YE IS Temp pH CV Anti-inflammatory Activity (%)1 -1 -1 -1 1 1 1 -1 91.252 1 -1 -1 -1 -1 1 1 49.603 -1 1 -1 -1 1 -1 1 58.284 1 1 -1 1 -1 -1 -1 60.885 -1 -1 1 1 -1 -1 1 36.266 1 -1 1 -1 1 -1 -1 95.597 -1 1 1 -1 -1 1 -1 79.108 1 1 1 1 1 1 1 75.959 0 0 0 0 0 0 0 64.57

Table 4: Verification of Plackett- Burman experimental design for anti-inflammatory activity of Bacillus baekryungensis AMHSUTested Variables “/100 ml”------------------------------------------------------------------------------------------------------------------------------

Medium level TY (g) BE (g) YE (g) IS (ml) T (°C) pH CV (ml) Anti-inflammatory activity (%)Optimized 1.5 0.45 0.3 0.5 35 8 25 91.08±0.42Basal 1 0.3 0.2 1 30 7 50 62.32±2.7Anti-optimized 0.5 0.15 0.1 1.5 25 6 75 23.18±6.81Anti-inflammatory activity (%) expressed as mean ±S.D

Fig. 1: Elucidation of different cultured factors affecting the production of anti-inflammatory agent(s) by Bacillusbaekryungensis AMHSU

(A) (B) (C)

Fig. 2: Macrograph showing immobilized Bacillus baekryungensis AMHSU cells on luffa pulp, (A): free luffa pulp“control”, (B): immobilized cells at high resolution and (C): immobilized cells at low resolution.


79

Table 5: Anti-inflammatory activity of partial purified fractions obtained by preparative HPLCFraction from HPLC Area (%) Retention time (min.) Activity (%)A 3.95 3.50 0B 22.25 4.10 0C 38.53 5.01 0D 6.29 8.18 1.95E 12.74 9.54 0.56F 16.25 12.50 0.84Ethyl acetate crude extract 96.58

Fig. 3: Fourier-Transform Infrared spectrum of the ethyl acetate extract of Bacillus baekryungensis AMHSU supernatant

Fig. 4: The H NMR spectrum of the ethyl-acetate extract of Bacillus baekryungensis AMHSU supernatant1

Propagation Using Adsorbed Immobilization Extraction and Purification of the Anti-inflammatoryTechnique: Adsorption method was efficiently Compound(s)maximize the anti-inflammatory activity. The data was Extraction: After incubation in the optimized medium forcompared to that obtained from the free cells of 24h, the culture were centrifuged and supernatant thenBacillus baekryungensis AMHSU. The immobilized cells challenged with equal amount of either ethyl acetate,upon luffa pulp showed obviously higher anti- chloroform and/or N-hexane. Solvents was selectedinflammatory activity (95.36±0.64) than that of other according to their polarity from high polar (ethyl-acetate)supported materials and free cells (89.23±0.34). Electron to non-polar (n-hexane). Each extract was air dried andmicroscopy photo showed the immobilized cells of re-suspended in saline solution (0.9% NaCl). TheBacillus baekryungensis AMHSU upon luffa pulp anti-inflammatory activity test for each extract was(Figure 2). chieved as mentioned before.


80

(A)

(B)

Fig. 5: GC-mass spectral analysis of Mass spectral analysis for the ethyl-acetate extract produced by Bacillusbaekryungensis AMHSU (A) and the major effective compound pyrrolo-pyrazine derivative in the ethyl-acetateextract produced by Bacillus baekryungensis AMHSU to library compound in GC-mass (B).

The results indicated that, the highest anti- compared to the crude ethyl acetate extract beforeinflammatory activity had obtained when ethyl acetate fractionation (Table 5). Results obtained reveal that crude(96.78±0.44) was used, where chloroform and N. hexane ethyl acetate extract (Combined fraction) showing highlywas less effective in extraction of the anti-inflammatory anti-inflammatory activity than every fraction alone.compounds. Their anti-inflammatory activity were32.10±3.26 and 8.86±1.07, respectively. Partial Characterization of the Anti-inflammatory

Fractionation: Ethyl acetate extract of Bacillusbaekryungensis AMHSU was subjected to partialpurification using preparative HPLC to obtain a purecompound(s) with anti-inflammatory activity. Using themobile phase system of acetonitrile: water in a ratio of20:80. Six fractions were obtained from preparativeHPLC, three fractions A, B and C showed no activity, theother three fractions D, E and F showed weak activity

Compound(s) by Bacillus baekryungensis AMHSUFourier-Transform Infrared Spectroscopy (FT-IR):Results of FT-IR spectroscopic studies have revealed thepresence of various chemical constituents in the ethylacetate extract produced by Bacillus baekryungensisAMHSU (Figure 3). The peak at 3220 and 2957 cm are1

corresponded to hydroxyl and CH stretching frequency,respectively. A band at 1649 cm is corresponded to1

carbonyl carbon. The peak at 1600 cm to assign C=C.1


81

The strong peak at 2957 cm assigned to the C-H that Bacillus baekryungensis YD13, was also isolated1

stretching which means that some aliphatic compounds from sediment samples but they was applied as probioticexisted in this bacterial extract. [13].

Nuclear Magnetic Resonance ( H NMR): The enhance the anti-inflammatory activity, where the1

characterization of crude ethyl-acetate extract by H NMR modified used LB medium increased the anti-inflammatory1

is shown in Figure 4. The signals of protons attached to activity (65.98%), compared to NB (41.48%). In agreementsaturated carbon atoms such as methyl, methylene as well with the results of this study Thakur et al. [14] showedas methine groups appear between 0.81 and 2.89 ppm in variation in the type of nutritional sources such carbonthe spectrum. The signals of protons attached to aromatic and nitrogen sources besides changes in pH, temperature,carbon atoms appear between 6.6 and 8.32 ppm in incubation period, shaking and inoculum size of thethe spectrum. The signals NH groups appear at 9.1 and antagonistic fungal strain can greatly influence antibiotic9.3 ppm. biosynthesis.

Gas Chromatography-mass Spectrophotometer (GC-MS) powerful tools for searching the key factors rapidly fromAnalysis: The GC-MS analysis of ethyl-acetate fraction a multivariable system and minimizing the error inindicates the presence of different bioactive components. determining the effect of parameters and the results areData revealed that the ethyl-acetate extract contained the achieved in an economical manner. Plackett-Burmanmaximum diversity of identified compounds and the most design, an efficient technique for medium componentprobable effective compound as anti-inflammatory agent optimization, was employed to identify significantaccording to literature data was pyrrolo[1, 2-a] pyrazine-1, variables that enhance anti-inflammatory compound(s)4-dione derivatives (Figure 5). production and to find out their probable optimal levels in

DISCUSSION Development of an efficient fermentation process for

Since the screening for compounds exerting microorganisms requires examination of a diverse array ofanti-inflammatory or immunostimulatory activities was not species-specific features, including physical and chemicalalways easy owing to the complexity of cellular factors. Nutritional and environmental factors play keyinteractions involved during an inflammatory response, roles in cell metabolism. Also several cultivationthe same extract were tested against several targets. parameters like pH, incubation period and temperatureThe data generated from various assays made it possible play a major role in the production of bioactiveto compare whether the results were consistent with each metabolites [15].other [11]. In this study, the responses of Plackett-Burman

In the present study the protein denaturation experiments show a wide variation in the anti-bioassay was selected for in vitro assessment of anti- inflammatory activity, ranging from 36.26% to 95.59%inflammatory property of the tested bacterial isolates corresponding to the combined effect of the sevensupernatants. Denaturation of tissue proteins is one of parameters in their specific ranges. Therefore, decreasingthe well-documented causes of inflammatory and arthritic of the culture volume and increasing temperature ofdiseases. Production of auto antigens in certain arthritic incubation will enhance the anti-inflammatory activity ofdiseases may be due to denaturation of proteins in vivo. active metabolites produced by Bacillus baekryungensisAgents that can prevent protein denaturation therefore, AMHSU.would be worthwhile for anti-inflammatory drug Anuradha et al. [16] has reported that the productiondevelopment [12]. of prodigiosin (anti-inflammatory compound from marine

The present study is an endeavor towards the bacteria Serratia marcescens was more in nutrient brothproduction of anti-inflammatory agents by marine (0.52 mg/ml) than peptone glycerol broth (0.302 mg/ml).bacteria. Bacillus baekryungensis AMHSU (with Prodigiosin production varied with inoculum level andassociation number: KT876052) was isolated from showed parabolic nature in the studied range. Thesediment at Western Harbor, Alexandria, Egypt maximum prodigiosin production 149.2 mg/mL wasduring 2013. They showed to be a promising tools for observed at 5.0% for Serratia marcescens MBB05.anti-inflammatory activity compared to the standard Prodigiosin production was comparatively less at 2.5 andanti-inflammatory drug. The previous studies reported 7.5% inoculum concentration.

The present study showed that culture media can

Statistical experimental designs were applied here as

a limited number of experiments [9].

the production of secondary metabolites by


82

In agreement with the results of the present study, compounds. Similarly, Yang et al. [22] used the ethyl-regarding to the effect of inoculum size, Pradeep et al. [17] acetate as a solvent in extraction of anti-inflammatoryfound prodigiosin production varied with inoculum level secondary metabolites from Bacillus sp. and marineand showed parabolic nature in the studied range. Among Pseudomonas sp. (N11) [23]. the two media were tested for prodigiosin production, viz., Results of our work obtained reveal that crudenutrient broth and peptone glycerol broth. Serratia ethyl-acetate extract (Combined fraction) showing highlymarcescens MBB05 showed prodigiosin production 135.5 anti-inflammatory activity than every fraction alone.mg/ml compared to 101 mg/mL in peptone glycerol broth. The present data of this study revealed that the ethyl-

Similar results were obtained by Freeman and acetate extract contained a diverse compounds, the mostAharonowitz [18] who developed a mild new method for probable effective compounds as anti-inflammatory agentthe immobilization of the whole microbial cells. They according to literature data was pyrrolo[1, 2-a]pyrazine-1,found the yield of cephalosporin antibiotic production by 4-dione derivatives.the immobilized bacterial cells using acrylamide monomers On the other hand, Sathiyanarayanan et al.[24](direct polymerization method) was significantly reported that the active compound produced bydecreased compared to the free cells of Streptomyces Streptomyces sp. MAPS15 possesses 5-Pyrolinido-2-clavuligerus. Moreover, Punita et al. [19] used pyrrolidone as a major part of crude extract and found toImmobilized Acremonium chrysogenum (mold) cells for have prominent antimicrobial potency. The NMR datacephalosporin-C production. It was found that cell growth confirms the presence of pyrrole derivative. Pyrrole is anrate of immobilized cells was reduced with about 39% of organic heterocyclic compound of five-memberedthe growth rate of free cells. diunsaturated ring structure composed of four carbon

Contrary, Srinivasulu et al. [20] studied the atoms and one nitrogen atom. Pyrrolidone is a keto-immobilization effect of Streptomyces marinensis NUV-5 pyrrole, which is a 5-membered lactam structureusing calcium alginate for the production of neomycin. compound (gamma-butyrolactam). Also, Sai LakshmanThey reported the antibiotic productivity was enhanced and Ramachandra [25] isolated a bacterial strainwith 32% on the use of the immobilized cells over the use Micrococcus luteus that capable of produce an anti-of the conventional free-cell. cancer agent which was identified as pyrrolo (1, 2-alpha)

On the other hand our results revealed that pyrazine1, 4 dione hexahydro 3-(2-methylpropyl).adsorption method was more efficiently in maximization ofthe anti-inflammatory activity using Bacillus ACKNOWLEDGMENTbaekryungensis AMHSU. The immobilized cells uponluffa pulp showed obviously higher anti-inflammatory Mamdouh Abdel-Mogib, Professor of Naturalactivity (95.36) than that of other supported materials and Product's Chemistry. Faculty of Science. El Mansourafree cells (89.23%). University. For his valuable help in chemistry section.

In agreement with our results, Delani et al. [21]showed that the most suitable matrix for the REFERENCESimmobilization of Bacillus firmus strain 7B was syntheticsponge and for Bacillus sphaericus strain 41 was loofa 1. Alexander, J.M., D.A. Milner and A.H. Sharpe, 2015.sponge due to the low cost process and improvement the Chapter 3: Inflammation and Repair. Robbins &production of â-cyclodextrin. Contrary, results obtained Cotran Pathologic Basis of Disease. Kumar, V.,by El-Naggar et al. [5] on using immobilized Bacillus Abbas, A.K. and Aster, J.C., (editors). 9 ed.:pumilus SMH101 cells (absorbed bacterial cells on solid Philadelphia, Saunders, Elsevier., pp: 69-111.supporters; luffa pulp and sponge) showed low antifungal 2. Mayer, A.M.S., A.D. Rodriguez, R. Berlinck andactivities against F. solani, R. solani and C. albicans. N. Fusetani, 2011. Marine pharmacology in 2007-2008:The average activity of the adsorbed cells was 37.8 and Marine compounds with antibacterial, anticoagulant,41.8%, respectively, com-pared with the free bacterial cells antifungal, anti-inflammatory, antimalarial,of Bacillus pumilus SMH101 58.6%. antiprotozoal, antituberculosis and antiviral

Results of the present study, indicated that, the activities; affecting the immune and nervous systemhighest anti-inflammatory activity had obtained when and other miscellaneous mechanisms of action.ethyl-acetate (96.78%) was used, where N. hexane (8.86) Comp. Biochem. Physiol. C Toxicol. Pharmacol.,was less effective in extraction of the anti-inflammatory 153(2): 191-222.

th


83

3. Piel, J., 2004. Metabolites from symbiotic bacterial. 13. Yan, F.J., X.L. Tian, S.L. Dong, Z.H. Fang andNat. Prod. Rep., 21(4): 519-538.

4. El-Sersy, N.A., 2007. Bioremediation of Methyleneblue by Bacillus thuringiensis 4G1: Application ofstatistical designs and surface plots for optimization.Biotechnology, 6: 34-39.

5. El-Naggar, M.M., U.M. Abdul-Raouf, H.A.H. Ibrahimand W.M.M. El-Sayed, 2014. Saccharification of Ulvalactuca via Psoudoaltromonas piscicida for biofuelproduction. Journal of Energy and NaturalResources, 3(6): 77-84.

6. Mizushima, Y. and M. Kobayashi, 1968.Interaction of anti-inflammatory drugs withserum proteins, especially with somebiologically active proteins. J. of Pharma. Pharmacol.,20: 169-173.

7. Sakat, S., A.R. Juvekar and M.N. Gambhire, 2010. Invitro antioxidant and anti-inflammatory activity ofmethanol extract of Oxalis corniculata Linn.International Journal of Pharma and PharmacologicalSciences, 2(1): 146-155.

8. Plackett, R.L. and J.P. Burman, 1946. The design ofoptimum multifactorial experiments. Biometrika.,33(4): 305-25.

9. El-Sharouny, E.E., N.M.K. El-Toukhy, N.A. El-Sersyand A.A. E-A.E l-Gayar, 2015. Optimization andpurification of mannanase produced by analkaliphilic-thermotolerant Bacillus cereus N1isolated from Bani Salama Lake in Wadi El-Natron.Biotechnology, Biotechnological Equipment.,29(2): 315-323.

10. El-Naggar, M.M., H.A.H. Ibrahim, M.G. Battah,F.K. A. Al-Gawad and M.S. Ibrahim, 2014. Antifungalagent production from a new marine Bacilluspumilus SMH101. African Journal of MicrobiologyResearch, 8(3): 286-296.

11. Do, M.A.T., 2012. Isolation and characterization ofanti-inflammatory compounds from marineorganisms: Eucratea loricate and Echinusesculentus. Master thesis. Institute of Pharmacy,Faculty of Health, University of Tromso.

12. Umapathy, E., E.J. Ndebia, A. Meeme, B. Adam,P. Menziwa, B.N. Nkeh-Chungag and J.E. Iputo,2010. An experimental evaluation of Albucasetosa aqueous extract on membrane stabilization,protein denaturation and white blood cell migrationduring acute inflammation. J. Med. Plants Res.,4: 789-795.

G. Yang, 2014. Growth performance, immune responseand disease resistance against Vibrio splendidusinfection in juvenile sea cucumber Apostichopusjaponicus fed a supplementary diet of the potentialprobiotic Paracoccus marcusii DB11. Aquaculture,420-421: 105-111.

14. Thakur, D., T.C. Bora, G.N. Bordoloi and S.Maiumdar, 2009. Influence of nutrition and culturingconditions for optimum growth and antimicrobialmetabolite production by Streptomyces sp. 201. J.Mycol. Med., 19: 161-167.

15. Usha Kiranmayi, M., P. Sudhakar, K. Sreenivasuluand M. Vijayalakshmi, 2011. Optimization of culturingconditions for improved production of bioactivemetabolites by Pseudonocardia sp. VUK-10.Mycobiology, 39: 174-181.

16. Anuradha, V.G., A. Nandini, M. Geetha and P.Gautam, 2004. A novel medium for the enhanced cellgrowth and production of prodigiosin from Serratiamarcescens isolated from soil. BMC Microbiol.,4: 1-11.

17. Pradeep, B.V., F.S. Pradeep, J. Angayarkanni andM. Palaniswamy, 2013. Optimization and productionof prodigiosin from Serratia marcescens MBB05using various natural substrates. Asian J. Pharm.Clin. Res., 6(1): 34-41.

18. Freeman, A. and Y. Aharonowitz, 1981.Immobilization of microbial cells in cross linked,pre-polymerized, linear polyacrylamide gels:Antibiotic production by immobilizedStreptomyces clavuligerus cells. Biotechnol. Bioeng.,23: 2747-2759.

19. Punita, M., S. Pradeep and K. Subir, 2007. Productionof CPC using immobilized cells of Acremoniumchrysogenum by entrapment technique in ALR.(cephalosporin C). Inter. J. Biotechnol. Biochem.,3(1): 1-8.

20. Srinivasulu, B., K. Adinarayana and P. Ellaiah, 2003.Investigations on neomycin production withimmobilized cells of Streptomyces marinensis NUV-5in calcium alginate matrix. AAPS Pharm. Sci. Tech.,21: 57-60.

21. Delani, T.C., R. Pazzetto, C.S. Mangolim, V. CarvalhoFenelon, C. Moriwaki and G. Matioli, 2012.Improved production of cyclodextrins byalkalophilic bacilli immobilized on synthetic or loofasponges. International Journal of MolecularSciences, 13: 13294.


84

22. Yang, S.C., C.F. Lin, W.Y. Chang, J. Kuo, Y.T. Huang, 24. Sathiyanarayanan, G., R. Gandhimathi, B.P.J. Chung and T.L. Hwang, 2013. Bioactive Sabarathnam and G. Seghal Kiran and Selvin, J., 2014.secondary metabolites of a marine Bacillus sp. Optimization and production of pyrrolidoneInhibit superoxide generation and elastase release in antimicrobial agent from marine sponge-associatedhuman neutrophils by blocking formyl peptide Streptomyces sp. MAPS15. Bioprocess Biosyst Eng.,receptor 1. Molecules, 18(6): 6455-6468. 37: 561-573.

23. Yang, S.C., P.J. Sung, C.F. Lin, J. Kuo, C.Y. Chen and 25. Sai Lakshman Mithun, V. and C.S.V. RamachandraT.L. Hwang, 2014. Anti-inflammatory effects of Rao, 2012. Isolation and molecular characterization ofsecondary metabolites of marine Pseudomonas sp. in anti-cancerous compounds producing marinehuman neutrophils are through inhibiting P38 bacteria by using 16s rRNA sequencing and gc-msMAPK, JNK and calcium pathways. PLoS ONE., techniques. International Journal of Modern9(12): e114761. Engineering Research, 2(6): 4510-2515.

Production of Anti-Inflammatory Pyrrol Compound from ...2)16/1.pdf11 2Manal M. El-Naggar, Hanan M....

Documents

Transcript of Production of Anti-Inflammatory Pyrrol Compound from ...2)16/1.pdf11 2Manal M. El-Naggar, Hanan M....