Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data...
Transcript of Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data...
![Page 1: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/1.jpg)
Data Preprocessing
UE 141 Spring 2013
1
Jing Gao SUNY Buffalo
![Page 2: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/2.jpg)
Outline
• Data • Data Preprocessing
– Improve data quality – Prepare data for analysis
• Exploring Data – Statistics – Visualization
2
![Page 3: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/3.jpg)
Document Data • Each document is a collection of words
3
![Page 4: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/4.jpg)
Transaction Data
• A collection of transactions – Each transaction involves a set of items
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
4
![Page 5: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/5.jpg)
Graph Data
Aspirin Yeast protein interaction network
Internet Co-author network
5
![Page 6: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/6.jpg)
Sequence Data
• DNA Sequence GGTTCCGCCTTCAGCCCCGCGCCCGCAGGGCCCGCCCCGCGCCGTCGAGAAGGGCCCGCCTGGCGGGCGGGGGGAGGCGGGGCCGCCCGAGCCCAACCGAGTCCGACCAGGTGCCCCCTCTGCTCGGCCTAGACCTGAGCTCATTAGGCGGCAGCGGACAGGCCAAGTAGAACACGCGAAGCGCTGGGCTGCCTGCTGCGACCAGGG
6
![Page 7: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/7.jpg)
Average Monthly Temperature of land and ocean
Spatial-Temporal Data
7
![Page 8: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/8.jpg)
Record Data • Data that consists of a collection of records,
each of which consists of a fixed set of attributes
Tid Refund Marital Status
Taxable Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes 10
8
![Page 9: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/9.jpg)
• Collection of data objects and their attributes
• An attribute is a property or characteristic of an object – Examples: eye color of a person,
temperature, etc. – Attribute is also known as
variable, field, characteristic, or feature
• A collection of attributes describe an object – Object is also known as record,
point, case, sample, entity, or instance
Tid Refund Marital Status
Taxable Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes 10
Attributes
Objects
Record Data
9
![Page 10: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/10.jpg)
Types of Attribute
• Categorical Attribute – Has only a finite or countably infinite set of values – Examples: zip codes, weather conditions, or the set of
words in a collection of documents
• Numerical Attribute – Has real numbers as attribute values – Examples: temperature, height, or weight
10
![Page 11: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/11.jpg)
Outline
• Data • Data Preprocessing
– Improve data quality – Prepare data for analysis
• Exploring Data – Statistics – Visualization
11
![Page 12: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/12.jpg)
12
Data Quality Issue
• Data in the real world is dirty – incomplete: lacking attribute values, lacking certain
attributes of interest • e.g., occupation=“ ” (missing data)
– noisy: containing noise, errors, or outliers • e.g., Salary=“−10” (an error)
– inconsistent: containing discrepancies in codes or names, e.g.,
• Age=“42” Birthday=“03/07/1997” • Was rating “1,2,3”, now rating “A, B, C” • discrepancy between duplicate records
![Page 13: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/13.jpg)
13
Preprocessing • Handle missing values
– Ignore the records with missing values – Estimate missing values
• Remove outliers – Find and remove those values that are significantly different
from the others
• Resolve conflicts – Merge information from different data sources – Find duplicate records and identify the correct information
![Page 14: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/14.jpg)
14
Prepare Data for Analysis
• Sampling • Feature selection • Dimensionality reduction • Discretization
![Page 15: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/15.jpg)
Sampling
8000 points 2000 Points 500 Points
• Goal – Extract a subset of records so that the selected records are
representative of original data
15
![Page 16: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/16.jpg)
Attribute Selection
• Redundant attributes – duplicate much or all of the information contained in
one or more other attributes – Example: purchase price of a product and the amount
of sales tax paid
• Irrelevant attributes – contain no information that is useful for the data
mining task at hand – Example: students' ID is often irrelevant to the task of
predicting students' GPA
16
![Page 17: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/17.jpg)
Dimensionality Reduction
• Goal is to reduce the number of attributes by creating a new set of attributes x2
x1
e
17
![Page 18: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/18.jpg)
18
Discretization
• Binning
– Convert numerical data into categorical data
– Divides the range into N intervals
q Sorted data for price (in dollars): 4, 8, 9, 15, 21, 21, 24, 25, 26, 28, 29, 34 * Partition into 3 bins: - Bin 1: 4, 8, 9, 15 - Bin 2: 21, 21, 24, 25 - Bin 3: 26, 28, 29, 34
![Page 19: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/19.jpg)
Outline
• Data • Data Preprocessing
– Improve data quality – Prepare data for analysis
• Exploring Data – Statistics – Visualization
19
![Page 20: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/20.jpg)
Statistics: Center Measurement
Mean: Summing up all the observation and dividing by number of observations. Mean of 20, 30, 40 is (20+30+40)/3 = 30.
n
x
nxxxx
xnxxx
n
ii
n
n
å==
+++= 121
,21
...
variable, thisofmean Then the . variablea of nsobservatio are ...,Let :Notation
Center measurement is a summary measure of the overall level of a dataset
20
![Page 21: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/21.jpg)
Statistics: Variability Measurement
Variance: The variance of a set of observations is the average of the squares of the deviations of the observations from their mean. In symbols, the variance of the n observations x1, x2,…xn is
Variance of 5, 7, 3? Mean is (5+7+3)/3 = 5 and the variance is
413
)57()53()55( 222
=-
-+-+-
1)(....)( 22
12
--++-
=n
xxxxS n
Standard Deviation: Square root of the variance. The standard deviation of the above example is 2.
21
![Page 22: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/22.jpg)
Statistics: Frequency Distribution
Age 1 2 3 4 5 6
Frequency 5 3 7 5 4 2
Frequency Distribution of Age
Grouped Frequency Distribution of Age:
Age Group 1-2 3-4 5-6
Frequency 8 12 6
Consider a data set of 26 children of ages 1-6 years. Then the frequency distribution of variable ‘age’ can be tabulated as follows:
22
![Page 23: Preprocessing - University at Buffalojing/ue141/sp13/doc/Preprocessing.pdf•Data • Data Preprocessing – Improve data quality – Prepare data for analysis • Exploring Data –](https://reader034.fdocuments.net/reader034/viewer/2022050208/5f5af0f35926ad21ec332540/html5/thumbnails/23.jpg)
Question
• Data Visualization – Choose a few creative and fascinating examples of data
visualization to show to the class
23
http://selection.datavisualization.ch/