Plastochromanol-8 and tocopherols are essentiallipid-soluble antioxidants during seed desiccationand quiescence in ArabidopsisLaurent Mène-Saffranéa, A. Daniel Jonesa,b, and Dean DellaPennaa,1

Departments of aBiochemistry and Molecular Biology and bChemistry, Michigan State University, East Lansing, MI 48824

Edited by Bob B. Buchanan, University of California, Berkeley, CA, and approved August 19, 2010 (received for review May 19, 2010)

Given their essential role as vitamin E, tocopherols and tocotrienolshave been studied extensively in animals and plants. In contrast, ourunderstanding of the function of plastochromanol-8 (PC-8), a thirdtype of tocochromanol with a longer side chain, is very limiteddespite thewide distribution of PC-8 in the plant kingdom, includingspecies consumed by humans. To investigate PC-8 function in vivo,we combined the Arabidopsis vte1 mutation that eliminates toco-pherols and PC-8 and causes the accumulation of 2,3-dimethyl-6-phytyl-1,4-benzoquinol (DMPBQ), a redox-active tocopherol precur-sor, and the vte2 mutation that eliminates tocopherols withoutaffecting PC-8. The vte2 vte1 double mutant lacks tocopherols,PC-8, and DMPBQ, and exhibits the most severe physiological andbiochemical phenotypes of any tocochromanol-affected genotypeisolated to date,most notably a severe seedling developmental phe-notype associatedwithmassive lipid oxidation initiated during seeddesiccation and amplified during seed quiescence. In contrast, thepresence of PC-8 in vte2 suppresses or attenuates all of the devel-opmental and biochemical phenotypes observed in vte2 vte1, dem-onstrating that PC-8 is a lipid antioxidant in vivo. Finally, the lowrelative fitness of vte2 vte1 demonstrates that tocopherols and PC-8are in vivo lipid antioxidants essential for seed plant survival.

vitamin E | seed longevity | lipid oxidation | tocochromanol |spermatophyte

Seed-bearing plants (spermatophytes) first appeared in thefossil record during the late Devonian period (about 370 mya)

and represent 90% of the extant terrestrial flora (1). One of thekey innovations for this evolutionary success is the capacity ofseed to maintain a viable desiccated embryo for extended periods(quiescence), thereby allowing seed plants to occupy ecosystemsexperiencing temporary nonpermissive growth conditions (e.g.,drought, frost). Extreme examples of the ability of seed to pre-serve plant genetic resources are demonstrated by the germina-tion and development of plants from 2,000-y-old date seed, 1,300-y-old lotus seed, and 600-y-old canna seed (2). More commonly,seed viability gradually decreases during quiescence as a functionof storage conditions (e.g., temperature, humidity, oxygen) andinitial seed quality (e.g., moisture, pathogens) (3).Genetic factors underlying seed longevity have been studied

only recently (reviewed in ref. 2). Protein repair and folding duringseed development, maturation, and storage have been shown to beimportant factors affecting seed longevity. Overexpression ofL-isoaspartyl O-methyltransferase 1, an enzyme that repairs dam-aged aspartate residues in proteins, reduced seed protein L-iso-aspartyl levels, and enhanced germination compared with WT inaccelerated aging tests, which subject dry seed to heat and highhumidity (4). Similarly, overexpression of the heat stress tran-scription factor HaHSFA9 increased several heat-shock proteinsin seed and improved resistance to accelerated aging treatments(5). Proper development and maturation of the seed coat (testa)also impacts seed longevity. For example, Arabidopsis transparenttesta mutants affected in testa pigmentation, aberrant testa shapemutants with altered testa structure, and the mucilage-deficientapetala2 mutant exhibited reduced seed longevity after naturalaging (6, 7). Finally, the Arabidopsis abscisic acid-insensitive 3 mu-

tant, which has reduced levels of seed storage and late embryoabundant and heat-shock proteins, exhibited reduced seed longev-ity, indicating that ABA-dependent acquisition of desiccation tol-erance is also an important factor influencing seed longevity (6, 8, 9).With regard to small metabolites in seed, the ubiquitous distri-

bution and high levels of tocopherols in seed suggest an importantfunction for these compounds in this organ. When Arabidopsistocopherol-deficient vte2-1 and vte1-1 seed were subjected to ac-celeratedaging, germination rateswere severely reduced, indicatingan important role for tocopherols in seed longevity (10). Germi-nating vte2-1 seedlings accumulated high amounts of oxidized lipidand exhibited a range of aberrant developmental phenotypes, in-dicating an important role of tocopherols as lipid-soluble anti-oxidants (10, 11). Despite also being tocopherol-deficient, vte1-1seedlings did not exhibit these phenotypes, indicating that 2,3-dimethyl-6-phytyl-1,4-benzoquinol (DMPBQ), a tocopherol pre-cursor that accumulates due to the mutation, is also able to preventlipid peroxidation (10, 11).Tocopherols are members of a larger group of compounds

termed tocochromanols that have a hydroxychroman moiety. InArabidopsis, tocopherol cyclase (VTE1) catalyzes formation of thehydroxychromanmoiety fromphytyl-benzoquinol precursors (12).Recently, it has been shown that VTE1 also can cyclize plasto-quinone-9 (PQ-9), a solanesyl-benzoquinol into plastochromanol-8 (PC-8), another type of tocochromanol that accumulates inArabidopsis and likely in most other plants and about which littleis known (13, 14) (Fig. 1). In the current study, we specificallyanalyzed PC-8 function in vivo by creating two Arabidopsis vte2vte1 double mutants that lack tocopherols, PC-8, and DMPBQ.Detailed characterization of these plants in comparison with thesingle-mutant parents demonstrated that both PC-8 and toco-pherols play essential roles in suppressing lipid oxidation initiatedduring seed desiccation and amplified during seed quiescence.This function and the significance of tocochromanols in the evolu-tionary success of spermatophytes are discussed.

ResultsvteMutants Reveal Functions for Plastochromanol-8 in Vivo. The vte1and vte2 mutations affect tocochromanol composition in Arabi-dopsis differently. vte2-1 eliminates tocopherols without affectingPC-8, whereas vte1-1 eliminates tocopherols and PC-8 and cau-ses the accumulation of their respective biosynthetic precursors,DMPBQ in seed and leaves and minor amounts of PQ-9 in seed(10, 15) (Figs. 1 and 2A and Fig. S1). The vte1-2 allele is phe-notypically identical to vte1-1 except that it is leaky in seed, whichaccumulate ∼30% of WT γ-tocopherol levels.

Author contributions: L.M.-S. and D.D. designed research; L.M.-S., A.D.J., and D.D. per-formed research; A.D.J. contributed new reagents/analytic tools; L.M.-S., A.D.J., and D.D.analyzed data; and L.M.-S., A.D.J., and D.D. wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.1To whom correspondence should be addressed. E-mail: dellapen@cns.msu.edu.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1006971107/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1006971107 PNAS | October 12, 2010 | vol. 107 | no. 41 | 17815–17820

PLANTBIOLO

GY

Dow

nloa

ded

by g

uest

on

Oct

ober

15,

202

0

To assess the role of PC-8 in Arabidopsis, the vte2-1 and vte1(vte1-1 or vte1-2) mutations were combined to generate twodouble mutants, vte2-1 vte1-1 and vte2-1 vte1-2 (referred tohereinafter as vte2 vte1). Despite the absence of genetic linkagebetween VTE1 and VTE2 (AT4G32770 and AT2G18950, re-spectively), no double-homozygous mutants were identifiedamong the 48 adult plants genotyped in each segregating F2population. To test whether double mutants might be lethal, F2plants homozygous for vte2-1 and segregating for the VTE1/vte1alleles were selected and self-pollinated, and the progeny wereplanted immediately on seed set, rather than from seed collectedafter plants had completed development and been fully dried.Seed in both F3 populations appeared to develop normally, andsiliques were filled with visually uniform seed, but on germination,∼25% of the progeny exhibited severe developmental defects anddelayed growth, whereas the remaining (∼75%) grew normally(Fig. S2A). Genotyping showed that these developmentally im-paired plants were invariably homozygous for both vte loci.Despite their severe developmental defects, a low percentage

of vte2 vte1 seedlings survived and produced seed, allowingtocochromanol quantification in both seed and leaf. In contrast tothe vte single mutants, which accumulate one or more tocochro-manols or biosynthetic precursors, vte2 vte1 lack tocopherols, PC-8, and DMPBQ and accumulate only minor amounts of PQ-9 inseed at levels slightly higher than their respective vte1 parents

(Fig. 2A and Fig. S1F). Because vte2 vte1 lacks PC-8 and vte2-1contains it, PC-8 function can be assessed in vivo by comparing thetwo genotypes (Fig. 1).Whereas Col, vte1-1, vte1-2, and vte2-1 seedlings derived from

seed harvested ∼30 d after pollination (DAP) (hereafter termed“fresh seed”) did not exhibit any obvious whole plant phenotype(Fig. 2 B–E), vte2 vte1 seedlings developed hypocotyls, but theircotyledons usually failed to expand, remaining enclosed in theseed coat, and seedling growth was arrested at this stage (Fig. 2 Fand H). On rare occasions, necrotic cotyledons developed andtrue leaves emerged on vte2 vte1 seedlings, but their developmentwas considerably delayed compared with other genotypes (com-pare Fig. 2 B–E with Fig. 2 G and I).

Abnormal Seedling Development Results from Seed Aging. It waspreviously reported that vte2-1 seedlings exhibited a severe andvariably penetrating developmental phenotype typified by failure ofone or both cotyledons to expand and inhibition of root growth (10).Therefore, it was surprising that neither vte2-1 seedlings derived fromfresh seed (Fig. 2E) nor the ∼75% of the vte2vte2VTE1vte1 progenythat were homozygous for vte2-1 (Fig. S2A) exhibited these seedlingdevelopmental defects. Because we analyzed fresh seed (Fig. 2 andFig. S2A), whereas Sattler et al. (10) used seed harvested after theentire vte2-1 plant had completed development and been dried, wehypothesized that seed age could be a key factor influencing the

O2

CO 2

HPP HO

CH 2 COCOOH

HGA HO

OH

CH 2 COOH

3

HO

OH

CH 3

CH 3 CH 3

H

MPBQ

3

HO

OH

CH 3

CH 3 CH 3

H

H 3 C

(accumulate in vte1 mutant)

HO

OH

CH 3

H

CH 3

9

MSBQ

HO

OH

CH 3

H

CH 3

9

H 3 C PQ-9

O

CH 3

H 3

HO

H 3 C

CH 3 CH 3

-tocopherol

O

CH 3

H 3

HO

CH 3

H 3 C

CH 3 CH 3

-tocopherol

O

CH 3

H 3

HO

CH 3 CH 3 -tocopherol

-tocopherol

O

CH 3

H 8

HO

H 3 C

CH 3 CH 3

PC-8

phytyl-PP

C O2 + PP i CO 2 + PP i

PPO H

CH 3

9

solanesyl-PP

HPPD/PDS1

HPT/VTE2 HST/PDS2

TC/VTE1 TC/VTE1TC/VTE1

SA M VTE3

SA M VTE3

SA M TMT/VTE4

SA M TMT/VTE4

compounds eliminated in the vte1 mutant

compounds eliminated in the vte2 mutant

DMPBQ

compounds eliminated in vte2 vte1 double mutants

O

CH 3

H 3

HO

CH 3

CH 3 CH 3

3

CH 3 CH 3

H PPO

Fig. 1. Tocochromanol biosynthetic pathway in Ara-bidopsis including the VTE1-dependent cyclization ofPQ-9 into PC-8. vte2-1 eliminates synthesis of com-pounds in the green box, vte1 eliminates those in thered box, and vte2-1 vte1 eliminates those in the blackbox. DMPBQ, which does not accumulate in WT seed orleaves, accumulates to high levels in vte1. HGA, homo-gentisic acid; HPP, p-hydroxyphenylpyruvate; HPPD,HPP dioxygenase; HPT (HST): homogentisate phytyl (orsolanesyl) transferase;MPBQ (MSBQ), 2-methyl-6-phytyl(or solanesyl)-1,4-benzoquinol; PP, diphosphate; PDS,phytoene desaturase; SAM, S-adenosylmethionine; C,tocopherol cyclase; TMT, tocopherol methyltransferase.

17816 | www.pnas.org/cgi/doi/10.1073/pnas.1006971107 Mène-Saffrané et al.

Dow

nloa

ded

by g

uest

on

Oct

ober

15,

202

0

phenotype of vte2-1 seedlings. Indeed, Arabidopsis flowers developasynchronously, and when the lowermost siliques are fully mature,the uppermost are just forming; thus, the actual age of seed harvestedfrom a dry plant, as done by Sattler et al. (10), may differ in age by asmuch as 2 mo. To test this hypothesis, we compared vertically grownseedlings derived from fresh seedwith those held for an additional 30d at room temperature (hereafter termed “aged seed”). Comparedwith WT, the root length of vte1-2 was not significantly different;those of vte1-1 and vte2-1 were significantly reduced, by 19% and15%, respectively; and those of vte2 vte1 were reduced by 93% (Fig.3A). When aged seed were assessed, all genotypes displayed modestbut significant reductions in root length compared with fresh seed ofeach genotype, with the exception of vte2-1, for which root growthwas reduced by 58%. The critical role of seed aging in the abnormaldevelopment of vte2-1 seedlings is illustrated in Fig. 3B.We also characterized the effect of seed aging on growth bio-

chemically in 8-d-old seedlings by quantifying eicosenoic acid(20:1), a fatty acid that accumulates almost exclusively in storagelipids and is a marker of the progress of triacylglycerol (TAG)breakdown during germination and early seedling development.Before imbibition, 20:1 levels in fresh and aged dry seed of thedifferent genotypes were similar to those in WT (Fig. S3A). Col,vte1-1, and vte1-2 seedlings derived from fresh or aged seedcontained < 2% of their initial 20:1 levels, indicating that TAGdegradation proceeds efficiently in these genotypes and is un-affected by seed aging (Fig. 3C). Like Col, vte2-1 seedlings derivedfrom fresh seed contained < 2% of their initial 20:1 content, butthose derived from aged seed contained 30%, indicating that seedaging strongly affected TAG breakdown in vte2-1. Even morestriking, vte2 vte1 seedlings derived from fresh seed contained∼30% of their initial 20:1 levels, indicating that complete toco-chromanol deficiency strongly inhibits TAG breakdown in theabsence of seed aging. The 20:1 content of vte2 vte1 seedlings

derived from aged seed was ∼40% of initial levels, demonstratingthat, as with vte2-1, seed aging further inhibits TAG breakdown inthe double mutant. Collectively these data show that the growthinhibition seen in both vte2 vte1 and vte2-1 seedlings is dependenton seed aging, indicating a critical role for PC-8 and tocopherolsbefore seed imbibition.The germination rates (percentage of seed showing radicle

emergence, but not necessarily root growth, after 7 d) of freshseed of all genotypes were >99%, indicating that PC-8 and/ortocopherol deficiency does not significantly affect germination offresh seed (Fig. S3B). When the same batches of seed were testedafter being aged for 6 mo at room temperature, the germinationrates of vte1-1 and vte1-2 mutants were not different from WT,whereas that of vte2-1 was 15% lower and those of the two vte2vte1 genotypes were 45% and 33% lower, respectively.

Together, PC-8 and Tocopherols Protect Polyunsaturated Fatty Acidsfrom Oxidation During Seed Desiccation and Quiescence. Previousstudies have shown that the abnormal phenotype of vte2-1 seedlingsis associated with massive lipid oxidation (10, 11). We found thatvte2-1 seedling phenotype is dependent on seed aging (Fig. 3),suggesting that seed aging also might affect lipid oxidation inseedlings. We tested this by quantifying the level of stable markersof lipid oxidation, esterified fatty acid hydroxides (LOHs), in 3-d-old seedlings derived from fresh and aged seed (30 and 60 DAPseed, respectively).Compared with WT, lipid oxidation was not enhanced in vte1-1

or vte1-2 seedlings regardless of the age of the seed from whichthey were derived (Fig. 4A). Consistent with previous reports (10,11) vte2-1 seedlings derived from aged seed contained high levelsof LOHs (44-fold greater than that in WT); however, vte2-1

Col-0

vte2-1

vte1-2

vte2-1 vte1-1

vte2-1 vte1-2

vte1-1

DMPBQ nd

nd

377.6 ± 7.7

nd

nd

612.8 ± 18.7

-toc

48.9 ± 3.3

nd

nd

nd

nd

nd

A

B C

D E

F G H I

PQ-9 nd

nd

45.6 ± 3.0

33.8 ± 4.2

50.5 ± 2.1

51.1 ± 2.2

PC-8

95.8 ± 2.2

nd

nd

nd

nd

104.6 ± 2.6

-toc

24.6 ± 1.3

nd

17.6 ± 1.6

nd

nd

nd

-toc

1 188.9 ± 47.1

nd

419.3 ± 13.8

nd

nd

3.7 ± 0.9

Fig. 2. vte mutants reveal functions for PC-8 in vivo. (A) Quantification oftocochromanols and prenylquinones in 30 DAP seed (average ± SEM, pmol/mg seed; n = 6). ND, not detected. Asterisks represent significance levelsusing Student’s t test relative to Col for PC-8 and to the respective vte1parent for PQ-9; **P < 0.01. The HPLC traces from which these data werederived are shown in Fig. S1. (B–I) Representative 6-d-old seedlings derivedfrom 30 DAP seed; Col (B), vte1-1 (C), vte1-2 (D), vte2-1 (E), vte2-1 vte1-1 (Fand G), and vte2-1 vte1-2 (H and I). (Scale bar: 1 mm.)

20:1

(n

g/s

eed

ling

)

0

700

200

400

500

600

300

100

Col-0 vte1-1 vte1-2 vte2-1 vte1-1vte2-1

vte1-2vte2-1

C

vte1-2 vte2-1

0

20

15

10

5

roo

t le

ng

th (

mm

)

A

B

Col-0 vte1-1 vte1-2 vte2-1 vte1-1 vte2-1

vte2-1 (90 DAP seed)vte2-1 (30 DAP seed)

Fig. 3. Role of seed aging in the seedling developmental phenotype. (A)Root length of 7-d-old seedlings (average ± SEM, mm; n = 40). (B) 12-d-oldvte2-1 seedlings made with 30 DAP seed (Left) and 90 DAP seed (Right).(Scale bar: 1 cm.) (C) Eicosenoic acid levels (20:1) in 8-d-old seedlings (aver-age ± SEM, ng/seedling; n = 6). White and black bars indicate seedlingsderived from fresh (30 DAP) and aged (60 DAP) seed, respectively. Symbolsindicate significance levels using Student’s t test of each genotype relative toWT of the same age (asterisks) and to the same genotype made with freshseed (stars). One symbol, P < 0.05; two symbols, P < 0.01.

Mène-Saffrané et al. PNAS | October 12, 2010 | vol. 107 | no. 41 | 17817

PLANTBIOLO

GY

Dow

nloa

ded

by g

uest

on

Oct

ober

15,

202

0

seedlings derived from fresh seed were indistinguishable fromWT(Fig. 4A). The LOH levels of seedlings derived from fresh vte2vte1 seed were already high and similar to that of vte2-1 seedlingsfrom aged seed, whereas those derived from aged vte2 vte1 seedcould not be determined, because these seedlings did not developsufficiently to provide tissue for analysis. Together, these datademonstrate that seed aging is a key factor controlling the lipidoxidation level in seedlings, indicating that lipid oxidation is likelyinitiated in seed before imbibition and amplified as seed age.Seed development and maturation are well characterized in

Arabidopsis and occur in 3 general stages during the first 20d postpollination. Early morphogenesis (0–5 d) gives the embryo itsbasic architecture. During seed maturation (5–15 d), the photo-synthetic seed expands to full size and accumulates storagereserves, and during late maturation (15–20 d), seed lose theirgreen pigmentation and the embryo becomes quiescent and tol-erant to desiccation (16). To determine the origin of the lipid ox-idation detected in seedlings, LOHs were quantified in greenmature seed (15DAP), in nongreen desiccated seed (20DAP), andin fresh and aged quiescent seed (30 and 60 DAP, respectively).Individual and total LOH levels were not significantly differ-

ent in 15 DAP seed of the various genotypes, indicating no en-hanced lipid oxidation during seed development and maturation(Fig. 4B and Table S1). Similarly, total LOH levels were notsignificantly different in 20 DAP Col, vte1-1, vte1-2, and vte2-1seed, although the latter showed small but significant increases(1.5- to 2-fold) in linolenic acid oxidation products. In contrast,total LOH levels from 20 DAP vte2 vte1 seed were 5- and 8-foldhigher than in WT, and individual LOHs derived from linoleicand linolenic acids were elevated up to 15- and 9.5-fold, re-spectively, over those in WT.By 30 DAP, individual and total LOH levels decreased 10- to

20-fold in Col but only 5- to 10-fold in vte1-1, vte1-2, and vte2-1,such that, although low, LOHs in these genotypes were slightlyhigher (2- to 4-fold) than Col. In 30 DAP vte2 vte1 seed, totalLOHs were 160- to 260-fold those of WT and increased 2- to

3-fold more by 60 DAP. At 60 DAP, total LOH levels increasedthreefold in Col seed and were indistinguishable from those ofvte1-1 and vte1-2. Lipid oxidation in vte2-1 seed increased sub-stantially at 60 DAP, with total LOH being 66-fold that of Col.Together, these data demonstrate that lipid oxidation observedin vte2 vte1 seedlings is initiated during the 5-d window of seeddesiccation (15–20 DAP) and further amplified during seedquiescence (20–60 DAP) and seedling development, whereas thepresence of PC-8 in vte2-1 delays the initiation and amplificationof lipid oxidation well into seed quiescence.

PC-8 and Tocopherols Are Essential for Plant Fitness. The severegrowth inhibition observed in vte2 vte1 seedlings derived fromfresh seed and induced after a short quiescence period in vte2-1often leads to an inability of seedlings to develop into an adultplant, and hence to loss of offspring production. We calculatedthe relative fitness of each genotype by dividing the percentage of60 DAP seed that developed into adult plants capable of pro-ducing seed (also called the survival rate in ecology) by the bestsurvival rate observed among the six genotypes studied. Therelative fitness of Col, vte1-1, and vte1-2 seed did not differ sig-nificantly (Fig. 5A). However, that of vte2 vte1 seed was signifi-cantly reduced by 91% and 85% whereas the presence of PC-8 invte2-1 limited this reduction to only 14% (Fig. 5A). We measuredthe dry weight of the few vte2 vte1 plants that grew to maturityduring the course of plant development to assess the role of PC-8and tocopherols in postseedling development. Compared withWT, dry weights of vte1-1 and vte1-2 plants were not different,whereas those of vte2-1 plants were reduced by 30–60% andthose of vte2 vte1 plants were reduced by 55–85%, depending onthe time point assessed (Fig. 5B). Despite these large absolutedifferences in final plant dry weights, slopes of the regressionlines for the different genotypes were not statistically different,indicating that after the initial seedling growth inhibition, allgenotypes have similar growth rates (Fig. S3C).

DiscussionTocopherol cyclases (TC) catalyze formation of the chromanolmoiety of tocochromanols, a compound class that includes toco-pherols and tocotrienols, well-studied compounds derived fromphytyl- and geranylgeranyl-benzoquinols, respectively. Despitethe absence of tocotrienols in Anabaena and Arabidopsis, theirrespective TCs also can convert geranylgeranyl-benzoquinols intotocotrienols, indicating a relatively broad substrate specificity ofTCs (17–19). Given the structural similarities between dimethyl-solanesyl-benzoquinol [plastoquinone-9 (PQ-9)] and dimethyl-phytyl-(or geranylgeranyl)-benzoquinol, it had been suggestedthat TC may also cyclize PQ-9 into PC-8, a third type of toco-chromanol with a 40 carbon unsaturated side chain derived fromsolanesyl (20, 21). The lack of PC-8 in the Arabidopsis vte1mutantand in its orthologous corn mutant sxd1 (13, 14) (Fig. 2A and Fig.S1), combined with the increased PC-8 levels in plants over-expressing Arabidopsis or corn TC (20, 21), support this conclu-sion. All plants contain TC and PQ-9 and thus have the potentialto produce PC-8. Indeed, a literature search showed that PC-8 iswidely distributed throughout the plant kingdom, being present inbryophytes, gymnosperms, and angiosperms (Table S2).Whereas the properties and functions of tocopherols and to-

cotrienols are widely described in plants, cyanobacteria, andanimals (22–24) just a single report has shown that PC-8 is a lipid-soluble antioxidant in vitro (25), and there are no data describingPC-8 function in vivo. To assess PC-8 function in vivo, we gen-erated an Arabidopsis vte2 vte1 genotype. vte2 vte1 have the mostextreme physiological and biochemical phenotypes of any toco-chromanol-affected genotype isolated to date, including a severeseedling developmental phenotype, root growth inhibition, re-duced triacylglycerol metabolism during germination, and re-duced relative fitness (Figs. 2 and 3 and Fig. S3). In comparison,the presence of PC-8 in vte2-1 suppresses or attenuates all of thephenotypes observed in vte2 vte1, demonstrating that PC-8 playsa role in vivo. Despite these differences, the phenotypes of both

100

1 LO

H (

pm

ol/n

mo

l FA

)

NA NA

seedlings

Col-0 vte1-1 vte1-2 vte2-1 vte2-1 vte1-1

vte2-1 vte1-2

10

10

60

50

0

40

30

20

LO

H (

pm

ol/n

mo

l FA

)

15 20 30 60days after pollination

seeddesiccation

seedquiescence

A

B

Fig. 4. PC-8 and tocopherols inhibit lipid oxidation during seed desiccationand quiescence. Total hydroxylinoleic and hydroxylinolenic acid levels in (A)3-d-old seedlings derived from fresh (30 DAP) and aged (60 DAP) seed (whiteand black bars, respectively; average ± SEM, pmol/nmol FA; n = 4) and (B) 15,20, 30, and 60 DAP seed (average ± SEM, pmol/nmol FA; n = 5 or 6). Whitecircles represent Col; white triangles, vte1-1; white squares, vte1-2; whitediamonds, vte2-1. Black triangles represent vte2-1 vte1-1; black squares,vte2-1 vte1-2. Values for Col-0, vte1-1, and vte1-2 are not significantly dif-ferent (see Table S2 for the full dataset), and thus data points overlap.Symbols (asterisks and stars) represent significance levels using Student’st test of each genotype relative to Col of same age (asterisks) and to thesame genotype made with fresh seed (stars). One symbol, P < 0.05; twosymbols, P < 0.01. FA, fatty acid; NA, not analyzed.

17818 | www.pnas.org/cgi/doi/10.1073/pnas.1006971107 Mène-Saffrané et al.

Dow

nloa

ded

by g

uest

on

Oct

ober

15,

202

0

vte2-1 and vte2 vte1 seedlings are exacerbated by seed aging (Figs.3 and 4A). This is most obvious in vte2-1 seedlings, which do notexhibit any developmental or biochemical phenotypes when de-rived from 30 DAP seed, but produce abnormal seedlings exhib-iting high levels of lipid oxidation when derived from 60DAP seed(Figs. 3 and 4A). These results demonstrate that seed aging isa key factor controlling the developmental and lipid oxidationphenotypes in vte2-1 and vte2 vte1 seedlings and suggest that lipidoxidation is initiated in seed before imbibition and amplifiedduring seed quiescence (aging). LOH analysis of developing,desiccating, and quiescent seed support this conclusion. Beforeseed desiccation (15 DAP), all genotypes contained similar LOHlevels, suggesting that mechanisms other than tocochromanolscontrol lipid oxidation or can compensate for the absence oftocochromanols during seed development (Fig. 4B and Table S1).During seed desiccation (15–20 DAP) and early quiescence (20–30 DAP), LOH levels were similar to those inWT in all genotypesexcept vte2 vte1, which exhibited extremely high levels of LOHs,indicating that lipid oxidation is initiated during seed desiccationin vte2 vte1. A large body of literature has documented that seeddesiccation results in extensive oxidative stress (reviewed in ref.26), and our data demonstrate that the abundant tocochromanolsaccumulated in seed are critical in controlling lipid oxidationinitiated during this period.Compared with vte2 vte1, the presence of PC-8 in vte2-1 pre-

vented lipid oxidation during seed desiccation (15–20 DAP) andearly quiescence (20–30 DAP). Lipid oxidation is enhanced invte2-1 seed (and seedlings derived thereof) only after extendedquiescence (60 DAP; Figs. 3 and 4). These results are particu-larly significant when one considers that the mole percent of PC-8 in vte2-1 (and WT) seed accounts for < 10% of the total WTtocochromanol content, indicating that PC-8 is a potent lipid-soluble antioxidant in vivo. This idea is consistent with a reportthat the domestication of flax, whose cultivated species arecharacterized by a high concentration of linolenic acid (a fattyacid very sensitive to oxidation), was paralleled by an increase ofPC-8 content in flax seed (27).

In the absence of tocochromanols, lipid oxidation initiatedduring seed desiccation is further amplified during seed quies-cence and germination (Fig. 4). The severity of the vte2-1 and vte2vte1 seedling phenotypes are directly related to the length of qui-escence (Fig. 3), with the relative fitness of 60 DAP seed beingdecreased by 14% and 90%, respectively (Fig. 5A). The low per-centage of vte2 vte1 seedlings that are able to develop into seed-bearing adult plants likely reflects heterogeneity in lipid oxidationat the level of individual vte2 vte1 seed. Similar to vte2 vte1, 90DAPvte2-1 seed germinate but fail to develop viable plants (Fig. 3B,Right). These results were obtained with seed stored under ambient(dry) conditions, which reduces the rate of decline in seed viability.Under the elevatedmoisture conditions encountered under naturalconditions, seed viability of tocochromanol-deficientmutantswouldbe expected to be even lower. These data indicate that partial ortotal tocochromanol deficiency is incompatible with a primary roleof seed: to preserve viable embryos for extended periods of non-permissive growth conditions (e.g., winter or drought) and therebymaintain a plant’s population within an ecosystem. This demon-strates that the lipid antioxidant function of tocopherols and PC-8during seed desiccation and quiescence is a critical component inthe ecological and evolutionary success of spermatophytes.Beyond establishing an in vivo role for PC-8 and demonstrating

the critical role of tocochromanols during seed desiccation andquiescence, the vte2 vte1 genotype provides additional insight intothe function of tocochromanols and prenylquinones during theplant’s life cycle. Surprisingly, the physiological and biochemicalphenotypes of vte2 vte1 are manifest only between seed desicca-tion and early seedling development (Figs. 2–4). Indeed, as hasbeen reported for vte2-1 (10), adult vte2 vte1 plants also do notexhibit obvious phenotypes, beyond a reduction in dry weightresulting from growth inhibition during early seedling de-velopment (Figs. S2B and S3C). Likewise, before desiccation,lipid oxidation levels of vte2 vte1 seed are similar to those of WT.Interestingly, these developmental stages during which totaltocochromanol deficiency seem to be not critical coincide withtissues being photosynthetic and containing high levels of PQ-9.Indeed, PQ-9 is 3-fold more abundant than α−tocopherol in adultleaf tissues (Fig. 2A and Fig. S1F). In addition to its role as a lipid-soluble electron carrier in photosynthesis, PQ-9 has been dem-onstrated to inhibit lipid peroxidation and scavenge singlet oxygen(28–30), activities that may compensate for the lack of toco-chromanols in leaves of adult vte2 vte1 and vte2 plants. This hy-pothesis is further supported by the vte1-1 mutant, which, despitelacking both PC-8 and tocopherols (Fig. 2A and Fig. S1F), doesnot exhibit enhanced lipid oxidation from seed desiccationthrough seedling development (Fig. 4 and ref. 10). This absence oflipid oxidation in vte1-1 coincides with accumulation of sub-stantial amounts of DMPBQ, a tocopherol pathway intermediatewith the same redox active dimethyl-benzoquinol moiety as PQ-9but substituted with a phytyl, rather than a solanesyl, side chain(Figs. 1 and 2A).Although attractive, the hypothesis that PQ-9 compensates for

the absence of tocochromanols in photosynthetic tissues is likelyimpossible to directly test genetically, because although PQ-9‒deficient genotypes exist, they result in albino, seedling-lethalphenotypes due to loss of photosynthetic electron transport (31,32). However, the clear overlapping lipid-soluble antioxidantactivities of tocochromanol intermediates (PQ-9 and DMPBQ)and tocochromanols (tocopherols, PC-8, and tocotrienols) mightexplain the apparently contradictory reports of substantial phe-notypic differences between mutants or transgenics affecting vte1and vte2 orthologs in different plant species (18, 33).

Materials and MethodsBiological Materials, Germination, Relative Fitness, and Growth Assays. Thevte2-1, vte1-1, and vte1-2mutants are in the Col-0 background (10, 15). Plantswere grown at 22 °C and 100 μmol m−2 s−1 under 12-h light to produce leaftissue and under 16-h light to produce seed. Root growth and germinationassays were performed as described previously (10). Relative fitness is thepercentage of seed that developed into adult plants producing seed (survival

2 3 4 5 6

100

0

10

1

dry

wei

gh

t (m

g/p

lan

t)

time (weeks)

0

100

80

60

40

20 rela

tive

fit

nes

s

Col-0

vte1-1

vte1-2

vte2-1

vte1-1 vte2-1

vte1-2 vte2-1

Col-0 vte1-1 vte1-2 vte2-1 vte1-1 vte2-1

vte1-2 vte2-1

A

B

Fig. 5. Relative fitness and postgerminative growth. (A) Relative fitness ofaged seed (60 DAP). Relative fitness was assessed by determining the per-centage of seed originally sown that developed into adult plants capableproducing seed divided by the highest percentage observed among the sixgenotypes studied (average ± SEM, %; n = 3). Asterisks represent signifi-cance levels using Student’s t test of each genotype relative to WT; **P <0.01. (B) Dry weight of plants obtained from aged seed (60 DAP) that grewbeyond the initial seedling stage (average ± SEM; n = 6).

Mène-Saffrané et al. PNAS | October 12, 2010 | vol. 107 | no. 41 | 17819

PLANTBIOLO

GY

Dow

nloa

ded

by g

uest

on

Oct

ober

15,

202

0

rate) divided by the highest percentage observed among the six genotypes(35). A total of 96 plants per genotype were analyzed in each of three in-dependent experiments. The dry weights of 2- to 6-wk-old plants were de-termined weekly by pooling 20, 15, 12, 6, and 3 individuals, respectively, anddrying for 72 h at 60 °C.

Genotyping. vte2-1, vte1-1, and vte1-2 mutations were genotyped with (d)CAPS. The CAPS marker for VTE2/vte2-1 differentiation has been describedpreviously (34). For VTE1/vte1-1, a 152-bp fragment was amplified with for-ward CTGCTCGTTGGGAGTATAGTACTCGTCCCGTTTACGGTCG and reverseGCTCACACCTGTGGAAAGGC primers. Digestion with TaqI generated 113- and39-bp fragments for vte1-1; VTE1 allele was undigested. For VTE1/vte1-2,a 288-bp fragment was amplified with forward GGAAAGGAGATACGAG-CAACACGCCCGAGCTATTTAAA and reverse GAAATTATGCGACTCAAGGC pri-mers. Digestion with SwaI generated 253- and 35-bp fragments for vte1-2; theVTE1 allele was undigested.

Eicosenoic Acid and Hydroxy Fatty Acid Analysis. Eicosenoic acidwas quantifiedby GC-FID as described previously (10). LOHs were analyzed by normal andreverse HPLC as described previously (10) using 200 mg of seedlings, 10 mg ofseed (30 and 60 DAP), and seed contained in two siliques (15 and 20 DAP) asstarting materials.

Tocochromanol Analysis. Total lipids were extracted from 50 mg of leaf tissueand 15 mg of dry seed as described previously (36). Tocochromanols wereanalyzed by HPLC (HP1100 series; Agilent Technologies) equipped with a diolcolumn (LiChrospher-100 Diol, 250 × 4 mm; Merck) as described previously(37). DMPBQ and PQ-9 (which elute at 2.5 and 3 min, respectively) were ana-lyzed at 256 nm. Standard curveswere constructedwith commercial standards

or those prepared in the laboratory. DMPBQandPQ-9 standardswere purifiedfrom vte1-1 seed and iris bulbs, respectively, as described previously (38). Aγ-tocopherol standard curve (37) was used for PC-8 quantification.

Mass Spectrometry Analysis. HPLC fractions corresponding to each peak in thediol system were characterized by LC-MS using a Shimadzu LC-20AD pumpcoupled to aWaters LCT Premiermass spectrometer. Samples were analyzed innegative ion mode using the electrospray ionization source with capillaryvoltage set to −4,600 V to enhance quinone ionization. Acquisition of massspectra with different degrees of fragmentation was performed by switchingaperture 1 voltage between 20, 35, 50, 65, and 80 V. Samples (10 μL) wereseparated with a C18 column (Ascentis Express; 2.1 × 50 mm, 2.7 μm particles;Supelco) using a ternary gradient (A: 10 mM aqueous ammonium acetate, B:methanol; C: 2-propanol) at 0.3 mL/min as follows: hold at 80%A/20%B until0.5 min, linear gradient to 5%A/95%B at 8 min, linear gradient to 5%A/15%B/80%C at 15 min, and hold until 18.0 min. The mass scale was calibrated using0.1%aqueous H3PO4 andN-butylbenzenesulfonamide as an internal lockmassfor improved mass accuracy. Identification of tocopherols, PC-8, DMPBQ, andPQ-9 were based on agreements of molecular masses ([M-H] for tocopherols,PC-8, and DMPBQ and M for PQ-9) to within 5 ppm of the theoretical valuesand on fragment ions derived from the aryl ring moiety following cross-ringcleavage of the chromanol heterocyclic ring (e.g., m/z 149 for γ-tocopherol).

ACKNOWLEDGMENTS.WethankDrs. C. Benning,A.Vieler, and E. R.Moelleringfor assistance with fatty acid analyses, Dr. David Braun (Pennsylvania StateUniversity) for maize sxd1 seed, and members of the D.D. laboratory formanuscript review. This work was supported by a Michigan State Universitystrategic partnership grant and National Science Foundation Grant MCB-023529 (to D.D.).

1. Pennisi E (2009) Origins: On the origin of flowering plants. Science 324:28–31.2. Rajjou L, Debeaujon I (2008) Seed longevity: Survival and maintenance of high

germination ability of dry seeds. C R Biol 331:796–805.3. Bonner FT (2008) Storage of seeds. Woody Plant Seed Manual, eds Bonner FT,

Karrfalt RP (US Department of Agriculture Forest Service, Washington, DC), AgricultureHandbook 727, pp 85–96.

4. Ogé L, et al. (2008) Protein repair L-isoaspartyl methyltransferase 1 is involved in bothseed longevity and germination vigor in Arabidopsis. Plant Cell 20:3022–3037.

5. Prieto-Dapena P, Castaño R, Almoguera C, Jordano J (2006) Improved resistance tocontrolled deterioration in transgenic seeds. Plant Physiol 142:1102–1112.

6. Clerkx EJM, Blankestijn-De Vries H, Ruys GJ, Groot SPC, Koornneef M (2004) Geneticdifferences in seed longevity of various Arabidopsis mutants. Physiol Plant 121:448–461.

7. Debeaujon I, Léon-Kloosterziel KM, Koornneef M (2000) Influence of the testa onseed dormancy, germination, and longevity in Arabidopsis. Plant Physiol 122:403–414.

8. Ooms JJJ, Leon-Kloosterziel KM, Bartels D, Koornneef M, Karssen CM (1993)Acquisition of dessication tolerance and longevity in seeds of Arabidopsis thaliana: Acomparative study using abscissic acid–insensitive abi3 mutants. Plant Physiol 102:1185–1191.

9. Sugliani M, Rajjou L, Clerkx EJM, Koornneef M, Soppe WJJ (2009) Natural modifiers ofseed longevity in the Arabidopsis mutants abscisic acid insensitive 3-5 (abi3-5) andleafy cotyledon1-3 (lec1-3). New Phytol 184:898–908.

10. Sattler SE, Gilliland LU, Magallanes-Lundback M, Pollard M, DellaPenna D (2004)Vitamin E is essential for seed longevity and for preventing lipid peroxidation duringgermination. Plant Cell 16:1419–1432.

11. Sattler SE, et al. (2006) Nonenzymatic lipid peroxidation reprograms gene expressionand activates defense markers in Arabidopsis tocopherol-deficient mutants. Plant Cell18:3706–3720.

12. Munne-Bosch S, Alegre L (2002) The functions of tocopherols and tocotrienols inplants. Crit Rev Plant Sci 21:31–57.

13. Szymanska R, Kruk J (2008) Plastochromanol, a “new” lipophilic antioxidant inArabidopsis leaves, is synthesized by tocopherol cyclase: The effect of high light onthe level of prenyllipid antioxidants. Photosynthesis, Energy from the Sun: 14thInternational Congress on Photosynthesis, eds Allen JFG, Golbeck J, Osmond B(Springer, Berlin), Vol 91, pp 1581–1584.

14. Zbierzak AM, et al. (2010) Intersection of the tocopherol and plastoquinol metabolicpathways at the plastoglobule. Biochem J 425:389–399.

15. Sattler SE, Cahoon EB, Coughlan SJ, DellaPenna D (2003) Characterization oftocopherol cyclases from higher plants and cyanobacteria: Evolutionary implicationsfor tocopherol synthesis and function. Plant Physiol 132:2184–2195.

16. Baud S, Boutin JP, Miquel M, Lepiniec L, Rochat C (2002) An integrated overview ofseed development in Arabidopsis thaliana ecotype WS. Plant Physiol Biochem 40:151–160.

17. Albermann C, et al. (2008) Biosynthesis of the vitamin E compound delta-tocotrienolin recombinant Escherichia coli cells. ChemBioChem 9:2524–2533.

18. Porfirova S, Bergmuller E, Tropf S, Lemke R, Dormann P (2002) Isolation of anArabidopsis mutant lacking vitamin E and identification of a cyclase essential for alltocopherol biosynthesis. Proc Natl Acad Sci USA 99:12495–12500.

19. Stocker A, Fretz H, Frick H, Rüttimann A, Woggon WD (1996) The substrate specificityof tocopherol cyclase. Bioorg Med Chem 4:1129–1134.

20. Kumar R, et al. (2005) Characterisation of plant tocopherol cyclases and theiroverexpression in transgenic Brassica napus seeds. FEBS Lett 579:1357–1364.

21. Raclaru M, et al. (2006) Increase of the tocochromanol content in transgenic Brassicanapus seeds by overexpression of key enzymes involved in prenylquinone biosynthesis.Mol Breed 18:93–107.

22. Dörmann P (2007) Functional diversity of tocochromanols in plants. Planta 225:269–276.

23. Maeda H, DellaPenna D (2007) Tocopherol functions in photosynthetic organisms.Curr Opin Plant Biol 10:260–265.

24. Atkinson J, Epand RF, Epand RM (2008) Tocopherols and tocotrienols in membranes:A critical review. Free Radic Biol Med 44:739–764.

25. Olejnik D, Gogolewski M, Nogala Kalucka M (1997) Isolation and some properties ofplastochromanol-8. Nahr-Food 41:101–104.

26. Bailly C (2004) Active oxygen species and antioxidants in seed biology. Seed Sci Res14:93–107.

27. Velasco L, Goffman FD (2000) Tocopherol, plastochromanol and fatty acid patterns inthe genus Linum. Plant Syst Evol 221:77–88.

28. Hundal T, Forsmark-Andrée P, Ernster L, Andersson B (1995) Antioxidant activity ofreduced plastoquinone in chloroplast thylakoid membranes. Arch Biochem Biophys324:117–122.

29. Kruk J, Jemiola Rzeminska M, Strzalka K (1997) Plastoquinol and alpha-tocopherolquinol are more active than ubiquinol and alpha-tocopherol in inhibition of lipidperoxidation. Chem Phys Lipids 87:73–80.

30. Kruk J, Trebst A (2008) Plastoquinol as a singlet oxygen scavenger in photosystem II.Biochim Biophys Acta 1777:154–162.

31. Cheng Z, et al. (2003) Highly divergent methyltransferases catalyze a conserved reactionin tocopherol and plastoquinone synthesis in cyanobacteria and photosynthetic eu-karyotes. Plant Cell 15:2343–2356.

32. Norris SR, Barrette TR, DellaPenna D (1995) Genetic dissection of carotenoid synthesisin Arabidopsis defines plastoquinone as an essential component of phytoenedesaturation. Plant Cell 7:2139–2149.

33. Hofius D, et al. (2004) RNAi-mediated tocopherol deficiency impairs photoassimilateexport in transgenic potato plants. Plant Physiol 135:1256–1268.

34. Mène-Saffrané L, Davoine C, Stolz S, Majcherczyk P, Farmer EE (2007) Genetic removal oftri-unsaturated fatty acids suppresses developmental and molecular phenotypes of anArabidopsis tocopherol-deficient mutant: Whole-body mapping of malondialdehydepools in a complex eukaryote. J Biol Chem 282:35749–35756.

35. Ridley M (2009) Evolution (Wiley-Blackwell), 3rd Ed, pp 792.36. Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification.

Can J Biochem Physiol 37:911–917.37. Matthaus B, Vosmann K, Pham LQ, Aitzetmuller K (2003) FA and tocopherol

composition of Vietnamese oilseeds. J Am Oil Chem Soc 80:1013–1020.38. Johnson TW, et al. (2000) Recruitment of a foreign quinone into the A(1) site of

photosystem I. I: Genetic and physiological characterization of phylloquinonebiosynthetic pathway mutants in Synechocystis sp. pcc 6803. J Biol Chem 275:8523–8530.

17820 | www.pnas.org/cgi/doi/10.1073/pnas.1006971107 Mène-Saffrané et al.

Dow

nloa

ded

by g

uest

on

Oct

ober

15,

202

0