THE JOURNAL OF BIOLOGICAL CHEMISTRY

Plasticity in the composition of the light harvesting antenna of higher plants preserves structural integrity and biological function*

Alexander V. Ruban‡§, Svetlana Solovieva‡, Pamela J. Lee‡, Cristian Ilioaia‡, Mark Wentworth‡, Ulrika Ganeteg⎟⎜, Frank Klimmek⎟⎢, Wah Soon Chow¶, Jan M. Anderson¶, Stefan Jansson⎟⎢and Peter Horton‡

From the ‡Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield S10 2TN, UK, ⎟⎢Umeå Plant Science Centre, Department of Plant Physiology, Umeå University, S-901 87 Umeå, Sweden, ¶Photobioenergetics Group, Research School of Biological Sciences, Australian National University, GPO Box 475, Canberra, ACT 2601, Australia

Arabidopsis plants in which the major trimeric light harvesting complex (LHCIIb) is eliminated by antisense expression still exhibit the typical macrostructure of photosystem II in the granal membranes. Here the detailed analysis of the composition and the functional state of the light harvesting antennae of both photosystem I and II of these plants is presented. Two new populations of trimers were found, both functional in energy transfer to the PSII reaction centre, a homotrimer of CP26 and a heterotrimer of CP26 and Lhcb3. These trimers possess characteristic features thought to be specific for the native LHCIIb trimers they are replacing: the long-wavelength form of lutein and at least 1 extra chlorophyll b, but they were less stable. A new population of loosely bound LHCI was also found, contributing to an increased antenna size for photosystem I, which may in part compensate for the loss of the phosphorylated LHCIIb that can associate with this photosystem. Thus, the loss of LHCIIb has triggered concerted compensatory responses in the composition of antennae of both photosystems. These responses clearly show the importance of LHCIIb in the structure and assembly of the photosynthetic membrane and illustrate the extreme plasticity at the level of the composition of the light harvesting system. The light harvesting antenna of higher plants displays a highly conserved complexity in terms of genetic make-up, protein composition, oligomerisation and macrostructure that is mostly poorly understood (1). In the case of PSII there are at least six different polypeptides, which are assembled into a mixture of monomeric and trimeric chl a/b xanthophyll protein complexes, collectively referred to as LHCII. The major complex, LHCIIb is composed of 3 types of polypeptides, products of the Lhcb1, 2 and 3 genes. The Lhcb1 and 2 are the dominating proteins. The minor complexes, CP29, CP26 and CP24 consist of ------------------------------------------------------------------------ *This work was supported by grants from the Biotechnology and Biological Sciences Research Council of the United Kingdom and the INTRO2 European Union FP6 Marie Curie Research Training Network. §To whom correspondence should be addressed. Tel: +44-114-2222713, Fax: +44-114-2222712, E-mail: a.ruban@sheffield.ac.uk.

the Lhcb4, Lhcb5 and Lhcb6 polypeptides and contain approx 15% of PSII chlorophyll. LHCIIb carries up to 60% of the pigments of the PSII antenna (2,3), with efficient energy transfer between chls and with a long chl singlet state excitation lifetime (4,5); this provides a large and highly efficient light harvesting system. LHCIIb is also involved in a crucial low-light adaptation strategy of plants, the state transitions, which control the relative PSI and PSII cross-sections (6). Equally, under light stress, excess light energy in LHCIIb can be safely dissipated into heat, an important photoprotective process, non-photochemical quenching (7). The ability of LHCIIb to exist in different conformations with a range of excited state lifetimes seems to be an important aspect of this latter process (8,9). The native LHCIIb state is a trimer of monomeric pigment-protein complexes. These trimers possess certain unexplained characteristics not found in monomers (e.g. extra chl b, a long wavelength lutein, bound phospholipid). On the other hand, the minor LHCII components, CP26, CP24 and CP29 are always monomeric. Trimeric LHCIIb and the monomeric complexes are associated with the dimeric PSII core, to form the LHCII-PSII supercomplexes, found in the granal membranes of the chloroplast (10). The role of the trimeric state, or indeed of the highly conserved macromolecular organisation of the entire granum is not understood, despite the recent advances in structure determination (3,10,11).

Genetic manipulation of the levels of specific pigments and polypeptides is proving a powerful approach to understanding the structure and function of the photosynthetic antennae (12-15). Lhcb2 antisense Arabidopsis thaliana plants have been constructed by introducing the Lhcb2.1 coding region in the antisense orientation into the plant genome (16). This resulted in not only complete absence of Lhcb2 but also Lhcb1 polypeptides. These plants in spite of having a pale-green appearance were able to develop, grow and produce seeds. Photosynthetic quantum yield was only slightly reduced and despite the absence of the key LHCII polypeptides, chloroplasts of antisense plants possess grana. However the vital adaptive functions of the photosynthetic membrane where LHCIIb plays a key role were found to be significantly inhibited (16); the state transitions were completely absent in the

http://www.jbc.org/cgi/doi/10.1074/jbc.M511415200The latest version is at JBC Papers in Press. Published on March 21, 2006 as Manuscript M511415200

Copyright 2006 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

2

antisense plants and NPQ was reduced by over 30 %. Remarkably, despite the absence of LHCIIb, trimeric structures were still found in the antenna, and photosystem II retained its characteristic macro-organisation, the supercomplex structure being virtually indistinguishable from that of the wild type (17). Biochemical analysis showed that the levels of other antenna proteins increase in the antisense plants and we suggested that the trimers are composed of the greatly increased amounts of Lhcb5, which is normally only found in the monomeric CP26 complex.

These observations led to the hypothesis that the increases in expression of other light harvesting genes may be compensatory changes that allow the thylakoid membrane structure to be preserved and photosynthetic performance to be maintained. The oligomeric structure of the antenna, particularly LHCIIb trimerisation, is therefore seen as a key feature of the molecular design of the functional thylakoid membrane. If this hypothesis is correct, these responses indicate the presence of a remarkable level of plasticity and robustness, which must result from a complex response of the altered LHC genome in the form of interplay between the expression of both Lhcb and Lhca genes and in the processes of assembly of supramolecular structure. Therefore, the aim of the current work was to test this hypothesis, firstly by carrying out a systematic analysis of the composition of the light harvesting antenna in the antisense plants, and secondly by determination of the functional competence of the new proteins. The data obtained also allowed us to assess the effectiveness of the compensatory response of the whole antenna system and to address the question of the reason for the trimeric LHCIIb structure and the molecular bases of its assembly and its specific characteristic properties.

MATERIALS AND METHODS

Lhcb2 antisense plants (asLhcb2), line asLhcb2-12, were derived from Arabidopsis thaliana, cv Columbia as previously described (16). Seed was obtained by self-pollination for several successive generations. Wild type (wt) and antisense plants were grown for 8-9 weeks in plant growth rooms with an 8-hr photoperiod with a light intensity of 200 µmol quanta m-2 s-1 and at a day/night temperatures of 22/15°C. Thylakoids were prepared by homogenizing fresh tissue in ice-cold grinding medium (330 mM sorbitol, 5 mM MgCl2, 10 mM Na4P2O7 (pH 6.5), 2 mM iso-ascorbate) with a polytron. The homogenate was then filtered through four layers of muslin followed by two layers of muslin and one layer of cotton wool. The filtrate was centrifuged for 10 min at 5,000g, and the chloroplast enriched pellet resuspended in wash buffer (330 mM sorbitol, 10 mM MES, pH 6.5), followed by a further 10 min centrifugation at 5,000g.

The pellet was then resuspended in 5 mM MgCl2 for 30 s to lyse any remaining intact chloroplasts, followed by an equal volume of osmoticum (660 mM sorbitol, 20 mM KCl, 2 mM EDTA and 100 mM HEPES, pH 6.5). After further centrifugation, thylakoids were resuspended in 20 mM Bis-Tris (pH 6.5), 5 mM MgCl2. The composition of carotenoids was determined by HPLC as described by Ruban et al. (18) with the modifications described by Andersson et al. (13). Chlorophyll content was obtained using the method of Porra et al. (19). Low temperature spectroscopy was performed using an OptistatDN LN-2 cooled bath cryostat (Oxford Instruments). Samples were diluted in a medium containing 70% glycerol (w/v), 20 mM HEPES buffer, pH 7.8, 5 mM MgCl2 and 0.33M sorbitol. The chlorophyll concentration for absorption was 4 µM and for the fluorescence and fluorescence excitation measurements was 1 µM. Polymethyl methacrylatec (PMMA) 1 cm cuvettes were used for all experiments. The temperature of the sample was monitored with a thermocouple sensor (Comark) immersed directly into the sample. Absorption measurements were performed using a Cary 500 UV-Vis-Nir spectrophotometer (Varian) modified to adopt the cryostat. The spectral resolution was 1 nm with a signal-to-noise ratio of 10000. The reduced single spectral beam mode was employed to focus the measuring beam on the sample only and to obtain the maximum light output. Spectra were corrected for the cuvette and buffer medium absorption using Gramms/32 software (Galactic Industries Corporation). Fluorescence emission and excitation spectra were recorded using a SPEX FluoroLog FL3-22 spectrofluorimeter (SPEX Industries Inc.). The excitation light was provided from a Xenon light source. In fluorescence emission measurements excitation was defined at 435 nm with a 5 nm spectral bandwidth. The fluorescence spectral resolution was 1 nm. In fluorescence excitation measurements fluorescence was detected at 685 nm with a 5 nm spectral bandwidth. The excitation spectral resolution was 1 nm. Spectra were automatically corrected for the spectral distribution of the exciting light during data acquisition. For FPLC analysis thylakoid samples were diluted to a final chl concentration of 1.5 mg ml–1 and solubilised by the addition of n-dodecyl α-D-maltoside to a final concentration of 0.85%. Samples were vortexed thoroughly for 1 min and centrifuged for 1 min at 16,000g. The supernatant was then filtered through a 0.45 µm nylon filter and subjected to gel filtration chromatography using a Superdex 200 HR 10/30 column in an Amersham-Pharmacia ÄKTA purifier system using the same buffer and similar conditions as previously described (15,17). For sucrose gradient separation, unstacked thylakoids were treated with 1% n-dodecyl β-D-maltoside with a ratio of β-DM/chl of 10 on ice for 30

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

3

min. Sucrose gradients were seven step exponential gradients from 0.15 to 1.0 M sucrose dissolved in 20 mM HEPES buffer containing 20 mM β-DM. The run time was 18 h at 200,000 g in a SW41 rotor at 4 °C. LHCI was prepared according to the method of Croce et al. (20). To separate LHCII components by non-denaturing Isoelectric focusing (IEF), a procedure modified from that described before (18,21) was used with a Pharmacia Multiphor II Electrophoresis system protocol. A slurry of volume 100 ml containing 4% Ultradex (Amersham), 2% Ampholine carrier ampholites (pH 3.5-5.0), 1% glycine, and 0.06% n-dodecyl β-D-maltoside (Sigma) was prepared and poured into the 24.5 x 11.0 cm tray to form a homogeneous layer. After carefully removing air bubbles, the tray was placed 70 cm below a small fan on a balance to allow the monitoring of the weight of evaporated water; 30 g of water was evaporated in approx. 2 h. Freshly prepared PSII particles or unstacked thylakoids with a total chl concentration of 2.5 mg/ml were resuspended in 1 ml of deionized water, and 0.5 ml of 3% n-dodecyl β-D-maltoside was added on ice. Incubation with occasional stirring lasted for 30 min. Samples were centrifuged at 35,000 g and the supernatants were applied 2 cm from the cathode of the precooled and prefocused gel (1 h of prefocusing at 8 W) using a sample applicator (10 x 2 cm). After the samples had been applied, the gel was allowed to equilibrate for 3 min before the start of focusing. The focusing procedure was carried out for 18 h at a constant power of 8 W at 4oC. The initial and final current values were normally about 15 and 5 mA, respectively. After measuring pH values, each green band was carefully collected using a spatula and eluted using columns with a minimum volume of a solution containing 100 mM Hepes (pH 7.6) and 0.01% n-dodecyl β-D-maltoside. For electrophoresis and western blot analysis, Protein samples were solubilized and separated by 15% denaturing SDS–PAGE. Roughly equal amounts of chlorophyll were loaded, about 2 µg per lane for PSII membranes and 0.5 µg for isolated supercomplexes and trimers. Proteins were transferred to Hybond-P PVDF membrane (Amersham Pharmacia) in a Mini-Trans-Blot transfer cell (Bio-Rad) at 30mA for 12 h. Membranes were detected with specific antibodies against the proteins Lhcb1–Lhcb6. The primary antibody was detected by a horseradish peroxidase (HRP)-labeled secondary antibody using an ECL Plus kit (Amersham-Pharmacia). Chemiluminescence was detected on Hyperfilm ECL (Amersham-Pharmacia) photographic film. For the antibodies against Lhcb1, Lhcb2 and Lhcb5, linear densitometric responses were found in the range of 0.5–10 µg of chl per lane for PSII membranes. For quantification of PSI, 1 µg chl was separated on SDS-PAGE and analyzed as described by Andersson et al. (13). PsaD and Lhca proteins were measured by densitometry of the immunoblots.

Total RNA was prepared from six-week-old plants as described in Ganeteg et al. (22). For Lhca4, the same primers as in Ganeteg et al. (22) were used, while for Lhcb5 the following primers were used: b5Fw:5´GGAGCAGCTGGTTTCATCATTCCTG;b5Rv:5´GAGAACAACCTCAGCAACTACGGCG. The primers were constructed so that the amplicon spanned an intron. cDNA was synthesised from 150 ng of RNA using a First-Strand cDNA Synthesis Kit (Amersham Biosciences, Little Chalfont, UK). Quantum RNA 18S Internal Standards (Ambion, Austin, USA) were used as internal standards. The linear range of the primers and the optimal ratio of 18S:primers:competimers were determined, as recommended by the vendor. PCR reactions were performed using Amplitaq Taq polymerase (Applied Biosystems, Foster City, USA). Both the cDNA synthesis and the PCR reactions were performed in triplicate, giving a total of n=9 reactions. For microarray analysis, total RNA (1µg) from three separately grown batches of WT (WT1-3) and asLhcb2 (asLhcb21-3) plants was amplified as described by Allemeersch et al. (23), using the MessageAmp II aRNA Kit (Ambion, Austin, USA). cDNA synthesis, labelling, microarray hybridization, scanning was performed according to Sjödin et al. (24) and stored in the public database UPSC-BASE (http://www.upscbase.umu.se) as experiment number UMA-0061. Statistical analysis was conducted using UPSC-BASE and was based on three dye swaps (i.e. six microarrays). The raw data were transformed (25) and print-tip loss normalized (26) and analysed further in UPSC-BASE.

RESULTS

Photosystem II antenna function in the absence of LHCIIb. Low-temperature absorption and fluorescence spectroscopy were used to analyse the antenna in the asLhcb2 plants, to provide information on the organisation of the pigments as well as their efficiency in supplying energy to the reaction centre complexes. Figure 1A shows 77K absorption spectra of thylakoid membranes and their second derivatives. The latter was used to resolve the complex spectral structure in order to identify different chlorophyll species and assign them to various pigment proteins (27). Chl b (650 nm) and the short-wavelength chl a at 661 nm are strongly reduced in the spectrum of asLhcb2 thylakoids, indicating the disappearance of typical LHCIIb spectral forms. The major maximum at 675 nm in wt is 3 nm red-shifted to 678 nm in asLhcb2 and the form at 683 nm, attributed to the PSII core antenna complex, CP47 (28), is enhanced. The bands above 690 nm that belong to PSI (29) remains unchanged, since the spectra were normalised in this region. This picture is consistent with the fact that in asLhcb2 plants the amount of LHCII is reduced and the PSII to PSI ratio is strongly enhanced i.e. there is a larger number of PSII units with a

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

4

smaller antenna size (16). Figure 1B displays the 77K fluorescence spectra of the wt and asLhcb2 thylakoids. The PSII fluorescence region from 670 to 700 nm was the most affected by the absence of LHCIIb. The difference spectrum, wt-minus-asLhcb2, exhibits a PSII core band at 685 nm with strong shoulders at 681 and 699 nm, both attributed to LHCIIb (30). This difference spectrum is explained by the reduction in content of LHCII, reducing the amount of energy transferred to the core and also the amount of direct emission. There is no indication of increase in fluorescence in the asLhcb2 plants that would arise from disconnected or non-functional antenna.

Figure 1C displays the Soret band absorption spectra and PSII fluorescence excitation spectra used to find whether the chl and xanthophyll species are transferring excitation energy to the PSII core in the asLhcb2 plants. For both wt and asLhcb2 thylakoids the features in the absorption spectra closely matched those in the excitation spectra. The second derivative analysis of the wt and asLhcb2 absorption spectra revealed very similar chl a profiles, reduced participation of chl b (471 nm band) and efficient involvement of xanthophylls absorbing at 485 nm (neoxanthin) and 495 nm (lutein). The most red-shifted Soret band at 510 nm is present in the spectrum of both the wt and asLhcb2 thylakoids. This band is characteristic of the trimeric state of LHCIIb (31). A very similar picture was obtained using detection at 678 nm – LHCII fluorescence band (not shown). Therefore these data reveal the characteristics of a new type of PSII antenna in the asLhcb2 plants in which antenna chls and xanthophylls are effectively transferring energy to the chl of PSII core complexes and which is likely to be trimeric.

Polypeptide and pigment composition of LHCII. Thylakoid membranes from wt and asLhcb2 plants were solubilised with detergent and subjected to sucrose gradient centrifugation, which separates three fractions enriched in PSI, PSII cores and LHCII (Figure 2A). In agreement with previous work (16), measurement of the amount of chlorophyll in each fraction shows that the amount of PSI is very similar in both the wild type and antisense plants, but the amount of LHCII is about 2 times reduced and the PSII core complexes are twice enhanced in the asLhcb2 plants. As expected, the polypeptide composition of the LHCII fraction was also different. In the wt, this fraction shows the expected profile of LHCII polypeptides (Figure 2B). In the preparation from the asLhcb2 plants, Lhcb 4, 5 and 6 were found (arrows), with a significant increase in the relative content of Lhcb5, identified by the Western blotting, consistent with previous results (16,17). However, in addition to the Lhcb polypeptides, a group of four smaller polypeptides from 20 to 23 kDa was clearly seen (bracketed). Western blotting using Lhca 1-4 antibodies positively identified these as being from LHCI (Figure 2C). It should be noted that the LHCII

fraction from asLhcb2 did not contain the PSI core polypeptides, which are signified by the high MW bands of the reaction centre and the number of smaller bands around 10 kDa. Normally, the Lhca proteins always stay very tightly attached to the PSI core under the solubilisation conditions/treatments used here, and special treatments using a combination of non-ionic and ionic detergents are needed to remove them. This suggests that the asLhcb2 plants contain a population of loosely bound LHCI not found in the wt.

The pigment compositions of the wt and asLhcb2 thylakoids were different, and reflected the reduction in LHCII and the increase in PSII content (Table 1). Thus, there were decreases in neoxanthin and chl b, which are enriched in LHCIIb, but an increase in β-carotene, found predominantly in reaction centre cores. It is interesting to note that the content of the xanthophyll cycle carotenoids is higher in the asLhcb2 thylakoids, probably due to the increased content of minor LHCII. The carotenoid compositions of the LHCII fractions also differed. Again the xanthophyll cycle content is higher whereas percentages of neoxanthin and lutein are reduced, as expected from the Lhcb compositions of these fractions and consistent with a fact that the xanthophyll cycle carotenoids have a stronger affinity for binding to the minor LHCII complexes than to LHCIIb. Also the amount of β-carotene is enhanced in the asLhcb2 preparation. This is likely to be a result of the presence of LHCI that is reported to bind this carotenoid (29) and also the CP47 and CP43 that are found in this fraction (Fig. 2B). The chl a/b ratio of the asLhcb2 LHCII preparation was higher than that for the wild type (2.0 vs 1.6). This is consistent with the fact that the chl b-enriched polypeptides, Lhcb1 and 2 were absent.

To get information on what level the amounts of the LHC proteins were regulated, the expression of the genes coding for the different Lhc gene products was examined. When RNA prepared from wt and asLhcb2 leaves were analysed on CATMA whole genome DNA microarrays (32), no differential expression of any Lhca or Lhcb gene could be observed (data not shown). To confirm these data, an independent verification of the results for Lhcb5 and Lhca4, the two proteins which on protein level accumulated most, was made using RT-PCR. Again, the steady-state RNA levels in wt and asLhcb2 were not different (data not shown), indicating that the accumulation of these polypeptides in asLhcb2 may be regulated at the translational or post-translational level.

Analysis of the oligomeric states of the LHCII antennae. Gel filtration was used to determine the oligomerisation states of the new type of LHCII antenna in the asLhcb2 plants. Unstacked thylakoids were solubilised with α-DM and loaded on a gel filtration column. Figure 3A shows typical chromatograms. For the wild type, bands of PSII membrane fragments, PSII supercomplexes, PSI, PSII

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

5

core complexes, LHCII timers and minor LHCII monomers were resolved and assigned as described previously (15,16,33). A similar picture was observed for the asLhcb2 thylakoids (Figure 3A, trace as), although the ratios of the component fractions clearly differed. In part this reflected the different contents of PSII and PSI, discussed above. However, examining the PSII fractions, there was a decrease in the relative proportions of supercomplexes relative to cores, suggesting the former are less stable under the detergent solubilisation procedures used. Similarly, there were more monomeric LHCII relative to trimeric LHCII in the asLhcb2 thylakoids. In fact, upon solubilisation with a slightly increased concentration of α-DM, which has no effect on LHCIIb trimers in the wt, there was almost complete disintegration of trimers in the asLhcb2 thylakoids (trace as’). It should be noted that this disintegration at higher α-DM was not complete and some complexes with a slightly increased retention time remained. The position of this band matched that for dimeric LHCI prepared from isolated PSI complexes and indeed polypeptide analysis showed that this fraction contains polypeptides around 20-23 kDa (see Figure 3B) that were positively identified by Western blots as Lhca1-4 (not shown). It is important to note that only Lhca polypeptides are present, not those from the PSI core complex. Consistent with this result, these Lhca polypeptides were found in the trimeric LHCII fraction from asLhcb2 plants, whereas they were absent from the wt. The occurrence of the LHCI components in the LHCII gel filtration profile is unexpected, similar to the finding of LHCI in the sucrose gradient LHCII band (see above). In fact LHCI polypeptides were even found in the PSII supercomplex fraction of the asLhcb2 plants, but not at all in that of the wt (Figure 3B, C). However, most significantly, PSII membrane fragments did not contain any LHCI, indicating that the presence of the Lhca1-4 proteins in the LHCII preparations is only contamination by a population of loosely bound LHCI found only in asLhcb2 plants – it does not represent Lhca proteins bound to PSII.

Purification of LHCII from asLhcb2 plants. Isoelectric focussing was used to prepare LHCII fractions from the asLhcb2 plants. Figure 4 shows the results of IEF of wt and asLhcb2 thylakoids. The sample from the asLhcb2 thylakoids was enriched in monomeric CP26 (identified by its pI position, absorption spectrum and Western blotting) compared to the wt sample (Figure 4A). In the wt most of the chlorophyll is found in the area that contains LHCIIb trimers. This area is depleted in the asLhcb2 sample, but one band is very prominent. This band is slightly up-shifted in comparison to that of the wt thylakoids, with pIs around 4.3 and 4.15 respectively. Two distinct bands were collected from the LHCII region and labelled as ief1 and ief2. Polypeptide analysis indicated differences between these two fractions of the asLhcb2 sample (Figure 4B). The first band

contained both Lhcb5 and Lhcb3 polypeptides. The Lhcb3 polypeptide was present almost exclusively in this band and in amounts much higher than in the wt LHCII (Figure 4C). The second band contained Lhcb5 but very little Lhcb3, and in addition a number of smaller polypeptides from 20 to 23 kDa.

The IEF fractions were applied to a gel filtration column. Here two distinct bands are found, corresponding to trimers and monomers (Figure 5A). The ief1 fraction from the asLhcb2 plants had almost the same ratio of trimers to monomers (approx 5:1) as the wt fractions. In contrast, the proportion of trimers relative to monomers for fraction ief2 was reduced to approx. 0.6:1. Since monomeric CP26 is not found in this region of IEF gel, this suggests that all of the Lhcb5 in these IEF fractions was trimeric but that the trimer built of only Lhcb5 dissociated during gel filtration; i.e. the homotrimer is less stable than the heterotrimer of Lhcb5 and Lhcb3. By increasing the detergent concentration used for the solubilisation of thylakoids and in the gel filtration it was possible to further reduce the yield of CP26 homotrimers. In the case of as_ief2” a band with a longer retention time remained, the same as found for a purified dimeric LHCI fraction. With lower DM concentration, as_ief2’ contained three bands, the trimer (I), the dimer (II) and the monomer (III). Analysis of these three fractions showed that the trimer band (I) was highly enriched in only the Lhcb5 polypeptide (Figure 5B, C). Band II was enriched in a doublet of the LHCI polypeptides identified as Lhca1 and 4, which are known to exist as a heterodimer (34). The monomer band contained Lhcb5 and all four types of Lhca polypeptides. Pigment composition of LHCII trimers from asLhcb2 plants. The pigment analysis revealed that the homotrimers that contained only CP26 complexes, have a chl a/b ratio of around 1.95 (Table 1). This is lower than that found for monomeric CP26, around 2.5 (35). The CP26 monomers prepared here had a ratio of 2.6 (Table 1). In addition, it is known that in comparison to LHCIIb, CP26 is missing 3 chl b molecules, leaving only 3 (36). A ratio of 2.67 would then arise if 8 chl a were bound. A value of 1.95 would arise if the trimeric complex bound one extra chl b. Figure 6A supports this conclusion, showing that in the low-temperature absorption spectrum of the Lhcb5 homotrimer the chl b band is more pronounced than in a spectrum of the Lhcb5 monomer. Calculations based on the area under the absorption spectrum also suggest one extra chl b in the Lhcb5 homotrimer. The chl a/b ratio of the Lhcb3/5 heterotrimer was 1.68. Since Lhcb3 binds 6 chl b molecules (37) it is suggested that the heterotrimer is built from 2 Lhcb5 and 1 Lhcb3, giving a predicted chlorophyll a/b ratio of 1.77. The low-temperature absorption spectrum of this heterotrimer indeed displays an even more pronounced chl b peak at 650 nm compared to the homotrimer and monomer.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

6

Treatment with phospholipase is well-known to cause monomerisation of LHCIIb trimers (38), because of the phospholipid bound to the complex (3). The same treatment was found to cause monomerisation of the Lhcb5 homotrimer (Figure 6B). In this experiment the chl a/b ratio of the trimer was 1.91. The monomer derived from this trimer had a ratio of 2.49, consistent with the data in Table 1 and confirming that trimerisation causes acquisition of extra chl. Indeed, upon monomerisation a free pigment band containing only chl b and no chl a was found; the proportion of chl b found in this band was approx 25%, consistent with the loss of one chl b out of a population of four. Treatment of wt LHCIIb trimers with phospholipase does not lead to any change in chl a/b ratio or loss of chl b (data not shown) as found previously (35,39).

The carotenoid composition of the asLhcb2 trimers differed from those of the wt. Principally, the xanthophyll cycle content of the asLhcb2 trimers is significantly higher than that of the wt ones, whereas the content of neoxanthin is reduced. There is little detectable β-carotene in the trimers, consistent with the strong reduction in LHCI contamination. The lutein content is virtually unchanged, suggesting that both the Lutein 1 and Lutein 2 molecules found in trimeric LHCIIb (3,11) are present in the Lhcb5 trimers. The carotenoid composition of the Lhcb5 trimers is similar to CP26 monomers, although not identical, with a smaller neoxanthin content. The composition of the homotrimers differed slightly from that of the heterotrimer – there was more violaxanthin bound to the former.

The Soret band absorption spectra of wt and Lhcb5 trimers are very similar and in particular their second derivatives display the presence of the 510 nm absorption band of the same magnitude (Figure 6C). This band, which arises from Lutein 2 is a characteristic for the trimeric LHCIIb state (31) and is clearly absent from the CP26 monomer, which displayed only the lutein band at 495 nm band (Figure 6C).

Photosystem I antenna in the asLhcb2 plants. The presence of LHCI contamination in various LHCII preparations suggests that there is a new population of this complex that is easily detached from PSI. Analysis of the relative amounts of Lhca protein by quantitative immunoblotting showed large increases in the contents of Lhca1-4 proteins, particularly a 2-3 fold increase in Lhca1 and Lhca4 compared to the wild type (Figure 7A). It was estimated that in thylakoids, per PSI reaction centre (from the PsaD protein), the levels of Lhca1-4 proteins in asLhcb2 plants increased by 140±4%, 20±6%, 44±4% and 280±8%, respectively (Figure 7A.) The same trends, but less pronounced, were also found if PSI preparations rather than thylakoids were analysed (data not shown), indicating that some of the extra LHCI is retained by the isolated PSI fraction. Moreover, gel filtration of the PSI preparation treated

with 1% n-dodecyl β-D-maltoside (β-DM) showed that a fraction of LHCI of the asLhcb2 plants can be more easily removed from the PSI core than in the wt (Figure 7B). A small band of LHCI was found in the profile of the asLhcb2 sample, but not in wt. Comparison of the low-temperature absorption spectra of the wt and asLhcb2 PSI indicated that the latter is more enriched in chl b and that the major chl a maximum is blue-shifted (Figure 7C). These are good indicators that the PSI from the asLhcb2 plants has a larger LHCI antenna than the wt, corroborating the results from the immunoblot analysis.

In order to assess if the extra LHCI functions as a part of the PSI antenna, fluorescence excitation spectroscopy was carried out on thylakoid preparations. Fluorescence was detected in the 735 nm region – the maximum of PSI fluorescence associated with the long-wavelength energy traps. These final acceptors of excitation at 77K can be used to estimate the relative size of the PSI antenna (40,41). Fluorescence excitation spectra of both the wt and asLhcb2 were normalised at around 710 nm region, the absorption band giving the F735 emission. It is clear that the amplitudes of the chl b region and short wavelength chl a are larger in the asLhcb2 spectrum than in the wt spectrum. This indicates that there is an increased functional antenna size of PSI in asLhcb2 plants, because of the presence of more LHCI. The estimated average increase in antenna size was found to be around 25%.

DISCUSSION

Features of the new type of LHCII antenna. The experiments described here provide direct proof that in antisense plants in which the main LHCII polypeptides are missing, trimers are assembled composed of the Lhcb5 protein which is normally only found in the monomeric CP26 complex. Two types of trimers were found, homotrimers of Lhcb5 and heterotrimers of Lhcb5 and Lhcb3. It was estimated that the percentage of homotrimers was much higher than that of the heterotrimers (65% vs 35%). Spectroscopic analysis showed that these trimers were functionally coupled to PSII in intact thylakoid membranes, transferring energy to the reaction centre core complexes. These observations are consistent with the observation by electron microscopy and image analysis of trimers in the PSII membrane fragments prepared from the asLhcb2 plants (17).

The existence of trimers in the antisense plants suggests a very special requirement for the LHCII trimeric structure. This could be both functional (in light harvesting) and structural (in assembly of the PSII macrostructure). The trimerisation of LHCIIb appears to create features that are important for the avoidance of energy loss by nonradiative dissipation (39) and the promotion of efficient energy transfer (5). The cluster consisting of chl a610, chl a611 and

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

7

chl a612, may be the conduit for energy transfer to neighbouring antenna and core complexes and the presence of three identical clusters on each trimer could enable efficient energy transfer within the PSII macrostructure, bearing some similarity to the pigment rings found in bacterial antenna complexes. Furthermore, the cluster of chl b601, chl b606 and chl b609 involves pigments in adjacent monomers. The phospholipid molecule that has a key role in the stabilisation of the trimer is tightly associated with chl b601, which is not H-bonded at either formyl C7 or carbonyl C13 as are other chl b molecules (3). It appears that the inclusion of the phospholipid create the binding pocket for the chl b601. It is suggested that trimerisation of CP26 re-creates some features of this pocket and causes an extra chl b to be bound, enabling it to function efficiently in energy transfer.

Another feature found exclusively in the trimeric state of LHCIIb is the red-shifted Lutein 2 band at 510 nm (31,42). This is also present in the CP26 homotrimers, suggesting a similarity between the Lutein 2 environment in this complex and that in LHCIIb. Neither the origin of the red shift of lutein nor its function is well understood. It may arise from new interactions between pigments bound to neighbouring monomers in the trimeric structure. For example, trimerisation would create an inter-monomer Lutein2-chl a603 associate that could red-shift the lutein absorption band.

One difference between the CP26 containing trimers and the LHCIIb trimer is the higher violaxanthin content of the former. Previously, it has been shown that the amount of violaxanthin is approx. 1 per LHCIIb in monomers but only about 0.3 in the trimer (35). In the case of CP26, the higher amount of violaxanthin is found in both the monomer and trimer. In the known binding site for violaxanthin on LHCIIb, there are two major interaction regions on the protein, the D-helix (the lumenal site) and the N-terminal loops (the stromal site). These coordinate the alignment of the xanthophyll by interacting with its head groups. Secondary structure prediction indicates that CP26 has a small extra helix on the N-terminal site (between 60th and 70th residues) centering at N-TSDELAK-C. This can act as a counterpart to the C-terminus helix D exerting a more coordinated and stabilizing effect on violaxanthin in comparison to the flexible loop structure in LHCIIb

The M-LHCIIb and S-LHCIIb timers, which are part of the the LHCII-PSII supercomplex, form an intrinsic part of the macro-organisation of PSII in the granal membranes (10), whereas the remaining trimers appear to be located in PSII-free membrane regions. The M trimer consists of Lhcb1 and Lhcb2, whereas the S trimer is composed of Lhcb1 and Lhcb3. We suggested previously, that only the M and S trimers are replaced by CP26 (17), since supercomplexes were observed but the ratio of LHCII/PSII was much lower (see Figure 2A). On the basis of the results presented here, it is suggested that

the Lhcb5 homotrimer replaces the M-trimer, whereas the Lhcb5/Lhcb3 heterotrimer replaces the S-trimer. These Lhcb5 trimers were less stable in the presence of detergents than the heterotrimers of Lhcb5 and 3 or wt LHCIIb trimers. Since Lhcb3 is involved in trimer formation in the wild type LHCIIb, it stabilises the Lhcb3/5 trimers.

The LHCII-PSII supercomplex also appears to be more sensitive to detergent attack in the asLhcb2 membranes, and this may arise because of the differences in the S-trimer. The S-trimer is the most tightly bound trimer and is therefore probably more important for supercomplex structure. In spite of a lower stability of the supercomplex and trimers, we have not detected any direct physiological consequence of this – for example heat-stability of PSII in vivo or of the trimers in vitro are the same for wt and asLhcb2 (M. Wentworth, unpublished data). However, the less stable trimers and supercomplexes and/or the decreased proportion of trimers could have effects on the three-dimensional organisation; although asLhcb2 plants do have grana, it is possible that the stability of these is reduced. Further analysis of the membrane structure in these plants is needed.

Antenna function in the thylakoid membrane in asLhcb2 plants. Figure 8 shows a schematic presentation of the LHC antenna function of both PSI and PSII. Normally the PSII antenna is larger than that of PSI. Taking the average number of LHCII trimers per PSII as 4 with 42 chlorophylls in each and about 35 chlorophylls in the minor antenna, this makes a total chlorophyll cross-section of about 200. For PSI, a recently published structure suggests that the LHCI size is equivalent to around 60 chlorophylls (44). Even taking into account chl of the core complexes, PSII would still have a larger antenna size than PSI. Under limiting low light, the efficiency of the linear electron transport would be compromised, since the antennae sizes of PSI and PSII differ. To compensate for this the state transitions allow rapid modulation of the PSII and PSI cross-sections. A part of the larger PSII antenna – the peripheral LHCIIb trimer - works as a shuttle between the two photosystems dependent upon the phosphorylation state of particular residues near the N terminus of the Lhcb1/2 polypeptides. When PSII is over-excited, the protein kinase is activated and phosphorylated LHCII serves as an antenna for PSI; when PSI is overexcited by far-red-enriched light light, the kinase is inactive and nonphosphorylated LHCII transfers energy only to PSII. In the asLhcb2 plants, state transitions can not occur because only the Lhcb1 and Lhcb2 polypeptides have the phosphorylation site. As a compensatory response to the absence of state transitions, there is an increase in LHCI, mostly the heterodimer of Lhca1-Lhca4. It is not clear yet whether this extra LHCI is permanently or transiently bound to PSI, reflecting a new mechanism reversibly controlling the PSI cross-section in the asLhcb2 plants.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

8

A concerted compensatory response of the photosynthetic light harvesting system. All the described alterations in PSI and PSII in asLhcb2 plants reveal a complex and co-ordinated response. Firstly, extra Lhcb polypeptides accumulate to compensate for the decreased PSII antenna size. Secondly, extra PSII is synthesised to balance the rate of electron delivery from PSII with the capacity of PSI. Thirdly, trimers are assembled from normally monomeric complexes. Fourthly, the pigment properties of the new trimers are adjusted to mimic the wild-type LHCIIb trimer. Fifthly, extra LHCI complex is synthesised to compensate for the absence of state transitions. This is the first finding of such a complex and multilevel response of the photosynthetic membrane to a genetic alteration in polypeptide biosynthesis, and indicates a high level of plasticity, in which structure and function of PSII-LHCII may be preserved despite different protein compositions.

To achieve this plasticity there has to be control over the expression of photosynthetic genes. A decrease in LHCII content in the as plants would decrease the reduction state of the electron transfer chain, eliciting a response equivalent to under-excitation of PSII – according to the theory of Pfannschmidt and Allen (45) this would increase transcription of chloroplast genes encoding PSII reaction centre proteins. In addition there would be a decrease in overall PSII electron transport – a decreased excitation pressure, as seen under limiting irradiance (46), which is known modulate the levels of all of the thylakoid membrane complexes, including LHCII and LHCI (47,48). An additional factor may be the co-ordination of chlorophyll and protein synthesis; the absence of the main population of chlorophyll binding proteins may in some way signal the accumulation of alternative binding proteins. There is currently little understanding of how these latter factors control expression of nuclear encoded genes and which of the numerous putative plastid signals are involved in co-ordinating chloroplast and nuclear gene expression (49). Which of the numerous possible levels of control used is also not clear – transcription, translation, or modulation by protein degradation, in which protein folding, pigment binding, assembly of subunits into complexes and construction of supramolecular organisations may all be regulated. The observation of CP26 accumulation in the asLhcb2 plants provides new insights into these processes. The compensatory accumulation of LHC proteins in the absence of LHCIIb seems not to be reflected by an increase in their mRNA levels, suggesting that the protein content is determined at least in part by proteolysis of those not properly assembled into the thylakoid membrane protein complexes. The gene coding for the protease (AtFtsH6) responsible for the degradation of LHCII subunits seems to be constitutively expressed (50), the proteolytic activity appearing to be regulated by the

availability of substrate, not the level of the protease. Therefore, trimers or monomers properly assembled into LHCII-PSII supercomplex may be resistant to the protease, whereas free trimers or monomers, can be degraded. Trimerisation may be an integral part of the process of supercomplex assembly, in which vacant sites in the growing complex are templates for the trimerisation of available proteins, or the availability of chl b and phospholipids may drive the trimerisation. In either case, it is assumed that in the wt, the dominant levels of Lhcb1 and Lhcb2 simply out-compete the smaller amounts of Lhcb5 for pigment binding, trimerisation and macro-assembly. Therefore, excess Lhcb5 would be degraded. In the absence of LHCIIb, however, CP26 trimers are stabilized by binding to PSII, resulting in an accumulation of CP26 in the thylakoids.

Clearly, the study of plants in which the levels of specific subunits have been genetically manipulated is a promising approach to gaining an understanding the complex events involved in regulating the composition and assembly of thylakoid membrane. REFERENCES 1. Jansson, S. (1999) Trends in Plant Science 4,

236-240 2. Kuhlbrandt, W., Wang, D.N., and Fujiyoshi, Y.

(1994) Nature 367, 614-621 3. Liu, Z., Yan, M., Wang, K., Kuang, T., Zhang, J.,

Gui, L., An, X., and Chang, W. (2004) Nature 428, 287-292

4. van Amerongen, H., and van Grondelle, R. (2001) J. Phys. Chem. B 105, 604-617

5. Novoderezhkin, V.I., Palacios, M.A., van Amerongen, H., and van Grondelle, R. (2005) J. Phys. Chem. B. 109, 10493-10504

6. Haldrup, A., Jensen, P.E., Lunde, C., and Scheller, H.V. (2001) Trends in Plant Sciences 6, 301-305

7. Horton, P., Ruban, A.V., and Walters, R.G. (1996) Annu. Rev. Pl. Physiol. Pl. Mol. Biol. 47, 655-684

8. Moya, I., Silvestri, M., Vallon, O., Cinque, G., and Bassi, R. (2001) Biochemistry 40, 12552-12561

9. Pascal, A.A., Liu, Z., Broess, K., van Oort, B., van Amerongen, H., Wang, C., Horton, P., Robert, B., Chang, W., and Ruban, A.V. (2005) Nature 436, 134-137

10. Dekker, J.P., and Boekema, E.J. (2005) Biochim. Biophys. Acta 1706, 12-39

11. Standfuss, J., Terwisscha van Scheltinga, A.C., Lamborghini, M., and Kühlbrandt, W. (2005) EMBO J. 24, 919-928

12. Ganeteg, U., Strand, Å., Gustaffson, P., and Jansson, S. (2001) Plant Physiol. 127, 150-158

13. Andersson, J., Walters, R.G., Horton, P., and Jansson, S. (2001) Plant Cell 13, 11930-1204

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

9

14. Davison, P., Hunter, C.N., and Horton, P. (2002) Nature 418, 203-206

15. Yakushevska, A.E., Keegstra, W., Boekema, E.J., Dekker, J.P., Jansson, S., Horton, P., and Ruban, A.V. (2003) Biochemistry 42, 608-613

16. Andersson, J., Wentworth, M., Walters, R.G, Howard, C., Ruban, A.V., Horton, P., and Jansson, S. (2003) Plant J. 35, 350-361

17. Ruban, A.V., Wentworth, M., Yakushevska, A.E., Andersson, J., Lee, P.J., Keegstra, W., Dekker, J.P., Boekema, E.J., Jansson, S., and Horton, P. (2003) Nature 421, 648-652

18. Ruban, A.V., Young, A.J., Pascal, A.A., and Horton, P. (1994) Plant Physiol. 104, 227-234

19. Porra, R.J., Thompson, W.A., and Kriedemann, P.E. (1989) Biochim. Biophys. Acta 975, 384-394

20. Croce, R., Zucchelli, G., Garlaschi, F., and Jennings, R.C. (1998) Biochemistry 37, 17355-17360

21. Dainese, P., Hoyer-Hansen, G., and Bassi, R. (1990) Photochem Photobiol 51, 693-703

22. Ganeteg, U., Klimmek, F., and Jansson, S. (2004) Plant Mol. Biol. 54, 641-651

23. Allemeersch, J., Durinck, S., Vanderhaeghen, R., Alard, P., Maes, R., Seeuws, K., Bogaert, T., Coddens, K., Deschouwer, K., Van Hummelen, P., Vuylsteke, M., Moreau, Y., Kwekkeboom, J., Wijfjes, A.H., May, S., Beynon, J., Hilson, P., and Kuiper, M.T. (2005) Plant Physiol. 137, 588-601

24. Sjödin, A., Bylesjö, M., Skogström, O., Eriksson, D., Nilsson, P., Rydén, P., Jansson, S., and Karlsson, J. (2005) UPSC-BASE - Populus transcriptomics online.

25. Dudley, A.M., Aach, J., Steffen, M.A., and Church, G.M. (2002) Proc. Natl. Acad. Sci. USA 99, 7554-7559

26. Smyth, G.K. and Speed, T. (2003) Methods 31, 265-273

27. Kitajima M, and Butler, W.L. (1975) Biochim. Biophys. Acta 408, 297-305

28. de Weerd, F.L., Palacios, M.A., Andrizhiyevskaya, E.G., Dekker, J.P., van Grondelle, R. (2002). Biochemistry 41, 15224-15233

29. Klimmek, F, Ganeteg, U., Ihalainen, J.A., van Roon, H., Jensen, P.E., Scheller, H.V., Dekker, J.P., and Jansson, S. (2005) Biochemistry 44, 3065-3073

30. Ruban, A.V., and Horton, P. (1992) Biochim. Biophys. Acta 1102, 30-38

31. Ruban A.V., Pascal, A., and Robert, B. (2000) FEBS Lett. 477, 181-185

32. Hilson, P., Allemeersch, J., Altmann, T., Aubourg, S., Avon, A., Beynon, J., Bhalerao, R.P., Bitton, F., Caboche, M., Cannoot, B., Chardakov, V., Cognet-Holliger, C., Colot, V., Crowe, M., Darimont, C., Durinck, S., Eickhoff, H., de Longevialle, A.F., Farmer, E.E., Grant, M.,

Kuiper, M.T., Lehrach, H., Leon, C., Leyva, A., Lundeberg, J., Lurin, C., Moreau, Y., Nietfeld, W., Paz-Ares, J., Reymond, P., Rouze, P., Sandberg, G., Segura, M.D., Serizet, C., Tabrett, A., Taconnat, L., Thareau, V., Van Hummelen, P., Vercruysse, S., Vuylsteke, M., Weingartner, M., Weisbeek, P.J., Wirta, V., Wittink, F.R., Zabeau, M., and Small, I. (2004) Genome Res 14, 2176-2189

33. Boekema, E.J., Van Roon, H., Van Breemen, J.F.L., and Dekker, J.P. (1999). Eur. J. Biochem. 266, 444-452

34. Jansson, S., Andersen, B., and Scheller, H.V. (1996) Plant Physiol. 112, 409-420

35. Ruban A.V., Lee, P.J. Wentworth, M., Young, A.J., and Horton, P. (1999) J Biol. Chem. 274, 10458-10465

36. Bassi, R., Sandona, D., and Croce, R. (1997) Physiol. Plant. 100, 769-779

37. Caffarri, S., Croce, R., Cattivelli, R., and Bassi, R. (2004) Biochemistry 43, 9467–9476

38. Nussberger, S., Dörr, K., Wang, D., and Kühlbrandt, W. (1993) J. Mol. Biol. 234, 347-356

39. Wentworth, M., Ruban, A.V., and Horton, P. (2004) Biochemistry 43, 501-509

40. Ruban A.V. (1991) Biochim. Biophys. Acta 1058, 411-415

41. Ruban A.V., and Trach V.V. (1991) Photosynth. Res. 29, 157-169

42. Ruban A.V., Pascal, A.A., Robert, B., and Horton, P. (2001) J. Biol. Chem. 276, 24862-24870

43. Palacios, M.A., Frese, R.N., Gradinaru, C.G., Premvardhan, L., Horton, P., Ruban, A.V., van Grondelle, R., and van Amerongen, H. (2003) Biochim. Biophys. Acta 1605, 83– 95

44. Ben-Shem, A., Frolow F., and Nelson, N. (2003) Nature 426, 630-635

45. Pfannschmidt, T., Nisson, A., and Allen, J.F. (1999) Nature 397, 625-628

46. Huner, N.P.A., Öquist, G., and Sarhan, F. (1998) Trends Plant Sci. 3, 224-2305

47. Anderson, J.M., Chow, W.S., and Park, Y.-I. (1995) Photosynth. Res. 46, 129-139

48. Bailey, S., Walters, R.G., Jansson, S., and Horton, P. (2001) Planta 213, 794-801

49. Rodermel, S. (2001). Trends in Plant Sciences 6, 471-478

50. Zelisko, A., Garcia Lorenzo, M., Jackowski, G., Jansson, S., and Funk, C. (2005) Proc. Nat. Acad. Sci. USA 102, 13699-13704

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

10

FIGURE LEGENDS

Fig. 1. Low-temperature spectroscopic analysis of the photosystem II antenna in the thylakoids of wt and asLhcb2 plants. (A) Absorption spectra (upper curves) and their second derivatives (lower curves) in the red region of the spectrum. wt, wt; as, asLhcb2. (B) Fluorescence emission spectra (upper curves) and the difference, wt minus asLhcb2 (lowest curve). (C) Fluorescence excitation spectra measured at 685 nm (solid lines) and 1- T (transmission) spectra (dotted lines) and the second derivatives of the excitation spectra (lower curves). Fig. 2. Sucrose density gradient analysis of thylakoids from wt and asLhcb2 plants (A) Sucrose gradients of solubilised thylakoids from wt (wt) and asLhcb2 (as) plants showing three major fractions, LHCII, PSII and PSI. (B) SDS PAGE analysis of wt (wt) and asLhcb2 (as) fractions taken from the sucrose gradients, thylakoids (th), LHCII (LHC) and PSI (PSI) fractions. WM, molecular weight markers. Brackets indicate the position of the Lhca polypeptides. Arrows indicate the positions of the Lhcb (C) Western blots of wt and asLhcb2 LHCII fractions with Lhca1-4 antibodies. Fig. 3. FPLC gel filtration fractionation of solubilised wt and antisense asLhcb2 thylakoid membranes. (A) Chromatograms of wt (wt) and asLhcb2 (as) thylakoids solubilised with 0.85 % n-dodecyl α-D-maltoside and asLhcb2 (as’) thylakoids solubilised with 1.2 % n-dodecyl α-D-maltoside. Major fractions are marked, PSII membrane fragments (PSIIm), PSII supercomplexes (PSIIs), PSII core complexes (PSIIc), PSI complex (PSI), trimeric (tr), dimeric (d) and monomeric (m) light harvesting complexes (LHC). Also shown is the profile of purified samples of PSI (1), LHCII (2) and LHCI (3). (B) SDS PAGE of various FPLC fractions as indicated in (A). LHC refers to the band containing the trimeric/dimeric complexes. (C) Western blots of PSII membrane fragments (PSIIm) and supercomplexes (PSIIs) from the asLhcb2 (as) fractions against Lhca1-4 antibodies. Fig. 4. Isoelectric focusing separation of solubilised unstacked thylakoid membranes from wt and asLhcb2 plants (A) IEF gel of solubilised wt (wt) and asLhcb2 (as) thylakoids. Brackets indicate the LHCII fractions 1 and 2, ief1 and ief2 respectively. (B) Polypeptide analysis of ief1 and ief2 from wt (wt) and asLhcb2 taken from the IEF gel. Labelled are Lhcb3 (arrows), Lhcb5 and Lhca (brackets) polypeptides. (C) Western blot of LHCII fractions 1-2 with Lhcb3 antibody. Fig. 5. FPLC analysis of IEF fractions. (A) FPLC profiles of as_ief2, as_ief2’ and as_ief2’’, which are three runs of the ief2 fraction from the asLhcb2 plants (see Figure 4) incubated for 5 min with 0.01, 0.1 and 0.4 % of n-dodecyl β-D-maltoside, respectively. I, II, and III are of trimer, dimer and monomer elution. Also shown is the profile of a purified LHCI. (B) Polypeptide analysis of parts of FPLC fractions (as_ief2 and as_ief2’) as shown in A (trimer, dimer, monomer - I, II, III respectively). (C) Western blot of the as_ief2’ band from B against Lhca antibodies. Fig. 6. Chlorophyll and carotenoid binding to various types of LHCII complexes from the wt and asLhcb2 plants. (A) Absorption spectra in the red region (A). as Lhcb5 tr and as Lhcb3/5 tr are homotrimers of Lhcb5 and heterotrimers of Lhcb3/5 prepared from as_ief1 and as_ief2 respectively; wt tr is a LHCII trimer from wt plants; wt Lhcb5 m and as Lhcb5 m corresponds to CP26 monomers from asLhcb2 and wt plants respectively. The vertical arrow indicates the chl b absorption region. (B) Sucrose gradient profile of as Lhcb5 tr (homotrimers) before (control) and after phospholipase (PLA2) treatment, and distribution of chl b in the treated fractions. Also shown are the chl a/b ratios of the control trimer and the monomer fraction from the phospholipase treatment. Phospholipase treatment was carried out as described by Wentworth et al. (2004). (C) Absorption spectra of LHC fractions in the Soret region (upper curves) and the second derivative spectra (lower curves). Details of fractions as in A. Fig. 7. Analysis of the antenna of photosystem I.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

11

(A) Western blot of thylakoids from wt (wt) and asLhcb2 (as) plants. The relative amount of each Lhca protein in asLhcb2 compared to wt (100%) is given (as/wt). The results shown are means ±SE (n=4). (B) FPLC gel filtration runs of PSI sucrose gradient fractions from wt (wt) and asLhcb2 (as) kept in the buffer medium containing 0.4% of n-dodecyl β-D-maltoside. The vertical arrow shows the position of LHCI dimers. (C) Low temperature absorption (solid lines) of PSI sucrose gradient preparations and 735 nm fluorescence excitation spectra of thylakoids (dashed lines) from the wt (wt) and asLhcb2 (as) plants. Vertical arrow indicates the chl b band. Fig. 8. Photosynthetic electron transfer and antenna function in wt and asLhcb2 plants. In the wt, imbalance between the electron transfer rates of PSII and PSI is corrected by means of state transitions, in which a portion of LHCIIb trimers, phosphorylated by the redox sensitive protein kinase, can associate with PSI and contribute to an increase in its absorption cross section. In the asLhcb2 plants the absence of LHCIIb trimers is compensated for by accumulation of CP26 trimers and by an increase in content of PSII. The mobile phospho-LHCII pool is absent and they are unable to perform state transitions: photosystem I gains extra loosely bound LHCI that may compensate for excitation energy imbalance between photosystems. LHCI (red) and LHCIIb (blue) – light harvesting antenna of photosystem I and II, respectively; RCI and II – reaction centres; e – electrons; PQ and PQH2 intermediate electron carrier plastoquinone in oxidized and reduced form. Shown in green are the minor LHCII antennae, totally monomeric in the wt, but including CP26 trimers in asLhcb2.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Plasticity in the light harvesting antenna

12

Table 1. Carotenoid composition of thylakoids and various LHCII preparations from wt and asLhcb2 plants. Sample Neo Vio Ant Lut βc XC car/chl a/b Thy, wt 4.1 3.1 0.3 13.0 9.0 3.4 0.31 3.30 Thy, as 3.4 4.8 0.4 14.0 15.0 5.2 0.40 4.20 Suc. grad. LHCII, wt 7.1 2.4 0.0 15.0 0.5 2.4 0.25 1.60 LHCII, as 5.9 5.2 0.7 16.0 3.2 5.9 0.31 2.00 IEF+FPLC trimer, wt 7.8 0.0 0.0 16.2 0.0 0.0 0.24 1.31 trimer 1, as 5.7 7.3 0.0 15.0 0.0 7.3 0.28 1.68 trimer 2, as 5.9 8.0 0.0 15.8 <0.3 8.0 0.30 1.95 CP26 4.1 8.1 0.0 16.8 0.0 8.1 0.29 2.60 Thy, thylakoids; wt, wild type; as, asLhcb2; Sucr. grad., sucrose gradient separation; IEF + FPLC, samples obtained by FPLC separation of IEF fractionated thylakoids as in Figure 5; βc, β-carotene; Neo, neoxanthin; Vio, violaxanthin; Ant, antheraxanthin; Lut, lutein; XC, xanthophylls cycle carotenoids; car, carotenoid; a/b, chlorophyll a/b ratio. Carotenoid data are normalized to 100 chlorophyll a + b molecules. Car/chl is the molar ratio. Standard errors were within 5% of the presented values

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 1.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 2.

Lhca1

Lhca2

Lhca3

Lhca4

wt as

C

B

WM thwt

thas

LHCwt

LHCas

PSI

16

30

36

5064

98

A

wt as

LHCII

PSII

PSI

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 3.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 4.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 5.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 6.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 7.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Figure 8.

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Peter HortonUlrika Ganeteg, Frank Klimmek, Wah Soon Chow, Jan M. Anderson, Stefan Jansson and

Alexander V. Ruban, Svetlana Solovieva, Pamela J. Lee, Cristian Ilioaia, Mark Wentworth,structural integrity and biological function

Plasticity in the composition of the light harvesting antenna of higher plants preserves

published online March 21, 2006J. Biol. Chem. 

  10.1074/jbc.M511415200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 9, 2020

http://ww

w.jbc.org/

Dow

nloaded from