Plant Physiology Preview. Published on November 9, 2017 ...Nov 09, 2017 · 19 Corresponding author...

1

Running title: Functional analysis of TsNAC1 in T. halophila 1

Corresponding author details: Juren Zhang; The Key Laboratory of the Plant Cell Engineering 2

and Germplasm Innovation, School of Life Science, Shandong University, Jinan 250100, 3

Shandong, China; Tel: +86 0531 88364350; Fax: +86 0531 88364350. 4

Title: TsNAC1 is a Key Transcription Factor in Abiotic Stress Resistance and Growth 5

Can Liu1, Baomei Wang1, Zhaoxia Li1, Zhenghua Peng1 and Juren Zhang1, * 6 1The Key Laboratory of the Plant Cell Engineering and Germplasm Innovation, School of Life 7

Sciences, Shandong University, Jinan 250100, Shandong, China 8

*To whom correspondence should be addressed. 9

One-sentence summary: TsNAC1 improves abiotic stress resistance of Thelungiella halophyla by 10

regulating ion transport and retards vegetative growth by limiting the expansion of cells. 11

12

Author contributions: C.L. performed most of the experiments and analyzed the data; B.W. and 13

Z.L. provided technical assistance; Z.P. and J.Z. supervised the experiments and analyzed the data; 14

C.L. and J.Z. completed the writing. 15

Funding information: This work was supported by the National Natural Science Foundation of 16

China [grant no. 31571674 to J.Z.] and National Major Projects for Genetically Modified 17

Organisms Breeding in China [grant no. 2016ZX08003004-003 to J.Z.]. 18

Corresponding author email: [email protected] 19

20

Abstract 21

NAC proteins constitute one of the largest families of plant-specific transcription factors, and a 22

number of these proteins participate in the regulation of plant development and responses to 23

abiotic stress. T. HALOPHILA STRESS RELATED NAC1 (TsNAC1) cloned from the halophyte 24

Thellungiella halophila is a NAC transcription factor gene, and its overexpression can improve 25

abiotic stress resistance, especially in the salt stress tolerance, in both T. halophila and 26

Arabidopsis and retard the growth of these plants. In this study, the transcriptional activation 27

activity of TsNAC1 and RD26 from Arabidopsis was compared with the target genes’ promoter 28

regions of TsNAC1 from T. halophila, and the results showed that the transcriptional activation 29

activity of TsNAC1 was higher in tobacco and yeast. The target sequence of the promoter from the 30

Plant Physiology Preview. Published on November 9, 2017, as DOI:10.1104/pp.17.01089

Copyright 2017 by the American Society of Plant Biologists

https://plantphysiol.orgDownloaded on February 25, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

https://plantphysiol.org

2

target genes was also identified, and TsNAC1 was shown to target the positive regulators of ion 31

transportation, such as T. HALOPHILA H+-PPASE 1 (TsVP1), and the transcription factors MYB 32

HYPOCOTYL ELONGATION-RELATED (MYBH), HOMEOBOX 12 (HB12). In addition, 33

TsNAC1 negatively regulates the expansion of cells, inhibits LIGHT-DEPENDENT SHORT 34

HYPOCOTYLS 1 (LSH1) and UDP-XYLOSYLTRANSFERASE 2 (TXT2), and directly controls the 35

expression of MULTICOPY SUPPRESSOR OF IRA1 4 (MSI4). Based on these results, we 36

propose that TsNAC1 functions as an important upstream regulator of plant abiotic stress 37

responses and vegetative growth. 38

39

Introduction 40

NAC transcription factors include at least 107 members in Arabidopsis (Riechmann et al., 2000) 41

and constitute one of the largest protein families in higher plants. NAC transcription factors have 42

important roles in plant development (Guo et al., 2005; Petricka et al., 2012), cell apoptosis (Lee 43

et al., 2014), abiotic stress tolerance (Tran et al., 2010), secondary cell wall (SCW) formation 44

(Yamaguchi and Demura, 2010) and endoplasmic reticulum stress resistance (Chi et al., 2017). 45

NAC families have a conserved N-terminal with a similar DNA-binding domain but highly 46

diverse C-terminals, which do not contain any known protein domains (Ooka et al., 2003). 47

Arabidopsis RESPONSIVE TO DESICCATION 26 (RD26, AT4G27410) is a NAC transcription 48

factor belonging to the ATAF subfamily, and it is markedly up-regulated by salt, drought and 49

abscisic acid (ABA) treatment. In addition, RD26 has the ability to positively regulate ABA 50

signaling (Fujita et al., 2004; Tran et al., 2004). In cotton, the overexpression of the rice NAC 51

gene SNAC1 improved tolerance to drought and salt via enhanced root development and reduced 52

transpiration rates ((Liu et al., 2014). Recent studies also showed that in maize, STRESS 53

RELATED NAC1 (ZmSNAC1) worked as a stress-responsive transcription factor in positively 54

modulating abiotic stress tolerance (Lu et al., 2012; Shiriga et al., 2014). However, the response of 55

the downstream networks of these NAC transcription factors (TFs) to abiotic stress have not been 56

clarified. 57

Arabidopsis is a salt-sensitive plant and presents certain limitations in studies of salt and 58

drought tolerance mechanisms. Thellungiella halophila (and Thellungiella salsuginea) is a close 59

relative of Arabidopsis, with similar coding sequences. However, T. halophila does show 60



3

differences at the metabolome level, including in the metabolism of alanine and the expression 61

patterns of certain drought or cold responsive genes (Amtmann et al., 2005; Benina et al., 2013). T. 62

halophila is a valuable model plant for the study of plant stress response mechanisms because it 63

has a small genome and exhibits high tolerance to drought, low temperatures and high salinity 64

(Zhu, 2001; Inan et al., 2004). 65

VACUOLAR H+-PYROPHOSPHATASE (H+-PPase) plays an important role in the abiotic stress 66

tolerance of plants. Overexpression of V-PPASE 1 (AVP1; AT1G15690) in Arabidopsis improved 67

the drought and salt tolerance in this species (Gaxiola et al., 2001). The overexpression of T. 68

HALOPHILA H+-PPASE 1 (TsVP1) also enhanced the salt and drought stress resistance in 69

different species, such as cotton, maize and tobacco (Gao et al., 2006; Li et al., 2008; Lv et al., 70

2009). Although expression of TsVP1 is apparently induced by salt stress, this is not the case for 71

AVP1 in Arabidopsis. Furthermore, one 130 bp (-667 to -538) region was identified as the key 72

sequence for salt stress response from the promoter of TsVP1 in T halophila (Sun et al., 2010). 73

Using the above-mentioned 130 bp region as a starting point, we identified T. HALOPHILA 74

STRESS RELATED NAC1 (TsNAC1), which is an ortholog of RD26 in Arabidopsis. The 75

overexpression of TsNAC1 substantially promoted the abiotic stress tolerance of plants and 76

retarded the growth of Thellungiella plants. We compared differences between TsNAC1 and RD26 77

to determine the function of TsNAC1 in growth regulation and abiotic responses. A ChIP-Seq 78

assay was used to reveal the downstream genes and regulation network. This study provides 79

evidence that the growth and abiotic stress resistance responses of halophyte T. halophila are 80

regulated by the key TF TsNAC1 in a dose-dependent manner. 81

82

83



4

Results 84

TsNAC1 is an upstream regulator of TsVP1 85

A plasmid containing a 3× tandemly repeated 530 bp DNA fragment of the TsVP1 promoter (nt 86

-667 to -138) was constructed and introduced into the yeast strain Y187. This strain was then 87

transformed with the pGADT7-cDNA library comprising cDNAs from T. halophila plants 88

exposed to a 12-h high-salt stress treatment. One target protein was identified from the strains 89

grown on medium SD/-HIS/-TRP with 5 mM 3-AT. The candidate gene was cloned from T. 90

halophila, and the BLAST results indicated that the target protein was TsNAC1, a member of the 91

NAC superfamily. TsNAC1 has an ORF with a length of 918 bp, shares approximately 86% 92

similarity with RD26 at the nucleotide level and 92% similarity at the amino acid level, and 93

includes the A-E subdomains of the NAC DNA-binding domain (Fig. 1A). Evolutionary tree 94

analysis indicated that TsNAC1 is the closest gene to RD26 (ANAC072) in T. halophila 95

(Supplemental Fig. S1). 96

The coding region of TsNAC1 was fused to the GAL4 activation domain, and the promoter of 97

TsVP1 was cloned into the reporter plasmid pLacZi. Both of the plasmids were transformed into 98

the yeast strain YM4271. X-gal staining for β-galactosidase activity showed a blue color in strains 99

with the promoter region of TsVP1 (Fig. 1B), indicating that TsNAC1 was bound to the promoter 100

region to activate the transcription of TsVP1 in yeast. 101

The TsNAC1-GST fusion protein was expressed in E. coli, and the 130 bp fragments of the 102

TsVP1 promoter were labeled with digoxigenin-ddUTP for an electrophoretic mobility shift assay 103

(EMSA). TsNAC1 was bound to the labelled probe, and the 200× molar excess unlabeled probe 104

could competitively inhibit the combination (Fig. 1C). These results demonstrated that TsNAC1 105

could bind to the 130 bp sequence of the TsVP1 promoter in vitro. 106

Expression profile of TsNAC1 107

To evaluate the expression pattern of TsNAC1 in T. halophila, real-time RT-PCR was performed 108

with diverse organ samples collected from embryogenesis to senescence. The results suggested 109

that the senescent organ, including senescent cauline leaves, rosette leaves and roots, always had a 110

higher expression level than other stages. Parts of the floral organs, such as sepals and petals, also 111

exhibited a clear expression pattern (Supplemental Fig. S2A). These data were consistent with the 112

public microarray data for RD26 from the e-FP browser (Schmid et al., 2005). 113



5

Plants (wild-type, WT) of T. halophila were sprayed and watered with 100 µM ABA or MeJA. 114

The roots were sensitive to ABA and showed a 600-fold expression peak after 24 h of treatment, 115

whereas the shoots were sensitive to MeJA and showed a 720-fold expression peak after 24 h of 116

treatment. Expression of TsNAC1 was also induced by cold, drought and active oxygen stress in 117

the shoots and by drought and salt stress in the roots (Supplemental Fig. S2B). 118

Overexpression of TsNAC1 retards the growth of T. halophila 119

Transgenic plants overexpressing TsNAC1 (OX, 35S:TsNAC1) and TsNAC1 RNAi plants (NR, 120

harboring hairpin-shaped TsNAC1 mRNA fragments (411-882 bp) driven by the CaMV 35S 121

promoter) were generated from T. halophila, and Arabidopsis overexpressing TsNAC1 plants 122

(OXA, 35S:TsNAC1) were also generated (Fig. 2A). Western blot analyses indicated that the 123



6

protein levels of these independent lines were consistent with the transcription levels of TsNAC1 124

(Fig. 2C). The overexpressing lines OX7 and OX10 and RNAi lines NR10 and NR11 of T. 125

halophila were selected to determine the effects of TsNAC1 transcript levels on growth and 126

abiotic stress responses. Seeds were germinated on 1/2 MS-agar medium, and the overexpressing 127



7

lines OX7 and OX10 seeds germinated later than the WT and RNAi seeds (Fig. 2B). After six 128

weeks of growth, the OX7 and OX10 plants were much smaller than the WT (Fig. 2B), and the 129

dry weights of the shoots and roots were substantially lighter (Fig. 2E). The dry weight of 130

6-week-old plants from the T. halophila OX lines was reduced by 10.1%-25.4% in the shoots and 131

by 49.5%-52.5% in the roots compared with those of the WT (Fig. 2E). In contrast, the NR10 and 132

NR11 plants had larger leaves and stronger roots (Fig. 2B). The biomass and growth rates were 133

inversely related to the expression levels of TsNAC1 (Fig. 2E). Taken together, these results led to 134

the conclusion that TsNAC1 retarded plant growth. 135

Overexpressing TsNAC1 improves abiotic stress resistance of plants 136

MeJA-responsive and ABA-responsive cis-acting regulatory elements are observed in the 137

promoter sequences of TsNAC1 and RD26, and the TsNAC1 promoter has an anaerobic induction 138

element and certain cold- and dehydration-responsiveness elements, including the TGA-element, 139

ARE and TC-rich repeats (Supplemental Tab. S1). To identify whether TsNAC1 expression 140

enhances plant tolerance to drought, high salinity, low temperatures, and reactive oxygen species 141

(ROS) stress in transgenic T. halophila, the seeds from the transgenic lines were germinated in a 142

medium of peat and vermiculite (at a 2:1 ratio), and the seedlings were grown for six weeks under 143

normal conditions. Under the low-temperature stress (-4℃) treatment (Fig. 2D), the 144

overexpressing plants had a higher survival rate after 48 h of treatment (Supplemental Fig. S3A). 145

After six weeks of growth, plants were watered with 18% PEG6000 solution for one week (Fig. 146

2D), and overexpressing plants exhibited higher tolerance to drought conditions than WT or RNAi 147

transgenic plants (Supplemental Fig. S3B). To examine salt resistance, the plants were thoroughly 148

watered with an 800 mM NaCl solution and then watered with 10 ml of a 400 mM NaCl solution 149

every 3 days (Fig. 2D). After 14 days of exposure, the transgenic RNAi and WT plants developed 150

necrotic leaves and certain senescent leaves died, whereas the TsNAC1 overexpression plants 151

displayed the same characteristics as untreated plants (Supplemental Fig. S3C). Uniform seedlings 152

of transgenic and WT plants were sprayed with 0.1 ml 3 mM paraquat per pot. After a 36 h 153

treatment the leaves of OX lines all showed greater resistance and higher survival probabilities 154

than the WT or NR plants (Supplemental Fig.S3D). These results suggested that overexpressing 155

TsNAC1 significantly improved plant abiotic resistance. 156

Exploration of the target genes of TsNAC1 157



8

To investigate how the overexpression of TsNAC1 retarded plant vegetative development, the 158

downstream target genes of TsNAC1 were identified by ChIP-Seq using overexpressing lines OX7 159

and OX10 and the TsNAC1 polyclonal antibody, the specificity of which was tested by Western 160

blot, with Col-0 and OXA lines plants leaves as materials and with the β-Actin antibody as the 161

contrast (Supplemental Fig. S4). Each sequencing read was mapped to the T. halophila genome 162

(http://thellungiella.org/) to identify their position using the ultrafast Bowtie aligner (Langmead et 163

al., 2009). The ChIP-Seq data included 14.2 million mapped reads, with 7.8x genome coverage on 164

average. After excluding the peaks in intergenic regions, MACS software (Zhang et al., 2008) 165

detected 1868 and 2454 genes associated with a gene model with p-values of <0.05 for each of the 166

ChIP-Seq datasets. A total of 892 genes were highly enriched in both sets, and 22.16% of these 167

gene peaks were located in the promoter region (a fragment of from -2000 bp to ATG) (Fig. 3A). 168

Additionally, excepted the peaks in the intergenic, the reads distribution was close to the 169

transcription start site (TSS) at -200 bp to +100 bp (Fig. 3B). TsNAC1 is an upstream regulator of 170

TsVP1. The ChIP-Seq signals of TP1G13990 (TsVP1) and TP2G25870 (Tub2), which were used 171

as the positive and the negative controls, respectively, were visualized on the genome browser 172

(Fig. 3C). Based on the ChIP-Seq, motifs around the binding peaks located at the promoter 173

regions and a short and ungapped CA(T/A)G sequence were investigated in Figure 3D. The ChIP 174

samples were quantified via q-PCR using primers specific to the promoters of TsVP1 and Tub2. As 175

shown in Fig. 3E, the promoter region of TsVP1 was effectively enriched, and TsVP1 was 176

expressed at higher levels in OX lines than in the NR lines. These data demonstrated that TsNAC1 177

targeted the promoter of TsVP1 and the ChIP-Seq results were valid. 178

To further explore the biological processes regulated by TsNAC1, the binding target genes were 179

classified into gene ontology (GO) groups. The GO analysis results for 892 co-enriched genes 180

showed a significant and coincident enrichment for biological regulation (GO:0065007), 181

developmental processes (GO:0032502) and responses to stimuli (GO:0050896) compared with 182

the input sample data (Fig. 3F). The next hierarchical classification of these genes primarily 183

involved biological processes, including cell growth (GO:0016049), embryonic development 184

ending in seed dormancy (GO:0009793) and response to salt stress (GO:0009651) (Fig. 3F). 185

Genes with fold enrichment >20 (normalized by the input sample) and peaks located in the 186

promoter region of genes from these three groups were selected to test for the expression levels in 187



9

transgenic plants, including the levels of TsVP1. Seven genes were up-regulated (log2 (OX/NR) >2) 188

and 2 genes were down-regulated (log2 (OX/NR) <-1) by TsNAC1 (Tab. 1). The promoter regions 189

for these nine genes were recombined into a pLacZi vector for one-hybrid yeast system assays of 190

the YM4271 strain. X-gal staining showed that these regions were targeted by TsNAC1 in yeast 191

(Fig. 4A). 192

TsNAC1 regulated genes with the CA(T/A)G element in the promoter 193

Motif discovery with the DNA fragments identified via ChIP-Seq around the binding peaks was 194

performed using MEME-ChIP (Bailey et al., 2015), and 197 DNA sequences (length between 67 195



10

to 434, average length 151.1) located at the promoter regions and a short and ungapped CA(T/A)G 196

motif with an E-value of <8.5e-018 were investigated (Fig. 3D). The distribution of the motif was 197

visualized using a histogram that showed the percent occurrence of the CA(T/A)G motif (x axis) 198

plotted against the log2-fold enrichment (FC) of IP samples compared with the input sample (y 199

axis), with the color of each square mapped to the number of indicated peak motifs. (Fig. 3D). In 200

general, peaks had one or more motifs at log2 >0, and the proportion of peaks containing a motif 201

at least increased along with log2 FC of TsNAC1 binding. 202

It had been demonstrated that TsNAC1 could recognize the 130 bp key region of the promoter of 203

TsVP1 in vivo and vitro. To identify the specific binding site, a serious 5`-deletion fragment was 204



11

amplified by PCR from -667 to -388 (280 bp). M1 was the full length of the 280 bp (Supplemental 205

Data S2), M2 was 10 bp shorten than M1 and by such analogy, M14 lost the full length of the 130 206

bp key fragment. Incubated the TsNAC1-GST with both moderate labeled 130 bp key fragment 207

and excess unlabeled 5`-deletion fragments, the results of gel retardation assay validated that the 208

combination between TsNAC1 and M13/M14 was weaker than M1-M12 obviously, and the 20 bp 209

fragment “GAATATACCATGGATAAGCA” was the core recognition sequence (Supplemental 210

Fig. S5B). The promoter of TsVP1 was able to be recognized by TsNAC1 and with 2 CA(T/A)G 211

motifs (-545, -400 to ATG) in this region (Supplemental Tab. 3). To identify the specific binding 212

site via EMSA, TsNAC1 was bound to these sites and when excess competitors (unlabeled 213

sequences) were added, the binding signals decreased remarkably while the mutant competitors 214

(unlabeled mutated sequences) could not (Supplemental Fig. S5A). The one-hybrid yeast system 215

results using series substitutions as reporters indicated that “CA(T/A)G” is the core DNA-binding 216

motif of TsNAC1 (Supplemental Fig. S5C). These results suggested that TsNAC1 could recognize 217

CA(T/A)G and thus regulate the downstream network. 218

Multiple cell expansion regulators are targeted by TsNAC1 219

LIGHT-DEPENDENT SHORT HYPOCOTYLS 1 (LSH1) and UDP-XYLOSYLTRANSFERASE 2 220

(TXT2) exerted positive regulation on cell expansion by acting as transcription factors (Iyer and 221

Aravind, 2012) or maintaining the structure of cell walls (Wang et al., 2014). MULTICOPY 222

SUPPRESSOR OF IRA1 4 (MSI4) negatively regulated the vegetative biomass by silencing the 223

expression of FLOWERING LOCUS C (FLC) (Morel et al., 2009). The ChIP-Seq and ChIP-PCR 224

analyses (Fig. 4B) indicated that these loci were the TsNAC1 target genes. The quantitative 225

RT-PCR results indicated that the expression of MSI4 was up-regulated but TXT2 and LSH1 were 226

down-regulated (Tab. 1) by TsNAC1 in the OX lines. Taken together, these data suggest that the 227

role of LSH1, TXT2 and MSI4 in retarding cell expansion is directly regulated by TsNAC1. TsVP1, 228

which was previously shown to play an important role in cell expansion, was a target gene of 229

TsNAC1 and was up-regulated in the OX lines but down-regulated in the NR lines. 230

TsNAC1 plays a crucial role in plant tolerance to salt stress 231

An analysis of the TsNAC1 ChIP-Seq data identified a number of positive regulators of salt stress 232

tolerance, including TsVP1, HOMEOBOX 12 (HB12) and MYB HYPOCOTYL 233

ELONGATION-RELATED (MYBH) as candidate TsNAC1 target genes. TsNAC1 has been shown 234



12

to bind to the 130 bp sequence of the TsVP1 promoter in vivo and in vitro. Two peaks were 235

identified at 450 to 600 bp (29.76 relative fold enrichment), and 300 to 450 bp (14.29 relative fold 236

enrichment) upstream of the ATG of TsVP1(Fig. 3C). Binding of TsNAC1 to two other genes was 237

also identified by the one-hybrid yeast assay (Fig. 4A) and by ChIP-PCR assay (Fig. 4B). The 238

expression levels of TsVP1, HB12 and MYBH were all up-regulated by TsNAC1 (Tab. 1). The 239

results confirmed that TsNAC1 positively regulates the expression of TsVP1, HB12 and MYBH in 240

plant salt stress tolerance. 241

TsNAC1 shows higher transcriptional activation activity than RD26 242

Two one-hybrid yeast systems were constructed to test for differences between the binding and 243

activation domains of RD26 and TsNAC1. First, open reading frames were cloned by translational 244

fusion with the yeast GAL4 activation domain (AD), and the TsVP1 promoter was linked to 245

pLacZi or pHis2.1 as reporters. The co-transformed YM4271 strains were cultured on SD/-HIS, 246

and β-galactosidase activity was examined to verify their DNA-binding ability. Although TsNAC1 247

and RD26 were able to bind to the TsVP1 promoter, X-gal staining demonstrated that the binding 248

ability of RD26 was slightly weaker than that of TsNAC1 (Fig. 5A). 249

RD26 was reported as having a repression domain (122-141) that suppresses the activation 250

domain (Hao et al., 2010). The full-length RD26 (1-314), a C-terminal activation domain (AD, 251

181-314) and the activation domain with the repression domain (122-314) were each recombined 252

into a pBD vector and then transformed in the YRG-2 strain. The strains containing only the AD 253

(181-314) grew well on the selection SD/-HIS medium and showed high β-galactosidase activity, 254

and the other two stains were stunted on SD/-HIS medium and showed much lower 255

β-galactosidase activity. The same TsNAC1 deletion strains (1-305, 105-305, and 164-305) were 256

also examined following training on SD/-HIS medium with an ONPG assay, and the region from 257

amino acids 105-163 of TsNAC1 was also found to suppress the transcriptional activation of AD 258

(164/305) (Fig. 5B). 259

The 164-305 region of TsNAC1 exerted limited higher transcriptional activity than the 181-314 260

region of RD26, although the β-galactosidase activity of the strains with the TsNAC1 105-305 261

region was twice as great as the strains with the RD26 122-314 region. These results suggest that 262

the repression ability of the TsNAC1 105-163 region was lower than that of the RD26 122-180 263

region. Alignments with ClustalW indicated that the presence of arginine at RD26-126 was the 264



13

only difference between the two protein sequences (Fig. 1A). A point mutation fragment was 265

constructed in pBD, and the results of the transcriptional activity assay supported our hypothesis 266

that the mutation from Arg to His weakened the repression ability (Fig. 5B). Overall, significant 267



14

differences were not observed in the binding ability of RD26 and the TsNAC1 target to the 268

promoter of TsVP1, although the transcript activation activity was much lower than that of 269

TsNAC1 in yeast. 270

Referenced to the results of ChIP-Seq and one-hybrid yeast system, seven genes (including 271

TsVP1) were up-targeted by TsNAC1. And except for MSI4, the promoter of these genes contained 272

the target motifs of RD26. To demonstrate whether TsNAC1 has higher transcript activation 273

activity in vivo, the promoter regions of these seven genes were connected into pGreenII 274

0800-Luc (with the PMSI4: Luc as the negative control) and co-transformed with 35S:TsNAC1 or 275

35S:RD26 into the protoplasts of T. halophila (Fig. 4C). And injected the transformed 276

Agrobacterium tumefciens GV3101 pGreenII 0800-PTsVP1: Luc and 35S:TsNAC1 into the leaves 277

of Tobacco in pairs also showed higher Luciferase signal than that of 35S:RD26 (Fig. 4D). All the 278

results demonstrated that TsNAC1 had higher transcript activity than RD26 in vivo. 279

280

281



15

Discussion 282

Abiotic stress, such as high-salt stress, has a considerable impact on the quality and yield of 283

agricultural products. Thus, the mechanisms of abiotic stress response must be investigated at the 284

molecular level. T. halophila is a halophytic plant with excellent salt and drought resistance, and it 285

is therefore an interesting system in which to study the mechanisms of abiotic stress response. 286

Here, we explored the abiotic stress resistance of TsNAC1 overexpression lines to identify target 287

genes for further investigation. 288

TsNAC1 participates in plant responses to multiple abiotic stressors 289

Previous studies of Arabidopsis showed that RD26 is an important regulator of abiotic stress that 290

is involved in the ABA-dependent dehydrate stress-signaling pathway (Fujita et al., 2004; Tran et 291

al., 2004). TsNAC1 is highly expressed in mature tissues (Supplemental Fig. S1A), which is 292

similar to the expression pattern of RD26 (Schmid et al., 2005). However, the expression of 293

TsNAC1 was induced by salt stress, drought and ABA treatments as well as by low temperatures, 294

reactive oxygen species stress and MeJA treatments (Supplemental Fig. S1B), which was 295

inconsistent with the findings for RD26. The promoter sequences of both TsNAC1 and RD26 have 296

light-responsive, MeJA-responsive and ABA-responsive cis-acting regulatory elements. However, 297

the TsNAC1 promoter also had auxin-responsive, anaerobically induced, and cold- and 298

dehydration-responsiveness elements (Supplemental Tab. S1), and these findings are consistent 299

with the expression pattern (Supplemental Fig. S1B). Moreover, the overexpression lines of T. 300

halophila showed slower growth and better survivability after exposure to low temperature, 301

drought stress, high-salt stress and reactive oxygen species stress, whereas RNAi lines showed 302

more rapid growth and were sensitive to abiotic stresses. Several regulator genes involved in the 303

response to abiotic stress were positively regulated by TsNAC1. For example, the expression of 304

DIACYLGLYCEROL KINASE 2 (DGK2), ASPARTATE AMINOTRANSFERASE 5 (AAT3), 305

and CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR 1 (CAMTA1) are induced by 306

low temperature to improve plant freezing tolerance (Byeong-ha Lee, 2005; Goulas et al., 2006; 307

Doherty et al., 2009), and their expression was increased in the OX lines (Supplemental Tab. S2). 308

ACONITASE 3 (ACO3), POLLEN-PISTIL INCOMPATIBILITY 2 (POP2) and 309

NAD-DEPENDENT MALIC ENZYME 2 (NAD-ME2) are induced by oxidative stress and 310

protect plants by increasing the stability in the molar ratio of metal ions (Moeder et al., 2007; 311



16

Yew-Foon Tan, 2010), and the expression of these genes was up-regulated by TsNAC1 as shown 312

by the real-time RT-PCR results for the OX lines against the WT plants (Supplemental Tab. S2). 313

These data suggest that TsNAC1 also plays a role in the control of ROS levels, which indicates 314

that the expression level of TsNAC1 was positively correlated with the resistance to abiotic 315

stresses of plant and TsNAC1 is a crucial regulator for multiple abiotic stress responses in T. 316

halophila. 317

TsNAC1 involvement in regulation of cell ion transport 318

TsNAC1 has been shown to play an important role in salt stress. Moreover, TsNAC1 targets the 319

promoter regions of TsVP1, HB12 and MYBH, and the expression levels of these genes were 320

reduced in the NR lines. The homologous analysis identified two H+-PPase in T. halophila, 321

including TsVP1, which is a crucial proton transporter protein. Utilizing the energy from the 322

hydrolysis of PPi, TsVP1 cooperates with H+-ATPase (Silva and Gerós, 2009) to transfer H+ into a 323

vacuole or the extracellular environment to improve salinity and drought stress tolerance (Gao et 324

al., 2006; Bao et al., 2009; Kumar et al., 2014). Prior studies have shown that AVP1 could not 325

respond to salt stress and was not positively regulated by RD26 (Sun et al., 2010). These 326

differences between TsNAC1 and RD26 contribute to differences in salt tolerance between 327

Arabidopsis and T. halophila. 328

HB12 is in the ABA-induced homeodomain-leucine zipper subfamily I (HD-Zip I), and it 329

specifically functions in Na+ ion homeostasis by regulating the expression of PMR2A (a Na+/Li+ 330

translocating P-type ATPase) in yeast and responds to salt and drought stresses (Shin et al., 2004; 331

Valdés et al., 2012). AtHB-12, the ortholog of HB12, is the target gene of ANAC019 (Hickman et 332

al., 2013), and its T-DNA insertion mutant exhibits longer inflorescence stems via the negative 333

regulation of the expression of GA 20-oxidase (Son et al., 2010). In addition to HB12, the 334

expression of MYBH, another transcription factor involved in salt and drought stresses, is also 335

controlled by TsNAC1. MYBH in Arabidopsis responds to salt and drought stress (Rasheed et al., 336

2016) and also plays a crucial role in auxin accumulation by up-regulating the expression of 337

PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) (Kwon, 2013). MYB families, such MYB2, 338

21,108,112,116 etc., are the target genes of RD26 (Hickman et al., 2013), and they are involved in 339

salt and dehydration tolerance (Yang et al., 2012; Wang et al., 2015). The RD26 target motif also 340

occurs in the promoters of the MYBH and HB12 genes in Arabidopsis, which suggests that these 341



17

promoters are involved in salt stress response. Previous studies of rice showed that the K+ 342

TRANSPORTER (OsHKT1) reduces Na+ accumulation as a response to salt stress and showed 343

that it is the downstream gene of OsMYBc (Zhang et al., 2015). Mutant hkt1-1 in Arabidopsis is 344

sensitive to NaCl and exhibits greater root growth than the WT. The OsHKT1 ortholog in T. 345

halophila is dramatically induced by salt stress (Ali et al., 2013), which suggests that MYBH 346

might be involved in the transport of K+ by regulating the expression of HKT1. These results show 347

that TsNAC1 improves the salt and drought tolerance of plants by directly or indirectly regulating 348

the transport of ions to maintain the proton gradient across the cell membrane and also provides 349

energy for secondary active transport, such as the transport of auxin, which is consistent with 350

observations in Arabidopsis (Li et al., 2005; Yang et al., 2014). 351

TsNAC1 retards growth by restricting cell expansion and organ size 352

The homozygotes of the T-DNA insertion mutants of RD26 (N1: SALK_072276, N2: 353

SALK_083756) were highly sensitive to high-salt conditions (unpublished data in our lab), 354

although significant differences in organ size were not observed compared with Col-0 (Fujita et al., 355

2004). Recent study indicated transgenic 35S:RD26 plants displayed a stunted growth phenotype 356

(Ye et al., 2017). When TsNAC1 derived by the CaMV35 promoter was introduced into N1 and N2, 357

the plants showed a smaller organ size than that of the Col-0 but bigger organs than that of the 358

TsNAC1 transgenic plants derived from the Col-0, and the lines also had significantly improved 359

salt tolerance (unpublished data in our lab). We calculated the cell size of vascular tissue in the 360

root maturation zone 5 days after sowing, and the cell size of the NR lines was increased by 20% 361

and that of the OX lines was reduced by 27.5% compared with that of the WT (Supplemental Fig. 362

S6). 363

In Arabidopsis, AVP1 participates in auxin transport and accumulates in the root (Li and 364

Gaxiola, 2005). And TsVP1, which is the ortholog of AVP1 in T. halophile, is up-regulated in 365

TsNAC1 overexpression lines and also regulates plant growth. Moreover, the overexpression of 366

AVP1 increases the shoot biomass of plants (Li and Gaxiola, 2005; Schilling et al., 2014), and the 367

overexpression of TsVP1 in tobacco, cotton and maize also enhances plant biomass (Gao et al., 368

2006; Li et al., 2008; Lv et al., 2009). Thus, crucial regulators must retard growth and reduce 369

organ size in TsNAC1 overexpression lines. Plants from TsNAC1 overexpression lines showed 370

slower growth and smaller organs than plants that overexpressed TsVP1. This result suggests that 371



18

the effect of TsVP1 on growth in TsNAC1 overexpression lines was overwhelmed by the other 372

target genes regulated by TsNAC1. 373

The organ size of plants is related to cellular processes, such as cell proliferation and expansion 374

(Horváth et al., 2006; Du et al., 2014; Cheng et al., 2016). The expression of MSI4 was 375

up-regulated in TsNAC1 OX lines, and Arabidopsis MSI4 mutants showed a several fold increase 376

in vegetative biomass and a 1.3-fold expansion in cell size (Morel et al., 2009). These results 377

suggest that MSI4 plays a negative regulator of cell expansion. The ortholog of MSI4 in 378

Arabidopsis has been shown to associate with HISTONE DEACETYLASE 6 (HDA6) and LYSINE 379

SPECIFIC DEMETHYLASE1 (LSD1) to repress FLC (Ausín et al., 2004; Yu et al., 2016), and 380

flc-3 mutants flower later than WT plants (Shindo et al., 2006) and present phenotypes similar to 381

that of OX lines (Supplemental Fig. S7). In addition to the up-regulation of MSI4, two positive 382

regulators of cell expansion, LSH1 and TXT2, are negatively regulated by TsNAC1. ALOG family 383

proteins act as the key developmental regulators of shoot organs (Takeda et al., 2011) and seeds 384

(Zhao et al., 2004). LSH1 functions with several other TFs for promoting unidimensional cell 385

enlargement (Zhao et al., 2004; Iyer and Aravind, 2012). The development of primary cell walls 386

plays a crucial role in plant growth (Cosgrove, 2005) and morphogenesis (Schopfer, 2006). 387

Xyloglucan (XyG) in the primary cell wall of dicotyledonous plants is a restraining factor on wall 388

extensibility (Keegstra and Albersheim, 1973; Hayashi, 2003; Park and Cosgrove, 2015). The 389

biosynthesis of XyG is catalyzed by the ortholog of TXT2 (UDP-xylosyltransferase 2), a GT34 390

family member (Vuttipongchaikij et al., 2012; Zabotina et al., 2012) in Arabidopsis (Cavalier et al., 391

2008). Ye et al. discovered TCH4 and EXPL2 were downregulated in 35S:RD26 plants to retard 392

plant growth (Ye et al., 2017). RT-PCR results indicated TXT2, which locates on the same 393

subfamily with TCH4, was suppressed 1.92 fold (Log (OX/WT)) (Tab. 1), but EXPA6, which 394

locates on the same subfamily with EXPL2 and with a 6.19 relative fold enrichment in its 395

promoter region, suppressed less than 0.23 fold (not shown in the data) in OX lines. Overall, 396

variations in the expression levels of MSI4, LSH1 and TXT2 induced by TsNAC1 lead to the 397

retardation of plant growth via retarding cell expansion. 398

TsNAC1 regulates embryonic development 399

Although the OX transgenic lines had smaller organ size, the fruit set was not lower than that of 400

the WT and NR lines. Several positive regulators involved in embryo development are regulated 401



19

by TsNAC1. Campesterol is the precursor in the synthesis of brassinosteroids (Hartmann, 1998) 402

and affects postembryonic growth in higher plants (Clouse and Sasse, 1998). CYP51 is involved in 403

the biosynthesis of campesterol, and cyp51 mutants are always embryo lethal (O'Brien et al., 2005) 404

or seedling lethal (Kim et al., 2005) via the generation of ROS and ethylene (Kim et al., 2010). In 405

the OX lines, CYP51 exhibits up-regulated expression, which could enhance the biosynthesis of 406

campesterol, which is beneficial for embryonic development. One member of the Cullin family, 407

CUL3, associates with RING-FINGER PROTEIN (RBX1) and BROAD COMPLEX (BTB) 408

domain proteins and works as an E3 ligase (Figueroa et al., 2005), which affects embryo pattern 409

formation at the heart stage (Thomann et al., 2005). In T. halophile, the expression of CUL3 is 410

up-regulated by TsNAC1 overexpression, which could regulate embryonic development. The 411

ortholog of PRP31 in Arabidopsis encodes a splicing factor and interacts with STABILIZED 1 412

(STA1) and ZINC-FINGER AND OCRE DOMAIN-CONTAINING PROTEIN 1 (ZOP1) to regulate 413

embryonic development by regulating the expression of RNA HELICASE 22 (RH22) (Kanai, 2013) 414

and TRIGALACTOSYLDIACYLGLYCEROL1 (TGD1) (Xu et al., 2005) under abiotic stress 415

treatments, such as cold stress (Du et al., 2015). In the T. halophile OX lines, the expression of 416

PRP31 was up-regulated by TsNAC1 overexpression, which suggests that PRP31 or TsNAC1 play 417

a role in abiotic stress resistance by improving embryonic development. 418

Stress tolerance coupled to growth retardation 419

Prior studies showed plants or tissues with lesser cell size contributes to plants abiotic stress 420

tolerance, such as the moisture resistance (Cutler et al., 1977; Bradford and Hsiao, 1982). Under 421

the abiotic stress, one way to improve the tolerance of plants is to construct a new ion homeostasis 422

via the active transport, such as improving the salt stress tolerance of plants via overexpressing 423

H+-PPase AVP1 (Li and Gaxiola, 2005). In this study, TsNAC1 improved salt stress tolerance of 424

plants via enhancing the expression of TsVP1, HB12 and MYBH et al. to regulate the 425

transformation of ion, and retarded plant growth via restricting cell expansion by effecting the 426

expression level of some plant growth genes, such as MSI4, LSH1 and TXT2 (Fig. 6). With the 427

advantage of smaller volume, lesser size cells wasted lesser energy on the active transportation of 428

ion to maintain the osmotic pressure, and more energy could be used to power the metabolic 429

reactions to improve abiotic stress resistance of plants. Recently，Ye et al reported that RD26 430

mediates crosstalk between drought and BR signaling. When overexpressed, BES1 target gene 431

RD26 can inhibit BR-regulated growth. Global gene expression studies suggest that RD26 can act 432



20

antagonistically to BR to regulate the expression of a subset of BES1-regulated genes, thereby 433

inhibiting BR function (Ye et al, 2017). In this study we found the overexpressed TsNAC1 434

increased the expression of CYP51 that took part in the biosynthesis of campesterol, the precursor 435

of BR, but the nexus of TsNAC1 function and BR signaling should mandate further investigations. 436

It is concluded that TsNAC1 as an upstream regulator of plant abiotic stress resistance and 437

vegetative growth functions directly on the promoter of MYBH, HB12, TsVP1, NAD-ME2, AAT3, 438

PRP31, CYP51, MSI4, LSH1, TXT2 etc., upon the increased or reduced expression, coordinates 439

both abiotic stress resistance and growth retardation by reducing cell expansion and growth rate. 440

Comparison between RD26 and TsNAC1 441

The binding activity to the promoter, the candidate motif and the downstream genes of TsNAC1 442

and RD26 were compared in this paper. As shown in Figure 5, a higher transcriptional activation 443

activity of TsNAC1 was found compared to RD26. In this study, the “CA(T/A)G” sequence was 444

verified as the core DNA-binding motif for TsNAC1 (Supplemental Fig. S5 ), while RD26 445

recognizes and binds to regions containing a CACG consensus sequence (Tran et al., 2004). 446

TsNAC1 preferred CATG than CAAG. The TsVP1 promoter sequence (-667 bp~-138 bp) used for 447

the binding activity assay contained both of these motifs, which explains why the binding activity 448

assay showed a similar level. A comparison of promoter sequences of major TsNAC1 targeted 449



21

genes in T. halophila and their ortholog genes in Arabidopsis (Supplemental Tab. S3) showed that 450

the distribution of motifs was different between species. Compared with the RNA-seq results with 451

the RD26OX lines as materials from Ye et al., in the 892 downstream target candidate genes of 452

TsNAC1, 135 genes were up-regulated in RD26OX lines and the main biological process enriched 453

in response to salt stress (included the ortholog of HB12 and MYBH), and the regulation of 454

transcription (Tab.1 & Supplemental Fig.S8). 258 genes were down-regulated and enriched in the 455

plant developmental process (included the ortholog of LSH1, TXT2, TCH4 and EXPA6, which 456

play roles in restricting cell expansion) and nitrogen metabolic (Tab. 1 & Supplemental Fig.S8). It 457

was worth noting that the expression of AVP1 is not regulated in RD26OX lines. All these 458

evidences were consistent with the RT-PCR results of our study (Tab. 1). The other 499 genes 459

enriched in post-embryonic development, ion transport, response to cold and oxidative stress. 460

These findings may provide evidences to clarify the similarities and differences between the OX 461

lines of TsNAC1 and RD26 in the plant development and stress resistance. 462

The promoter and the CDS regions of AVP1 and TsVP1 have approximately 75% similarity. Five 463

RD26 targeted motifs are observed in the AVP1 promoter, whereas three TsNAC1 targeted motifs 464

are observed in the TsVP1 promoter (Supplemental Tab. S3). Both motifs and promoters are 465

differential, which might have caused the discrepancy in response to salt stress. In the T. halophila 466

OX lines, the TsNAC1 target genes presented altered expression levels, with MSI4, TsVP1, etc. 467

showing up-regulated expression and LSH1 and TXT2 showing down-regulated expression. These 468

data suggest that there may be different regulation patterns of TsNAC1 based on the distribution 469

of the target motifs. Additional work is required to determine whether polymorphisms of the 470

regulatory mechanisms occur. TsNAC1 appears to play similar but not identical roles in T. 471

halophila and Arabidopsis for the regulation of plant growth and responses to abiotic stressors. 472

473

Conclusions 474

Plants from TsNAC1 overexpression lines showed higher survival rates under abiotic stress and 475

grew slowly under normal conditions. The ChIP-Seq data offer evidence that the overexpression 476

of TsNAC1 up-regulates the genes involved in the response to abiotic stresses and ion transport, 477

thereby improving stress resistance, and negatively regulates the genes involved in plant 478

vegetative growth, thereby reducing cell expansion (Fig. 6). TsNAC1 regulates target genes with 479



22

the “CA(T/A)G” consensus sequence, which differs from the results for RD26. In the model 480

extremophile plant T. halophila, TsNAC1 is a crucial upstream regulator for abiotic stress 481

resistance and cell expansion. 482

483

Materials and methods 484

One-hybrid yeast screening of T. halophila cDNA libraries 485

The 6-week old Thellungiella halophila wild plants, which exposed to a 12 h high-salt stress 486

treatment, were used to construct the cDNA library. The extraction of mRNA was performed with 487

the Oligotex mRNA Mini Kit (Qiagen). The LD-PCR was executed by the PCR cDNA Synthesis 488

Kit (SMART). All the fragments were linked to the vector pGADT7-AD and transformed into 489

yeast Y187 strain (Invitrogen) following the Yeast Protocols Handbook (Clontech). Cultured the 490

transformed stains on SD/-LEU medium. Extracted yeast plasmid and amplified with the T7 491

Sequencing Primer and the 3' AD Sequencing Primer on plasmid, most fragments were from 700 492

bp to 2000 bp. Considering the stability of the specific binding between the protein and the DNA 493

sequence, three-time tandem repeated 530 bp DNA fragment of the TsVP1 promoter (-667 494

bp~-138 bp) were cloned into pHis2.1 as the bait. Transformed the bait vector into the cDNA 495

library and cultured on SD/-HIS/-TRP with 5 mM 3-AT. Extracted the plasmid of the thrive stains 496

and amplified with the T7 Sequencing Primer and the 3' AD Sequencing Primer. The amplicons 497

were transformed into the E. coil and sequenced at BioSune (Shanghai). 498

Binding active assay of TsNAC1 and RD26 in yeast system 499

The coding sequence of TsNAC1 and RD26 were obtained by PCR and the products were digested 500

by EcoRI/SmaI and BamHI/SacI, then connected into the pGADT7-AD vector which containing 501

the GAL4 active domain. The promoters of TsVP1 and candidate target genes were cloned into the 502

EcoRI/KpnI site of pLacZi or the EcoRI/SpeI sites of pHis2.1. Plasmids were transformed in the 503

yeast strain YM4271 (Invitrogen) in pairs. The β-galactosidase activities were examined by X-gal 504

staining and measured as described in the Yeast Protocols Handbook (Clontech) using ONPG 505

(o-nitrophenyl-β-D-galactopyranoside) as the substrate. 506

Vector construction and transformation 507

The full-length cDNA of TsNAC1 was ligated into the vector pCAMBI1300 that contains the 508

hygromycin as the selective marker. The specific fragment (418 bp-882 bp) of TsNAC1 was 509



23

reorganization into the vector of pFGC-5941 to interfere the expression of TsNAC1 and used bar 510

as the selective marker. Vectors were introduced into Thellungiella halophila upon Agrobacterium 511

tumefciens-mediated transformation GV3101 by Floral-dip methods. Thellungiella halophila 512

seeds were planted in peat: vermiculite (2:1) grown at 24 °C under long day condition (16 h light, 513

8 h dark) and with a relative humidity of 50% for 6 weeks. Transformed the plants to 2 °C -4 °C 514

for 5 weeks vernalization, then putted back to 24 °C to enter the mature period. 515

Polyclonal antibody of TsNAC1 516

Firstly, the full-length of TsNAC1 was cloned and connected into the pGEX-4T-1, and then the 517

integrated plasmid was transformed into BL21 stain. Cultivated the prokaryotic expression strain 518

and induced the expression of protein NAC-GST as described in the “Molecular cloning a 519

laboratory manual III” on page 1221-1231. The purification of the soluble NAC-GST protein was 520

performed by the Chelating Sepharose Fast Flow (GE Healthcare). The performance of the 521

preparation of the polyclonal antibody was accomplished by the Abmart Company. The titer of the 522

antibody was over 5×104 IU. 523

Electrophoretic mobility shift assay 524

Probes were generated using a Dig Gel Shift kit (Roche). The mutated competitors of the 130 bp 525

key region in the promoter of TsVP1 was the sequence between PT7 and PT8 ( -667 bp to -538 bp), 526

which region was reported with no salt response (Sun et al., 2010) and sited beside the 130 bp key 527

region. 528

Plant performance under different treatment in the greenhouse 529

Thellungiella halophila seeds were planted in peat: vermiculite (2:1) grown at 24 °C under long 530

day condition (16 h light, 8 h dark) and with a relative humidity of 50%. Different treatments were 531

performed after seeding 6-weeks. Sprayed the uniform seedlings of transgenic plants and wild 532

type with 0.1ml 3mmol/l paraquat for every pot to mimic the active oxygen stress treatment. In the 533

low temperature stress treatment experiments, the transgenic plants were transferred into the other 534

culturing room with -4 °C and with >3500 lux light intensity for 48 h. Watered these plants with 535

18% PEG6000 solution 50ml for every pot to mimic the drought stress and with a 10ml addition 536

every 2 days. Watered these transgenic lines with an 800 mM NaCl solution and then watered with 537

10 ml of a 400 mM NaCl solution every 3 days to keep the 600 mM NaCl concentration of culture 538

medium two weeks. The hormone treatment was performed by spraying and watering the 100 μM 539



24

ABA or 100 μM MeJA 1 ml for each pot. 540

Plant RNA extraction and realtime RT-PCR 541

The total RNA was extracted by Trizol (TAKARA, Japan) reagent. An amount of 500 ng total 542

RNA was used to inverse transcription with Transcriptor First Strand cDNA Synthesis Kit 543

(TAKARA, Japan). Diluted the cDNA 10 times and then as the template for real-time RT-PCR. 544

RT-PCR reaction system: SYBR® Premix Ex TaqTM (2x) 5 μl, PCR Forward Primer (10 μM) 0.2 545

μl, PCR Reverse Primer (10 μM) 0.2 μl, cDNA template 1μl, with distilled deionized water up to 546

10 μl. The PCR reaction conditions: incubate for 3 min at 95 °C, followed by a total of 40 cycles 547

of (15 s at 95 °C, 30 s at 58 °C, at 72 ºC 30 s). 548

Luciferase assay 549

Promoter fragments in the pGreenII 0800: Luc vector co-transformed with the pSoup helper 550

plasmid into Agrobacterium tumefciens GV3101 and injected together with 35S:TsNAC1 or 551

35S:RD26 into the Tobacco leaves. The isolation of T. halophila protoplast and transformation 552

were performed according to the protocol described previously (Yoo et al., 2007; Wu et al., 2009). 553

Cells were harvested 18h post-transfection, and luciferase activity (Luc/Rluc) was measured after 554

cell lysis using the Double-Luciferase Reporter Assay Kit (TransDetect®). 555

ChIP and ChIP-qPCR 556

The details of ChIP were as described by Kaufmann et al. (Kaufmann and Al, 2010). Sequencing 557

platform: Illumina Hiseq 4000. Aligner and parameter: Clean Parameter “soap_mm_gz -p 4 -v 5 -s 558

35 -m 0 -x 600”. Peak caller and parameter: Peak Calling Parameter “macs14 -g 411831487 -p 559

1e-5 -w --space 50 -m 10,30”. Independent lines OX7 and OX10 were used to ChIP-qPCR assay 560

and all the samples were diluted to 10 ng/µl, and reacted with the system: SYBR® Premix Ex 561

TaqTM (2x) 5 μl, PCR Forward Primer (10 μM) 0.2 μl, PCR Reverse Primer (10 μM) 0.2 μ l, 562

cDNA template 1 μl, and added distilled deionized H20 up to 10 μl. 563

The primers used to amplify the enriched region of the target genes were listed in Supplemental 564

Table S4. All the target genes of TsNAC1 were listed in Supplemental Table S5. The row data of 565

ChIP-seq were upload to the data sharing platform figshare: 566

https://figshare.com/projects/Exploration_of_the_target_genes_of_TsNAC1/25135 567

Transcript activation activity assay 568

The C-terminal activation domain (164-305), the activation domain with the repression domain 569



25

(105-305) and the full-length of transcription factors domain (1-305) of TsNAC1 were connected 570

into the EcoRI and PstI sites of pGBKT7-BD. The C-terminal activation domain (181-314), the 571

activation domain with the repression domain (122-314), the full-length of transcription factors 572

domain (1-314) and the point mutant (126 R to H) of RD26 were also inserted and connected into 573

the BamHI and PstI sites of pGBKT7-BD vector. Plasmids were transformed in the yeast reporter 574

strain YRG-2 (Agilent Stratagene). The β-galactosidase activities were examined by X-gal 575

staining and measured by ONPG assay. 576

577

Acknowledgements 578

We thank Arabidopsis Biological Resource Center for Arabidopsis mutants. 579

SUPPLEMENTAL DATA 580

Supplemental Figure S1. Evolutionary relationships of TsNAC1 581

Supplemental Figure S2. Expression Pattern Analysis of TsNAC1 in wild type plants of T. 582

halophila. 583

Supplemental Figure S3. Abiotic stress treatment comparison between the OX, wild type and NR 584

lines. 585

Supplemental Figure S4. The validity of TsNAC1 antibody. 586

Supplemental Figure S5. Determination of the core binding motif. 587

Supplemental Figure S6. Comparison of growth parameters in root after sowing 5 days. 588

Supplemental Figure S7. Difference of phenotype and flowering time among the different lines. 589

Supplemental Figure S8. Biological process gene ontology analysis. 590

Supplemental Table S1. The different sites between the promoter of TsNAC1 and RD26. 591

Supplemental Table S2. Candidate target genes of TsNAC1 on other abiotic stress. 592

Supplemental Table S3. The distribution of motifs in the promoter of target genes. 593

Supplemental Table S4. Primers used in this study. 594

Supplemental Table S5: Candidate target genes of TsNAC1 in T. halophila. 595

Supplemental Data 1. TsNAC1 peptide sequence. 596

Supplemental Data 2. The promoter sequence of TsVP1. 597

598

599



26

Table 600

Table 1. Candidate target genes of TsNAC1 identified by ChIP-Seq. 601

a TGI, T. halophila Genome Initiative. bAGI, the ortholog of T. halophila in Arabidopsis Genome Initiative. 602

c Motif, whether with the CAT(A)G in the promoter region of target genes in T. halophila. 603

d Alias, the ortholog of target genes' short names in Arabidopsis, excepted the TsVP1, which has been 604

reported. 605

e Enrichment fold, which was normalized by the Input sample data. 606

f Relative expression level, log2 (relative expression of target gene in OXA lines against in wild type 607

plants, normalized with the expression level of Tub2) referenced to the results of real-time RT-PCR. 608

609

Figure Legends 610

Figure 1. The 130 bp key region of the promoter of TsVP1 is a direct binding target of TsNAC1. 611

A, Multiple amino acid sequences alignment result of TsNAC1 and its ortholog in Arabidopsis 612

(RD26). The identical residues were shaded in black and five subdomains (A-E) were indicated on 613

the sequences. B, Transcriptional activity assay of TsNAC1 in yeast strain YM4271. TsNAC1 was 614

cloned and fused with the GAL4 active domain. The promoter of TsVP1 was cloned into pLacZi 615

vector. Streaked transformants on YPDA and SD/-URA medium. The activities of β-galactosidase 616

were examined by X-gal staining. C, The electrophoretic mobility shifts assay (EMSA). Probes, 617

TsNAC1-GST, competitors (130 bp unlabeled fragments) and mutated competitors at a 50× and 618

TGI numbera AGI numberb Motifc(Y/N) Aliasd Enrichment folde Relative expression levelf

Tp3g32900 AT2G19520 Y MSI4 35.71 3.93

Tp2g20180 AT5G28490 Y LSH1 25.51 -2.18

Tp6g02410 AT4G02500 Y TXT2 31.06 -1.92

Tp1g10290 AT1G11680 Y CYP51 59.52 3.46

Tp2g04490 AT1G60170 Y PRP31 44.64 3.01

Tp1g21950 AT1G26830 Y CUL3 41.21 2.96

Tp1g13990 AT1G15690 Y TsVP1 29.76 3.43

Tp5g01460 AT3G61890 Y HB12 39.68 2.57

Tp2g12110 AT5G47390 Y MYBH 29.76 2.18



27

200× molar excess were present (+) or absent (-) in each reaction. And the protein-DNA 619

complexes were marked by the black arrow. 620

Figure 2. TsNAC1 regulated the growth of T. halophila. 621

A, Diagrams of plant overexpression vector and RNA interference vector. B, Phenotypes of 622

TsNAC1 transgenic plants. Seedlings grown on MS-agar for 4 days after sowing, plants grown in 623

soil for 6 weeks and 14 weeks (after vernalization treatment for 5 weeks). C, The western blot 624

result of transgenic lines and wild type. D, Phenotype of the OX, wild-type and NR T. halophila 625

plants after 48 h treatment in -4 ℃ with 3500 lux; after one week of drought stress with a 18% 626

PEG6000 solution; after keeping the 600 mM NaCl concentration of culture medium two weeks; 627

after 36 h of active oxygen stress with the 0.1 ml 3 mM paraquat solution for every pot. E, The 628

TsNAC1 expression level in OX7, OX10, NR10, NR11 and wild type (the expression was 629

normalized with Actin), and the dry weight of shoots and roots. OX7, OX10: Different 630

overexpression lines; NR10, NR11: Different RNAi lines. All bars represent means± s.d, three 631

biological replicates in the experiment, 5 plants for each repeat. Significant differences (Student’s 632

T-Test, P <0.01 (**) and P <0.05 (*)). 633

Figure 3. ChIP-Seq assay of TsNAC1. 634

A, Distribution of TsNAC1 TF binding sites. B, Identified peaks distance from TSS (transcription 635

start sites) for TsNAC1.The peaks were highly enriched in -200 bp - +100 bp to TSS. C, The 636

ChIP-Seq signal of TP1G13990 (TsVP1) and TP2G25870 (Tub2) on the genome browser. The tag 637

counts were normalized in each bin according to the total number of reads. Short black lines 638

marked regions used for ChIP-qPCR assay. D, Binding situation of TsNAC1 quantified by the 639

percent occurrence of the CA(T/A)G motif (x axis) plotted against the log2- FC of IP samples 640

compared with the input sample (y axis), with the color of each square mapped to the number of 641

indicated peak motifs. E, The anti-TsNAC1 ChIP- qPCR validation and the transcripts detection 642

of TsVP1 and TsNAC1. Sample immunized by preimmune serum were used as the negative 643

control in ChIP-qPCR assay. F, The gene ontology (GO) analysis results of the Input sample data 644

and two IP samples (OX7, OX10) data. The dotted boxes rectangles labeled the significant and 645

consistent enrichment GO and the hierarchical classification results of biological regulation, 646

developmental processes and responses to stimuli. All bars represent means± s.d, three biological 647

replicates in the experiment, 5 plants for each repeat. Significant differences (Student’s T-Test, P 648



28

<0.01 (**) and P <0.05 (*)). 649

Figure 4. Validation of candidate downstream genes. 650

A, Downstream target promoter fragments were connected into pLacZi and transformed into the 651

pAD-GAL4-TsNAC1 YM4271 strain. The β-galactosidase activities were validated by X-gal 652

staining. Measures of β-gal activity with the ONPG as substrate. B, Binding of TsNAC1 to the 653

promoter of downstream genes as determined by ChIP-PCR. With the 6-week wild type rosette 654

leaves as materials and immunoprecipitated with TsNAC1 antibody and protein A agarose beads. 655

Negative control reactions were performed in parallel using preimmune serum. β-gal units (Mu): 656

1,000 × OD574/ (t × V × OD600), t: elapsed incubation time (min), V: volume of culture (mL). C, 657

D, Transient expression of the P35S:TsNAC1 or P35S:RD26 construct with Promoter: Luc 658

reporter constructs in: C, T. halophila protoplasts; D, Tobacco leaves, representative 659

bioluminescence images are shown. All bars represent means± s.d, three biological replicates in 660

the experiment. Significant differences (Student’s T-Test, P <0.01 (**) and P <0.05 (*)). 661

Figure 5. Assays of transcription factor activity in yeast system. 662

A, The binding activity of TsNAC1 and RD26 to the promoter of TsVP1. TsNAC1 and RD26 were 663

cloned and fused with yeast GAL4 active domain. The promoter of TsVP1 was linked into the 664

pHis2.1 and pLacZi vectors as reporters. B, Truncation analysis of transcriptional activation 665

activity of TsNAC1 and RD26. Numbers on the top indicate the positions of amino acids. A-E 666

subdomains of the NAC DNA-binding domains are colored by black, the active domains are 667

colored by gray and the mutation of the amino acid are colored by red. The C-terminal activation 668

domain (164-305, 181-314), the activation domain with the repression domain (105-305, 122-314) 669

and the full-length of transcription factors domain (1-305, 1-314) were cloned and fused with the 670

yeast GAL4 binding domain. Transformants were screened on the SD/-LEU or SD/-TRP and 671

SD/-HIS, the β-galactosidase activities were validated by X-gal staining and quantified by ONPG 672

assay. Western blot was executed with the antibody of GST. All bars represent means± s.d, three 673

biological replicates in the experiment. Significant differences (Student’s T-Test, P <0.01 (**) and 674

P <0.05 (*)). 675

Figure 6. Proposed model for regulation of plant development and stress responses by TsNAC1. 676

TsNAC1 functions as an upstream regulator of plant osmotic stress (regulates ion transportation), 677

oxidative stress, cold stress responses; and coordinates both vegetative growth (retards cell 678



29

expansion) and reproductive growth. 679

680

681



Parsed CitationsAli A, Park HC, Aman R, Ali Z, Yun DJ (2013) Role of HKT1 in Thellungiella salsuginea, a model extremophile plant. Plant Signaling &Behavior 8

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Amtmann A, Bohnert HJ, Bressan RA (2005) Abiotic stress and plant genome evolution. Search for new models. Plant Physiol 138: 127-130


Ausín I, Alonso-Blanco C, Jarillo JA, Ruiz-García L, Martínez-Zapater JM (2004) Regulation of flowering time by FVE, a retinoblastoma-associated protein. Nature Genetics 36: 162-166


Bailey TL, Johnson J, Grant CE, Noble WS (2015) The MEME Suite. Nucleic Acids Res 43: W39-49Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bao AK, Wang SM, Wu GQ, Xi JJ, Zhang JL, Wang CM (2009) Overexpression of the Arabidopsis H+-PPase enhanced resistance to saltand drought stress in transgenic alfalfa (Medicago sativa L.). Plant Science 176: 232-240


Benina M, Obata T, Mehterov N, Ivanov I, Petrov V, Toneva V, Fernie AR, Gechev TS (2013) Comparative metabolic profiling ofHaberlea rhodopensis, Thellungiella halophyla, and Arabidopsis thaliana exposed to low temperature. Front Plant Sci 4: 499


Bradford KJ, Hsiao TC (1982) Physiological Responses to Moderate Water Stress. Springer Berlin HeidelbergPubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Byeong-ha Lee DAH, Jian-Kang Zhu (2005) The Arabidopsis Cold-Responsive Transcriptome and Its Regulation by ICE1. Plant Cell 17:3155-3175


Cavalier DM, Lerouxel O, Neumetzler L, Yamauchi K, Reinecke A, Freshour G, Zabotina OA, Hahn MG, Burgert I, Pauly M (2008)Disrupting Two Arabidopsis thaliana Xylosyltransferase Genes Results in Plants Deficient in Xyloglucan, a Major Primary Cell WallComponent. Plant Cell 20: 1519-1537


Cheng H, Chen X, Zhu J, Huang H (2016) Overexpression of a Hevea brasiliensis ErbB-3 Binding protein 1 Gene Increases DroughtTolerance and Organ Size in Arabidopsis. Frontiers in Plant Science 7


Chi YH, Melencion SM, Alinapon CV, Kim MJ, Lee ES, Paeng SK, Park JH, Nawkar GM, Jung YJ, Chae HB, Kang CH, Lee SY (2017) Themembrane-tethered NAC transcription factor, AtNTL7, contributes to ER-stress resistance in Arabidopsis. Biochem Biophys ResCommun


Clouse SD, Sasse JM (1998) BRASSINOSTEROIDS: Essential Regulators of Plant Growth and Development. Annual Review of PlantBiology 49: 427-451



http://www.ncbi.nlm.nih.gov/pubmed?term=Ali A%2C Park HC%2C Aman R%2C Ali Z%2C Yun DJ %282013%29 Role of HKT1 in Thellungiella salsuginea%2C a model extremophile plant%2E Plant Signaling %26 Behavior 8&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ali A, Park HC, Aman R, Ali Z, Yun DJ (2013) Role of HKT1 in Thellungiella salsuginea, a model extremophile plant. Plant Signaling & Behavior 8

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ali&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Role of HKT1 in Thellungiella salsuginea, a model extremophile plant.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Role of HKT1 in Thellungiella salsuginea, a model extremophile plant.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ali&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Amtmann A%2C Bohnert HJ%2C Bressan RA %282005%29 Abiotic stress and plant genome evolution%2E Search for new models%2E Plant Physiol 138%3A 127%2D130&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Amtmann A, Bohnert HJ, Bressan RA (2005) Abiotic stress and plant genome evolution. Search for new models. Plant Physiol 138: 127-130

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Amtmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Abiotic stress and plant genome evolution&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Abiotic stress and plant genome evolution&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Amtmann&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Aus�n I%2C Alonso%2DBlanco C%2C Jarillo JA%2C Ruiz%2DGarc�a L%2C Mart�nez%2DZapater JM %282004%29 Regulation of flowering time by FVE%2C a retinoblastoma%2Dassociated protein%2E Nature Genetics 36%3A 162%2D166&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Aus�n I, Alonso-Blanco C, Jarillo JA, Ruiz-Garc�a L, Mart�nez-Zapater JM (2004) Regulation of flowering time by FVE, a retinoblastoma-associated protein. Nature Genetics 36: 162-166

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ausín&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of flowering time by FVE, a retinoblastoma-associated protein&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of flowering time by FVE, a retinoblastoma-associated protein&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ausín&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bailey TL%2C Johnson J%2C Grant CE%2C Noble WS %282015%29 The MEME Suite%2E Nucleic Acids Res 43%3A W39%2D49&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bailey TL, Johnson J, Grant CE, Noble WS (2015) The MEME Suite. Nucleic Acids Res 43: W39-49

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bailey&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The MEME Suite&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The MEME Suite&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bailey&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bao AK%2C Wang SM%2C Wu GQ%2C Xi JJ%2C Zhang JL%2C Wang CM %282009%29 Overexpression of the Arabidopsis H%2B%2DPPase enhanced resistance to salt and drought stress in transgenic alfalfa %28Medicago sativa L%2E%29%2E Plant Science 176%3A 232%2D240&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bao AK, Wang SM, Wu GQ, Xi JJ, Zhang JL, Wang CM (2009) Overexpression of the Arabidopsis H+-PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L.). Plant Science 176: 232-240

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of the Arabidopsis H+-PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of the Arabidopsis H+-PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bao&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Benina M%2C Obata T%2C Mehterov N%2C Ivanov I%2C Petrov V%2C Toneva V%2C Fernie AR%2C Gechev TS %282013%29 Comparative metabolic profiling of Haberlea rhodopensis%2C Thellungiella halophyla%2C and Arabidopsis thaliana exposed to low temperature%2E Front Plant Sci 4%3A 499&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Benina M, Obata T, Mehterov N, Ivanov I, Petrov V, Toneva V, Fernie AR, Gechev TS (2013) Comparative metabolic profiling of Haberlea rhodopensis, Thellungiella halophyla, and Arabidopsis thaliana exposed to low temperature. Front Plant Sci 4: 499

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Benina&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative metabolic profiling of Haberlea rhodopensis, Thellungiella halophyla, and Arabidopsis thaliana exposed to low temperature.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative metabolic profiling of Haberlea rhodopensis, Thellungiella halophyla, and Arabidopsis thaliana exposed to low temperature.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Benina&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bradford KJ%2C Hsiao TC %281982%29 Physiological Responses to Moderate Water Stress%2E Springer Berlin Heidelberg&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bradford KJ, Hsiao TC (1982) Physiological Responses to Moderate Water Stress. Springer Berlin Heidelberg

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bradford&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Physiological Responses to Moderate Water Stress.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Physiological Responses to Moderate Water Stress.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bradford&as_ylo=1982&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Byeong%2Dha Lee DAH%2C Jian%2DKang Zhu %282005%29 The Arabidopsis Cold%2DResponsive Transcriptome and Its Regulation by ICE1%2E Plant Cell 17%3A 3155%2D3175&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Byeong-ha Lee DAH, Jian-Kang Zhu (2005) The Arabidopsis Cold-Responsive Transcriptome and Its Regulation by ICE1. Plant Cell 17: 3155-3175

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Byeong-ha&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis Cold-Responsive Transcriptome and Its Regulation by ICE1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis Cold-Responsive Transcriptome and Its Regulation by ICE1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Byeong-ha&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cavalier DM%2C Lerouxel O%2C Neumetzler L%2C Yamauchi K%2C Reinecke A%2C Freshour G%2C Zabotina OA%2C Hahn MG%2C Burgert I%2C Pauly M %282008%29 Disrupting Two Arabidopsis thaliana Xylosyltransferase Genes Results in Plants Deficient in Xyloglucan%2C a Major Primary Cell Wall Component%2E Plant Cell 20%3A 1519%2D1537&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cavalier DM, Lerouxel O, Neumetzler L, Yamauchi K, Reinecke A, Freshour G, Zabotina OA, Hahn MG, Burgert I, Pauly M (2008) Disrupting Two Arabidopsis thaliana Xylosyltransferase Genes Results in Plants Deficient in Xyloglucan, a Major Primary Cell Wall Component. Plant Cell 20: 1519-1537

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cavalier&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Disrupting Two Arabidopsis thaliana Xylosyltransferase Genes Results in Plants Deficient in Xyloglucan, a Major Primary Cell Wall Component&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Disrupting Two Arabidopsis thaliana Xylosyltransferase Genes Results in Plants Deficient in Xyloglucan, a Major Primary Cell Wall Component&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cavalier&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cheng H%2C Chen X%2C Zhu J%2C Huang H %282016%29 Overexpression of a Hevea brasiliensis ErbB%2D3 Binding protein 1 Gene Increases Drought Tolerance and Organ Size in Arabidopsis%2E Frontiers in Plant Science 7&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cheng H, Chen X, Zhu J, Huang H (2016) Overexpression of a Hevea brasiliensis ErbB-3 Binding protein 1 Gene Increases Drought Tolerance and Organ Size in Arabidopsis. Frontiers in Plant Science 7

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cheng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of a Hevea brasiliensis ErbB-3 Binding protein 1 Gene Increases Drought Tolerance and Organ Size in Arabidopsis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of a Hevea brasiliensis ErbB-3 Binding protein 1 Gene Increases Drought Tolerance and Organ Size in Arabidopsis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cheng&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chi YH%2C Melencion SM%2C Alinapon CV%2C Kim MJ%2C Lee ES%2C Paeng SK%2C Park JH%2C Nawkar GM%2C Jung YJ%2C Chae HB%2C Kang CH%2C Lee SY %282017%29 The membrane%2Dtethered NAC transcription factor%2C AtNTL7%2C contributes to ER%2Dstress resistance in Arabidopsis%2E Biochem Biophys Res Commun&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chi YH, Melencion SM, Alinapon CV, Kim MJ, Lee ES, Paeng SK, Park JH, Nawkar GM, Jung YJ, Chae HB, Kang CH, Lee SY (2017) The membrane-tethered NAC transcription factor, AtNTL7, contributes to ER-stress resistance in Arabidopsis. Biochem Biophys Res Commun

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chi&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Clouse SD%2C Sasse JM %281998%29 BRASSINOSTEROIDS%3A Essential Regulators of Plant Growth and Development%2E Annual Review of Plant Biology 49%3A 427%2D451&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Clouse SD, Sasse JM (1998) BRASSINOSTEROIDS: Essential Regulators of Plant Growth and Development. Annual Review of Plant Biology 49: 427-451

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Clouse&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=BRASSINOSTEROIDS: Essential Regulators of Plant Growth and Development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=BRASSINOSTEROIDS: Essential Regulators of Plant Growth and Development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Clouse&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1


Cosgrove DJ (2005) Growth of the plant cell wall. Nature Reviews Molecular Cell Biology 6: 850-861Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cutler JM, Rains DW, Loomis RS (1977) The Importance of Cell Size in the Water Relations of Plants. Physiologia Plantarum 40: 255-260Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Doherty CJ, Van Buskirk HA, Myers SJ, Thomashow MF (2009) Roles for Arabidopsis CAMTA transcription factors in cold-regulatedgene expression and freezing tolerance. Plant Cell 21: 972


Du JL, Zhang SW, Huang HW, Cai T, Li L, Chen S, He XJ (2015) The Splicing Factor PRP31 Is Involved in Transcriptional GeneSilencing and Stress Response in Arabidopsis. Mol Plant 8: 1053-1068


Du L, Li N, Chen L, Xu Y, Li Y, Zhang Y, Li C, Li Y (2014) The ubiquitin receptor DA1 regulates seed and organ size by modulating thestability of the ubiquitin-specific protease UBP15/SOD2 in Arabidopsis. Plant Cell 26: 665


Figueroa P, Gusmaroli G, Serino G, Habashi J, Ma L, Shen Y, Feng S, Bostick M, Callis J, Hellmann H (2005) Arabidopsis Has TwoRedundant Cullin3 Proteins That Are Essential for Embryo Development and That Interact with RBX1 and BTB Proteins to FormMultisubunit E3 Ubiquitin Ligase Complexes in Vivo. Plant Cell 17: 1180-1195


Fujita M, Fujita Y, Maruyama K, Seki M, Hiratsu K, Ohme-Takagi M, Tran LS, Yamaguchi-Shinozaki K, Shinozaki K (2004) A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J 39: 863-876


Gao F, Gao Q, Duan X, Yue G, Yang A, Zhang J (2006) Cloning of an H+-PPase gene from Thellungiella halophila and its heterologousexpression to improve tobacco salt tolerance. J Exp Bot 57: 3259-3270


Gaxiola RA, Li J, Undurraga S, Dang LM, Allen GJ, Alper SL, Fink GR (2001) Drought- and salt-tolerant plants result fromoverexpression of the AVP1 H+-pump. Proc Natl Acad Sci U S A 98: 11444-11449


Goulas E, Schubert M, Kieselbach T, Kleczkowski LA, Gardestrom P, Schroder W, Hurry V (2006) The chloroplast lumen and stromalproteomes of Arabidopsis thaliana show differential sensitivity to short- and long-term exposure to low temperature. Plant J 47: 720-734


Guo HS, Xie Q, Fei JF, Chua NH (2005) MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxinsignals for arabidopsis lateral root development. Plant Cell 17: 1376-1386


Hartmann MA (1998) Plant sterols and the membrane environment. Trends in Plant Science 3: 170-175Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hayashi T (2003) Xyloglucans in the Primary Cell Wall. Annual Review of Plant Biology 40: 139-168Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title


http://www.ncbi.nlm.nih.gov/pubmed?term=Cosgrove DJ %282005%29 Growth of the plant cell wall%2E Nature Reviews Molecular Cell Biology 6%3A 850%2D861&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cosgrove DJ (2005) Growth of the plant cell wall. Nature Reviews Molecular Cell Biology 6: 850-861

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cosgrove&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Growth of the plant cell wall&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Growth of the plant cell wall&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cosgrove&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cutler JM%2C Rains DW%2C Loomis RS %281977%29 The Importance of Cell Size in the Water Relations of Plants%2E Physiologia Plantarum 40%3A 255%2D260&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cutler JM, Rains DW, Loomis RS (1977) The Importance of Cell Size in the Water Relations of Plants. Physiologia Plantarum 40: 255-260

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cutler&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Importance of Cell Size in the Water Relations of Plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Importance of Cell Size in the Water Relations of Plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cutler&as_ylo=1977&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Doherty CJ%2C Van Buskirk HA%2C Myers SJ%2C Thomashow MF %282009%29 Roles for Arabidopsis CAMTA transcription factors in cold%2Dregulated gene expression and freezing tolerance%2E Plant Cell 21%3A 972&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Doherty CJ, Van Buskirk HA, Myers SJ, Thomashow MF (2009) Roles for Arabidopsis CAMTA transcription factors in cold-regulated gene expression and freezing tolerance. Plant Cell 21: 972

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Doherty&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Roles for Arabidopsis CAMTA transcription factors in cold-regulated gene expression and freezing tolerance.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Roles for Arabidopsis CAMTA transcription factors in cold-regulated gene expression and freezing tolerance.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Doherty&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Du JL%2C Zhang SW%2C Huang HW%2C Cai T%2C Li L%2C Chen S%2C He XJ %282015%29 The Splicing Factor PRP31 Is Involved in Transcriptional Gene Silencing and Stress Response in Arabidopsis%2E Mol Plant 8%3A 1053%2D1068&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Du JL, Zhang SW, Huang HW, Cai T, Li L, Chen S, He XJ (2015) The Splicing Factor PRP31 Is Involved in Transcriptional Gene Silencing and Stress Response in Arabidopsis. Mol Plant 8: 1053-1068

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Du&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Splicing Factor PRP31 Is Involved in Transcriptional Gene Silencing and Stress Response in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Splicing Factor PRP31 Is Involved in Transcriptional Gene Silencing and Stress Response in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Du&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Du L%2C Li N%2C Chen L%2C Xu Y%2C Li Y%2C Zhang Y%2C Li C%2C Li Y %282014%29 The ubiquitin receptor DA1 regulates seed and organ size by modulating the stability of the ubiquitin%2Dspecific protease UBP15%2FSOD2 in Arabidopsis%2E Plant Cell 26%3A 665&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Du L, Li N, Chen L, Xu Y, Li Y, Zhang Y, Li C, Li Y (2014) The ubiquitin receptor DA1 regulates seed and organ size by modulating the stability of the ubiquitin-specific protease UBP15/SOD2 in Arabidopsis. Plant Cell 26: 665

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Du&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The ubiquitin receptor DA1 regulates seed and organ size by modulating the stability of the ubiquitin-specific protease UBP15/SOD2 in Arabidopsis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The ubiquitin receptor DA1 regulates seed and organ size by modulating the stability of the ubiquitin-specific protease UBP15/SOD2 in Arabidopsis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Du&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Figueroa P%2C Gusmaroli G%2C Serino G%2C Habashi J%2C Ma L%2C Shen Y%2C Feng S%2C Bostick M%2C Callis J%2C Hellmann H %282005%29 Arabidopsis Has Two Redundant Cullin3 Proteins That Are Essential for Embryo Development and That Interact with RBX1 and BTB Proteins to Form Multisubunit E3 Ubiquitin Ligase Complexes in Vivo%2E Plant Cell 17%3A 1180%2D1195&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Figueroa P, Gusmaroli G, Serino G, Habashi J, Ma L, Shen Y, Feng S, Bostick M, Callis J, Hellmann H (2005) Arabidopsis Has Two Redundant Cullin3 Proteins That Are Essential for Embryo Development and That Interact with RBX1 and BTB Proteins to Form Multisubunit E3 Ubiquitin Ligase Complexes in Vivo. Plant Cell 17: 1180-1195

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Figueroa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis Has Two Redundant Cullin3 Proteins That Are Essential for Embryo Development and That Interact with RBX1 and BTB Proteins to Form Multisubunit E3 Ubiquitin Ligase Complexes in Vivo&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis Has Two Redundant Cullin3 Proteins That Are Essential for Embryo Development and That Interact with RBX1 and BTB Proteins to Form Multisubunit E3 Ubiquitin Ligase Complexes in Vivo&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Figueroa&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fujita M%2C Fujita Y%2C Maruyama K%2C Seki M%2C Hiratsu K%2C Ohme%2DTakagi M%2C Tran LS%2C Yamaguchi%2DShinozaki K%2C Shinozaki K %282004%29 A dehydration%2Dinduced NAC protein%2C RD26%2C is involved in a novel ABA%2Ddependent stress%2Dsignaling pathway%2E Plant J 39%3A 863%2D876&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fujita M, Fujita Y, Maruyama K, Seki M, Hiratsu K, Ohme-Takagi M, Tran LS, Yamaguchi-Shinozaki K, Shinozaki K (2004) A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J 39: 863-876

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujita&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujita&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gao F%2C Gao Q%2C Duan X%2C Yue G%2C Yang A%2C Zhang J %282006%29 Cloning of an H%2B%2DPPase gene from Thellungiella halophila and its heterologous expression to improve tobacco salt tolerance%2E J Exp Bot 57%3A 3259%2D3270&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gao F, Gao Q, Duan X, Yue G, Yang A, Zhang J (2006) Cloning of an H+-PPase gene from Thellungiella halophila and its heterologous expression to improve tobacco salt tolerance. J Exp Bot 57: 3259-3270

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cloning of an H+-PPase gene from Thellungiella halophila and its heterologous expression to improve tobacco salt tolerance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cloning of an H+-PPase gene from Thellungiella halophila and its heterologous expression to improve tobacco salt tolerance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gao&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Gaxiola RA%2C Li J%2C Undurraga S%2C Dang LM%2C Allen GJ%2C Alper SL%2C Fink GR %282001%29 Drought%2D and salt%2Dtolerant plants result from overexpression of the AVP1 H%2B%2Dpump%2E Proc Natl Acad Sci U S A 98%3A 11444%2D11449&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gaxiola RA, Li J, Undurraga S, Dang LM, Allen GJ, Alper SL, Fink GR (2001) Drought- and salt-tolerant plants result from overexpression of the AVP1 H+-pump. Proc Natl Acad Sci U S A 98: 11444-11449

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gaxiola&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Drought- and salt-tolerant plants result from overexpression of the AVP1 H+-pump&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Drought- and salt-tolerant plants result from overexpression of the AVP1 H+-pump&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gaxiola&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Goulas E%2C Schubert M%2C Kieselbach T%2C Kleczkowski LA%2C Gardestrom P%2C Schroder W%2C Hurry V %282006%29 The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show differential sensitivity to short%2D and long%2Dterm exposure to low temperature%2E Plant J 47%3A 720%2D734&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Goulas E, Schubert M, Kieselbach T, Kleczkowski LA, Gardestrom P, Schroder W, Hurry V (2006) The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show differential sensitivity to short- and long-term exposure to low temperature. Plant J 47: 720-734

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Goulas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show differential sensitivity to short- and long-term exposure to low temperature&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show differential sensitivity to short- and long-term exposure to low temperature&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Goulas&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Guo HS%2C Xie Q%2C Fei JF%2C Chua NH %282005%29 MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for arabidopsis lateral root development%2E Plant Cell 17%3A 1376%2D1386&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Guo HS, Xie Q, Fei JF, Chua NH (2005) MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for arabidopsis lateral root development. Plant Cell 17: 1376-1386

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Guo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for arabidopsis lateral root development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for arabidopsis lateral root development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Guo&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hartmann MA %281998%29 Plant sterols and the membrane environment%2E Trends in Plant Science 3%3A 170%2D175&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hartmann MA (1998) Plant sterols and the membrane environment. Trends in Plant Science 3: 170-175

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hartmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant sterols and the membrane environment&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant sterols and the membrane environment&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hartmann&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hayashi T %282003%29 Xyloglucans in the Primary Cell Wall%2E Annual Review of Plant Biology 40%3A 139%2D168&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hayashi T (2003) Xyloglucans in the Primary Cell Wall. Annual Review of Plant Biology 40: 139-168

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hayashi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Xyloglucans in the Primary Cell Wall&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Xyloglucans in the Primary Cell Wall&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hayashi&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1


Hickman R, Hill C, Penfold CA, Breeze E, Bowden L, Moore JD, Zhang P, Jackson A, Cooke E, Bewickecopley F (2013) A localregulatory network around three NAC transcription factors in stress responses and senescence in Arabidopsis leaves. Plant Journalfor Cell & Molecular Biology 75: 26


Horváth BM, Magyar Z, Zhang Y, Hamburger AW, Bakó L, Visser RG, † CWB, † LB (2006) EBP1 regulates organ size through cell growthand proliferation in plants. Embo Journal 25: 4909


Inan G, Zhang Q, Li P, Wang Z, Cao Z, Zhang H, Zhang C, Quist TM, Goodwin SM, Zhu J, Shi H, Damsz B, Charbaji T, Gong Q, Ma S,Fredricksen M, Galbraith DW, Jenks MA, Rhodes D, Hasegawa PM, Bohnert HJ, Joly RJ, Bressan RA, Zhu JK (2004) Salt cress. Ahalophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth anddevelopment of extremophiles. Plant Physiol 135: 1718-1737


Iyer LM, Aravind L (2012) ALOG domains: provenance of plant homeotic and developmental regulators from the DNA-binding domain ofa novel class of DIRS1-type retroposons. Biol Direct 7: 39


Kanai M (2013) The Plastidic DEAD-box RNA Helicase 22, HS3, is Essential for Plastid Functions Both in Seed Development and inSeedling Growth. Plant & Cell Physiology 54: 1431


Kaufmann K, Al E (2010) Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) orhybridization to whole genome arrays (ChIP-CHIP). 5: 457-472


Keegstra K, Albersheim P (1973) The Structure of Plant Cell Walls. III. a Model of the Walls of Suspension-Cultured Sycamore CellsBased on the Interconnections of the Macromolecular Components. Plant Physiology 51: 188-197


Kim HB, Lee H, Oh CJ, Lee HY, Eum HL, Kim HS, Hong YP, Lee Y, Choe S, An CS, Choi SB (2010) Postembryonic seedling lethality inthe sterol-deficient Arabidopsis cyp51A2 mutant is partially mediated by the composite action of ethylene and reactive oxygen species.Plant Physiol 152: 192-205


Kim HB, Schaller H, Goh CH, Mi K, Choe S, An CS, Durst F, Feldmann KA, Feyereisen R (2005) Arabidopsis cyp51 mutant showspostembryonic seedling lethality associated with lack of membrane integrity. Plant Physiology 138: 2033


Kumar T, Uzma, Khan MR, Abbas Z, Ali GM (2014) Genetic improvement of sugarcane for drought and salinity stress tolerance usingArabidopsis vacuolar pyrophosphatase (AVP1) gene. Molecular Biotechnology 56: 199


Kwon Y (2013) A novel Arabidopsis MYB-like transcription factor, MYBH, regulates hypocotyl elongation by enhancing auxinaccumulation. Journal of Experimental Botany 64: 3911-3922


Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the humangenome. Genome Biology 10: R25

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title https://plantphysiol.orgDownloaded on February 25, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Hickman R%2C Hill C%2C Penfold CA%2C Breeze E%2C Bowden L%2C Moore JD%2C Zhang P%2C Jackson A%2C Cooke E%2C Bewickecopley F %282013%29 A local regulatory network around three NAC transcription factors in stress responses and senescence in Arabidopsis leaves%2E Plant Journal for Cell %26 Molecular Biology 75%3A 26&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hickman R, Hill C, Penfold CA, Breeze E, Bowden L, Moore JD, Zhang P, Jackson A, Cooke E, Bewickecopley F (2013) A local regulatory network around three NAC transcription factors in stress responses and senescence in Arabidopsis leaves. Plant Journal for Cell & Molecular Biology 75: 26

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hickman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A local regulatory network around three NAC transcription factors in stress responses and senescence in Arabidopsis leaves.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A local regulatory network around three NAC transcription factors in stress responses and senescence in Arabidopsis leaves.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hickman&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Horváth BM%2C Magyar Z%2C Zhang Y%2C Hamburger AW%2C Bakó L%2C Visser RG%2C �?� CWB%2C �?� LB %282006%29 EBP1 regulates organ size through cell growth and proliferation in plants%2E Embo Journal 25%3A 4909&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Horv�th BM, Magyar Z, Zhang Y, Hamburger AW, Bak� L, Visser RG, ? CWB, ? LB (2006) EBP1 regulates organ size through cell growth and proliferation in plants. Embo Journal 25: 4909

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Horv�?¡th&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=EBP1 regulates organ size through cell growth and proliferation in plants.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=EBP1 regulates organ size through cell growth and proliferation in plants.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Horv�?¡th&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Inan G%2C Zhang Q%2C Li P%2C Wang Z%2C Cao Z%2C Zhang H%2C Zhang C%2C Quist TM%2C Goodwin SM%2C Zhu J%2C Shi H%2C Damsz B%2C Charbaji T%2C Gong Q%2C Ma S%2C Fredricksen M%2C Galbraith DW%2C Jenks MA%2C Rhodes D%2C Hasegawa PM%2C Bohnert HJ%2C Joly RJ%2C Bressan RA%2C Zhu JK %282004%29 Salt cress%2E A halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles%2E Plant Physiol 135%3A 1718%2D1737&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Inan G, Zhang Q, Li P, Wang Z, Cao Z, Zhang H, Zhang C, Quist TM, Goodwin SM, Zhu J, Shi H, Damsz B, Charbaji T, Gong Q, Ma S, Fredricksen M, Galbraith DW, Jenks MA, Rhodes D, Hasegawa PM, Bohnert HJ, Joly RJ, Bressan RA, Zhu JK (2004) Salt cress. A halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol 135: 1718-1737

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Inan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Salt cress&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Salt cress&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Inan&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Iyer LM%2C Aravind L %282012%29 ALOG domains%3A provenance of plant homeotic and developmental regulators from the DNA%2Dbinding domain of a novel class of DIRS1%2Dtype retroposons%2E Biol Direct 7%3A 39&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Iyer LM, Aravind L (2012) ALOG domains: provenance of plant homeotic and developmental regulators from the DNA-binding domain of a novel class of DIRS1-type retroposons. Biol Direct 7: 39

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Iyer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ALOG domains: provenance of plant homeotic and developmental regulators from the DNA-binding domain of a novel class of DIRS1-type retroposons.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ALOG domains: provenance of plant homeotic and developmental regulators from the DNA-binding domain of a novel class of DIRS1-type retroposons.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Iyer&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kanai M %282013%29 The Plastidic DEAD%2Dbox RNA Helicase 22%2C HS3%2C is Essential for Plastid Functions Both in Seed Development and in Seedling Growth%2E Plant %26 Cell Physiology 54%3A 1431&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kanai M (2013) The Plastidic DEAD-box RNA Helicase 22, HS3, is Essential for Plastid Functions Both in Seed Development and in Seedling Growth. Plant & Cell Physiology 54: 1431

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kanai&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Plastidic DEAD-box RNA Helicase 22, HS3, is Essential for Plastid Functions Both in Seed Development and in Seedling Growth.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Plastidic DEAD-box RNA Helicase 22, HS3, is Essential for Plastid Functions Both in Seed Development and in Seedling Growth.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kanai&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kaufmann K%2C Al E %282010%29 Chromatin immunoprecipitation %28ChIP%29 of plant transcription factors followed by sequencing %28ChIP%2DSEQ%29 or hybridization to whole genome arrays %28ChIP%2DCHIP%29%2E 5%3A 457%2D472&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kaufmann K, Al E (2010) Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP). 5: 457-472

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kaufmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP)&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Chromatin immunoprecipitation (ChIP) of plant transcription factors followed by sequencing (ChIP-SEQ) or hybridization to whole genome arrays (ChIP-CHIP)&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kaufmann&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Keegstra K%2C Albersheim P %281973%29 The Structure of Plant Cell Walls%2E III%2E a Model of the Walls of Suspension%2DCultured Sycamore Cells Based on the Interconnections of the Macromolecular Components%2E Plant Physiology 51%3A 188%2D197&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Keegstra K, Albersheim P (1973) The Structure of Plant Cell Walls. III. a Model of the Walls of Suspension-Cultured Sycamore Cells Based on the Interconnections of the Macromolecular Components. Plant Physiology 51: 188-197

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Keegstra&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Structure of Plant Cell Walls&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Structure of Plant Cell Walls&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Keegstra&as_ylo=1973&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim HB%2C Lee H%2C Oh CJ%2C Lee HY%2C Eum HL%2C Kim HS%2C Hong YP%2C Lee Y%2C Choe S%2C An CS%2C Choi SB %282010%29 Postembryonic seedling lethality in the sterol%2Ddeficient Arabidopsis cyp51A2 mutant is partially mediated by the composite action of ethylene and reactive oxygen species%2E Plant Physiol 152%3A 192%2D205&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim HB, Lee H, Oh CJ, Lee HY, Eum HL, Kim HS, Hong YP, Lee Y, Choe S, An CS, Choi SB (2010) Postembryonic seedling lethality in the sterol-deficient Arabidopsis cyp51A2 mutant is partially mediated by the composite action of ethylene and reactive oxygen species. Plant Physiol 152: 192-205

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Postembryonic seedling lethality in the sterol-deficient Arabidopsis cyp51A2 mutant is partially mediated by the composite action of ethylene and reactive oxygen species&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Postembryonic seedling lethality in the sterol-deficient Arabidopsis cyp51A2 mutant is partially mediated by the composite action of ethylene and reactive oxygen species&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim HB%2C Schaller H%2C Goh CH%2C Mi K%2C Choe S%2C An CS%2C Durst F%2C Feldmann KA%2C Feyereisen R %282005%29 Arabidopsis cyp51 mutant shows postembryonic seedling lethality associated with lack of membrane integrity%2E Plant Physiology 138%3A 2033&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim HB, Schaller H, Goh CH, Mi K, Choe S, An CS, Durst F, Feldmann KA, Feyereisen R (2005) Arabidopsis cyp51 mutant shows postembryonic seedling lethality associated with lack of membrane integrity. Plant Physiology 138: 2033

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis cyp51 mutant shows postembryonic seedling lethality associated with lack of membrane integrity.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis cyp51 mutant shows postembryonic seedling lethality associated with lack of membrane integrity.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kumar T%2C Uzma%2C Khan MR%2C Abbas Z%2C Ali GM %282014%29 Genetic improvement of sugarcane for drought and salinity stress tolerance using Arabidopsis vacuolar pyrophosphatase %28AVP1%29 gene%2E Molecular Biotechnology 56%3A 199&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kumar T, Uzma, Khan MR, Abbas Z, Ali GM (2014) Genetic improvement of sugarcane for drought and salinity stress tolerance using Arabidopsis vacuolar pyrophosphatase (AVP1) gene. Molecular Biotechnology 56: 199

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kumar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic improvement of sugarcane for drought and salinity stress tolerance using Arabidopsis vacuolar pyrophosphatase (AVP1) gene.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic improvement of sugarcane for drought and salinity stress tolerance using Arabidopsis vacuolar pyrophosphatase (AVP1) gene.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kumar&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kwon Y %282013%29 A novel Arabidopsis MYB%2Dlike transcription factor%2C MYBH%2C regulates hypocotyl elongation by enhancing auxin accumulation%2E Journal of Experimental Botany 64%3A 3911%2D3922&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kwon Y (2013) A novel Arabidopsis MYB-like transcription factor, MYBH, regulates hypocotyl elongation by enhancing auxin accumulation. Journal of Experimental Botany 64: 3911-3922

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kwon&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A novel Arabidopsis MYB-like transcription factor, MYBH, regulates hypocotyl elongation by enhancing auxin accumulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A novel Arabidopsis MYB-like transcription factor, MYBH, regulates hypocotyl elongation by enhancing auxin accumulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kwon&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Langmead B%2C Trapnell C%2C Pop M%2C Salzberg SL %282009%29 Ultrafast and memory%2Defficient alignment of short DNA sequences to the human genome%2E Genome Biology 10%3A R25&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10: R25

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Langmead&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Langmead&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1


Lee S, Lee HJ, Huh SU, Paek KH, Ha JH, Park CM (2014) The Arabidopsis NAC transcription factor NTL4 participates in a positivefeedback loop that induces programmed cell death under heat stress conditions. Plant Sci 227: 76-83


Li B, Wei A, Song C, Li N, Zhang J (2008) Heterologous expression of the TsVP gene improves the drought resistance of maize. PlantBiotechnol J 6: 146-159


Li J, Gaxiola R (2005) Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development. Science 310: 121-125Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Li J, Yang H, Peer WA, Richter G, Blakeslee J, Bandyopadhyay A, Titapiwantakun B, Undurraga S, Khodakovskaya M, Richards EL,Krizek B, Murphy AS, Gilroy S, Gaxiola R (2005) Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development. Science310: 121-125


Liu G, Li X, Jin S, Liu X, Zhu L, Nie Y, Zhang X (2014) Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance byenhancing root development and reducing transpiration rate in transgenic cotton. PLoS One 9: e86895


Lu M, Ying S, Zhang DF, Shi YS, Song YC, Wang TY, Li Y (2012) A maize stress-responsive NAC transcription factor, ZmSNAC1, confersenhanced tolerance to dehydration in transgenic Arabidopsis. Plant Cell Rep 31: 1701-1711


Lv SL, Lian LJ, Tao PL, Li ZX, Zhang KW, Zhang JR (2009) Overexpression of Thellungiella halophila H(+)-PPase (TsVP) in cottonenhances drought stress resistance of plants. Planta 229: 899-910


Moeder W, Pozo OD, Navarre DA, Martin GB, Klessig DF (2007) Aconitase plays a role in regulating resistance to oxidative stress andcell death in Arabidopsis and Nicotiana benthamiana. Plant Molecular Biology 63: 273-287


Morel P, Tréhin C, Breuil-Broyer S, Negrutiu I (2009) Altering FVE/MSI4 results in a substantial increase of biomass in Arabidopsis —the functional analysis of an ontogenesis accelerator. Molecular Breeding 23: 239-257


O'Brien M, Chantha SC, Rahier A, Matton DP (2005) Lipid signaling in plants. Cloning and expression analysis of the obtusifoliol14alpha-demethylase from Solanum chacoense Bitt., a pollination- and fertilization-induced gene with both obtusifoliol and lanosteroldemethylase activity. Plant Physiology 139: 734


Ooka H, Satoh K, Doi K, Nagata T, Otomo Y, Murakami K, Matsubara K, Osato N, Kawai J, Carninci P, Hayashizaki Y, Suzuki K, KojimaK, Takahara Y, Yamamoto K, Kikuchi S (2003) Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana.DNA Res 10: 239-247


Park YB, Cosgrove DJ (2015) Xyloglucan and its interactions with other components of the growing cell wall. Plant & Cell Physiology56: 180


Petricka JJ, Winter CM, Benfey PN (2012) Control of Arabidopsis Root Development. Annual Review of Plant Biology 63: 563https://plantphysiol.orgDownloaded on February 25, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee S%2C Lee HJ%2C Huh SU%2C Paek KH%2C Ha JH%2C Park CM %282014%29 The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions%2E Plant Sci 227%3A 76%2D83&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee S, Lee HJ, Huh SU, Paek KH, Ha JH, Park CM (2014) The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions. Plant Sci 227: 76-83

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis NAC transcription factor NTL4 participates in a positive feedback loop that induces programmed cell death under heat stress conditions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li B%2C Wei A%2C Song C%2C Li N%2C Zhang J %282008%29 Heterologous expression of the TsVP gene improves the drought resistance of maize%2E Plant Biotechnol J 6%3A 146%2D159&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li B, Wei A, Song C, Li N, Zhang J (2008) Heterologous expression of the TsVP gene improves the drought resistance of maize. Plant Biotechnol J 6: 146-159

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Heterologous expression of the TsVP gene improves the drought resistance of maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Heterologous expression of the TsVP gene improves the drought resistance of maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li J%2C Gaxiola R %282005%29 Arabidopsis H%2B%2DPPase AVP1 regulates auxin%2Dmediated organ development%2E Science 310%3A 121%2D125&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li J, Gaxiola R (2005) Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development. Science 310: 121-125


http://scholar.google.com/scholar?as_q=Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li J%2C Yang H%2C Peer WA%2C Richter G%2C Blakeslee J%2C Bandyopadhyay A%2C Titapiwantakun B%2C Undurraga S%2C Khodakovskaya M%2C Richards EL%2C Krizek B%2C Murphy AS%2C Gilroy S%2C Gaxiola R %282005%29 Arabidopsis H%2B%2DPPase AVP1 regulates auxin%2Dmediated organ development%2E Science 310%3A 121%2D125&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li J, Yang H, Peer WA, Richter G, Blakeslee J, Bandyopadhyay A, Titapiwantakun B, Undurraga S, Khodakovskaya M, Richards EL, Krizek B, Murphy AS, Gilroy S, Gaxiola R (2005) Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development. Science 310: 121-125


http://scholar.google.com/scholar?as_q=Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu G%2C Li X%2C Jin S%2C Liu X%2C Zhu L%2C Nie Y%2C Zhang X %282014%29 Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance by enhancing root development and reducing transpiration rate in transgenic cotton%2E PLoS One 9%3A e86895&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Liu G, Li X, Jin S, Liu X, Zhu L, Nie Y, Zhang X (2014) Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance by enhancing root development and reducing transpiration rate in transgenic cotton. PLoS One 9: e86895

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance by enhancing root development and reducing transpiration rate in transgenic cotton.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of rice NAC gene SNAC1 improves drought and salt tolerance by enhancing root development and reducing transpiration rate in transgenic cotton.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lu M%2C Ying S%2C Zhang DF%2C Shi YS%2C Song YC%2C Wang TY%2C Li Y %282012%29 A maize stress%2Dresponsive NAC transcription factor%2C ZmSNAC1%2C confers enhanced tolerance to dehydration in transgenic Arabidopsis%2E Plant Cell Rep 31%3A 1701%2D1711&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lu M, Ying S, Zhang DF, Shi YS, Song YC, Wang TY, Li Y (2012) A maize stress-responsive NAC transcription factor, ZmSNAC1, confers enhanced tolerance to dehydration in transgenic Arabidopsis. Plant Cell Rep 31: 1701-1711

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lu&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lu&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lv SL%2C Lian LJ%2C Tao PL%2C Li ZX%2C Zhang KW%2C Zhang JR %282009%29 Overexpression of Thellungiella halophila H%28%2B%29%2DPPase %28TsVP%29 in cotton enhances drought stress resistance of plants%2E Planta 229%3A 899%2D910&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lv SL, Lian LJ, Tao PL, Li ZX, Zhang KW, Zhang JR (2009) Overexpression of Thellungiella halophila H(+)-PPase (TsVP) in cotton enhances drought stress resistance of plants. Planta 229: 899-910

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lv&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of Thellungiella halophila H(+)-PPase (TsVP) in cotton enhances drought stress resistance of plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of Thellungiella halophila H(+)-PPase (TsVP) in cotton enhances drought stress resistance of plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lv&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Moeder W%2C Pozo OD%2C Navarre DA%2C Martin GB%2C Klessig DF %282007%29 Aconitase plays a role in regulating resistance to oxidative stress and cell death in Arabidopsis and Nicotiana benthamiana%2E Plant Molecular Biology 63%3A 273%2D287&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Moeder W, Pozo OD, Navarre DA, Martin GB, Klessig DF (2007) Aconitase plays a role in regulating resistance to oxidative stress and cell death in Arabidopsis and Nicotiana benthamiana. Plant Molecular Biology 63: 273-287

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Moeder&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Aconitase plays a role in regulating resistance to oxidative stress and cell death in Arabidopsis and Nicotiana benthamiana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Aconitase plays a role in regulating resistance to oxidative stress and cell death in Arabidopsis and Nicotiana benthamiana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Moeder&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Morel P%2C Tréhin C%2C Breuil%2DBroyer S%2C Negrutiu I %282009%29 Altering FVE%2FMSI4 results in a substantial increase of biomass in Arabidopsis �??the functional analysis of an ontogenesis accelerator%2E Molecular Breeding 23%3A 239%2D257&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Morel P, Tr�hin C, Breuil-Broyer S, Negrutiu I (2009) Altering FVE/MSI4 results in a substantial increase of biomass in Arabidopsis ?the functional analysis of an ontogenesis accelerator. Molecular Breeding 23: 239-257

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Morel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Altering FVE/MSI4 results in a substantial increase of biomass in Arabidopsis â�?�?the functional analysis of an ontogenesis accelerator&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Altering FVE/MSI4 results in a substantial increase of biomass in Arabidopsis â�?�?the functional analysis of an ontogenesis accelerator&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Morel&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=O%27Brien M%2C Chantha SC%2C Rahier A%2C Matton DP %282005%29 Lipid signaling in plants%2E Cloning and expression analysis of the obtusifoliol 14alpha%2Ddemethylase from Solanum chacoense Bitt%2E%2C a pollination%2D and fertilization%2Dinduced gene with both obtusifoliol and lanosterol demethylase activity%2E Plant Physiology 139%3A 734&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=O'Brien M, Chantha SC, Rahier A, Matton DP (2005) Lipid signaling in plants. Cloning and expression analysis of the obtusifoliol 14alpha-demethylase from Solanum chacoense Bitt., a pollination- and fertilization-induced gene with both obtusifoliol and lanosterol demethylase activity. Plant Physiology 139: 734

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=O'Brien&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Lipid signaling in plants.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Lipid signaling in plants.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=O'Brien&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ooka H%2C Satoh K%2C Doi K%2C Nagata T%2C Otomo Y%2C Murakami K%2C Matsubara K%2C Osato N%2C Kawai J%2C Carninci P%2C Hayashizaki Y%2C Suzuki K%2C Kojima K%2C Takahara Y%2C Yamamoto K%2C Kikuchi S %282003%29 Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana%2E DNA Res 10%3A 239%2D247&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ooka H, Satoh K, Doi K, Nagata T, Otomo Y, Murakami K, Matsubara K, Osato N, Kawai J, Carninci P, Hayashizaki Y, Suzuki K, Kojima K, Takahara Y, Yamamoto K, Kikuchi S (2003) Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res 10: 239-247

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ooka&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ooka&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Park YB%2C Cosgrove DJ %282015%29 Xyloglucan and its interactions with other components of the growing cell wall%2E Plant %26 Cell Physiology 56%3A 180&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park YB, Cosgrove DJ (2015) Xyloglucan and its interactions with other components of the growing cell wall. Plant & Cell Physiology 56: 180

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Xyloglucan and its interactions with other components of the growing cell wall.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Xyloglucan and its interactions with other components of the growing cell wall.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1



Rasheed S, Bashir K, Matsui A, Tanaka M, Seki M (2016) Transcriptomic Analysis of Soil-Grown Arabidopsis thaliana Roots and Shootsin Response to a Drought Stress. Frontiers in Plant Science 7: 180


Riechmann JL, Heard J, Martin G, Reuber L, Jiang C, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, Creelman R, Pilgrim M,Broun P, Zhang JZ, Ghandehari D, Sherman BK, Yu G (2000) Arabidopsis transcription factors: genome-wide comparative analysisamong eukaryotes. Science 290: 2105-2110


Schilling RK, Petra M, Yuri S, Bettina B, Mark T, Roy SJ, Plett DC (2014) Expression of the Arabidopsis vacuolar H?-pyrophosphatasegene (AVP1) improves the shoot biomass of transgenic barley and increases grain yield in a saline field. Plant Biotechnology Journal12: 378–386


Schmid M, Davison TS, Henz SR, Pape UJ, Demar M, Vingron M, Scholkopf B, Weigel D, Lohmann JU (2005) A gene expression map ofArabidopsis thaliana development. Nat Genet 37: 501-506


Schopfer P (2006) Biomechanics of plant growth. American Journal of Botany 93: 1415Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Shin D, Koo YD, Lee J, Lee HJ, Baek D, Lee S, Cheon CI, Kwak SS, Lee SY, Yun DJ (2004) Athb-12, a homeobox-leucine zipper domainprotein from Arabidopsis thaliana, increases salt tolerance in yeast by regulating sodium exclusion. Biochemical & BiophysicalResearch Communications 323: 534-540


Shindo C, Lister C, Crevillen P, Nordborg M, Dean C (2006) Variation in the epigenetic silencing of FLC contributes to natural variationin Arabidopsis vernalization response. Genes & Development 20: 3079-3083


Shiriga K, Sharma R, Kumar K, Yadav SK, Hossain F, Thirunavukkarasu N (2014) Genome-wide identification and expression pattern ofdrought-responsive members of the NAC family in maize. Meta Gene 2: 407-417


Silva P, Gerós H (2009) Regulation by salt of vacuolar H(+)-ATPase and H(+)-pyrophosphatase activities and Na(+)/H(+) exchange.Plant Signal Behav 4: 718-726


Son O, Hur YS, Kim YK, Lee HJ, Kim S, Kim MR, Nam KH, Lee MS, Kim BY, Park J (2010) ATHB12, an ABA-Inducible Homeodomain-Leucine Zipper (HD-Zip) Protein of Arabidopsis, Negatively Regulates the Growth of the Inflorescence Stem by Decreasing theExpression of a Gibberellin 20-Oxidase Gene. Plant & Cell Physiology 51: 1537-1547


Sun Q, Gao F, Zhao L, Li K, Zhang J (2010) Identification of a new 130 bp cis-acting element in the TsVP1 promoter involved in the saltstress response from Thellungiella halophila. BMC Plant Biol 10: 90


Takeda S, Hanano K, Kariya A, Shimizu S, Zhao L, Matsui M, Tasaka M, Aida M (2011) CUP-SHAPED COTYLEDON1 transcription factoractivates the expression of LSH4 and LSH3, two members of the ALOG gene family, in shoot organ boundary cells. Plant J 66: 1066-


http://www.ncbi.nlm.nih.gov/pubmed?term=Petricka JJ%2C Winter CM%2C Benfey PN %282012%29 Control of Arabidopsis Root Development%2E Annual Review of Plant Biology 63%3A 563&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Petricka JJ, Winter CM, Benfey PN (2012) Control of Arabidopsis Root Development. Annual Review of Plant Biology 63: 563

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Petricka&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Control of Arabidopsis Root Development.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Control of Arabidopsis Root Development.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Petricka&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Rasheed S%2C Bashir K%2C Matsui A%2C Tanaka M%2C Seki M %282016%29 Transcriptomic Analysis of Soil%2DGrown Arabidopsis thaliana Roots and Shoots in Response to a Drought Stress%2E Frontiers in Plant Science 7%3A 180&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rasheed S, Bashir K, Matsui A, Tanaka M, Seki M (2016) Transcriptomic Analysis of Soil-Grown Arabidopsis thaliana Roots and Shoots in Response to a Drought Stress. Frontiers in Plant Science 7: 180

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rasheed&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptomic Analysis of Soil-Grown Arabidopsis thaliana Roots and Shoots in Response to a Drought Stress.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptomic Analysis of Soil-Grown Arabidopsis thaliana Roots and Shoots in Response to a Drought Stress.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rasheed&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Riechmann JL%2C Heard J%2C Martin G%2C Reuber L%2C Jiang C%2C Keddie J%2C Adam L%2C Pineda O%2C Ratcliffe OJ%2C Samaha RR%2C Creelman R%2C Pilgrim M%2C Broun P%2C Zhang JZ%2C Ghandehari D%2C Sherman BK%2C Yu G %282000%29 Arabidopsis transcription factors%3A genome%2Dwide comparative analysis among eukaryotes%2E Science 290%3A 2105%2D2110&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Riechmann JL, Heard J, Martin G, Reuber L, Jiang C, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, Creelman R, Pilgrim M, Broun P, Zhang JZ, Ghandehari D, Sherman BK, Yu G (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290: 2105-2110

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Riechmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Riechmann&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schilling RK%2C Petra M%2C Yuri S%2C Bettina B%2C Mark T%2C Roy SJ%2C Plett DC %282014%29 Expression of the Arabidopsis vacuolar H%3F%2Dpyrophosphatase gene %28AVP1%29 improves the shoot biomass of transgenic barley and increases grain yield in a saline field%2E Plant Biotechnology Journal 12%3A 378�??386&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schilling RK, Petra M, Yuri S, Bettina B, Mark T, Roy SJ, Plett DC (2014) Expression of the Arabidopsis vacuolar H?-pyrophosphatase gene (AVP1) improves the shoot biomass of transgenic barley and increases grain yield in a saline field. Plant Biotechnology Journal 12: 378?386

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schilling&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Expression of the Arabidopsis vacuolar H?-pyrophosphatase gene (AVP1) improves the shoot biomass of transgenic barley and increases grain yield in a saline field.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Expression of the Arabidopsis vacuolar H?-pyrophosphatase gene (AVP1) improves the shoot biomass of transgenic barley and increases grain yield in a saline field.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schilling&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schmid M%2C Davison TS%2C Henz SR%2C Pape UJ%2C Demar M%2C Vingron M%2C Scholkopf B%2C Weigel D%2C Lohmann JU %282005%29 A gene expression map of Arabidopsis thaliana development%2E Nat Genet 37%3A 501%2D506&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schmid M, Davison TS, Henz SR, Pape UJ, Demar M, Vingron M, Scholkopf B, Weigel D, Lohmann JU (2005) A gene expression map of Arabidopsis thaliana development. Nat Genet 37: 501-506

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schmid&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A gene expression map of Arabidopsis thaliana development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A gene expression map of Arabidopsis thaliana development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schmid&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schopfer P %282006%29 Biomechanics of plant growth%2E American Journal of Botany 93%3A 1415&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schopfer P (2006) Biomechanics of plant growth. American Journal of Botany 93: 1415

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schopfer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Biomechanics of plant growth.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Biomechanics of plant growth.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schopfer&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shin D%2C Koo YD%2C Lee J%2C Lee HJ%2C Baek D%2C Lee S%2C Cheon CI%2C Kwak SS%2C Lee SY%2C Yun DJ %282004%29 Athb%2D12%2C a homeobox%2Dleucine zipper domain protein from Arabidopsis thaliana%2C increases salt tolerance in yeast by regulating sodium exclusion%2E Biochemical %26 Biophysical Research Communications 323%3A 534%2D540&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shin D, Koo YD, Lee J, Lee HJ, Baek D, Lee S, Cheon CI, Kwak SS, Lee SY, Yun DJ (2004) Athb-12, a homeobox-leucine zipper domain protein from Arabidopsis thaliana, increases salt tolerance in yeast by regulating sodium exclusion. Biochemical & Biophysical Research Communications 323: 534-540

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shin&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shin&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shindo C%2C Lister C%2C Crevillen P%2C Nordborg M%2C Dean C %282006%29 Variation in the epigenetic silencing of FLC contributes to natural variation in Arabidopsis vernalization response%2E Genes %26 Development 20%3A 3079%2D3083&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shindo C, Lister C, Crevillen P, Nordborg M, Dean C (2006) Variation in the epigenetic silencing of FLC contributes to natural variation in Arabidopsis vernalization response. Genes & Development 20: 3079-3083

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shindo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Variation in the epigenetic silencing of FLC contributes to natural variation in Arabidopsis vernalization response&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Variation in the epigenetic silencing of FLC contributes to natural variation in Arabidopsis vernalization response&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shindo&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shiriga K%2C Sharma R%2C Kumar K%2C Yadav SK%2C Hossain F%2C Thirunavukkarasu N %282014%29 Genome%2Dwide identification and expression pattern of drought%2Dresponsive members of the NAC family in maize%2E Meta Gene 2%3A 407%2D417&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shiriga K, Sharma R, Kumar K, Yadav SK, Hossain F, Thirunavukkarasu N (2014) Genome-wide identification and expression pattern of drought-responsive members of the NAC family in maize. Meta Gene 2: 407-417

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shiriga&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide identification and expression pattern of drought-responsive members of the NAC family in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide identification and expression pattern of drought-responsive members of the NAC family in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shiriga&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Silva P%2C Ger�s H %282009%29 Regulation by salt of vacuolar H%28%2B%29%2DATPase and H%28%2B%29%2Dpyrophosphatase activities and Na%28%2B%29%2FH%28%2B%29 exchange%2E Plant Signal Behav 4%3A 718%2D726&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Silva P, Ger�s H (2009) Regulation by salt of vacuolar H(+)-ATPase and H(+)-pyrophosphatase activities and Na(+)/H(+) exchange. Plant Signal Behav 4: 718-726

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Silva&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation by salt of vacuolar H(+)-ATPase and H(+)-pyrophosphatase activities and Na(+)/H(+) exchange&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation by salt of vacuolar H(+)-ATPase and H(+)-pyrophosphatase activities and Na(+)/H(+) exchange&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Silva&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Son O%2C Hur YS%2C Kim YK%2C Lee HJ%2C Kim S%2C Kim MR%2C Nam KH%2C Lee MS%2C Kim BY%2C Park J %282010%29 ATHB12%2C an ABA%2DInducible Homeodomain%2DLeucine Zipper %28HD%2DZip%29 Protein of Arabidopsis%2C Negatively Regulates the Growth of the Inflorescence Stem by Decreasing the Expression of a Gibberellin 20%2DOxidase Gene%2E Plant %26 Cell Physiology 51%3A 1537%2D1547&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Son O, Hur YS, Kim YK, Lee HJ, Kim S, Kim MR, Nam KH, Lee MS, Kim BY, Park J (2010) ATHB12, an ABA-Inducible Homeodomain-Leucine Zipper (HD-Zip) Protein of Arabidopsis, Negatively Regulates the Growth of the Inflorescence Stem by Decreasing the Expression of a Gibberellin 20-Oxidase Gene. Plant & Cell Physiology 51: 1537-1547

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Son&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Son&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sun Q%2C Gao F%2C Zhao L%2C Li K%2C Zhang J %282010%29 Identification of a new 130 bp cis%2Dacting element in the TsVP1 promoter involved in the salt stress response from Thellungiella halophila%2E BMC Plant Biol 10%3A 90&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sun Q, Gao F, Zhao L, Li K, Zhang J (2010) Identification of a new 130 bp cis-acting element in the TsVP1 promoter involved in the salt stress response from Thellungiella halophila. BMC Plant Biol 10: 90

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sun&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of a new 130 bp cis-acting element in the TsVP1 promoter involved in the salt stress response from Thellungiella halophila.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of a new 130 bp cis-acting element in the TsVP1 promoter involved in the salt stress response from Thellungiella halophila.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sun&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


1077Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Thomann A, Brukhin V, Dieterle M, Gheyeselinck J, Vantard M, Grossniklaus U, Genschik P (2005) Arabidopsis CUL3A and CUL3Bgenes are essential for normal embryogenesis. Plant J 43: 437-448


Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2004)Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16: 2481-2498


Tran LS, Nishiyama R, Yamaguchi-Shinozaki K, Shinozaki K (2010) Potential utilization of NAC transcription factors to enhance abioticstress tolerance in plants by biotechnological approach. GM Crops 1: 32-39


Valdés AE, Övernäs E, Johansson H, Rada-Iglesias A, Engström P (2012) The homeodomain-leucine zipper (HD-Zip) class Itranscription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acidreceptor gene activities. Plant Molecular Biology 80: 405-418


Vuttipongchaikij S, Brocklehurst D, C S-K, Ashford DA, Gomez LD, SJ M-M (2012) Arabidopsis GT34 family contains five xyloglucan α-1,6-xylosyltransferases. New Phytologist 195: 585–595


Wang C, Li S, Ng S, Zhang B, Zhou Y, Whelan J, Wu P, Shou H (2014) Mutation in xyloglucan 6-xylosytransferase results in abnormalroot hair development in Oryza sativa. J Exp Bot 65: 4149-4157


Wang R, Jing W, Xiao L, Jin Y, Shen L, Zhang W (2015) The Rice High-Affinity Potassium Transporter1;1 Is Involved in Salt Toleranceand Regulated by an MYB-Type Transcription Factor. Plant Physiol 168: 1076-1090


Wu FH, Shen SC, Lee LY, Lee SH, Chan MT, Lin CS (2009) Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolationmethod. Plant Methods 5: 16


Xu C, Fan J, Froehlich JE, Awai K, Benning C (2005) Mutation of the TGD1 chloroplast envelope protein affects phosphatidatemetabolism in Arabidopsis. Plant Cell 17: 3094-3110


Yamaguchi M, Demura T (2010) Transcriptional regulation of secondary wall formation controlled by NAC domain proteins. PlantBiotechnology 27: 237-242


Yang A, Dai X, Zhang WH (2012) A R2R3-type MYB gene, OsMYB2, is involved in salt, cold, and dehydration tolerance in rice. J Exp Bot63: 2541-2556


Yang H, Zhang X, Gaxiola RA, Xu G, Peer WA, Murphy AS (2014) Over-expression of the Arabidopsis proton-pyrophosphatase AVP1enhances transplant survival, root mass, and fruit development under limiting phosphorus conditions. J Exp Bot 65: 3045-3053https://plantphysiol.orgDownloaded on February 25, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Takeda S%2C Hanano K%2C Kariya A%2C Shimizu S%2C Zhao L%2C Matsui M%2C Tasaka M%2C Aida M %282011%29 CUP%2DSHAPED COTYLEDON1 transcription factor activates the expression of LSH4 and LSH3%2C two members of the ALOG gene family%2C in shoot organ boundary cells%2E Plant J 66%3A 1066%2D1077&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Takeda S, Hanano K, Kariya A, Shimizu S, Zhao L, Matsui M, Tasaka M, Aida M (2011) CUP-SHAPED COTYLEDON1 transcription factor activates the expression of LSH4 and LSH3, two members of the ALOG gene family, in shoot organ boundary cells. Plant J 66: 1066-1077

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Takeda&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Takeda&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Thomann A%2C Brukhin V%2C Dieterle M%2C Gheyeselinck J%2C Vantard M%2C Grossniklaus U%2C Genschik P %282005%29 Arabidopsis CUL3A and CUL3B genes are essential for normal embryogenesis%2E Plant J 43%3A 437%2D448&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Thomann A, Brukhin V, Dieterle M, Gheyeselinck J, Vantard M, Grossniklaus U, Genschik P (2005) Arabidopsis CUL3A and CUL3B genes are essential for normal embryogenesis. Plant J 43: 437-448

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Thomann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis CUL3A and CUL3B genes are essential for normal embryogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis CUL3A and CUL3B genes are essential for normal embryogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Thomann&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tran LS%2C Nakashima K%2C Sakuma Y%2C Simpson SD%2C Fujita Y%2C Maruyama K%2C Fujita M%2C Seki M%2C Shinozaki K%2C Yamaguchi%2DShinozaki K %282004%29 Isolation and functional analysis of Arabidopsis stress%2Dinducible NAC transcription factors that bind to a drought%2Dresponsive cis%2Delement in the early responsive to dehydration stress 1 promoter%2E Plant Cell 16%3A 2481%2D2498&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2004) Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 16: 2481-2498

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tran&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tran&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tran LS%2C Nishiyama R%2C Yamaguchi%2DShinozaki K%2C Shinozaki K %282010%29 Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach%2E GM Crops 1%3A 32%2D39&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tran LS, Nishiyama R, Yamaguchi-Shinozaki K, Shinozaki K (2010) Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach. GM Crops 1: 32-39

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tran&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tran&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Vald�s AE%2C �vern�s E%2C Johansson H%2C Rada%2DIglesias A%2C Engstr�m P %282012%29 The homeodomain%2Dleucine zipper %28HD%2DZip%29 class I transcription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acid receptor gene activities%2E Plant Molecular Biology 80%3A 405%2D418&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Vald�s AE, �vern�s E, Johansson H, Rada-Iglesias A, Engstr�m P (2012) The homeodomain-leucine zipper (HD-Zip) class I transcription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acid receptor gene activities. Plant Molecular Biology 80: 405-418

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Valdés&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The homeodomain-leucine zipper (HD-Zip) class I transcription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acid receptor gene activities&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The homeodomain-leucine zipper (HD-Zip) class I transcription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acid receptor gene activities&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Valdés&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Vuttipongchaikij S%2C Brocklehurst D%2C C S%2DK%2C Ashford DA%2C Gomez LD%2C SJ M%2DM %282012%29 Arabidopsis GT34 family contains five xyloglucan α%2D1%2C6%2Dxylosyltransferases%2E New Phytologist 195%3A 585�??595&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Vuttipongchaikij S, Brocklehurst D, C S-K, Ashford DA, Gomez LD, SJ M-M (2012) Arabidopsis GT34 family contains five xyloglucan ?-1,6-xylosyltransferases. New Phytologist 195: 585?595

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vuttipongchaikij&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vuttipongchaikij&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang C%2C Li S%2C Ng S%2C Zhang B%2C Zhou Y%2C Whelan J%2C Wu P%2C Shou H %282014%29 Mutation in xyloglucan 6%2Dxylosytransferase results in abnormal root hair development in Oryza sativa%2E J Exp Bot 65%3A 4149%2D4157&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang C, Li S, Ng S, Zhang B, Zhou Y, Whelan J, Wu P, Shou H (2014) Mutation in xyloglucan 6-xylosytransferase results in abnormal root hair development in Oryza sativa. J Exp Bot 65: 4149-4157

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mutation in xyloglucan 6-xylosytransferase results in abnormal root hair development in Oryza sativa&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mutation in xyloglucan 6-xylosytransferase results in abnormal root hair development in Oryza sativa&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang R%2C Jing W%2C Xiao L%2C Jin Y%2C Shen L%2C Zhang W %282015%29 The Rice High%2DAffinity Potassium Transporter1%3B1 Is Involved in Salt Tolerance and Regulated by an MYB%2DType Transcription Factor%2E Plant Physiol 168%3A 1076%2D1090&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang R, Jing W, Xiao L, Jin Y, Shen L, Zhang W (2015) The Rice High-Affinity Potassium Transporter1;1 Is Involved in Salt Tolerance and Regulated by an MYB-Type Transcription Factor. Plant Physiol 168: 1076-1090

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Rice High-Affinity Potassium Transporter1;1 Is Involved in Salt Tolerance and Regulated by an MYB-Type Transcription Factor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Rice High-Affinity Potassium Transporter1;1 Is Involved in Salt Tolerance and Regulated by an MYB-Type Transcription Factor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wu FH%2C Shen SC%2C Lee LY%2C Lee SH%2C Chan MT%2C Lin CS %282009%29 Tape%2DArabidopsis Sandwich %2D a simpler Arabidopsis protoplast isolation method%2E Plant Methods 5%3A 16&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wu FH, Shen SC, Lee LY, Lee SH, Chan MT, Lin CS (2009) Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method. Plant Methods 5: 16

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tape-Arabidopsis Sandwich - a simpler Arabidopsis protoplast isolation method.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wu&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu C%2C Fan J%2C Froehlich JE%2C Awai K%2C Benning C %282005%29 Mutation of the TGD1 chloroplast envelope protein affects phosphatidate metabolism in Arabidopsis%2E Plant Cell 17%3A 3094%2D3110&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Xu C, Fan J, Froehlich JE, Awai K, Benning C (2005) Mutation of the TGD1 chloroplast envelope protein affects phosphatidate metabolism in Arabidopsis. Plant Cell 17: 3094-3110

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mutation of the TGD1 chloroplast envelope protein affects phosphatidate metabolism in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mutation of the TGD1 chloroplast envelope protein affects phosphatidate metabolism in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xu&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yamaguchi M%2C Demura T %282010%29 Transcriptional regulation of secondary wall formation controlled by NAC domain proteins%2E Plant Biotechnology 27%3A 237%2D242&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yamaguchi M, Demura T (2010) Transcriptional regulation of secondary wall formation controlled by NAC domain proteins. Plant Biotechnology 27: 237-242

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yamaguchi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional regulation of secondary wall formation controlled by NAC domain proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional regulation of secondary wall formation controlled by NAC domain proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yamaguchi&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang A%2C Dai X%2C Zhang WH %282012%29 A R2R3%2Dtype MYB gene%2C OsMYB2%2C is involved in salt%2C cold%2C and dehydration tolerance in rice%2E J Exp Bot 63%3A 2541%2D2556&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang A, Dai X, Zhang WH (2012) A R2R3-type MYB gene, OsMYB2, is involved in salt, cold, and dehydration tolerance in rice. J Exp Bot 63: 2541-2556

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1



Ye H, Liu S, Tang B, Chen J, Xie Z, Nolan TM, Jiang H, Guo H, Lin HY, Li L (2017) RD26 mediates crosstalk between drought andbrassinosteroid signalling pathways. Nature Communications 8: 14573


Yew-Foon Tan NOT, Nicolas L. Taylor, A. Harvey Millar (2010) Divalent Metal Ions in Plant Mitochondria and Their Role in Interactionswith Proteins and Oxidative Stress-Induced Damage to Respiratory Function. Plant Physiology 152: 747


Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis.Nature Protocols 2: 1565


Yu CW, Chang KY, Wu K (2016) Genome-Wide Analysis of Gene Regulatory Networks of the FVE-HDA6-FLD Complex in Arabidopsis.Front Plant Sci 7: 555


Zabotina OA, Avci U, Cavalier D, Pattathil S, Chou YH, Eberhard S, Danhof L, Keegstra K, Hahn MG (2012) Mutations in multiple XXTgenes of Arabidopsis reveal the complexity of xyloglucan biosynthesis. Plant Physiol. 159: 1367-1384


Zhang W, Wang R, Jing W, Xiao L, Jin Y, Shen L (2015) The OsHKT1;1 Transporter is Involved in Salt Tolerance and Regulated by anMYB-Type Transcription Factor. Plant Physiology 168


Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS (2008) Model-basedanalysis of ChIP-Seq (MACS). Genome Biol 9: R137


Zhao L, Nakazawa M, Takase T, Manabe K, Kobayashi M, Seki M, Shinozaki K, Matsui M (2004) Overexpression of LSH1, a member ofan uncharacterised gene family, causes enhanced light regulation of seedling development. Plant J 37: 694-706


Zhu JK (2001) Plant salt tolerance. Trends Plant Sci 6: 66-71Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title


http://www.ncbi.nlm.nih.gov/pubmed?term=Yang H%2C Zhang X%2C Gaxiola RA%2C Xu G%2C Peer WA%2C Murphy AS %282014%29 Over%2Dexpression of the Arabidopsis proton%2Dpyrophosphatase AVP1 enhances transplant survival%2C root mass%2C and fruit development under limiting phosphorus conditions%2E J Exp Bot 65%3A 3045%2D3053&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang H, Zhang X, Gaxiola RA, Xu G, Peer WA, Murphy AS (2014) Over-expression of the Arabidopsis proton-pyrophosphatase AVP1 enhances transplant survival, root mass, and fruit development under limiting phosphorus conditions. J Exp Bot 65: 3045-3053

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Over-expression of the Arabidopsis proton-pyrophosphatase AVP1 enhances transplant survival, root mass, and fruit development under limiting phosphorus conditions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Over-expression of the Arabidopsis proton-pyrophosphatase AVP1 enhances transplant survival, root mass, and fruit development under limiting phosphorus conditions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ye H%2C Liu S%2C Tang B%2C Chen J%2C Xie Z%2C Nolan TM%2C Jiang H%2C Guo H%2C Lin HY%2C Li L %282017%29 RD26 mediates crosstalk between drought and brassinosteroid signalling pathways%2E Nature Communications 8%3A 14573&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ye H, Liu S, Tang B, Chen J, Xie Z, Nolan TM, Jiang H, Guo H, Lin HY, Li L (2017) RD26 mediates crosstalk between drought and brassinosteroid signalling pathways. Nature Communications 8: 14573

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ye&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=RD26 mediates crosstalk between drought and brassinosteroid signalling pathways.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=RD26 mediates crosstalk between drought and brassinosteroid signalling pathways.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ye&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yew%2DFoon Tan NOT%2C Nicolas L%2E Taylor%2C A%2E Harvey Millar %282010%29 Divalent Metal Ions in Plant Mitochondria and Their Role in Interactions with Proteins and Oxidative Stress%2DInduced Damage to Respiratory Function%2E Plant Physiology 152%3A 747&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yew-Foon Tan NOT, Nicolas L. Taylor, A. Harvey Millar (2010) Divalent Metal Ions in Plant Mitochondria and Their Role in Interactions with Proteins and Oxidative Stress-Induced Damage to Respiratory Function. Plant Physiology 152: 747

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yew-Foon&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Divalent Metal Ions in Plant Mitochondria and Their Role in Interactions with Proteins and Oxidative Stress-Induced Damage to Respiratory Function.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Divalent Metal Ions in Plant Mitochondria and Their Role in Interactions with Proteins and Oxidative Stress-Induced Damage to Respiratory Function.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yew-Foon&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoo SD%2C Cho YH%2C Sheen J %282007%29 Arabidopsis mesophyll protoplasts%3A a versatile cell system for transient gene expression analysis%2E Nature Protocols 2%3A 1565&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocols 2: 1565

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yoo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoo&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yu CW%2C Chang KY%2C Wu K %282016%29 Genome%2DWide Analysis of Gene Regulatory Networks of the FVE%2DHDA6%2DFLD Complex in Arabidopsis%2E Front Plant Sci 7%3A 555&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yu CW, Chang KY, Wu K (2016) Genome-Wide Analysis of Gene Regulatory Networks of the FVE-HDA6-FLD Complex in Arabidopsis. Front Plant Sci 7: 555

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-Wide Analysis of Gene Regulatory Networks of the FVE-HDA6-FLD Complex in Arabidopsis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-Wide Analysis of Gene Regulatory Networks of the FVE-HDA6-FLD Complex in Arabidopsis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yu&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zabotina OA%2C Avci U%2C Cavalier D%2C Pattathil S%2C Chou YH%2C Eberhard S%2C Danhof L%2C Keegstra K%2C Hahn MG %282012%29 Mutations in multiple XXT genes of Arabidopsis reveal the complexity of xyloglucan biosynthesis%2E Plant Physiol%2E 159%3A 1367%2D1384&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zabotina OA, Avci U, Cavalier D, Pattathil S, Chou YH, Eberhard S, Danhof L, Keegstra K, Hahn MG (2012) Mutations in multiple XXT genes of Arabidopsis reveal the complexity of xyloglucan biosynthesis. Plant Physiol. 159: 1367-1384

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zabotina&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mutations in multiple XXT genes of Arabidopsis reveal the complexity of xyloglucan biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mutations in multiple XXT genes of Arabidopsis reveal the complexity of xyloglucan biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zabotina&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang W%2C Wang R%2C Jing W%2C Xiao L%2C Jin Y%2C Shen L %282015%29 The OsHKT1%3B1 Transporter is Involved in Salt Tolerance and Regulated by an MYB%2DType Transcription Factor%2E Plant Physiology 168&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang W, Wang R, Jing W, Xiao L, Jin Y, Shen L (2015) The OsHKT1;1 Transporter is Involved in Salt Tolerance and Regulated by an MYB-Type Transcription Factor. Plant Physiology 168

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The OsHKT1;1 Transporter is Involved in Salt Tolerance and Regulated by an MYB-Type Transcription Factor.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The OsHKT1;1 Transporter is Involved in Salt Tolerance and Regulated by an MYB-Type Transcription Factor.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang Y%2C Liu T%2C Meyer CA%2C Eeckhoute J%2C Johnson DS%2C Bernstein BE%2C Nusbaum C%2C Myers RM%2C Brown M%2C Li W%2C Liu XS %282008%29 Model%2Dbased analysis of ChIP%2DSeq %28MACS%29%2E Genome Biol 9%3A R137&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, Liu XS (2008) Model-based analysis of ChIP-Seq (MACS). Genome Biol 9: R137

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Model-based analysis of ChIP-Seq (MACS).&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Model-based analysis of ChIP-Seq (MACS).&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhao L%2C Nakazawa M%2C Takase T%2C Manabe K%2C Kobayashi M%2C Seki M%2C Shinozaki K%2C Matsui M %282004%29 Overexpression of LSH1%2C a member of an uncharacterised gene family%2C causes enhanced light regulation of seedling development%2E Plant J 37%3A 694%2D706&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhao L, Nakazawa M, Takase T, Manabe K, Kobayashi M, Seki M, Shinozaki K, Matsui M (2004) Overexpression of LSH1, a member of an uncharacterised gene family, causes enhanced light regulation of seedling development. Plant J 37: 694-706

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhao&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhao&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhu JK %282001%29 Plant salt tolerance%2E Trends Plant Sci 6%3A 66%2D71&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhu JK (2001) Plant salt tolerance. Trends Plant Sci 6: 66-71

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant salt tolerance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant salt tolerance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhu&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1


Plant Physiology Preview. Published on November 9, 2017 ...Nov 09, 2017 · 19 Corresponding author...

Documents

Transcript of Plant Physiology Preview. Published on November 9, 2017 ...Nov 09, 2017 · 19 Corresponding author...