Prof. G.W. Otim-Nape, Plant Virologist and Chairman,Africa Innovations Institute, 1544 Koire Close, Bukoto, P.O. Box

34981, Kampala, Uganda (www.afrii.org)

Plant Biotechnology for Sustainability and Global Economy:

An African Perspective illustrated by cassava mosaic pandemic in East Africa, and impacts of

interventions on livelihoods in Uganda

Purpose of the presentation

● Allow the Plants for Life PhD students to become aware of the reality and scientific challenges regarding agricultural production in Uganda

● Transmit knowledge on the specific case studies on cassava mosaic disease problem and the application of biotechnology in resolving it.

● Allow open discussions about the subjects and strategies employed, and strongly contribute to their education and vision about the global challenges ahead regarding plant science research.

Structure of the presentation● Introduction to AfrII and its programes.● Importance of plant biotechnology

● Cassava Mosaic Disease case study in Uganda● Application of plant biotechnology in:

Understanding the cause of the epidemicMonitoring genetic diversity of the virusDeveloping resistant varieties

● Dissemination of mosaic control measures● Impact of the Interventions to Control mosaic ● Implications of the case study to the PhD students

Africa Innovations Institute❑ Center of

excellence in agricultural and environment research and innovations in Eastern Africa.

❑ Undertake research and innovations development that transforms the lives of smallholder farmers and SMEs.

AfrII staff and Chinese delegation after a successful meeting on implementation of the AgriTT Project.

Vision

Small holder farmers enjoying increased incomes and assured of food and nutrition security.

Mission

To undertake agricultural research and innovations that transform the lives and incomes of smallholder farmers while ensuring food and nutrition security and environmental sustainability.

Objectives1. To generate and accelerate utilization of knowledge and innovations for sustainable

agricultural development and advancement of science and technology in Africa.

2. To facilitate learning, and bridge information gaps through managing our knowledge base, publishing our research findings, sharing of lessons learnt and holding of conferences, seminars and camps.

3. To promote entrepreneurship and accelerate transformation of knowledge and innovations into agri-business ventures through partnerships and linkages with the private sector players in agriculture and industry.

4. To promote and participate in capacity development in agriculture, research, science, and innovations for sustainability of the agricultural sector.

Programmes and ProjectsCommodity

Value Chains Development Programme

Climate Change and Environment Sustainability Programme

Agriculture for improved Nutrition

Programme

Capacity and Institutional DevelopmentProgramme

CAVA 1&2

Rice ENRICH

Sesame Project

Vital Signs Project

Securing Livelihoods

CBIT Project

IMMANA Project

L4L Project

Drivers of Food Choice

Journalist training

SDG-NDCs workshop

Gender training

The overall goal is to improve food security and income of people involved in the rice value chains in Uganda.

Specific objectives are:

1) Improving productivity through elimination of major constraints in rice production- agronomy, pest and disease control, nutrition.

2) Improving rice post-harvest management and processing in collaboration with artisanal and commercial processors;

3) Capacity building of key value chain actors- farmers and processors - production and processing practices, and skills;

4) Improving linkages and access to markets for farmers and artisanal processors.

AfrII’s Work Programme on Rice

Research Progress – Pictorials

AfrII research scientist processing soil and plant samples from rice experiments for chemical analysis

Partners of the ENRICH Rice programme discuss with AfrII’s Farmers’ Research Group on performance of rice nutrition trial at Doho Rice Scheme, Eastern Uganda, June 2018.

1) Improving productivity and efficiency of rice value chains – productivity (agronomy, disease control, nutrition) and production systems efficiency.

2) Improving rice post-harvest management and processing in collaboration with artisanal and commercial processors;

3) Capacity building of AfrII to engage in high quality science through joint research and publications

Areas for future collaboration

Biotechnology – a definition● The word "biotechnology“ - first used in 1917 to describe processes

using living organisms to make a product or run a process, such as industrial fermentations.

● CBD - “Any technological application that uses biological systems, living organisms, or derivatives theory, to make or modify products or processes for specific use’’

● The FAO defines it broadly as in the CBD and narrowly as “a range of different molecular technologies such as gene manipulation and gene transfer, DNA typing and cloning of plants and animals”

● The common tools used - genomics and genetic manipulations, marker-assisted selection (MAS), transgenics or genetic engineering, molecular markers, molecular diagnostics, vaccines, tissue culture and micro-propagation.

Importance in sustainability and global economy

● Contrary to what others may say, plant biotechnology is making significant contribution to food security, environmental and economic sustainability.

● Transgenics and genetic modified crops, have played a critical role,

● In 2017, global area of biotech crops was 189.8 million hectares, representing an increase of 3% from 2016, equivalent to 4.7 million hectares

● Soybeans, corn, cotton and canola have been the major crops (Table 1)

Economic and Environment Benefits

1. Farm income benefits: ● Since 1996 - $186.1 billion,

54.8% by developing country farmers.

● In 2016 alone was $18.2 billion,

2. Environmental benefits:

● Since 1996, pesticides use reduced by 671.2m kg a.i. (8.2% reduction),

● Environmental impact (EIQ indicator) for herbicide and insecticide use fell by18.4%.

3. Reduced GHG emissions Fuel savings:

● In 2016 - about 2,945m kg CO2

● 1996 to 2016: 29,169m kg of CO2

No/minimum tillage ● an extra 6,586m kg of

soil carbon sequestered in 2016 or 24,172m kg CO2 equivalent

Application of Plant Biotechnology to Cassava

Mosaic Pandemic in Uganda – A Case Study

XVIth

XVIIth

XXth

Cassava Importation Routes in the World

Cassava Producing Countries

Grown in 105 countries globally; 250 million Africans depend on it for food and income.

Cassava in Uganda

• Most important staple food crop

• Provides food and income security of most rural farmers

• Ranks 2nd in area planted and per capita consumption

• Area under cassava: ~ 400,000 Ha.

• Current production: ~ 5.4m mt

Severe mosaic disease epidemic appears, 1988(Left) Whiteflies on lower young cassava leaf, (middle) - whitefly-transmitted severe CMD affected cassava otherwise grown from a healthy cuttings (Right) – spread of the disease in a susceptible cassava crop.

Mosaic Disease Epidemic (c) Severe CMD in an initially healthy planting of cassava during

the 1997 epidemic in Uganda

(d) An abandoned planting of cassava established with cuttings from plants infected the previous year

Fig. 2. Reconstructed movement of the cassava mosaic epidemic in Uganda: 1990- 1999●The epidemic expands in 3 distinct zones: pre-epidemic, epidemic front & recovery zone

●At the ‘front’: unusually severe CMD symptoms & high whitefly numbers

●Front covered east to west (~ 600km)

●It moved southward at ~ 20-30km annually; ~ 15,000 sq. km annually

●By 1999, entire country traversed; the epidemic reported in W. Kenya, NW Tanzania, Rwanda, Eastern DRC & S. Sudan

1990s

1998

2002

2005?

?

The CMD Pandemic Spreads to the Great Lakes Region

Impact of the epidemic

• Loss of cassava biodiversity: virtual elimination of nearly all the existing varieties and land races

• Drastic decline in cassava production (From 1993 ~60,000 ha lost annually, equiv. US $60 million)

• Food shortages & famine-related deaths especially in eastern and northern Uganda

• Decline in National GDP in 1997 attributed to CMD (budget speech)

Impact of cassava mosaic epidemic on area, production and yield of cassava

Note: decline and recovery during periods -1990-1994 and 1994 -1999 respectively

Impact of mosaic epidemic

Understanding the cause of the epidemic

Talking about cassava

mosaic epidemic,

are scientists

going too slow or ignorant

of our problems?

We want solutions, not

words. Do we eat your

words?

Molecular analysis of viral DNA● DNA samples were extracted from virus isolates from plants with (1)

very severe symptoms from within epidemic areas, (2) moderate symptoms from outside the epidemic areas and (3) reference samples from Kenya, Tanzania and Malawi (Xueping Zhou 1997).

● The whole DNA-A of isolates C39 and C74, and of a Tanzanian isolate of EACMV (EACMV-T) were amplified – using three pairs of primers.

● DNA-A of isolate C100 was amplified as two fragments with degenerate primer pairs

● A fragment including the intergenic region and the AV2 and coat protein (CP) genes of isolates C70, C74 and EACMV-K was also amplified.

● The intergenic region, the AV2 gene of ACMV-U1 and the CP gene of ACMV-U2 were amplified

Table 1. Primers used for PCR

Primer designation* Primer sequence (5« to 3«)† Position in DNA‡Primers used for cloning:

UV-AL1}F1 TGTCTTCTGGGACTTGTGTG 2057–2076aUV-AL1}R1 AACCTATCCCCGATGCTCAT 2595–2576aUV-AL1}F2 GTAATTGGGAAAGGGCCTCT 2546–2565aUV-CP}R GTTACGGAGCAACATGCAAT 1140–1121aUV-AL3}F TACACATGCCTCRAATCCTG 1033–1052aUV-AL1}R2 CTCCGCCACAAACTTACGTT 2119–2100aACMV-AL1}F GCGGAATCCCTAACATTATC 1985–2004bACMV-AR0}R GCTCGTATGTATCCTCTAAGGCCTG 233–209bACMV-CP}F2 ACATACGAGCCCAGTACGTT 224–243bACMV-CP}R2 CCAACACTATTGAGTGCAAG 1119–1100bPAL1v1978§ GCATCTGCAGGCCCACATYGTCTTYCCNGT PAR1c715§ GATTTCTGCAGTTDATRTTYTCRTCCATCCA PAR1v722§ ATATCTGCAGGGNAARATHTGGATGGA PAL1c1960§ TGGACTGCAGACNGGNAARACNATGTGGGC Additional primer used for sequencing:

UV-CP}F2 GCGTCAACATGTGGGATCCATT 164–185aPrimer used for specific detection of UgV:

ACMV-CP}R3 TGCCTCCTGATGATTATATGTC 947–926b Primers for ACMV DNA-B: ACMV-BR1}F TGTATAGTATCAGGAAGCAG 436–455cACMV-BR1}R GGTGCTCAATCGCTTATTAA 1036–1017cACMV-BL1}F CTATAATGCTTTCAATGTCC 1273–1292c

ACMV-BL1}R CAATTGATGATAACGTACCA 1788–1769c* Designations containing }F or v denote forward primers and those containing }R or c are reverse primers. † R represents A or G; Y represents C or T; D represents A, G or T; H represents A, C or T; N represents A, C, G or T.; ‡ Residue numbers refer to the sequences of: a, DNA-A of isolate C39 (this paper); and b and c, DNA-A and DNA-B, respectively, of ACMV (Stanley & Gay, 1983) renumbered to make residue 1 the A in the conserved nonanucleotide TAATATTAC in the intergenic region (originally residue 153).§ Primers are named according to Rojas et al. (1993)

The arrangement of ORFs. ● The arrangement, positions

and sizes of ORFs in DNA-A of C39 and EACMV-T was similar to that in DNA-A of other whitefly-transmitted geminiviruses but differed from ACMV-K

● Meaning that the isolates were those of a geminivirus; but the geminivirus was not ACMV (Table 2).

Comparison of complete DNA-A sequences. ● The sequences of all isolates

from within the epidemic areas (C39, C74, C100) were " 98% identical; and also identical to that of EACMV–T than to ACMV–K –

● Meaning the isolates were of a similar virus to EACMV-T and not ACMV-K (Table 3).

Comparison of DNA fragments 1

Comparison of DNA fragments - 2

Comparison of intergenic regions. ● The intergenic regions of

the three isolates from the epidemic area (C39, C70 and C74) were identical in length (326 nt) and very similar in sequence;

● and was 95% identical to that of EACMV-K and EACMV-T than EACMV-M; but not to ACMV isolates

● isolates similar to EACMV, different from ACMV.

Analysis of the coat protein. ● The sequences of isolates C39, C70

and C74 were similar in both nucleotide sequence identity and amino acid sequence identity and could be divided into three parts:

The 5’ part extremely similar to that of EACMV; a large central part very like ACMV; towards the 3’ again similar to EACMV –

● Strong evidence that the CP is a result of a recombination between EACMV and ACMV (Table 4).

Comparison of ORFs and CP gene of DNA-A of virus isolates

Table 3. Percentage AA sequence identities of putative products of ORFs in DNA-A of EACMV, ACMV and isolate C39ORF Viruses compared

  C39 and EACMV-T

C39 and ACMV-K

EACMV-T and ACMV-K

AV2 95 62 60

AV1(CP) 89 91 81

AC1(Rep) 97 69 69

AC2 90 63 64

AC3 90 69 70

AC4 91 31 30

Table 4. Percentage NTs and AM sequence identities of three regions of the coat protein gene of isolate C39, EACMV-T and ACMV-U2Isolate compared

Region of C39 gene (nt no.)

  1–219 220–678 679–771

EACMV-T 99 (100) 75 (82) 98 (100)

ACMV-U2 79 (82) 99 (99) 76 (90)

Numbers are percentage nucleotide sequence identity. Numbers in parentheses are percentage amino acid sequence identity.

Conclusion. ● The data provided strong evidence that CP gene of the C

isolates had arisen by recombination between EACMV and ACMV.

● The recombination resulted in a more aggressive virus strain able to infect, multiply in high concentrations and spread in all plant tissues causing very severe symptoms.

● Because the C isolates differ consistently, and in a characteristic way, from both EACMV and ACMV, they were referred to subsequently as the Uganda variant (EACMV - UgV).

● The recombination is illustrated in figure.

Monitoring spread and diversity of cassava begomovirus isolates: Kenya –PCR-RLPF and DNA sequencing

Breeding varieties for

mosaic disease resistance

Breeding Varieties for Mosaic Resistance -1

● The use of resistant varieties was considered the cornerstone for control– all local varieties highly susceptible

● Improved germplasms, tissue culture and true seeds, with possible resistance was introduced from IITA, Nigeria.

● Materials raised in seedling nursery, cloned and evaluated in preliminary, advanced, uniform yield and on-farm trials –a cycle lasts about 10yrs, but we reduced to 6yrs.

Cassava genotypes for evaluation in a preliminary yield trials

Breeding Varieties for Mosaic Resistance - 2

● The local varieties were hybridized with the exotic TMS 30572, 30337 and 60142 and 4(2) 1425 and other materials

● Seed progenies subjected through similar cycles of breeding and selection, including molecular marker assisted selection.

● The evaluation considered level of resistance to CMD, other diseases and pests and good agronomic and organoleptic qualities.

● By 1994, after five years of serious work, three varieties were gazetted as official varieties for cultivation. This number had increased to 8 by 1998 and to several thereafter.

Molecular markers assisted breeding● Planting of thousands of segregating materials in a seedling nursery

under high mosaic disease pressure.

● Selection and confirmation of absence of infection of symptomless plants by the four mosaic virus strains - PCR using primers specific to the four virus strains (Zhou et al., 1997).

● Amplification of DNA samples from the non-infected plants using specific SSR markers (SSRY28, NS158, NS169 and RME1) associated with the CMD2 gene, the dominant gene, which confers resistance to ACMD.

● Selection, rapid multiplication and further fielfield evaluation of the selected genotypes for resistance and desirable attributes and confirmation of resistance.

● Participatory OFTs and official release of superior performers as new varieties for cultivation.

Scientists inspect cassava crop in a uniform variety yield trial,1994

By 1994, after five years of serious work, three varieties were gazetted as official varieties for cultivation.

This number had increased to 8 by 1998: Nase 1, Nase 2, Nase 3, Nase 4, Nase 5, Nase 6, Nase 7 and Nase 8

Improved varieties Nase 10 - high yielding and resistant to CMD

Multiplication and dissemination of mosaic

resistant varieties and other strategies for control

Dissemination of mosaic control measures

● National Network of Cassava Workers (NANEC), a vehicle for accelerated transfer of mosaic control technologies was developed for use.

● An integrated strategy based on on-farm trials, demonstrations, selection of healthy planting materials, rouging and use of resistant varieties and training of farmers and extension workers was adopted

● Three approaches were used for multiplication:- at institutional farms, by farming groups and by individual farmers.

● At least 536 accelerated on-farm trials were conducted over the period and an estimated 100,000 hectares of mosaic resistant varieties were multiplied in 1997 and given to farmers throughout the country.

The National Network of Cassava Workers in Uganda (NANEC)

A demonstration field of officially released varieties and promising cassava genotypes at NAARI.

Adoption of mosaic control measures

● Over 35,000 farmers, opinion leaders and extension agents were trained from 1991 to 1996 on the cassava mosaic pandemic and how to control it

● A survey conducted in 1997 indicated that at least 80% of these farmers were using most or all of the mosaic control technologies.

● By 1997, there was less intense manifestation of severe mosaic symptoms on crops of local and improved varieties

● On 14th December 1998, NARO officially announced that it had successfully tamed cassava mosaic and the war was over (New Vision, Monday, December 1998).

The Wise Women of Vvumba

The wise women of Vvumba were instrumental in dissemination of improved varieties and other mosaic control measures

• Adoption of CMD resistant varieties grew rapidly

• CMD incidence and severity reduced drastically

• The declining cassava production trend reversed

• Famine eliminated and food security was restored.

• Huge positive social, and economic returns to investment

Outcome of interventions

Measures of return

2000 2003

Net present value (NPV)

US $90 M

US $132 M

rate of return (IRR)

167% 175%

Benefit Cost Ratio (BCR)

18.2 22

Impact of interventions (2)• Full restoration of

cassava production

• Improved cassava productivity

• Improved food security & incomes

• Increased farmers’ knowledge on control of CMD

• Adoption of NARO’s strategy to address CMD in the region & other epidemics in Uganda (coffee, bananas)

• Institutional changes based on the NANEC e.g creation of NARO’s Outreach Directorate

Trends in production, area and yield of cassava in Uganda, 1981-1999 (base = 1981)

Initiation of interventions

Expect the unexpected: resistant varieties send prices crushing

● Fresh cassava roots back on sale at Nakasero market, Kampala by 1997,

● Improved production has led to lower farm gate prices for roots, benefiting the urban poor but reducing farmers’ incomes,

● New processing opportunities could boost incomes and employment

  

   

Implications to plant biotechnology students● This is a clear example of internationalization of research, technology

and learning. PhD graduates should be aware and keen to forge an integrated partnership in order to solve global economic and sustainability challenges.

● Good science must impact on development- peoples’ lives, economy and the environment. The PhD students should reorientate their mindsets from purely scientific thinking to broad-based thinking, which views science as an ingredient for development to which they are expected to contribute their bit.

● The interspecific recombination seen in nature in this mosaic virus case calls for caution. Care should be taken to avoid unintended consequences in genetic engineering.

Key Literature on Mosaic in Uganda● https://www.researchgate.net/publication/13953291_Evidence_that_DNA-A_of_a_gemin

ivirus_associated_with_severe_cassava_mosaic_disease_in_Uganda_has_arisen_by_interspecific_recombination

● https://www.researchgate.net/publication/229684889_Role_of_a_novel_type_of_double_infection_in_geminivirus_induced_epidemic_of_severe_cassava_mosaic_in_Uganda

● https://www.researchgate.net/publication/279696593_Bemisia_tabaci_and_cassava_mosaic_virus_disease_in_Africa

● https://www.researchgate.net/publication/285295843_Cassava_mosaic_viruses_in_Uganda_The_current_pandemic_and_approaches_to_control

● https://www.researchgate.net/publication/27792162_Accelerating_the_Transfer_of_Improved_Production_Technologies_Controlling_African_Cassava_Mosaic_Virus_Disease_Epidemics_in_Uganda

● https://www.researchgate.net/publication/5296668_Diversity_of_begomoviruses_associated_with_mosaic_disease_of_cultivated_cassava_Manihot_esculenta_Crantz_and_its_wild_relative_Manihot_glaziovii_Mull_Arg_in_Uganda

Controlling Cassava Viruses Through Genetic Engineering

(Borrowed from VIRCA Project Dr C.M. Fauquet)

Hypothesis Experimental ConstructPlantlets

Excel dbVector

Backbone- PCR

CopyNumber- Dot Blot

- Southern

Expression- RT-PCR- Northern- ELISA

Molecular Screens

Transformation

Micropropagation(growth chamber DDPSC)

Cassava TrackerWeb db

Commercial ConstructCallus

Virus challenges(greenhouse, DDPSC)

Virus challenge, agronomics(field, Africa)

VIRCA Cassava Production Pipeline

EACMV clones % Infectivityin Cassava

Symptom Level

(1-5 scale)

Recovery (R)/Non-recovery (NC)

phenotypes

Kenyan Isolates

1 EACMV-[K24] 100 2-4 R

2 EACMV-KE2[K48] 100 3-4 NR

3 EACMV-KE2[K201] 100 5 NR

4 EACMV-KE3[K229] 100 2-4 Mild Recovery

5 EACMV-KE3[K308] 86 1-4 R

Ugandan Isolates

6 EACMV-UG[K282] 100 2-4 Mild Recovery

Zanzibar Isolates

7 EACMZV-[K3] 100 1-2 NR

8 EACMZV-[K19] 86 1-4 R

9 EACMZV-[K275] 100 2-4 Mild Recovery

Control

10 ACMV-[CM] 100 3 R

Infectious EACMV clones from Kenya in Cassava

KE2

KE3

Challenging systems

Helios Biolistic

Small target areaNo limitation for age and tissue 250 plants can be shot per day

Large target areaLimited by plant size70 plants can shoot per day

Cassava pipeline is producing transgenic cassava showing resistance to ACMV and/or

EACMV

Non-transgenic cassava variety60444 infected with K201

Transgenic cassava variety60444 infected with K201

AcknowledgementsThe work described was supported by many donors: the International Development Research Centre (IDRC) of Canada, the Gatsby Charitable Foundation; UK, the British Department for International Development (DFID) through the Natural Resources Institute (NRI), U.K, the United States Agency for International Development (USAID) and the Government of Uganda (GoU), to whom we are grateful. Your actions have and will continue to save millions of people in this country and beyond.

IDRC, DFID and GoU supported generation of knowledge and technologies for controlling mosaic. The Gatsby Charitable Foundation pioneered moving technologies from the research station to the farmers and their effective dissemination. USAID supported further technology dissemination. We thank International Institute of Tropical Agriculture (IITA) for the cassava germplasms which became the corner stone for control. I thank Dr Margarida Oliveria and the NOVA University, Lisbon for organizing and supporting this visit. I am most grateful.

Thank You