1225Journal of Atherosclerosis and Thrombosis　Vol.22, No.12

Original Article

Pioglitazone Reduces Vascular Lipid Accumulation in Angiotensin II- Induced Hypertensive Rat

Aiko Sakamoto1, Yasutomi Higashikuni1, Makiko Hongo1, Yasushi Imai1, 2, Kazuhiko Koike3, Ryozo Nagai1, 4, Issei Komuro1 and Nobukazu Ishizaka5

1Department of Cardiovascular Medicine, University of Tokyo Graduate School of Medicine, Tokyo, Japan2Department of Cardiovascular Medicine, Jichi Medical University, Tochigi, Japan3Department of Gastroenterology, University of Tokyo Graduate School of Medicine, Tokyo, Japan4Jichi Medical University, Tochigi, Japan5Division of Cardiology, Osaka Medical College, Osaka, Japan

Aim: In an insulin-resistant state, excess lipids may accumulate in various non-adipose tissues, lead-ing to histological and functional damage. It has been suggested that peroxisome proliferator-acti-vated receptor-gamma (PPARγ) may ameliorate disorganized lipid balance. In the current study, we analyzed whether pioglitazone, an agonist of PPARγ, reduces angiotensin II-induced vascular lipid accumulation.Methods: Angiotensin II was infused into rats at doses of 0.7 mg/kg/day via a subcutaneously implanted osmotic minipump for 7 consecutive days. Pioglitazone was orally given at a dose of 2.5 mg/kg/day for 7 days.Results: Pioglitazone significantly reduced angiotensin II-induced enhanced lipid deposition and superoxide production in the adventitia of the aorta, as detected by oil red O and dihydroethidium (DHE) staining, respectively. Increased DHE signals, some observed at the site of lipid deposition, were mainly localized in ED-1-positive monocytes/macrophages. Angiotensin II-induced upregula-tion of the expression of LDL receptor and Nox1 was inhibited by pioglitazone treatment. In addi-tion, angiotensin II significantly reduced the expression of PCSK9, and this reduction was amelio-rated by pioglitazone. On the other hand, pioglitazone did not significantly alter the expression of the phosphorylated forms of AMPKα and ACC, which was downregulated by angiotensin II.Conclusions: Pioglitazone treatment suppressed excess lipid accumulation and superoxide production in the aorta in an angiotensin II-induced rat model of hypertension.

J Atheroscler Thromb, 2015; 22: 1225-1234.

Key words: Aorta, Lipid accumulation, Angiotensin II, Peroxisome proliferator-activated receptor

Introduction

Obesity and associated disorders, such as diabetes and atherosclerosis, are closely related to the elevated levels of lipids and chronic inflammation1). Recent reports have suggested that ectopic fat distribution might be a better predictor of future cardiovascular

Address for correspondence: Aiko Sakamoto, Department of Cardiovascular Medicine, University of Tokyo Graduate School of Medicine, 7-3-1 Hongo, Bunkyo, Tokyo, 113-8655, JapanE-mail: asakamoto-tky@umin.ac.jpReceived: November 29, 2014Accepted for publication: April 29, 2015

events than overall obesity itself 2, 3). Adipocytes have sufficient capacity to store overflowing lipids in the cytosol, whereas non-adipocyte cells have limited space to store excess fat4). Intracellular lipid accumula-tion in non-adipocyte cells and excess lipid utilization may disrupt cellular homeostasis and lead to cell death, a phenomenon defined as “lipotoxicity”5). Lipotoxic-ity occurs in multiple organs, including cardiac and vascular tissues. Perivascular fat may play an indepen-dent role in adverse vascular biology, such as the pathogenesis of arterial stiffness4). Lipotoxicity has been reported to impair endothelial cell function via diverse mechanisms, including vascular insulin resis-

1226 Sakamoto et al.

days.

Histological and Immunohistochemical AnalysisOil red O staining was performed on sections of

unfixed, freshly frozen vascular samples (3 μm in thickness). The area of lipid deposition was calculated by the image analysis software Photoshop (Adobe), and lipid deposition was semiquantified as described else-where17). Staining with the oxidative fluorescent dye dihydroethidium (DHE) was performed as described previously18). Images were obtained with a fluores-cence microscope BX51 (Olympus), and the fluores-cence intensity, obtained from at least five fields for each section, was calculated as a percentage of that of the untreated control. Immunohistochemistry was per-formed as described previously19). Primary antibody against rat macrophage/monocyte (ED-1; BMA Bio-medicals) was used at a dilution of 1/100.

Western Blot AnalysisWestern blot analysis was performed as described

previously20). All layers of vascular samples were used for the analysis. Antibody against low-density lipopro-tein (LDL) receptor (Abcam) was used at a dilution of 1/500. Antibodies against total and phosphorylated forms of AMP-activated protein kinase (AMPK) (Cell Signaling Technology), total and phosphorylated forms of acetyl-CoA carboxylase (ACC) (Cell Signaling Tech-nology), sterol regulatory element-binding proteins (SREBP)-1c (Cell Signaling Technology), proprotein convertase subtilisin/kexin type 9 (PCSK9) (Abcam), and β-actin (Sigma) were used at a dilution of 1/1000. Antibodies against fatty acid synthase (FAS) (Cell Sig-naling Technology) and Nox1 (Abcam) were used at a dilution of 1/2000. An ECL Western blotting system (Amersham Life Sciences) was used for detection. Bands were visualized by a luminoanalyzer (Fuji Photo Film). Band intensity was calculated as a percentage of the control value.

tance, inflammation, and oxidative stress6).In an insulin-resistant state, multiple alterations,

including activation of the renin-angiotensin system and increased expression of pro-inflammatory cyto-kines can be observed5). Activation of the renin-angio-tensin system plays a key role in the progression of various diabetic complications and also leads to vascu-lar dysfunction7, 8). In a recent study, we showed that administration of angiotensin II caused marked lipid accumulation in the heart and kidney in a rat model of hypertension9, 10). Furthermore, it has been reported that lipids are ligands for transcriptional regulators of the peroxisome proliferator-activated receptor (PPAR) family; therefore, regulating lipid delivery may have a significant impact on PPAR function5). Several previ-ous studies have shown that PPARγ agonists may pro-mote adipogenesis and act favorably in suppressing the excess accumulation of ectopic lipid11-13). We have also demonstrated that cardiac and renal lipid deposits are reduced by treatment with pioglitazone, an agonist of PPARγ14, 15). Here we analyzed the impact of piogl-itazone on vascular lipid accumulation in a rat model of angiotensin II-induced hypertension.

Materials and Methods

Animal ModelsAll experiments were performed in accordance

with the guidelines for animal experimentation approved by the Animal Center for Biomedical Research, Fac-ulty of Medicine, University of Tokyo. Angiotensin II-induced hypertension was induced in male Sprague –Dawley rats (250 –300 g) by subcutaneous implanta-tion of an osmotic minipump (Alza Pharmaceutical), as described previously16). Briefly, Val5-Ang II (Sigma Chemical) was infused at doses of 0.7 mg/kg/day via a subcutaneously implanted osmotic minipump for 7 days. In some angiotensin II-infused rats, pioglitazone (Takeda Pharmaceutical Co., Tokyo, Japan) was orally given at a dose of 2.5 mg/kg/day for 7 consecutive

Table 1. Oligonucleotide primers used in the study

Gene GenBank No. Forward Primer Reverse Primer

Nox1SREBP-1cFASLDL receptorPPARγGAPDH

MN_053683XM_213329M76767X13722NM_013124NM_017008

TGGACGAATTAGGCAAACCGCTGATGGAGACAGGGAGTTCCTGGAACGTGAACATGATCTCGGAGGACGAGATCCACATTATCAGCTCTGTGGACCTCTCTGAACGGGAAGCTCACTGG

TTGGGGTGGGCAGTAGCTATATCACCACGGCTGTCAGTTTCACCAGCAGGATACTCAGAAAGCGTCCTTCCTGCCTAAAGGCTCTACTTTGATCGCACTCCACCACCCTGTTGCTGTA

SREBP, sterol regulatory element-binding proteins; FAS, fatty acid synthase; LDL, low-density lipoprotein; PPAR, peroxisome proliferator-activated receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

1227Pioglitazone and Lipid Accumulation

Statistical AnalysisData are expressed as the mean±SEM. We used

ANOVA followed by a multiple comparison test to compare raw data, before expressing results as a per-centage of the control value using the statistical analy-sis software Dr. SPSS II for Windows (SPSS Inc.). A value of p＜0.05 was considered to be statistically sig-nificant.

Results

Accumulation of Lipids in the AortaThe body weight, blood pressure, and serum lipid

Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

mRNA expression of lipid metabolism-related genes was analyzed by real-time quantitative PCR per-formed by LightCycler, together with hybriprobe tech-nology (Roche Diagnostics), using forward and back-ward primers described in Table 1. All layers of vascu-lar samples were used for the analysis. mRNA expres-sion of target genes was normalized to that of the endogenous control glyceraldehyde-3-phosphate dehy-drogenase (GAPDH). The target genes were Nox1, FAS, SREBP-1c, LDL receptor, and PPARγ.

Fig.1. Oil red O staining of the aorta of rats given angiotensin II with or without pioglitazone. Shown are vascular sections from a control rat (A), a rat given pioglitazone (B), a rat given angiotensin II (C), and a rat given angiotensin II plus pioglitazone (D). Original magnification, ×400. Scale bar indicates 50 μm. E. Semi-quantification of the oil red O-stained area. Data represent the mean±SEM of data from six to seven rats in each group. Ang II, angiotensin II; Pio, pioglitazone.＊p＜0.005 versus untreated control.

Oil re

d O-st

ained

area

(% co

ntrol)

0

300

500

900

E

700

B

Pio

A

Control Ang II

C

Ang II+Pio

D800

600

400

200100

*

Fig.2. Dihydroethidium (DHE) staining of the aorta of rats given angiotensin II with or without pioglitazone. Shown are vascular sections from a control rat (A), a rat given pioglitazone (B), a rat given angiotensin II (C), and a rat given angiotensin II plus pioglitazone (D). Original magnification, ×400. Scale bar indicates 50 μm. E. DHE signal intensity. Data represent the mean±SEM of data from six to seven rats in each group. Abbreviations are the same as in Fig. 1.＊＊p＜0.001 versus untreated control.

B

Pio

A

Control

C

Ang II

D

Ang II+Pio DHE

signa

l inten

sity

(% co

ntrol)

0

100

200

400

E

300**

1228 Sakamoto et al.

was suppressed by pioglitazone treatment (87±5%, p= NS versus control) (Fig.2). In the aorta of angiotensin II-infused rats, increased DHE signals were observed in the adventitia of the aorta among cells that were mainly positive for ED-1; thus, they were judged to be monocytes/macrophages. Some adventitial cells with increased DHE signals were detected at the site of lipid deposition (Fig.3). In addition, angiotensin II significantly increased the protein expression of Nox1 (227±18%, p＜0.001 versus control), a component of NADPH oxidase, and this upregulation was sup-pressed by pioglitazone treatment (154±19%, p=NS versus control). Angiotensin II-induced upregulation

data of rats in each group have been described previ-ously14). Oil red O staining of vascular sections showed no apparent lipid deposition in untreated control rats and control rats treated with pioglitazone alone (Fig.1A, B). An increase in oil red O-positive lipid droplets was observed in the adventitia of the aorta in angiotensin II-infused rats (Fig.1C), and this increase was sup-pressed by pioglitazone administration (Fig.1D).

Superoxide Production in the AortaCompared with untreated control rats, DHE stain-

ing-positive signals were increased by angiotensin II (285±34%, p＜0.001 versus control), and this increase

Fig.3. Serial sections of the aorta from angiotensin II-treated rats. A. Oil red O staining. B. Dihydroethidium (DHE) staining. C. ED-1 immunostaining. Original magnification, ×400. Scale bar indicates 50 μm.

A B C

Fig.4. Western blot analysis and real-time reverse transcription-polymerase chain reaction (RT-PCR) analysis of Nox1. A. Western blot. The white lines represent the connection point of band images. B. The protein expression in treated rats relative to control rats. Data represent the mean±SEM of data from five to eight rats in each group. C. mRNA expression in treated rats relative to control rats. Data represent the mean±SEM of data from nine to ten rats in each group. Abbreviations are the same as in Fig. 1.＊＊p＜0.001 versus untreated control.

-Actin

Nox1

Control Pio Ang II Ang II+Pio

A

0

100

200

300

0

200

700

400

B C

Nox1

mRN

A(%

contr

ol)

Nox1

prote

in(%

contr

ol)

600500

300

100

****

1229Pioglitazone and Lipid Accumulation

sus control), and this reduction was ameliorated by concomitant pioglitazone treatment (61±9%, p=NS versus control). Although not statistically significant, angiotensin II suppressed SREBP-1c mRNA expres-sion (61±7%, p=NS versus control), and concomi-tant treatment with pioglitazone significantly upregu-lated the expression of SREBP-1c mRNA (204±28%, p＜0.005 versus control). The expression of PPARγ mRNA was not altered either by angiotensin II alone (54±7%, p=NS versus control) or angiotensin II plus pioglitazone (134±30%, p=NS versus control) (Fig.7).

Discussion

In the current study, we demonstrated that piogl-itazone suppressed excess lipid accumulation and super-oxide production induced by angiotensin II in the rat aorta. Angiotensin II significantly decreased the expres-sion of FAS in the rat aorta, but this decrease was restored by pioglitazone treatment. In addition, con-comitant administration of angiotensin II and piogli-tazone significantly increased the mRNA expression of SREBP-1c, even though pioglitazone treatment reduced vascular lipid accumulation. Pioglitazone did not alter the suppressed expression of phosphorylated AMPKα and ACC induced by angiotensin II, which might rather act to enhance vascular lipid deposition. On the other hand, angiotensin II-induced upregulation of the LDL receptor and downregulation of PCSK9 were both improved by pioglitazone treatment. The expres-sion of NADPH oxidase, which was increased by

of mRNA expression of Nox1 (565±95%, p＜0.001 versus control) was also inhibited by pioglitazone treat-ment (298±57%, p=NS versus control) (Fig.4).

Regulation of Genes Related to Lipid MetabolismCompared with untreated control rats, angioten-

sin II significantly decreased PCSK9 expression (41±3%, p＜0.005 versus control), and this decrease was ameliorated by pioglitazone (72±10%, p=NS versus control). Furthermore, the protein expression of LDL receptor was significantly increased by angiotensin II (195±25%, p＜0.005 versus control), and this upreg-ulation was ameliorated by pioglitazone treatment (145±30%, p=NS versus control) (Fig.5). Although the expression of total and phosphorylated forms of AMPKα and ACC was significantly reduced by angio-tensin II, this downregulation was not affected by pio-glitazone treatment (Fig.6). The protein expression of FAS was significantly decreased by angiotensin II (43±6%, p＜0.05 versus control), and this reduction was ameliorated by pioglitazone treatment (57±9%, p=NS versus control). Concomitant treatment of pio-glitazone and angiotensin II significantly increased the protein expression of SREBP-1c (132±11%, p＜0.05 versus control).

Angiotensin II-induced upregulation of LDL receptor mRNA expression (757±227%, p＜0.01 ver-sus control) was suppressed by pioglitazone (314±75%, p=NS versus control), as with the protein expres-sion. In addition, angiotensin II significantly reduced the expression of FAS mRNA (32±5%, p＜0.05 ver-

Fig.5. Western blot analysis of proprotein convertase subtilisin/kexin type 9 (PCSK9) and low-density lipoprotein receptor (LDLR). A. Representative western blots. The white lines represent the connection point of band images. B, C. Respective protein expression in treated rats relative to control rats. Data represent the mean±SEM of data from five to eight rats in each group. Abbreviations are the same as in Fig. 1.＊p＜0.005 versus untreated control.

LDLR

PCSK9

A

-Actin

PC

SK

9 (%

)

LDLR

(%)

0

50

100

150

0

100

250

200

B C

*

*150

50

Control Pio Ang II Ang II+Pio

1230 Sakamoto et al.

lipotoxicity may decrease endothelial NO synthase (eNOS) gene expression and eNOS catalytic activity, which leads to vascular endothelial cell dysfunction, by several key mechanisms, including inflammation and oxidative stress as well as insulin resistance5). Under an activated renin-angiotensin system, NADPH oxi-dase-mediated superoxide production may reduce NO bioavailability and induce vascular dysfunction25). Our current study demonstrated that in the angiotensin II-infused rat, DHE signals indicating superoxide pro-duction were increased at the site of lipid deposition and were mainly localized in ED-1-positive mono-cytes/macrophages.

Lipids are ligands for the transcriptional regula-tors of PPARs, which belong to the nuclear hormone receptor superfamily5, 26). Under normal conditions, PPARγ is mainly expressed in adipose tissue and regu-lates various functions, including the development of fat cells and their capacity to store lipids27). Because PPARγ plays a pivotal role in adipogenesis, its muta-tion causes a failure of adipogenesis and leads to insu-

angiotensin II, was also inhibited by pioglitazone. These findings collectively suggest that the improvement in exacerbated lipid homeostasis and enhanced oxidative stress may be due to a vasculoprotective property of pioglitazone in the activated renin-angiotensin system.

Accumulation of fat around blood vessels, i.e., perivascular fat, may impair vascular function, both directly via lipotoxicity and indirectly via cytokine secretion21). Yudkin et al. reported that perivascular adipocytes may act as an integrated organ responsible for paracrine and vasocrine signaling, which in turn would affect insulin resistance22). It has been shown that, because perivascular adipose tissue has chemotac-tic properties through the secretion of several chemo-kines that aggravate inflammation, perivascular fat may impair endothelial function23). Insulin has important vascular actions, such as stimulating the production of nitric oxide (NO) from the endothelium leading to vasodilation, which strongly suggests that a reciprocal association exists between insulin resistance in the vas-culature and endothelial dysfunction24). Furthermore,

Fig.6. Western blot analysis of fatty acid synthase (FAS), sterol regulatory element-binding proteins (SREBP)-1c, AMP-activated protein kinase α (AMPK), phosphorylated (activated) AMPKα (p-AMPK), acetyl-CoA carboxylase (ACC), and phosphory-lated (inactivated) ACC (p-ACC). A. Representative western blots. The white lines represent the connection point of band images. B, C, D, E, F, G. Respective protein expression in treated rats relative to control rats. Data represent the mean±SEM of data from five to eight rats in each group. Abbreviations are the same as in Fig. 1.#p＜0.05 versus untreated control.＊p＜0.005 versus untreated control.＊＊p＜0.001 versus untreated control.

ACC

p-ACC

p-AMPK(Thr172)

AMPK

-Actin

Control Pio Ang II Ang II+Pio

A

AC

C (%

)A

MP

K (%

)

0

50

100

150

0

50

100

150

**** **

##

C

F

p-A

CC

(%)

p-A

MP

K (%

)

0

50

100

150

0

50

100

200

150

* *

*#

G

D

SREBP-1c

FAS

FAS

(%)

0

50

100

200

B

SR

EB

P-1

c (%

)

0

50

100

150

E#

150

#

#

1231Pioglitazone and Lipid Accumulation

acid metabolism-related genes, such as SREBP-1c and FAS and the phosphorylated forms of AMPKα and ACC. In some cases, it rather changed the expression to exacerbate lipid deposition. This finding may be, at least in part, compatible with the previous report that PPARα and PPARβ/δ, but not PPARγ, favorably modulate the expression of genes associated with car-diac fatty acid metabolism33).

On the other hand, we demonstrated that the upregulation of the LDL receptor and downregulation of PCSK9 induced by angiotensin II were both atten-uated by pioglitazone treatment. PCSK9, which is pri-marily synthesized by the liver and intestine, is a cru-cial protein in LDL cholesterol metabolism34). PCSK9 promotes degradation of the LDL receptor and pre-vents it from recycling to the membrane. Chan et al. demonstrated that anti-PCSK9 antibody increased LDL receptor protein levels both in HepG2 cells and in the liver of wild-type mice35). Duan et al. reported that pioglitazone increased PCSK9 protein expression in the liver of wild-type mice, although it also increased hepatic LDL receptor protein expression36). In con-trast, it has been shown that hepatic protein expres-sion, but not mRNA expression, of the LDL receptor is significantly inhibited by pioglitazone in obese dia-betic mice37). Although not statistically significant, the expression of PCSK9 was borderline increased by the administration of pioglitazone alone in the current study; in addition, angiotensin II-induced downregu-

lin resistance28). Medina-Gomez et al. reported that the ablation of PPARγ-2 in the ob/ob background resulted in decreased fat volume, severe insulin resis-tance, β-cell dysfunction, and dyslipidemia29). It has been suggested that PPARγ prevents lipotoxicity by several mechanisms, such as promoting adipose tissue expansion, increasing the lipid-buffering capacity of peripheral organs, and facilitating the adaptive prolif-erative response of β-cells to insulin resistance. Fur-thermore, Gumieniczek et al. showed that pioglitazone ameliorated oxidative stress in diabetic rabbits30). Recently, the effects of pioglitazone on the renin-angio-tensin system and lipid metabolism have been demon-strated in clinical researches as well as in animal exper-iments. Saiki et al. reported that pioglitazone sup-pressed the plasma concentrations of angiotensin II, a marker of adipocyte renin-angiotensin system, in patients with type 2 diabetes31). Yoshii et al. showed that in patients with type 2 diabetes, pioglitazone sig-nificantly improved not only glycemic control but also lipid profiles, including serum levels of LDL-choles-terol and high-density lipoprotein (HDL)-cholesterol, while the cumulative incidence of primary cardiovas-cular events did not differ according to the treatment with or without pioglitazone during the 2-year study period32). In the current study, although pioglitazone treatment significantly reduced vascular lipid accumu-lation and superoxide production induced by angio-tensin II, it did not alter the expression of several fatty

Fig.7. Real-time reverse transcription-polymerase chain reaction (RT-PCR) analysis of the mRNA levels of the low-density lipo-protein receptor (LDLR) (A), fatty acid synthase (FAS) (B), sterol regulatory element-binding proteins (SREBP)-1c (C), and peroxisome proliferator-activated receptor (PPAR)-γ (D). Data represent the mean±SEM of data from nine to ten rats in each group. Abbreviations are the same as in Fig. 1.#p＜0.05 versus untreated control.##p＜0.01 versus untreated control.＊p＜0.005 versus untreated control.

* *

LDLR

(%)

0

400

700

1000

A

900

600

200100

800

500

300 FAS

(%)

0

50

100

250

B

200

150

SR

EB

P-1

c (%

)

0

50

100

150

C250

200

PPA

R-

(%)

0

50

100

150

D200

##

#

1232 Sakamoto et al.

stress by pioglitazone may be related to a vasculopro-tective effect during the activation of the renin-angio-tensin system.

Acknowledgement

The work was supported in part by a grant from Okinaka Memorial Institute for Medical Research and a Grant-in-Aid for Young Scientists (B) Grant Num-ber 26860543 from the Japan Society for the Promo-tion of Science (JSPS).

Disclosures

Issei Komuro received honoraria or research funds from Daiichi Sankyo Company Limited, Takeda Phar-maceutical Company Limited, Mitsubishi Tanabe Pharma Corporation, Astellas Pharma Inc, Bristol-Myers Squibb Company, and Nippon Boehringer Ingelheim Co., Ltd., independently of the current study.

References

1) Isa SA, Ruffino JS, Ahluwalia M, Thomas AW, Morris K, Webb R: M2 macrophages exhibit higher sensitivity to oxLDL-induced lipotoxicity than other monocyte/macro-phage subtypes. Lipids Health Dis, 2011; 10: 229

2) Despres JP, Lemieux I: Abdominal obesity and metabolic syndrome. Nature, 2006; 444: 881-887

3) Fox CS, Massaro JM, Hoffmann U, Pou KM, Maurovich-Horvat P, Liu CY, Vasan RS, Murabito JM, Meigs JB, Cupples LA, D’Agostino RB, Sr., O’Donnell CJ: Abdom-inal visceral and subcutaneous adipose tissue compart-ments: association with metabolic risk factors in the Fram-ingham Heart Study. Circulation, 2007; 116: 39-48

4) Lim S, and Meigs JB: Ectopic fat and cardiometabolic and vascular risk. Int J Cardiol, 2013; 169: 166-176

5) Wende AR, Symons JD, Abel ED: Mechanisms of lipo-toxicity in the cardiovascular system. Curr Hypertens Rep, 2012; 14: 517-531

6) Symons JD, Abel ED: Lipotoxicity contributes to endo-thelial dysfunction: a focus on the contribution from ceramide. Rev Endocr Metab Disord, 2013; 14: 59-68

7) Patel VB, Bodiga S, Basu R, Das SK, Wang W, Wang Z, Lo J, Grant MB, Zhong J, Kassiri Z, Oudit GY: Loss of angiotensin-converting enzyme-2 exacerbates diabetic car-diovascular complications and leads to systolic and vascu-lar dysfunction: a critical role of the angiotensin II/AT1 receptor axis. Circ Res, 2012; 110: 1322-1335

8) Ishizaka N, Saito K, Mori I, Matsuzaki G, Ohno M, Nagai R: Iron chelation suppresses ferritin upregulation and attenuates vascular dysfunction in the aorta of angiotensin II-infused rats. Arterioscler Thromb Vasc Biol, 2005; 25: 2282-2288

9) Hongo M, Ishizaka N, Furuta K, Yahagi N, Saito K, Sak-urai R, Matsuzaki G, Koike K, Nagai R: Administration

lated PCSK9 expression was restored by concomitant treatment with pioglitazone. Recently, the accumula-tion of both cholesterol and fatty acid has been sug-gested to be associated with lipotoxicity in pancreatic β-cells38). Together with these previous observations, present results may suggest that the modulation of genes related to cholesterol metabolism by PPARγ activation may underlie to some extent the ameliora-tion of vascular lipotoxicity.

In the current study, angiotensin II infusion sig-nificantly reduced the expression of the phosphory-lated forms of AMPKα and ACC. We previously dem-onstrated that the phosphorylated form of AMPKα was also decreased by angiotensin II in the rat liver39). However, angiotensin II upregulated the cardiac and renal expression of phosphorylated AMPKα and ACC14, 15). Kim et al. reported that, in vascular smooth muscle cells of spontaneously hypertensive rats, angio-tensin II inhibited the activation of AMPKα40). Tak-ing these observations together, we propose the hypoth-esis that vascular tissue may be, at least in part, an organ that provides the capacity to store excess lipids to protect other organs, such as the heart and kidney, against damage from lipotoxicity in a state of aggra-vated lipid homeostasis. Additionally, although not sta-tistically significant, pioglitazone decreased the expres-sion of phosphorylated AMPKα in the current study. We previously reported that the phosphorylated form of AMPKα was increased by pioglitazone in the rat heart and kidney, although there was no statistical sig-nificance in the rat heart14, 15). Boyle et al. found that rosiglitazone significantly upregulated the expression of the phosphorylated form of AMPKα in human aortic endothelial cells41). As it has been widely recog-nized that thiazolidinediones activate AMPK in vari-ous organs, our current finding seems to contradict previous reports. However, in our current study, the expression ratio of phosphorylated AMPKα to total AMPKα was increased by pioglitazone treatment irre-spective of the presence or absence of angiotensin II as compared with untreated control, indicating that pio-glitazone may promote the activation of AMPKα. Although pioglitazone suppressed the expression of total AMPKα in the current study, this point is a sub-ject for future investigation to elucidate the role of pioglitazone in the amelioration of vascular lipotoxic-ity.

In summary, pioglitazone treatment reduced vas-cular lipid accumulation induced by angiotensin II, an effect that was not accompanied by favorable modula-tion of the expression of fatty acid metabolism-related genes. The current findings suggest that the ameliora-tion of vascular lipotoxicity and aggravated oxidative

1233Pioglitazone and Lipid Accumulation

ing from perivascular fat: a mechanism linking insulin resistance to vascular disease. Lancet, 2005; 365: 1817-1820

23) Henrichot E, Juge-Aubry CE, Pernin A, Pache JC, Velebit V, Dayer JM, Meda P, Chizzolini C, Meier CA: Produc-tion of chemokines by perivascular adipose tissue: a role in the pathogenesis of atherosclerosis ? Arterioscler Thromb Vasc Biol, 2005; 25: 2594-2599

24) Kim JA, Montagnani M, Koh KK, Quon MJ: Reciprocal relationships between insulin resistance and endothelial dysfunction: molecular and pathophysiological mecha-nisms. Circulation, 2006; 113: 1888-1904

25) De Batista PR, Palacios R, Martin A, Hernanz R, Medici CT, Silva MA, Rossi EM, Aguado A, Vassallo DV, Salaices M, Alonso MJ: Toll-like receptor 4 upregulation by angio-tensin II contributes to hypertension and vascular dys-function through reactive oxygen species production. PLoS One, 2014; 9: e104020

26) Kume S, Uzu T, Isshiki K, Koya D: Peroxisome prolifera-tor-activated receptors in diabetic nephropathy. PPAR Res, 2008; 2008: 879523

27) Medina-Go mez G, Gray S, Vidal-Puig A: Adipogenesis and lipotoxicity: role of peroxisome proliferator-activated receptor gamma (PPARgamma) and PPARgammacoacti-vator-1 (PGC1). Public Health Nutr, 2007; 10: 1132-1137

28) Arunachalam S, Tirupathi Pichiah PB, Achiraman S: Doxo-rubicin treatment inhibits PPARgamma and may induce lipotoxicity by mimicking a type 2 diabetes-like condition in rodent models. FEBS Lett, 2013; 587: 105-110

29) Medina-Gomez G, Gray SL, Yetukuri L, Shimomura K, Virtue S, Campbell M, Curtis RK, Jimenez-Linan M, Blount M, Yeo GS, Lopez M, Seppanen-Laakso T, Ashcroft FM, Oresic M, Vidal-Puig A: PPAR gamma 2 prevents lipotoxicity by controlling adipose tissue expandability and peripheral lipid metabolism. PLoS Genet, 2007; 3: e64

30) Gumieniczek A, Hopkala H, Zabek A: Protective effects of a PPARgamma agonist pioglitazone on anti-oxidative system in testis of diabetic rabbits. Pharmazie, 2008; 63: 377-378

31) Saiki A, Ohira M, Endo K, Koide N, Oyama T, Murano T, Miyashita Y, Shirai K: Pioglitazone decreases plasma angiotensin II concentration in type 2 diabetes. J Athero-scler Thromb, 2010; 17: 651-657

32) Yoshii H, Onuma T, Yamazaki T, Watada H, Matsuhisa M, Matsumoto M, Kitagawa K, Kitakaze M, Yamasaki Y, Kawamori R, Group P-JS: Effects of pioglitazone on mac-rovascular events in patients with type 2 diabetes mellitus at high risk of stroke: the PROFIT-J study. J Atheroscler Thromb, 2014; 21: 563-573

33) Gilde AJ, van der Lee KA, Willemsen PH, Chinetti G, van der Leij FR, van der Vusse GJ, Staels B, van Bilsen M: Peroxisome proliferator-activated receptor (PPAR) alpha and PPARbeta/delta, but not PPARgamma, modulate the expression of genes involved in cardiac lipid metabolism. Circ Res, 2003; 92: 518-524

34) Lambert G, Sjouke B, Choque B, Kastelein JJ, Hovingh GK: The PCSK9 decade. J Lipid Res, 2012; 53: 2515-2524

35) Chan JC, Piper DE, Cao Q, Liu D, King C, Wang W,

of angiotensin II, but not catecholamines, induces accu-mulation of lipids in the rat heart. Eur J Pharmacol, 2009; 604: 87-92

10) Saito K, Ishizaka N, Hara M, Matsuzaki G, Sata M, Mori I, Ohno M, Nagai R: Lipid accumulation and transform-ing growth factor-beta upregulation in the kidneys of rats administered angiotensin II. Hypertension, 2005; 46: 1180-1185

11) Panchapak esan U, Chen XM, Pollock CA: Drug insight: thiazolidinediones and diabetic nephropathy--relevance to renoprotection. Nat Clin Pract Nephrol, 2005; 1: 33-43

12) Nemoto S, Razeghi P, Ishiyama M, De Freitas G, Taegt-meyer H, Carabello BA: PPAR-gamma agonist rosigli-tazone ameliorates ventricular dysfunction in experimen-tal chronic mitral regurgitation. Am J Physiol Heart Circ Physiol, 2005; 288: H77-82

13) Yamasaki Y, Katakami N, Furukado S, Kitagawa K, Nagat-suka K, Kashiwagi A, Daida H, Kawamori R, Kaku K: Long-term effects of pioglitazone on carotid atherosclero-sis in Japanese patients with type 2 diabetes without a recent history of macrovascular morbidity. J Atheroscler Thromb, 2010; 17: 1132-1140

14) Sakamoto A, Hongo M, Furuta K, Saito K, Nagai R, Ishizaka N: Pioglitazone ameliorates systolic and diastolic cardiac dysfunction in rat model of angiotensin II-induced hypertension. Int J Cardiol, 2013; 167: 409-415

15) Sakamoto A, Hongo M, Saito K, Nagai R, Ishizaka N: Reduction of renal lipid content and proteinuria by a PPAR-gamma agonist in a rat model of angiotensin II-induced hypertension. Eur J Pharmacol, 2012; 682: 131-136

16) Ishizaka N, de Leon H, Laursen JB, Fukui T, Wilcox JN, De Keulenaer G, Griendling KK, Alexander RW: Angio-tensin II-induced hypertension increases heme oxygen-ase-1 expression in rat aorta. Circulation, 1997; 96: 1923-1929

17) Ishizaka N, Matsuzaki G, Saito K, Noiri E, Mori I, Nagai R: Expression and localization of PDGF-B, PDGF-D, and PDGF receptor in the kidney of angiotensin II-infused rat. Lab Invest, 2006; 86: 1285-1292

18) Saito K, Ishizaka N, Aizawa T, Sata M, Iso ON, Noiri E, Ohno M, Nagai R: Role of aberrant iron homeostasis in the upregulation of transforming growth factor-beta1 in the kidney of angiotensin II-induced hypertensive rats. Hypertens Res, 2004; 27: 599-607

19) Ishizaka N, Aizawa T, Yamazaki I, Usui S, Mori I, Kuro-kawa K, Tang SS, Ingelfinger JR, Ohno M, Nagai R: Abnormal iron deposition in renal cells in the rat with chronic angiotensin II administration. Lab Invest, 2002; 82: 87-96

20) Aizawa T, Ishizaka N, Taguchi J, Nagai R, Mori I, Tang SS, Ingelfinger JR, Ohno M: Heme oxygenase-1 is upreg-ulated in the kidney of angiotensin II-induced hyperten-sive rats: possible role in renoprotection. Hypertension, 2000; 35: 800-806

21) Montani JP, Carroll JF, Dwyer TM, Antic V, Yang Z, Dulloo AG: Ectopic fat storage in heart, blood vessels and kidneys in the pathogenesis of cardiovascular diseases. Int J Obes Relat Metab Disord, 2004; 28 Suppl 4: S58-65

22) Yudkin JS, Eringa E, Stehouwer CD: “Vasocrine” signal-

1234 Sakamoto et al.

38) Ishikawa M, Iwasaki Y, Yatoh S, Kato T, Kumadaki S, Inoue N, Yamamoto T, Matsuzaka T, Nakagawa Y, Yahagi N, Kobayashi K, Takahashi A, Yamada N, Shimano H: Cholesterol accumulation and diabetes in pancreatic beta-cell-specific SREBP-2 transgenic mice: a new model for lipotoxicity. J Lipid Res, 2008; 49: 2524-2534

39) Ishizaka N, Hongo M, Sakamoto A, Saito K, Furuta K, Koike K: Liver lipid content is reduced in rat given 7-day administration of angiotensin II. J Renin Angiotensin Aldosterone Syst, 2011; 12: 462-468

40) Kim HY, Cha HJ, Kim HS: CCL5 upregulates activation of AMP-activated protein kinases in vascular smooth muscle cells of spontaneously hypertensive rats. Cytokine, 2014; 67: 77-84

41) Boyle JG, Logan PJ, Ewart MA, Reihill JA, Ritchie SA, Connell JM, Cleland SJ, Salt IP: Rosiglitazone stimulates nitric oxide synthesis in human aortic endothelial cells via AMP-activated protein kinase. J Biol Chem, 2008; 283: 11210-11217

Tang J, Liu Q, Higbee J, Xia Z, Di Y, Shetterly S, Arimura Z, Salomonis H, Romanow WG, Thibault ST, Zhang R, Cao P, Yang XP, Yu T, Lu M, Retter MW, Kwon G, Henne K, Pan O, Tsai MM, Fuchslocher B, Yang E, Zhou L, Lee KJ, Daris M, Sheng J, Wang Y, Shen WD, Yeh WC, Emery M, Walker NP, Shan B, Schwarz M, Jackson SM: A proprotein convertase subtilisin/kexin type 9 neutralizing antibody reduces serum cholesterol in mice and nonhuman primates. Proc Natl Acad Sci U S A, 2009; 106: 9820-9825

36) Duan Y, Chen Y, Hu W, Li X, Yang X, Zhou X, Yin Z, Kong D, Yao Z, Hajjar DP, Liu L, Liu Q, Han J: Peroxi-some Proliferator-activated receptor gamma activation by ligands and dephosphorylation induces proprotein con-vertase subtilisin kexin type 9 and low density lipoprotein receptor expression. J Biol Chem, 2012; 287: 23667-23677

37) Peng J, Huan Y, Jiang Q, Sun SJ, Jia CM, Shen ZF: Effects and Potential Mechanisms of Pioglitazone on Lipid Metabolism in Obese Diabetic KKAy Mice. PPAR Res, 2014; 2014: 538183