PIN1MaintainsRedoxBalanceviathec-Myc/NRF2 Axis to ...carcinoma (PDAC). PIN1 is a key effector...

Molecular Cell Biology

PIN1Maintains RedoxBalance via the c-Myc/NRF2Axis to Counteract Kras-Induced MitochondrialRespiratory Injury in Pancreatic Cancer CellsChen Liang1,2,3,4, Si Shi1,2,3,4, Mingyang Liu5, Yi Qin1,2,3,4, Qingcai Meng1,2,3,4,Jie Hua1,2,3,4, Shunrong Ji1,2,3,4, Yuqing Zhang5, Jingxuan Yang5, Jin Xu1,2,3,4,Quanxing Ni1,2,3,4, Min Li5, and Xianjun Yu1,2,3,4

Abstract

Kras is a decisive oncogene in pancreatic ductal adeno-carcinoma (PDAC). PIN1 is a key effector involved in theKras/ERK axis, synergistically mediating various cellularevents. However, the underlying mechanism by which PIN1promotes the development of PDAC remains unclear. Herewe sought to elucidate the effect of PIN1 on redox homeo-stasis in Kras-driven PDAC. PIN1 was prevalently upregu-lated in PDAC and predicted the prognosis of the disease,especially Kras-mutant PDAC. Downregulation of PIN1inhibited PDAC cell growth and promoted apoptosis, par-tially due to mitochondrial dysfunction. Silencing of PIN1damaged basal mitochondrial function by significantlyincreasing intracellular ROS. Furthermore, PIN1 maintained

redox balance via synergistic activation of c-Myc and NRF2to upregulate expression of antioxidant response elementdriven genes in PDAC cells. This study elucidates a newmechanism by which Kras/ERK/NRF2 promotes tumorgrowth and identifies PIN1 as a decisive target in therapeuticstrategies aimed at disturbing the redox balance in pancre-atic cancer.

Significance: This study suggests that antioxidation pro-tects Kras-mutant pancreatic cancer cells from oxidativeinjury, which may contribute to development of a targetedtherapeutic strategy for Kras-driven PDAC by impairingredox homeostasis.

IntroductionPancreatic cancer is one of the most lethal malignancies,

with an overall 5-year survival rate of less than 8% (1).Pancreatic ductal adenocarcinoma (PDAC) is the majorhistologic type, accounting for >95% of human pancreaticneoplasms (2). Notably, oncogenic Kras mutations occurearly in PDAC carcinogenesis and are observed in morethan 90% of PDAC cases (3). Hence, there is an urgentneed to explore the underlying mechanism and downstreameffectors of the constitutive activation of the Kras proto-

oncogene, which would contribute to the development of analternative therapy for refractory pancreatic cancer.

Oncogenic Kras drives downstream activation of the ERKsignaling pathway, which promotes proliferation, metabolicreprogramming and metastasis, and prevents from apoptosis(4–7). Accumulated evidence has demonstrated thatmetabolic reprogramming is an emerging hallmark of can-cer (8). Our previous findings indicated that ERK kinasemodulates F-box and WD repeat domain-containing 7(FBW7) ubiquitination in a T205 phosphorylation-dependentmanner, and FBW7 is a negative regulator of mitochondrialrespiration in pancreatic cancer cells, thereby revealing animportant function of Kras/ERK/FBW7 axis in promotingPDAC progression (7, 9). However, the mechanism underly-ing the impact of ERK/FBW7 on mitochondrial metabolismremains unclear.

Protein interactingwithnever inmitosis A1 (PIN1) is amemberof the parvulin subfamily of peptidyl prolyl cis/trans isomerases(PPIases; ref. 10), which specifically isomerize the Ser/Thr-Propeptide bonds of proteins after phosphorylation to regulate theirconformational changes with high efficiency (11, 12). The PIN1-mediated isomerization alters the structures and activities of theseproteins; PIN1 is thereby involved in diverse physiologic andpathologic processes (13). Proline-directed phosphorylation is aposttranslational modification that is instrumental in regulatingsignaling from the plasma membrane to the nucleus, the dysre-gulation of which contributes to cancer development (14). ERKis a proline-directed protein kinase, and proline exhibits twoconformations, cis and trans (12, 15). PIN1 catalyzes the isomer-ization of ERK-phosphorylating substrates to activate them,

1Department of Pancreatic Surgery, Fudan University Shanghai Cancer Center,Shanghai, China. 2Department of Oncology, Shanghai Medical College, FudanUniversity, Shanghai, China. 3Shanghai Pancreatic Cancer Institute, Shanghai,China. 4Pancreatic Cancer Institute, Fudan University, Shanghai, China. 5Depart-ment of Medicine, Department of Surgery, the University of Oklahoma HealthSciences Center, Oklahoma City, Oklahoma.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

C. Liang, S. Shi, M. Liu, and Y. Qin contributed equally to this article.

Corresponding Authors: Min Li, The University of Oklahoma Health SciencesCenter, 975 NE 10th Street, BRC 1262A, Oklahoma City, OK 73104. Phone: 405-271-1796; Fax: 405-271-1476; E-mail: [email protected]; and Xianjun Yu, Pan-creatic Cancer Institute, Fudan University, 270DongAn Road, Shanghai 200032,P.R. China. Phone: 86-021-64175590, ext. 1307; Fax: 86-021-64031446; E-mail:[email protected]

doi: 10.1158/0008-5472.CAN-18-1968

�2018 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 133

on January 1, 2021. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst October 24, 2018; DOI: 10.1158/0008-5472.CAN-18-1968

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-18-1968&domain=pdf&date_stamp=2018-12-28

[email protected]

http://cancerres.aacrjournals.org/

synergistically mediating various cellular consequences (16–18).Because we previously demonstrated that ERK kinase modulatesFBW7 phosphorylation in a PIN1-dependent manner (7), weexamined the effect of PIN1 on cancer metabolism.

Nuclear factor E2-related factor 2 (NRF2) is a leucine zippertranscription factor and plays an important role in the mainte-nance of redox homeostasis. When subjected to oxidative stress,NRF2 is stabilized, accumulated, and translocates to the nucleus,where it binds to a specific DNA sequence, referred to as theantioxidant response element (ARE), and induces the expressionof a cohort of cytoprotective enzyme genes (19, 20).NRF2 and theARE-driven genes it controls are frequently upregulated in PDACand correlate with poor survival. Upregulation of NRF2 is, at leastin part, Kras-driven and contributes to proliferation and chemore-sistance in PDAC (21, 22).

Here, we show that PIN1 is prevalently upregulated in pancre-atic cancer and predicts prognosis. Given the oncogenic effect ofPIN1 on pancreatic tumorigenesis, we demonstrate that PIN1protects the basal mitochondrial function from Kras/ERK-induced oxidative injury and maintains the redox balance inPDAC by increasing the expression of ARE-driven genes. Ourstudy identifies PIN1 as a decisive regulator of redox homeostasisfor cell survival via cooperation with the c-Myc/NRF2/ARE axis,thereby highlighting PIN1 as an important target for the treatmentof Kras-driven pancreatic cancer.

Materials and MethodsHuman tissues and cell culture

The clinical tissue samples used in this study were obtainedfrom patients who were diagnosed at Fudan University ShanghaiCancer Center in the year of 2012. Written informed consent wasobtained from the patients and the studies were approved by theInstitutional Research Ethics Committee of Fudan UniversityShanghai Cancer Center. The clinical information for the samplesis presented in Supplementary Table S1. The pathologic gradingwas performed by two independent pathologists at our center.

The PANC-1, MiaPaCa-2, CFPAC-1, Capan-1, and SW1990human pancreatic cancer cell lines were purchased from ATCCin 2012 andwere cultured at 37�C in a humidified incubator with5%CO2. The cell lines were authenticated by short tandem repeatprofiling in 2016 and were tested for Mycoplasma contaminationwith PCR-based method every 3 months. Cells used for theexperimental study were passaged within 10 to 15 passages afterreviving from the frozen vials.

PlasmidspLKO.1 TRC cloning vector (Addgene plasmid 10878)was used

togenerate shRNAconstructs againstPIN1andc-Myc. 21bp targetsagainst PIN1 were GCCATTTGAAGACGCCTCGTT and AGGA-GAAGATCACCCGGACCA, respectively. 21-bp targets againstc-MycwereCCTGAGACAGATCAGCAACAAandCAGTTGAAACA-CAAACTTGAA, respectively. pCMV-C-FLAG vector obtained fromthe manufacturer was used to generate the PIN1(W34/K63A)dominant negative mutant, designated as PIN1MUT, to examinethe interaction with c-Myc. To generate PIN1WT and PIN1MUT

stably overexpressing cells, HA-tagged PIN1WT and PIN1MUT werecloned into a pCDH-CMV-MCS-EF1 vector (System Biosciences).

qPCR analysisTotal RNA was extracted with TRIzol reagent (Invitrogen),

purified using the PureLink RNAMinikit (Life Technologies), and

assessed for quality andquantity using absorptionmeasurements.The expression of candidate genes and b-actin was determined byquantitative real-time PCR, according to the standard proceduresdescribed previously (9). RNA was used for analysis of HumanOxidative Stress using pathway-focused RT-PCR array systems(The Human Oxidative Stress RT2 Profiler PCR Array; PAHS-065ZA; Qiagen). Comparative data analysis was performed viathe DDCt method using the PCR Array Data analysis web portal(http://gncpro.sabiosciences.com/gncpro/gncpro.php) to deter-mine relative expression differences between the comparisongroups. All reactions were run in triplicate, and primer sequencesare listed in Supplementary Table S2.

Oxygen consumption rate analysisCellular mitochondrial function was determined using the

Seahorse XF Cell Mito stress test kit per the manufacturer'sinstructions, as described previously (9). Briefly, cells were seededinto 96-well plates and incubated overnight. After washing thecells with Seahorse buffer, 175 mL of Seahorse buffer plus 25 mLeach of 1 mmol/L oligomycin, 1 mmol/L FCCP [carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone], and 1 mmol/L rotenonewas automatically injected to measure the OCR. The OCR valueswere calculated after normalization to the cell number and areplotted as the mean � SD.

Reactive oxygen species evaluationOne hour before the end of the experimental time, cells were

incubated with 50 mmol/L 20,70-dichlorodihydrofluoresceindiacetate (H2DCF-DA) within a Reactive Oxygen Species AssayKit (Beyotime) at 37�C. Cells were then washed, resuspended inice-cold PBS, and collected. The fluorescence intensities of DCF,formed by the reaction of DCF with ROS, were monitored withan excitation wavelength at 488 nm and emission wavelengthat 530 nm.

Analysis of the intracellular reduced glutathione/oxidizedglutathione ratio and NADPþ/NADPH ratio

The intracellular glutathione/oxidized glutathione (GSH/GSSG) ratio was determined using Abcam's GSH/GSSG RatioDetection Assay Kit. The NADPþ/NADPH ratio was determinedusing Abcam NADPþ/NADPH Assay Kit. The assays were per-formed to examine the oxidative status of the pancreatic cancercells, according to the manufacturer's instructions.

Chromatin immunoprecipitation assayChromatin immunoprecipitation (ChIP) was performed

according to the instructions of the Magna ChIP A/G Chro-matin Immunoprecipitation Kit (Merck Millipore Corporation;ref. 23). The nuclear DNA extracts were amplified using a pairof primers (Supplementary Table S3) that spanned the NRF2 orHMOX1 promoter region. As a negative control, the primaryantibody was omitted or replaced with normal rabbit or mouseserum. To verify whether PIN1 and c-Myc or NRF2 simulta-neously occupy the same region on the NRF2 or HMOX1promoter, the re-ChIP assay was performed. In brief, after thestandard ChIP process, the beads were incubated with equalvolumes of 10 mmol/L DTT for 30 minutes at 37�C to elute thechromatin from the beads. The eluent was then diluted withsonication buffer, followed by a second round of the ChIPreaction.

Liang et al.

Cancer Res; 79(1) January 1, 2019 Cancer Research134



http://gncpro.sabiosciences.com/gncpro/gncpro.php


Animal modelsBALB/c-nu mice (4–6 weeks of age, 18–20 g, Shanghai SLAC

Laboratory Animal Co., Ltd.) were housed in sterile, filter-cappedcages. The right flanks of mice were injected subcutaneously with2 � 106 SW1990 cells with stably expressing sh-PIN1 and scram-ble shRNA in 100 mL PBS. The size of xenograft was determinedtwice a week by measuring tumor length and width with calipers.Tumor volumes were determined using the formula volume ¼length � width2/2. At the indicated time, the tumors were surgi-cally dissected. Samples were then processed for histopathologicexamination. All animal experiments were performed accordingto the guidelines for the care and use of laboratory animals andwere approved by the Institutional Animal Care and Use Com-mittee of Fudan University.

Statistical analysisAll data are presented as the mean � SD. Experiments were

repeated at least three times. Two-tailed unpaired Student t tests orone-way ANOVA were used to evaluate the data. Spearman corre-lation analysis was used to determine the correlation between theNRF2 and PIN1 expression levels. Fisher exact test was used todetermine the correlation between PIN1 and the clinicopathologiccharacteristics. SPSS software (version 17.0, IBM Corp.) was usedfor the data analysis. Statistical differences were considered signif-icant at �, P < 0.05; ��, P < 0.01, and ��, P < 0.001.

ResultsPIN1 is prevalently upregulated and predicts poor prognosis inPDAC

To investigate the role of PIN1 in PDAC progression, we firstused hematoxylin-eosin and IHC staining to examine PIN1expression in 10 paired PDAC and adjacent normal tissues (Fig.1A). PIN1 was highly upregulated in primary PDAC comparedwith the corresponding adjacent benign tissues (Fig. 1A). Theprevalent upregulation of PIN1 expression was revealed by IHCstaining of a tissue microarray of the PDAC samples (Fig. 1B andC). Seventy-one (64.54%) of the 110 PDAC samples showedabundant PIN1, while the remaining 39 samples (35.46%) hadlow PIN1 expression (Fig. 1C).

Next, the analysis of the clinical characteristics andpathology ofthe PDAC revealed that higher expression of PIN1 in PDAC wassignificantly associated with tumor size (P¼ 0.0249; Supplemen-tary Table S1). To determine whether the predictive effect of PIN1on survival depended on the Kras mutation, we examined 70patients with PDAC to perform Kras mutation testing. We foundthat 80% of the patients harbored the mutant Kras (Supplemen-tary Table S4), and we further stratified the cohort into Kraswild-type (KrasWT) and Kras-mutant (KrasMUT) groups. Kaplan–Meier analysis revealed that PIN1was aprognosticmarker inKras-mutant PDAC, but not in KrasWT PDAC (Fig. 1D). However, therewas no significant correlation between Kras-mutant status andPIN1 level (Supplementary Table S4).Next,weperformed IHC forERK phosphorylation (p-ERK), and found that the effect of PIN1level on survival depended on ERK activation (Fig. 1E). Likewise,IHC analysis revealed a significant correlation of ERK phosphor-ylation levels with PIN1 expression in PDAC tissue (Supplemen-tary Table S5). Moreover, as the univariate and multivariate Coxregression analysis showed, PIN1 was an independent prognosticfactor in PDAC, where increased PIN1 expression was predictiveof a short overall survival rate for patients with PDAC (Table 1).

PIN1 supports the growth of pancreatic cancer in vitro andin vivo

Considering the vital clinical significance of PIN1 in PDAC, weinvestigatedwhether PIN1 affected the tumor growth in vitro. First,we determined the expression level of PIN1 in various humanPDAC cell lines with Kras mutations and in normal humanpancreatic ductal epithelial (HPDE) cells. The PIN1 levels wereprevalently upregulated in five human pancreatic cancer cell linesespecially theKras-mutant cell lines (Fig. 1F; Supplementary TableS6), compared with HPDE cells (Fig. 1F). Next, specific shRNAsagainst PIN1were constructed for stable transfection intoCapan-1and SW1990 cells. As shown in Supplementary Fig. S1A, both sh-PIN1-Aand sh-PIN1-B effectively knockeddownPIN1expression.The cell viability and clone formation capacity were significantlyreduced in Capan-1 and SW1990 cells with stable expression ofPIN1 shRNA (Fig. 1G; Supplementary Fig. S1B). A subsequentcell-cycle analysis indicated that knockdown of PIN1 arrested thecell cycle at the S-phase (Supplementary Fig. S1C and S1D).Moreover, knockdown of PIN1 decreased the survivin expression(Supplementary Fig. S1E). Given that high cancer cell prolifera-tion requires sufficient energy, we also demonstrated that PIN1significantly increased ATP production to support the growth ofcancer cells (Supplementary Fig. S1F). Moreover, to determinewhether PIN1 promoted tumor growth in vivo, we subcutaneouslyinjected SW1990 cells into nude mice. As expected, the down-regulation of PIN1 inhibited tumor growth in a xenograft mousemodel (Fig. 1H and I; Supplementary Fig. S1G), which exhibitedfewer Ki-67-positive and survivin-positive cells (Fig. 1J and K).

Downregulation of PIN1 negatively regulated mitochondrialrespiration in pancreatic cancer cells

Because energy metabolism reprogramming is associated withmitochondrial function, we first examined the OCR, an indicatorof the mitochondrial respiration capacity, and showed that theOCRs were decreased in Capan-1 and SW1990 cells with PIN1knockdown (Fig. 2A). Interestingly, the addition of FCCP, amitochondrial uncoupler, did not stimulatemaximal respiration.Instead, FCCP caused respiration to fall below basal levels,indicating that the uncoupled maximal respiratory capacity forATP synthesis was depressed (Fig. 2A). Measurement of themitochondrial potential further demonstrated that downregula-tion of PIN1 damaged mitochondrial function, with decreasedmitochondrial potential in Capan-1 and SW1990 cells (Fig. 2B).Because themitochondrial potential was also an indicator of earlyapoptosis, we examined the role of PIN1 in apoptosis control.Flow cytometric analysis for apoptosis showed that PIN1 was anantiapoptosis molecule; inhibition of PIN1 expression increasedcell apoptosis, especially the percentage of early apoptotic cells(Fig. 2C). Moreover, we also found that knockdown of PIN1decreased the expressionofCOX IVand SIRT3, twomitochondrialproteins (Supplementary Fig. S2).

To further confirm the importance of PIN1 in mitochondrialfunction, we constructed a dominant negative mutant, PIN1MUT,without affecting FBW7 expression (Fig. 2D). Staining of PIN1MUT

and PIN1 wild-type (PIN1WT) cells with MitoTracker Green, amembrane potential–based mitochondrial dye, revealed that themitochondrial network in the PIN1WT cells clustered in the peri-nuclear region, compared with the control cells. However, inacti-vationof PIN1 could induce the appearance of aberrant dot-shapedmitochondria, a more interconnected mitochondrial network, anda decreased perinuclear clustering (Fig. 2E). As the mitochondria

Antioxidative Role of PIN1 in PDAC

www.aacrjournals.org Cancer Res; 79(1) January 1, 2019 135




Figure 1.

PIN1 is upregulated in pancreatic cancer and predicts poor overall survival. A, Representative hematoxylin and eosin (H&E) and IHC images of PIN1 expression in PDACor adjacent normal tissues (left;magnificationscalebar, 100mm). PIN1 expressionwashigher in PDAC tissues than in adjacent normal tissues, asdeterminedby the IHC score(right). B, IHC scoring of PIN1 expression in PDAC patient tissue samples (magnification scale bar, 40 mm). C, The percentage of patients with PDAC with differentlevels of PIN1 examined by IHC. D, Stratification of the cohort according to Kras status showed no predictive effect of PIN1 on prognosis in patients with PDAC withKraswild-type (KrasWT), but high PIN1 expression predicted the poor survival of patientswithKrasmutant (KrasMUT).E, Therewas nopredictive effect for PIN1 onprognosisof patientswithPDACwith low levels ofphosphorylatedERK (p-ERK), but highPIN1 expressionpredicted thepoor survival of patientswithhigh-levelp-ERK.F, Immunoblotanalysis ofPIN1 expression in the indicatedhumanpancreatic cancer cell lines andanHPDEcell line.G,Knockdownof PIN1 inhibitedcell proliferationofCapan-1 andSW1990cells, according to results from the CCK-8 proliferation kit. H, An image of the SW1990 xenografts that were dissected from nude mice. I, At the indicated times, the sizesof the scramble and sh-PIN1 xenograftsweremeasured (mean� SEM; n¼ 6). J, IHC staining of survivin andKi-67 in xenograft tissues to determine the cellular proliferativecapacity.K, IHCstainingof survivinandKi-67 in xenograft tissueswasquantifiedasmean� SD. �� ,P<0.01 versus scramble for xenograftsor xenografts treatedwithvehicle.

Liang et al.





became depolarized, they lost their membrane potential andincorporated less dye into theirmembranes.High intensity stainingwas observed in PIN1WT cells, while the intensity of MitoTrackerGreen was restored in the PIN1MUT cells, indicating repolarizationof mitochondria (Fig. 2E). Furthermore, we used transmissionelectron microscopy (TEM) to observe the ultrastructure of themitochondria in the PIN1WT and PIN1MUT cells. Consistent withthe above results, the PIN1WT cells demonstrated interconnectedmitochondria, although the PIN1MUT cells contained rounded andswollen mitochondria (Fig. 2F and G). To further quantify themitochondrial number, we found that PIN1 was an importantpositive regulator of mitochondrial biogenesis (Fig. 2H).

PIN1 regulates redox balance to affect mitochondrial functionBecause cellular redox homeostasis is important for mainte-

nance of mitochondrial respiratory function (24), we furthervalidated whether PIN1 was an antioxidative molecule that pro-tected basal mitochondrial respiration in Capan-1 and SW1990pancreatic cancer cells. As expected, inhibition of PIN1 expressionsignificantly increased ROS production (Fig. 3A). Moreover,silencing of PIN1 expression decreased the GSH/GSSG ratio andincreased the NADPþ/NADPH ratio (Fig. 3B and C). To investi-gate whether this redox imbalance impaired mitochondrial func-tion, we treated the PIN1 knockdown cells with an antioxidant,NAC, to recover the redox status (Fig. 3D). The results indicatedthat the antioxidant treatment could counteract the unfavorableeffect of the PIN1 knockdown on mitochondrial function, asanalyzed by OCR and JC-1 (Fig. 3E and F). Indeed, the increasedapoptosis induced by PIN1 knockdown could also be counter-acted by treatment with NAC (Fig. 3G).

PIN1 transcriptionally activates NRF2 expression in PDACNext, we performed a PCR array to examine the influence of the

PIN1 knockdown on the expression of antioxidative genes. The

results indicated that ARE-driven genes were significantly down-regulated in PIN1-silenced cells (Fig. 4A and B). AREs are in theregulatory regions of several genes that encode for enzymes thatcontribute to the regulation of antioxidants (21). We cloned theARE sequences into a luciferase vector and cotransfected it with aPIN1 expression vector, showing that ARE activity was increasedin a dose-dependent manner (Fig. 4C). This finding was alsoconfirmed in the Capan-1 and SW1990 cells. PIN1 increased theactivity of ARE (Fig. 4D) and further increased the mRNA andprotein levels of ARE-driven genes (GCLC, GCLM, TXNRD, ME1,and NQO1; Fig. 4E; Supplementary Fig. S3A).

BecauseNRF1 andNRF2 are the important transcription factorsthat are responsible for the expression of ARE-driven genes (24),we examined the influence of PIN1 on NRF1 and NRF2 expres-sion. As shown in Fig. 4F, downregulation of NRF2 was observedupon silencing PIN1 expression in pancreatic cancer cells, but nochange in the expression of NRF1 was observed (SupplementaryFig. S3B). Recently, the NRF2/ARE axis was identified as theoxidative stress response pathway that contributes to pancreaticcarcinogenesis (25). We further confirmed NRF2 mRNA down-regulation in cells with PIN1 knockdown by quantitative PCR(Fig. 4G). An immunofluorescence analysis indicated that theNRF2 decrease was accompanied by PIN1 downregulation inCapan-1 and SW1990 cells (Fig. 4H). IHC staining of serial tissuemicroarray for NRF2 and PIN1 indicated a positive correlationbetween PIN1 and NRF2 in 110 patient samples (Fig. 4I). More-over, we demonstrated that PIN1 increased the promoter activityof NRF2 to upregulate its transcription (Fig. 4J).

PIN1 interacts with c-Myc to bind to the promoter of NRF2To uncover the regulatorymechanism,we predicted the proteins

that interacted with PIN1 using bioinformatics. Several transcrip-tion factors are shown in Fig. 5A (http://mentha.uniroma2.it).Notably, there was one conservative c-Myc–binding site (E-box)

Table 1. Univariate and multivariate Cox regression of overall survival for patients with PDAC

Univariate MultivariateCharacteristics HR 95% CI P HR 95% CI P

Age, y<60 1 0.7070–1.616 0.09967�60 1.069

GenderFemale 1 0.5807 –1.344 0.5649Male 0.886

Tumor size (cm)<4.0 1 1.496 to 3.875 0.0004a 1 1.339–3.208 0.001b

�4.0 2.081 2.073Tumor differentiationWell/Moderate 1 0.9094–2.177 0.127Poor 1.381

Lymph node statusNegative 1 1.418–3.408 0.0005a 1 1.429–3.354 0.000a

Positive 2.028 2.189Vessel infiltrationNegative 1 0.6387–2.026 0.6622Positive 1.131

Nerve infiltrationNegative 1 0.4284–1.261 0.2644Positive 0.7553

PIN1 expressionLow 1 1.382–3.13 0.0005a 1 1.325–3.294 0.002b

High 2.125 2.089

NOTE: Univariate P values were derived with log-rank test. Multivariate P values were derived with Cox regression analysis.aP < 0.001.bP < 0.01.





http://mentha.uniroma2.it


Figure 2.

PIN1 maintains cell survival by protecting mitochondrial function. A, Knockdown of PIN1 decreased the OCR in Capan-1 and SW1990 cells. B, Mitochondrialpotential was analyzed by detecting the JC-1 decrease in Capan-1 and SW1990 cells with the knockdown of PIN1. The decrease in mitochondrial potential wasquantified as mean � SD. �� , P < 0.01. C, Knockdown of PIN1 resulted in apoptosis of Capan-1 and SW1990 cells, which was quantified as the means � theSD. �� , P < 0.01. D, Immunoblot analysis of FBW7 expression in Capan-1 and SW1990 cells infected with the dominant-negative mutant vector of PIN1 (PIN1MUT) toindicate the inactivation of PIN1. The wild-type PIN1 (PIN1WT) was used as a positive control. E, Fluorescence microscopic analysis of a PIN1MUT-induceddeformed mitochondrion stained with MitoTracker Green. F, Transmission electron microscopy analysis of mitochondrial morphology affected byPIN1 in PANC-1 cells. G, Quantification of transmission electron microscopy data as the percentages of swollen mitochondria and interconnected mitochondria.H, Quantification of transmission electron microscopy data as the number of mitochondria per 20 mm2 (�� , P < 0.01 vs. control PANC-1 cells).

Liang et al.





in the NRF2 promoter (Fig. 5B). c-Myc could bind to the NRF2promoter (Fig. 5C), and silencing of Myc inhibited NRF2 expres-sion (Supplementary Fig. S4A–S4C). Thus, we hypothesized thatc-Myc could carry PIN1 to bind to the NRF2 promoter. Asexpected, c-Myc was a PIN1 interaction partner in a coimmuno-

precipitation assay (Fig. 5D). An immunofluorescence analysisshowed that PIN1 and c-Myc were predominantly colocalized inCapan-1 and SW1990 cells (Fig. 5E). Furthermore, PIN1 wasdemonstrated to be enriched at the NRF2 promoter region(Fig. 5F). To confirm whether PIN1 and c-Myc interacted at the

Figure 3.

PIN1 regulates redox balance to affect mitochondrial function in pancreatic cancer. A, Left, analysis of ROS production by flow cytometry in Capan-1 and SW1990cells with knockdown of PIN1. Right, quantification of ROS production is shown as mean � SD. �� , P < 0.01. B, Determination of the GSH/GSSG ratioin Capan-1 and SW1990 cells with knockdown of PIN1. �, P < 0.05; �� , P < 0.01. C, Determination of the NADPþ/NADPH ratio in Capan-1 and SW1990 cells withknockdown of PIN1. � , P < 0.05; �� , P < 0.01. D, Analysis of ROS production in Capan-1 and SW1990 cells with knockdown of PIN1 after treatment with antioxidant,NAC (10 mmol/L). E, Analysis of the OCR in Capan-1 and SW1990 cells with the knockdown of PIN1 after treatment with 10 mmol/L NAC. F, Detection of themitochondrial potential in Capan-1 and SW1990 cells with the knockdown of PIN1 after treatment with NAC. G, Quantification of the mitochondrial potentialin Capan-1 and SW1990 cells with the knockdown of PIN1 after treatment with 10 mmol/L NAC.






Figure 4.

PIN1 transcriptionally activates the NRF2 axis in pancreatic cancer cells. A, PCR array analysis of the effect of PIN1 downregulation on antioxidative geneexpression. B, The volcano plot identified significant gene expression changes from the PCR array data, displaying statistical significance versus fold changeon the y- and x-axes, respectively. C, PIN1 increased ARE luciferase activity in a dose-dependent manner in HEK-293T cells. �� , P < 0.001 versus cellscotransfected with Repo-NC and pCDH-PIN1. D, PIN1 increased ARE luciferase activity in Capan-1 and SW1990 cells. �� , P < 0.01. E, PIN1 affected thetranscription of ARE-driven genes in Capan-1 and SW1990 cells. F, Immunoblot analysis of NRF1 and NRF2 expression in Capan-1 and SW1990 cells withsilencing of PIN1 expression. G, Quantitative PCR was performed to confirm that NRF2 mRNA expression was downregulated by knockdown of PIN1.�� , P < 0.01. H, Immunofluorescence analysis of NRF2 in Capan-1 and SW1990 cells with silencing of PIN1 expression. I, Left, representative images of IHCanalysis of NRF2 and PIN1 expression in PDAC patient samples (magnification scale bar, 40 mm). Right, Spearman analysis of IHC data showed that PIN1 waspositively associated with NRF2 (r ¼ 0.4259). J, PIN1 increased the promoter activity of NRF2. �� , P < 0.01.

Liang et al.





NRF2 promoter chromatin region, we performed a sequential re-ChIP assay and observed that PIN1 and c-Myc occupied the sameregion at the NRF2 promoter (Fig. 5G). PIN1 knockdowndecreased the occupation of c-Myc on the NRF2 promoter (Fig.5H). However, the interaction between PIN1 and c-Myc disap-peared when inactivation of PIN1 resulted from the dominantnegative mutation (Fig. 5I). Luciferase reporter assays indicatedthat PIN1 not only increased the NRF2 promoter activity, but alsoenhanced the positive effect of c-Myc on the NRF2 promoteractivity (Fig. 5J).Moreover, IHCanalysis of xenograft samples alsodemonstrated that PIN1 expression was positively correlatedwith c-Myc and NRF2 expression (Supplementary Fig. S4D).

Next, to investigate the effect of c-Myc on the PIN1-inducedmalignant potential, we silenced Myc in BxPC-3 cells, one wild-type K-ras cell, with overexpressing PIN1, and found that silenced

Myc could decrease the PIN1-induced upregulation of NRF2(Supplementary Fig. S4E and S4F). Furthermore, silenced Mycalso counteracted the PIN1-induced enhancement of prolifera-tion and survival in BxPC-3 cells (Supplementary Fig. S4G andS4H). Moreover, silenced Myc recovered the mitochondrialpotential, OCR, and ROS production in BxPC-3 with PIN1 over-expression (Supplementary Fig. S4I–S4K).

PIN1 promotes nuclear translocation of NRF2 to increase AREactivity

As the immunofluorescence results show (Fig. 5H), silencing ofPIN1 not only decreased the abundance of NRF2, but also likelydecreased NRF2 nuclear translocation in Capan-1 and SW1990cells. Thus, we extracted both cytosolic and nuclear protein frac-tions to examine the effect of PIN1 on the translocation of NRF2.

Figure 5.

PIN1 interacts with c-Myc to bind the promoter of NRF2. A, Bioinformatics predicted the protein interacted with PIN1 protein. B, Schematic representationof the NRF2 promoter regions that contain one E-box, the conservative c-Myc–binding site. C, c-Myc enrichment at the NRF2 promoter wasmeasured using a c-Mycantibody to perform the ChIP assay. D, Coimmunoprecipitation analysis of the interaction between PIN1 and c-Myc in pancreatic cancer cells. E, Doubleimmunofluorescent staining revealed colocalization of the c-Myc and PIN1 proteins in Capan-1 and SW19990 cells. F, PIN1 enrichment at the NRF2 promoterwas measured using a PIN1 antibody to perform the ChIP assay. G, The ChIP and re-ChIP experiments indicated that PIN1 and c-Myc synergistically occupied thesame promoter region on the NRF2 promoter.H,Downregulation of PIN1 decreased the abundance of c-Myc that occupied the NRF2 promoter. I, PIN1MUT-FLAGwastransfected into HEK-293T cells, where it failed to interact with c-Myc. J, PIN1 was involved in the c-Myc-mediated upregulation of the promoter activity ofNRF2. �, P < 0.05; �� , P < 0.01 versus cells cotransfected with pGL3-NRF2 and c-Myc.






As indicated, knockdown of PIN1 decreased the nuclear fractionof NRF2 in the pancreatic cancer cells (Fig. 6A), while PIN1MUT

had a slight effect on NRF2 translocation compared with PIN1WT

(Fig. 6B). A similar result was obtainedwith immunofluorescenceand IHC for NRF2 (Fig. 6C; Supplementary Fig. S5). Thus, wehypothesized that PIN1 might cooperate with NRF2 to enter thenucleus. To confirm this hypothesis, we performed coimmuno-precipitation assays to demonstrate the interaction between PIN1andNRF2 (Fig. 6D) and an immunofluorescence analysis to showthat PIN1 was colocalized with NRF2 in Capan-1 and SW1990cells (Fig. 6E). ChIP assays indicated that PIN1 was also enrichedin theARE region (Fig. 6F). To investigatewhether PIN1 interactedwith NRF2 to bind to the ARE chromatin region, we performed asequential re-ChIP assay and demonstrated that PIN1 and NRF2occupied the same location on the ARE region of the HMOX1promoter (Fig. 6G). Indeed, downregulation of PIN1 significantlydecreased the occupation of NRF2 on the HMOX1 promoter (Fig.6H). The combination of a high level of PIN1 with a high level ofNRF2 might be a good predictor of unfavorable prognosis inhuman patients with PDAC (Fig. 6I).

DiscussionOncogenic Kras mutations are highly prevalent in PDAC

carcinogenesis (3). Constitutive activation of Kras drivesuncontrolled proliferation and enhances the survival of cancercells, primarily through the Ras–Raf–MEK–ERK and PI3K–Akt–mTOR pathways (26–33). In the past few decades, extensiveefforts have been focused on identifying effective moleculartargets for this oncogene (34). However, these efforts havefailed, and Kras is still considered to be an undruggable target.Herein, we identify PIN1 as a decisive gene and a prognosticfactor for Kras-mutant PDAC. Downregulation of PIN1 inhibitscell growth and promotes apoptosis of pancreatic cancer cells,partially due to mitochondrial dysfunction. To decipher theregulatory mechanism underlying the effect of PIN1 on mito-chondrial function, we demonstrated that PIN1 maintained theredox balance via synergistic activation of the c-Myc/NRF2/AREaxis to counteract Kras-induced oxidative injury in Kras-mutantPDAC (Fig. 6J).

It is evident that cancer cells require a sufficient energy supply tofuel Kras-induced proliferation. Thus, Kras-induced metabolicreprogramming is a requirement for uncontrolled proliferationand malignant property maintenance (5, 30, 35). In addition toATP, Oronsky and colleagues noted the requirement of NADPHfor the survival of cancer cells, which made it possible to developstrategies for targeting cancer that involved disrupting the redoxbalance (36). Notably, Kras does not affect the activity of theoxidative arm of the pentose phosphate pathway, which providesNADPH for ROS detoxification (33). Thus, detoxification isheavily dependent on Kras-driven glutamine metabolism (32,37). In the context of PDAC, Kras expression directs the metab-olism of glutamine through a unique pathway to maintain theredox state (32, 38). The normal functions of mitochondria arerequired for glutamine-driven detoxification (39). A previousreport indicated that Kras leads to mitochondrial dysfunction,which is accompanied by an increase in ROS production (30).Paradoxically, despite Kras-induced changes in mitochondrialfunction, no significant cell death was detected (30). Thus, wehypothesizedKras-driven PDAC cells had aprotectivemechanismfrom "respiratory injury" to regulate the redox balance.

As one of isomerases, PIN1 also catalyzes a conformationalmodification of integrase to restrict HIV-1 genome integration(40). Moreover, PIN1 regulated the ATF1 expression at thetranscriptional and posttranscriptional level (41). Previousstudies have shown that PIN1 catalyzes the isomerization ofERK-phosphorylating substrates to activate them and ERK kinasemodulates FBW7 phosphorylation in a PIN1-dependent manner(7). Because c-Myc was one of substrates for ubiquitination anddegradation of FBW7, the catalytic activity of PIN1 is so importantfor the accumulation of cytoplasmic c-Myc in pancreatic cancercells. Moreover, PIN1 was demonstrated to interact with c-Myc toincrease the NRF2 transcription and play a role in antioxidativestress. Because c-Myc is extremely important for determining theredox balance in the Kras-driven PDAC (42), Kras-mutant cellsnot only induce oxidative stress, but also harbor a mechanism toprevent excessive ROS production. PIN1/c-Myc are involved inthismechanism tomaintain the basal level of intracellular ROS tosupport the growth and survival of cancer cells.

Accumulated evidence has demonstrated that PIN1 functionsas an oncogene by regulating numerous protein kinases andphosphatases, which are involved in cell metabolism, cell-cycleprogression, cell proliferation, and apoptosis (14). Moreover,PIN1 overexpression is prevalent in many human cancers andassociated with a poor prognosis (43–45). Previously, it wasreported that PIN1-mediated polyubiquitination of FBW7 whenT205 was phosphorylated by activation of the Ras/ERK signalingpathway (7, 46). FBW7 has been demonstrated to bind NRF1 andpromote proteasome degradation of NRF1 (47). Furthermore,our previous study indicated that the FBW7/c-Myc/TXNIP axisnegatively regulated mitochondrial respiration in PDAC, espe-cially maximal respiration (9). Moreover, TXNIP plays an impor-tant role in redox homeostasis that increases the production ofROS, resulting in cellular apoptosis (48). Thus, we hypothesizedthat PIN1 could be involved in oxidative injury and mitochon-drial bioenergetics. Indeed, our results indicated that knockdownof PIN1 could increase the ROS level and inhibit mitochondrialrespiration in pancreatic cancer cells. It is well known that mostoncogenes suppress mitochondrial metabolism to support gly-colysis. In our results, however, PIN1 was an exception. It bal-anced redox potential and counteracted Kras-induced oxidativestress, which played a key role in mitochondrial protection fromoxidative injury. Thus, we assumed that PIN1 was decisive for thebasal mitochondrial respiration and cell survival of Kras-mutantpancreatic cancer cells.

Under homeostatic conditions, NRF2 affects themitochondrialmembrane potential, fatty acid oxidation, and availability ofsubstrates for respiration. Under conditions of stress stimulation,activation of NRF2 predominantly regulates the antioxidant pro-gram that tightly controls the levels of ROS (24, 49, 50).Moreover,enhanced ROS detoxification and additional NRF2 functionsmight be protumorigenic (51). Emerging evidence has demon-strated that Kras, B-Raf, and c-Myc each increase the transcriptionof NRF2 to elevate the antioxidant program and thereby lowerintracellular ROS and confer a further reduced intracellular envi-ronment (25, 51). However, it is unclear howNRF2 is activated bythe Ras/ERK axis. We also demonstrated that the c-Myc axisincreased NRF2 transcription. Importantly, PIN1 interacted withc-Myc/NRF2, leading to upregulation of the expression of ARE-driven genes. Moreover, a report indicated that NRF2 influencedmitochondrial biogenesis (24). Thus, PIN1 protected mitochon-drial function partially by affecting NRF2 expression to maintain

Liang et al.





Figure 6.

PIN1 promotes the nuclear translocation of NRF2 to increase the ARE activity. A and B, The nuclear and cytoplasmic fraction was extracted to examine theeffect of PIN1 on the translocation of NRF2. C, Immunofluorescence analysis indicated that nuclear translocation of NRF2 was decreased in Capan-1 and SW1990cells transfected with the PIN1MUT vector. D, Coimmunoprecipitation analysis of the interaction between PIN1 and NRF2 in pancreatic cancer cells. E, Doubleimmunofluorescent staining revealed colocalization of the NRF2 and PIN1 proteins in Capan-1 and SW19990 cells. F and G, ChIP and re-ChIP experimentsindicated that PIN1 and NRF2 synergistically occupied the same region on the promoter of HMOX1. H, Downregulation of PIN1 decreased the occupation byNRF2 on the promoter of HMOX1. I, Kaplan–Meier survival curve of patients with PDAC tissues with PIN1HighNRF2High (n ¼ 64) and PIN1LowNRF2Low (n ¼ 16)expression profiles. J, A working model illustrates the role of PIN1 in redox homeostasis in Kras-mutant pancreatic cancer cells.






redox homeostasis. That PIN1 maintained a low level of Kras-induced ROS by ERK/c-Myc/NRF2 axis to avoid apoptosis andsupport basal mitochondrial respiration is to decipher the para-dox of Kras-influencing ROS and mitochondrial function.

Taken together, our findings elucidated a novel regulatoryfunction for PIN1 through activation of the NRF2-mediatedantioxidant program and the importance of PIN1 for the survivalof Kras-mutant pancreatic cancer cells.Moreover, genetic targetingof PIN1 impairs Kras-directed proliferation and tumorigenesis.Thus, the PIN1 antioxidant and cellular detoxification programrepresents a previously unappreciated mediator of oncogenesis,and the development of its inhibitor is expected to provide atherapeutic benefit for pancreatic cancer.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: C. Liang, S. Shi, M. Liu, Y. Qin, Y. Zhang, M. Li, X. YuDevelopment of methodology: Y. Qin, Q. Meng, J. Xu, M. LiAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): C. Liang, J. Hua

Analysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): C. Liang, M. Liu, Q. Meng, S. Ji, Y. Zhang, M. LiWriting, review, and/or revision of the manuscript: C. Liang, S. Shi, M. Liu,Y. Zhang, J. Yang, J. Xu, M. Li, X. YuAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): S. Shi, M. Liu, Y. Qin, J. Hua, S. Ji, M. LiStudy supervision: M. Liu, Q. Ni, M. Li, X. Yu

AcknowledgmentsThis studywas jointly fundedby theNational Science Fund forDistinguished

Young Scholars of China (grant no. 81625016 to X. Yu), the National NaturalScience Foundation of China (grant nos. 81502031 to YQin; 81602085 to S. Ji;and 81772555 to J. Xu), and Shanghai Sailing Program (grant no. 16YF1401800to S. Ji; 17YF1402500 to S. Shi). Moreover, we are grateful to Prof. Qunying Lei(Fudan University) for valuable discussions.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received August 1, 2018; revised September 21, 2018; accepted October 19,2018; published first October 24, 2018.

References1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin

2018;68:7–30.2. Wolfgang CL, Herman JM, Laheru DA, Klein AP, Erdek MA, Fishman EK,

et al. Recent progress in pancreatic cancer. CA Cancer J Clin 2013;63:318–48.

3. Hruban RH, Adsay NV, Albores-Saavedra J, Anver MR, Biankin AV, BoivinGP, et al. Pathology of genetically engineered mouse models of pancreaticexocrine cancer: consensus report and recommendations. Cancer Res2006;66:95–106.

4. Liu M, Yang J, Zhang Y, Zhou Z, Cui X, Zhang L, et al. ZIP4 promotespancreatic cancer progression by repressing ZO-1 and Claudin-1 through aZEB1-dependent transcriptional mechanism. Clin Cancer Res 2018;24:3186–96.

5. Bryant KL, Mancias JD, Kimmelman AC, Der CJ. KRAS: feeding pancreaticcancer proliferation. Trends Biochem Sci 2014;39:91–100.

6. Liang C, Qin Y, Zhang B, Ji S, Shi S, Xu W, et al. ARF6, induced by mutantKras, promotes proliferation and Warburg effect in pancreatic cancer.Cancer Lett 2016;388:303–11.

7. Ji S,QinY, Shi S, Liu X,HuH, ZhouH, et al. ERKkinase phosphorylates anddestabilizes the tumor suppressor FBW7 in pancreatic cancer. Cell Res2015;25:561–73.

8. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell2011;144:646–74.

9. Ji S,Qin Y, Liang C,Huang R, Shi S, Liu J, et al. FBW7 (F-box andWD repeatdomain-containing 7) negatively regulates glucose metabolism by target-ing the c-Myc/TXNIP (thioredoxin-binding protein) axis in pancreaticcancer. Clin Cancer Res 2016;22:3950–60.

10. Lu KP, Hanes SD, Hunter T. A human peptidyl-prolyl isomerase essentialfor regulation of mitosis. Nature 1996;380:544–7.

11. Lu KP, Finn G, Lee TH, Nicholson LK. Prolyl cis-trans isomerization as amolecular timer. Nat Chem Biol 2007;3:619–29.

12. Lu KP, Zhou XZ. The prolyl isomerase PIN1: a pivotal new twist inphosphorylation signalling and disease. Nat Rev Mol Cell Biol 2007;8:904–16.

13. Xu GG, Etzkorn FA. Pin1 as an anticancer drug target. Drug News Perspect2009;22:399–407.

14. Lu Z,Hunter T. Prolyl isomerase Pin1 in cancer. Cell Res 2014;24:1033–49.15. Gothel SF, Marahiel MA. Peptidyl-prolyl cis-trans isomerases, a superfam-

ily of ubiquitous folding catalysts. Cell Mol Life Sci 1999;55:423–36.16. Yang W, Zheng Y, Xia Y, Ji H, Chen X, Guo F, et al. ERK1/2-dependent

phosphorylation and nuclear translocation of PKM2 promotes theWarburg effect. Nat Cell Biol 2012;14:1295–304.

17. Dougherty MK, Muller J, Ritt DA, Zhou M, Zhou XZ, Copeland TD, et al.Regulation of Raf-1 by direct feedback phosphorylation.Mol Cell 2005;17:215–24.

18. Shen ZJ, Esnault S, Schinzel A, Borner C, Malter JS. The peptidyl-prolylisomerase Pin1 facilitates cytokine-induced survival of eosinophils bysuppressing Bax activation. Nat Immunol 2009;10:257–65.

19. Shukla K, Sonowal H, Saxena A, Ramana KV, Srivastava SK. Aldosereductase inhibitor, fidarestat regulates mitochondrial biogenesis viaNrf2/HO-1/AMPK pathway in colon cancer cells. Cancer Lett 2017;411:57–63.

20. ChaHY, Lee BS, Chang JW, Park JK, Han JH, KimYS, et al. Downregulationof Nrf2 by the combination of TRAIL and Valproic acid induces apoptoticcell death of TRAIL-resistant papillary thyroid cancer cells via suppressionof Bcl-xL. Cancer Lett 2016;372:65–74.

21. Hayes AJ, Skouras C, Haugk B, Charnley RM. Keap1-Nrf2 signalling inpancreatic cancer. Int J Biochem Cell Biol 2015;65:288–99.

22. Ji S, Zhang B, Liu J, Qin Y, Liang C, Shi S, et al. ALDOA functions as anoncogene in the highlymetastatic pancreatic cancer. Cancer Lett 2016;374:127–35.

23. HussongM, Borno ST, Kerick M,Wunderlich A, Franz A, SultmannH, et al.The bromodomain protein BRD4 regulates the KEAP1/NRF2-dependentoxidative stress response. Cell Death Dis 2014;5:e1195.

24. Dinkova-Kostova AT, Abramov AY. The emerging role of Nrf2 in mito-chondrial function. Free Radic Biol Med 2015;88:179–88.

25. DeNicolaGM,Karreth FA,HumptonTJ,GopinathanA,WeiC, FreseK, et al.Oncogene-induced Nrf2 transcription promotes ROS detoxification andtumorigenesis. Nature 2011;475:106–9.

26. Eser S, Schnieke A, Schneider G, Saur D. Oncogenic KRAS signalling inpancreatic cancer. Br J Cancer 2014;111:817–22.

27. Collins MA, Bednar F, Zhang Y, Brisset JC, Galban S, Galban CJ, et al.Oncogenic Kras is required for both the initiation and maintenance ofpancreatic cancer in mice. J Clin Invest 2012;122:639–53.

28. Collins MA, Brisset JC, Zhang Y, Bednar F, Pierre J, Heist KA, et al.Metastatic pancreatic cancer is dependent on oncogenic Kras inmice. PLoSOne 2012;7:e49707.

29. Corcoran RB, Cheng KA, Hata AN, Faber AC, Ebi H, Coffee EM, et al.Synthetic lethal interaction of combined BCL-XL and MEK inhibitionpromotes tumor regressions in KRAS mutant cancer models. Cancer Cell2013;23:121–8.

30. Hu Y, Lu W, Chen G, Wang P, Chen Z, Zhou Y, et al. K-ras(G12V)transformation leads tomitochondrial dysfunction and ametabolic switchfrom oxidative phosphorylation to glycolysis. Cell Res 2012;22:399–412.

Liang et al.





31. Weinberg F, Hamanaka R, Wheaton WW, Weinberg S, Joseph J, Lopez M,et al. MitochondrialmetabolismandROS generation are essential for Kras-mediated tumorigenicity. Proc Natl Acad Sci U S A 2010;107:8788–93.

32. Son J, Lyssiotis CA, Ying H, Wang X, Hua S, Ligorio M, et al. Glutaminesupports pancreatic cancer growth through a KRAS-regulated metabolicpathway. Nature 2013;496:101–5.

33. Ying H, Kimmelman AC, Lyssiotis CA, Hua S, Chu GC, Fletcher-Sananikone E, et al. Oncogenic Kras maintains pancreatic tumors throughregulation of anabolic glucose metabolism. Cell 2012;149:656–70.

34. Yoshikawa Y, Takano O, Kato I, Takahashi Y, Shima F, Kataoka T. Rasinhibitors display an anti-metastatic effect by downregulation of lysyloxidase through inhibition of the Ras-PI3K-Akt-HIF-1alpha pathway.Cancer Lett 2017;410:82–91.

35. Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism.Nat Rev Cancer 2011;11:85–95.

36. Oronsky BT,OronskyN, Fanger GR, Parker CW,Caroen SZ, LybeckM, et al.Follow the ATP: tumor energy production: a perspective. Anticancer AgentsMed Chem 2014;14:1187–98.

37. Liang C, Qin Y, Zhang B, Ji S, Shi S, Xu W, et al. Metabolic plasticity inheterogeneous pancreatic ductal adenocarcinoma. Biochim Biophys Acta2016;1866:177–88.

38. Trachootham D, Zhou Y, Zhang H, Demizu Y, Chen Z, Pelicano H, et al.Selective killing of oncogenically transformed cells through a ROS-mediatedmechanismbybeta-phenylethyl isothiocyanate.CancerCell2006;10:241–52.

39. Wise DR, Thompson CB. Glutamine addiction: a new therapeutic target incancer. Trends Biochem Sci 2010;35:427–33.

40. Manganaro L, Lusic M, Gutierrez MI, Cereseto A, Del Sal G, Giacca M.Concerted action of cellular JNK and Pin1 restricts HIV-1 genome inte-gration to activated CD4þ T lymphocytes. Nat Med 2010;16:329–33.

41. Huang GL, Liao D, Chen H, Lu Y, Chen L, Li H, et al. The protein level andtranscription activity of activating transcription factor 1 is regulated byprolyl isomerase Pin1 in nasopharyngeal carcinoma progression. CellDeath Dis 2016;7:e2571.

42. Benassi B, Fanciulli M, Fiorentino F, Porrello A, Chiorino G, Loda M, et al.c-Myc phosphorylation is required for cellular response to oxidative stress.Mol Cell 2006;21:509–19.

43. Wulf GM, Ryo A, Wulf GG, Lee SW, Niu T, Petkova V, et al. Pin1 isoverexpressed in breast cancer and cooperates with Ras signaling inincreasing the transcriptional activity of c-Jun towards cyclin D1. EMBOJ 2001;20:3459–72.

44. Bao L, Kimzey A, Sauter G, Sowadski JM, Lu KP, Wang DG. Prevalentoverexpression of prolyl isomerase Pin1 in human cancers. Am J Pathol2004;164:1727–37.

45. TanX, ZhouF,Wan J,Hang J, ChenZ, Li B, et al. Pin1 expression contributesto lung cancer: prognosis and carcinogenesis. Cancer Biol Ther 2010;9:111–9.

46. Min SH, Lau AW, Lee TH, Inuzuka H, Wei S, Huang P, et al. Negativeregulation of the stability and tumor suppressor function of Fbw7 by thePin1 prolyl isomerase. Mol Cell 2012;46:771–83.

47. Biswas M, Phan D, Watanabe M, Chan JY. The Fbw7 tumor suppressorregulates nuclear factor E2-related factor 1 transcription factor turnoverthrough proteasome-mediated proteolysis. J Biol Chem 2011;286:39282–9.

48. Zhou J, Chng WJ. Roles of thioredoxin binding protein (TXNIP) inoxidative stress, apoptosis and cancer. Mitochondrion 2013;13:163–9.

49. Itoh K, Wakabayashi N, Katoh Y, Ishii T, Igarashi K, Engel JD, et al. Keap1represses nuclear activation of antioxidant responsive elements by Nrf2through binding to the amino-terminal Neh2 domain. Genes Dev 1999;13:76–86.

50. Nguyen T, Nioi P, Pickett CB. The Nrf2-antioxidant response elementsignaling pathway and its activation by oxidative stress. J Biol Chem 2009;284:13291–5.

51. Chio II, Jafarnejad SM, Ponz-Sarvise M, Park Y, Rivera K, Palm W, et al.NRF2 promotes tumor maintenance by modulating mRNA translation inpancreatic cancer. Cell 2016;166:963–76.






2019;79:133-145. Published OnlineFirst October 24, 2018.Cancer Res Chen Liang, Si Shi, Mingyang Liu, et al. Pancreatic Cancer CellsCounteract Kras-Induced Mitochondrial Respiratory Injury in PIN1 Maintains Redox Balance via the c-Myc/NRF2 Axis to

Updated version

10.1158/0008-5472.CAN-18-1968doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2018/10/24/0008-5472.CAN-18-1968.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/79/1/133.full#ref-list-1

This article cites 51 articles, 8 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/79/1/133To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-18-1968

http://cancerres.aacrjournals.org/content/suppl/2018/10/24/0008-5472.CAN-18-1968.DC1

http://cancerres.aacrjournals.org/content/79/1/133.full#ref-list-1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/79/1/133


PIN1MaintainsRedoxBalanceviathec-Myc/NRF2 Axis to ...carcinoma (PDAC). PIN1 is a key effector...

Documents

Transcript of PIN1MaintainsRedoxBalanceviathec-Myc/NRF2 Axis to ...carcinoma (PDAC). PIN1 is a key effector...