Phylogéographie du mélèze laricin (Larix laricina [Du roi ... · merci également à Julie...
Transcript of Phylogéographie du mélèze laricin (Larix laricina [Du roi ... · merci également à Julie...
Phylogéographie du mélèze laricin (Larix laricina
[Du roi] K. Koch) en Amérique du Nord
Mémoire
Emile Warren
Maîtrise en sciences forestières
Maître ès sciences (M. Sc.)
Québec, Canada
© Emile Warren, 2015
III
Résumé
La structure des populations du mélèze laricin (Larix laricina [Du roi] K. Koch) a été
étudiée à l’aide de polymorphismes de l’ADN mitochondrial et chloroplastique. Deux
populations, situées en Alaska et au Labrador, étaient génétiquement distinctes des autres,
suggérant l'existence de refuges glaciaires nordiques à ces endroits. La répartition spatiale
des haplotypes a révélé un clivage génétique entre deux groupes de populations occupant
l’est et l’ouest de l'aire de répartition. Ce patron témoignerait de la présence de deux lignées
glaciaires génétiquement distinctes provenant d’autant de refuges localisés au sud de
l'inlandsis Laurentidien. L’analyse des données polliniques a permis de corroborer la
présence de refuges glaciaires au sud-ouest des Grands Lacs et à l’ouest des Appalaches, en
plus des possibles refuges en Alaska et au Labrador. La haute différenciation génétique
propre aux populations de l’ouest pourrait être la conséquence d’une forte compétition
interspécifique lors de la recolonisation postglaciaire de cette région.
V
Abstract
Geographical population structure of the North American larch, Larix laricina [Du
roi] K. Koch was studied using mitochondrial and chloroplast DNA polymorphisms. Some
populations from Alaska and Labrador were genetically differentiated from neighboring
populations, suggesting that these two regions served as glacial refugia. The spatial
distribution of haplotypes revealed a cleavage between eastern and western populations,
which are probably representative of two distinct glacial lineages that expanded from the
south of the ice sheet following the last glacial maximum. Mapped pollen records helped
inferring the putative location of glacial refugia south-west of the Great Lakes, west of the
Appalachians, as well as in Alaska and Labrador. High population differentiation among
western populations likely indicates that interspecific competition was strong during the
postglacial colonization of the region.
VII
Table des matières
Résumé ................................................................................................................................. III Abstract ................................................................................................................................. V
Table des matières ..............................................................................................................VII Liste des tableaux ................................................................................................................. IX Liste des figures ................................................................................................................... XI Remerciements .................................................................................................................. XIII Avant-propos ..................................................................................................................... XV
Chapitre 1 - Introduction générale ......................................................................................... 1 1.1 Phylogéographie ........................................................................................................... 1
1.1.1 Définitions et concepts .......................................................................................... 1 1.1.2 La dernière glaciation ............................................................................................ 2
1.1.3 Refuges glaciaires .................................................................................................. 3 1.1.4 Pollen et graines chez les conifères ....................................................................... 4
1.1.5 Données fossiles .................................................................................................... 5 1.2 Diversité génétique ....................................................................................................... 5
1.2.1 Mécanismes affectant la diversité génétique ......................................................... 6 1.2.2 Propriétés génétiques des refuges glaciaires ......................................................... 7 1.2.3 Marqueurs génétiques ............................................................................................ 8
1.2.4 Analyse des données génétiques ........................................................................... 8 1.3 Les génomes cytoplasmiques des conifères ................................................................. 9
1.3.1 Génome mitochondrial .......................................................................................... 9 1.3.2 Génome chloroplastique ...................................................................................... 10
1.4 Espèce à l’étude : le mélèze laricin ............................................................................ 10
1.4.1 Le genre Larix ..................................................................................................... 10 1.4.2 Larix laricina ....................................................................................................... 11
1.4.2.1 Éco-physiologie de l’espèce ........................................................................ 12 1.4.2.2 Diversité génétique ...................................................................................... 13
1.4.2.3 Hybridation .................................................................................................. 14 1.5 Objectifs et hypothèses .............................................................................................. 14 1.6 Littérature citée .......................................................................................................... 16
Chapitre 2 – Histoire postglaciaire du mélèze laricin .......................................................... 23 2.1 Résumé ....................................................................................................................... 24 2.2 Abstract ...................................................................................................................... 25 2.3 Introduction ................................................................................................................ 26 2.4 Materials and methods ............................................................................................... 30
2.4.1 Sampling and DNA Extraction ............................................................................ 30
2.4.2 MtDNA polymorphism screening, PCR conditions and genotyping .................. 31 2.4.3 CpDNA polymorphism screening, PCR conditions and genotyping .................. 31 2.4.4 Genetic diversity, population structure and differentiation ................................. 32
2.4.5 Analysis of published pollen paleorecords .......................................................... 33 2.5 Results ........................................................................................................................ 34
2.5.1 Genetic diversity .................................................................................................. 34 2.5.2 Population structure and differentiation .............................................................. 36 2.5.3 Analysis of published pollen paleorecords .......................................................... 36
VIII
2.6 Discussion ................................................................................................................... 41
2.6.1 Genetic diversity and population differentiation ................................................. 41
2.6.2 Population structure and phylogeographic inferences ......................................... 42 2.6.3 High cpDNA population differentiation and competition in western Canada ..... 43
2.7 Conclusions ................................................................................................................ 45 2.8 Acknowledgements .................................................................................................... 46 2.9 Literature cited ............................................................................................................ 47
Chapitre 3 - Conclusions et perspectives de recherche ........................................................ 51 3.1 Retour sur les objectifs et hypothèses de recherche ................................................... 51 3.2 Inférences phylogéographiques .................................................................................. 52 3.3 Différenciation génétique des populations de l’ouest ................................................. 54 3.4 Littérature citée ........................................................................................................... 56
Liste entière de la littérature citée ........................................................................................ 59
Annexes ................................................................................................................................ 69
IX
Liste des tableaux
Table 2.1. Population genetic diversity estimates and Bayesian group assignment based on
three cpSSRs markers for 45 Larix laricina populations. ........................................ 38
Appendix S1. Mitotype counts for one mtDNA polymorphic locus in 45 Larix laricina
populations. ............................................................................................................. 69
Appendix S2. Chlorotype counts for three cpDNA polymorphic SSRs in 45 Larix laricina
populations. ......................................................................................................... 70-72
Appendix S3. List of mtDNA loci scanned for Larix laricina mtDNA polymorphism, primer
sequences, annealing temperature and sequencing results. ................................ 73-75
XI
Liste des figures
Figure 1.1. Simulation de l’aire recouverte par la calotte glaciaire nord-américaine lors du
dernier maximum glaciaire il y a 21 000 ans (i.e. 18 000 14C BP). La zone blanche
représente les territoires recouverts par la glace et la zone grise les territoires non
recouverts. Tiré de Dyke et al. 2004. ......................................................................... 3
Figure 1.2. Carte représentant l’aire de répartition des trois espèces du genre Larix en
Amérique du Nord. L’aire de répartition est montrée en vert pour Larix laricina, en
bleu pour Larix lyallii et en rouge pour Larix occidentalis...................................... 12
Figure 2.1. Biogeographic model illustrating contrasted scenarios of postglacial
recolonization by early-successional and late-sucessional species. Large ellipses
represent a modeled terrestrial landscape recently deglaciated (barren landscape;
white), colonized by early-successional species (yellow), or colonized by late-
successional species (green). The four small circles represent unproductive sites
where more extreme ecological conditions with respect to the surrounding landscape
prevail. These sites are either virtually treeless (white circles) or colonized by early-
successional, low resource-demanding species (yellow circles) but late-successional,
high resource-demanding, species cannot establish there. Both scenarios begin with a
recently deglaciated barren landscape and end with the current landscape dominated
by late-successional species interspaced by small, disjunct populations of the early-
successional species. The difference between the two scenarios is the chronology of
postglacial recolonization with the recently deglaciated landscape initially colonized
by an early-successional (A) or a late-successional (B) species. ............................. 29
Figure 2.2. Geographic distribution of mitotypes (A), chlorotypes (B), and (C) Bayesian
clustering of 45 Larix laricina populations. Chlorotypes with a frequency below 0.01
were pooled as “Others”. Bayesian clustering based on chlorotype frequencies using
the “spatial clustering of groups” option implemented in BAPS 6.0 (Corander et al.,
2008). Population numbers correspond to those in Table 2.1. ................................. 35
Figure 2.3. Among-population relative genetic distances using cpDNA data across Larix
laricina natural range. The analysis was carried out with the Alleles in Space (AIS)
software using the “genetic landscape shapes” procedure (Miller, 2005). The “height”
value represents population differentiation at a given point. The higher the “height”,
the higher the relative population differentiation. Interpolation performed with a grid
of 100 × 100 and a distance weighting parameter of 1 (see Miller et al., 2006 for
details). ..................................................................................................................... 37
Figure 2.4. Mapped pollen paleorecords of Larix sp. and Picea sp. between 20 and 4
calibrated kiloyears before present (cal kyr BP) reconstructed from 408 and 466
pollen cores, respectively. Black and pink dots indicate the presence of larch and
spruce pollen in the paleorecord during each 2 kyr time-interval, respectively. ..... 39
Figure 2.5. Mapped pollen paleorecords of Larix sp. and Abies sp. between 20 and 4
calibrated kiloyears before present (cal kyr BP) reconstructed from 408 and 490
pollen cores, respectively. Black and green dots indicate the presence of larch and fir
pollen in the paleorecord during each 2 kyr time-interval, respectively. ................. 40
XII
Figure S1. Accumulation curves of the number of chlorotypes uncovered as a function of
the number of populations sampled. Western and Eastern lineages are represented by
red and blue colors, respectively. Each polygon represents 95% confidence interval
envelopes of 100 randomly permuted accumulation curves. Boxplots of the 100
permutations indicate lower quartile, median and upper quartile; whiskers length are
1.5 × interquartile ranges. Filled lines are the extrapolation curves fitted from each
mean accumulation curve using an asymptotic, negative exponential function. ..... 79
XIII
Remerciements
J’aimerais d’abord remercier Jean Bousquet qui m’a donné l’opportunité de réaliser
ce projet et m’a fourni toutes les ressources pour accomplir des avancées en phylogéographie,
discipline qui m’était complètement étrangère. Merci de m’avoir permis de mener ce projet
à terme et d’acquérir autant d’expérience. J’aimerais aussi remercier Jean Beaulieu du Centre
de foresterie des Laurentides et Martin Perron du Ministère des forêts, de la faune et des parcs
du Québec pour m’avoir fourni des échantillons ou de l’aide lors de l’échantillonnage. Un
merci également à Julie Godbout et Benjamin Cinget pour avoir échantillonné certaines
populations éloignées de mélèze laricin et à Juan-Pablo Jaramillo-Correa pour avoir conçu la
seule amorce mitochondriale ayant révélé des résultats pertinents dans le cadre de mon étude.
J’aimerais également remercier toute l’équipe de professionnels de recherche et
d’étudiants-chercheurs du laboratoire. Sauphie Senneville, qui m’a fourni une aide
incalculable pendant les premières années du projet, autant comme « coach » en ce qui
concerne les méthodes qu’en fournissant un temps précieux pour m’aider à effectuer les
innombrables amplifications PCR avant de partir en congé de maternité. Sébastien Gérardi,
pour toutes ces discussions sur la génétique et les notions qui n’étaient pas toujours claires.
Merci infiniment, collègue, pour toute ton aide dans les analyses, la rédaction et le reste.
Guillaume de Lafontaine, pour ses talents d’homme de pollen, merci de t’être infiltré dans la
foule avant la ligne d’arrivée pour ajouter à ce travail la touche qui lui manquait. Merci à
Sylvie Blais et France Gagnon pour leur « coaching » dans le laboratoire et pour m’avoir
enseigné une multitude de techniques, et à Marcel Laurent Estrada et Francis Tremblay pour
leur aide dans les débuts avec les millions de manipulations à faire.
Merci aussi à tous mes camarades de bureau et du deuxième étage de l’Institut de
biologie intégrative et des systèmes au pavillon Marchand. Mebarek Lamara et Juliana Sena,
impossible d’imaginer de meilleurs comparses de bureau, vous êtes les prochains à déposer
vos thèses, tenez bon; Gaby Germanos, Julien Prunier, Mathieu Paradis, pour ces dizaines de
conversation de coin de corridor ou de rackage de tips.
XIV
Finalement, merci à ma copine Marie-Pier de m’avoir épaulé et enduré pendant ces
trois dernières années de travail insensées à aller au lit à 5 heures du matin. Merci, on est
partis pour la gloire!
XV
Avant-propos
Le premier chapitre de ce mémoire est une introduction générale comprenant une
revue de littérature qui traite des principaux concepts nécessaires à la compréhension des
thèmes abordés dans le reste du mémoire. Ce chapitre se conclut sur la présentation des
objectifs et hypothèses qui ont guidé le travail effectué.
Le deuxième chapitre est un article scientifique rédigé en anglais par l’étudiant et
corrigé par les co-auteurs. Jean Bousquet (directeur) et Jean Beaulieu (codirecteur) ont
participé à la conception du projet, Sauphie Senneville a aidé à réaliser les travaux
expérimentaux en laboratoire, Martin Perron et Jean Beaulieu ont fourni de l’aide à
l’échantillonnage, Juan-Pablo Jaramillo-Correa a conçu les amorces mitochondriales et
Sébastien Gérardi et Guillaume de Lafontaine ont fourni de l’aide avec les analyses. Tous
ont participé à la rédaction du manuscrit. L’article est destiné à être publié dans une revue
scientifique internationale. Il est lui-même composé de cinq sous-parties. La première partie
est une introduction synthétique reprenant les concepts essentiels de l’introduction générale
du mémoire. La deuxième partie, le matériel et les méthodes, contient l’information
nécessaire pour reproduire l’étude ainsi qu’une explication détaillée des analyses effectuées.
La partie suivante est composée des résultats obtenus qui sont interprétés et analysés dans
l’avant-dernière partie, où l’on discute des implications de ces derniers. L’article se termine
par une conclusion.
Le troisième chapitre est une conclusion générale du mémoire. Cette partie contient
les conclusions quant à l’atteinte des objectifs de l’étude et la vérification des hypothèses
posées lors de l’introduction du mémoire. Elle se termine par un récapitulatif des limites de
l’étude et des perspectives de recherche futures permettant de répondre à ces limites et
d’étendre la portée de l’étude.
1
Chapitre 1 - Introduction générale
1.1 Phylogéographie
1.1.1 Définitions et concepts
La biogéographie est l’étude de la répartition géographique des espèces (MacArthur,
1967). Elle cherche à décrire la répartition et l’abondance des individus ou des populations à
différentes échelles spatiales en considérant les facteurs historiques, géologiques,
géographiques et biotiques (Humphries, 2000).
La phylogénie est l’étude des relations entre les espèces actuelles et leurs ancêtres.
Elle a pour but d’établir des liens de parenté entre les espèces et de retracer leur histoire
évolutive à travers le temps. Les informations utilisées pour construire un arbre
phylogénétique proviennent traditionnellement de traits morphologiques et d’outils
moléculaires (Bousquet et al., 1992). La phylogénie peut également s’intéresser aux liens de
parenté entre les individus ou les populations d’une même espèce, et donc s’appliquer à
différents niveaux taxonomiques.
La phylogéographie peut être considérée comme l’union de la phylogénie et de la
biogéographie. Elle consiste à projeter un arbre phylogénétique à l’échelle d’une espèce sur
un support géographique (Avise, 2000). Le but est de retracer l’histoire des différentes
populations à travers le temps et l’espace pour ensuite inférer les événements climatiques ou
géologiques passés ayant causé leur répartition actuelle (Bermingham & Moritz, 1998;
Hewitt, 2000; Soltis et al., 2006; Jaramillo-Correa et al., 2009). Les oscillations climatiques
et les phénomènes de vicariance (barrières physiques ou isolement géographique séparant
deux populations anciennement unies) peuvent causer des bases d’échanges génétiques (flux
génique), des goulots d’étranglement (réduction de la taille effective d’une population
entraînant une réduction de sa diversité génétique et la dérive aléatoire de cette dernière) ou
encore, l’expansion des populations, pouvant entraîner des divergences dans la composition
génétique des populations (Arbogast & Kenagy, 2001).
La phylogéographie nécessite donc d’étudier un ou plusieurs traits ayant évolué dans
le temps tout en laissant des vestiges ou « signatures », dans les populations contemporaines
2
de l’espèce étudiée. Pour ce faire, l’outil utilisé le plus fréquemment dans les études récentes
est le polymorphisme génétique, soit la variation du code génétique des individus. En effet,
l’ADN (Acide désoxyribonucléique) évolue dans le temps à travers ses mécanismes de
réplication qui modifient progressivement les séquences nucléotidiques au fil des réplications
(mutations). Lorsque ces changements sont conservés, ils laissent des traces dans les
populations actuelles. Si ces polymorphismes sont structurés géographiquement, c’est-à-dire
répartis de façon non aléatoire dans l'espace, il est possible de retracer l’histoire
phylogéographique de l’espèce (Avise et al., 1987). Lorsque l’on compare plusieurs études
phylogéographiques réalisées sur un même territoire, il est même possible d’observer des
tendances multi-espèces et d’inférer les processus historiques communs qui ont modelé leur
répartition géographique actuelle, augmentant la puissance d’inférence de l’approche
(Bermingham & Moritz, 1998; Jaramillo-Correa et al., 2009).
1.1.2 La dernière glaciation
Le début du dernier événement glaciaire majeur remonte à environ 135 000 ans. Le
dernier maximum glaciaire (Last Glacial Maximum; LGM) est quant à lui décrit comme le
moment où un maximum d’eau était séquestré par les glaces à l’échelle de la planète (Mix et
al., 2001). Cela correspond à la période où le niveau d’eau eustatique était à son plus bas. Il
aurait été atteint entre 23 000 et 19 000 cal. yr. BP. (Mix et al., 2001).
En Amérique du Nord, la glace aurait recouvert progressivement les régions
nordiques jusqu’à ce que les plaques glaciaires recouvrent le Canada presqu’entièrement.
Durant le LGM, la calotte glaciaire s’étendait sur les dix provinces et trois territoires
canadiens, ainsi que sur une partie du nord des États-Unis (Figure 1.1) (Dyke et al., 2002).
3
Figure 1.1. Simulation de l’aire recouverte par la calotte glaciaire nord-américaine lors du
dernier maximum glaciaire il y a 21 000 ans (i.e. 18 000 14C BP). La zone blanche représente
les territoires recouverts par la glace et la zone grise les territoires non recouverts. Tiré de
Dyke et al. 2004.
1.1.3 Refuges glaciaires
Lors des périodes glaciaires du Quaternaire, les espèces ont vu leur environnement
changer énormément (Webb & Bartlein, 1992; Davis & Shaw, 2001). La vie macroscopique
dans les zones terrestres recouvertes de glace devenant très difficile voire impossible, la
progression des glaces aurait repoussé les différentes espèces vers les régions méridionales
libres de glace. De tels endroits où les espèces ont pu survivre aux époques glaciaires et ainsi
éviter l’extinction (Jackson et al., 1997) sont appelés refuges glaciaires (Shafer et al., 2010;
Keppel et al., 2012; Gavin et al., 2014).
En Amérique du Nord, les refuges glaciaires présumés les plus couramment évoqués
étaient situés au sud des glaciers. Du côté oriental du continent, la chaîne de montagnes des
4
Appalaches sépare deux refuges principaux qui auraient été situés à l’est des Appalaches et
au sud des Grands Lacs (Godbout et al., 2005; Jaramillo-Correa et al., 2009; Gérardi et al.,
2010). À l'ouest du continent, plusieurs refuges ont été identifiés dont un qui aurait été
localisé à l’ouest des Rocheuses, la chaîne de montagnes agissant comme barrière physique
à la migration (Jaramillo-Correa et al., 2004; Godbout et al., 2008; Wei et al., 2011).
Certaines études mentionnent la possibilité d’un refuge sur le plateau continental du Labrador
exondé au LGM (Jaramillo-Correa et al., 2004; Gérardi et al., 2010) ainsi qu’en Alaska
(Béringie) (Hopkins, 1982; Brubaker et al., 2005; Anderson et al., 2006; Zazula et al., 2006;
de Lafontaine et al., 2010; Gérardi et al., 2010). Cette dernière région était libre de glace au
LGM et semble donc avoir été un refuge de prédilection pour plusieurs espèces ayant une
aire de répartition nordique (Jackson et al., 2000). En plus de ceux-ci, certains auteurs
mentionnent l'existence possible de micro-refuges glaciaires cryptiques localisés à la marge
de la calotte glaciaire dont on ignore l’emplacement exact puisque certains pourraient
aujourd’hui être localisés sur le plateau océanique continental maintenant inondé (Tremblay
& Schoen, 1999; McLachlan et al., 2005; Godbout et al., 2010; Shafer et al., 2010). Ces
derniers ont été suggérés pour expliquer la présence hâtive de certaines espèces à des endroits
jugés inatteignables dans la fenêtre de temps donnée selon leur vitesse de migration
(McLachlan et al., 2005). À la suite du retrait des glaces, les espèces ont pu progressivement
recoloniser les terres nouvellement déglacées à partir des divers refuges glaciaires pour
aboutir à la répartition actuelle des populations (Pielou, 1991).
1.1.4 Pollen et graines chez les conifères
Le flux génique des génomes des organelles dans la famille des Pinaceae est transmis
de façon bilatérale et uniparentale, soit par la mère (matrilinéaire) ou par le père
(patrilinéaire). Le pollen, gamétophyte mâle, transmet le génome chloroplastique (ADNcp)
(Neale & Sederoff, 1988) et l’ovule, gamète femelle, transmet le génome mitochondrial
(ADNmt) (Dong & Wagner, 1993).
Cela donne lieu à des patrons de dissémination distincts selon le génome étudié,
puisque le flux génique par graine ou par pollen est différent chez les Pinaceae (Petit et al.,
2005; Jaramillo-Correa et al., 2009). Le pollen, plus léger, peut être transporté par le vent et
être disséminé sur de longues distances, tandis que la graine, plus lourde, voyage moins
5
aisément. On la retrouvera plutôt dans un périmètre proximal de la mère (Petit & Vendramin,
2007). De manière générale chez les Pinaceae, on admet que l’ADNmt a une capacité de
dissémination plus faible que l’ADNcp puisque la graine parcourt une distance plus courte
que le pollen. Par conséquent, les barrières physiques limitant leur dissémination agissent
différemment et on s’attend à obtenir une meilleure dispersion de l’ADNcp et une plus grande
uniformité géographique de la structure génétique des populations. En phylogéographie, on
cherchera cependant à obtenir la plus grande résolution possible des structures géographiques
anciennes et une différenciation génétique maximale des populations, l’ADNmt sera alors le
génome de choix (Avise et al., 1987; Jaramillo-Correa et al., 2009).
1.1.5 Données fossiles
Dans un contexte d’étude de l’histoire biogéographique d’une espèce, les données
fossiles de pollen et de macrofossiles peuvent également être comparées aux résultats des
analyses de structure génétique de populations. Le registre fossile permet de confirmer la
présence d’une espèce ou d’un genre (s’il n’est pas possible de discriminer
morphologiquement le pollen d’espèces d’un même genre) à un endroit et un moment donné.
Néanmoins, on peut inférer la localisation des refuges glaciaires potentiels en s’appuyant
simultanément sur les données moléculaires, les simulations d’expansion des calottes
glaciaires telles que proposées par Dyke 2004 (Figure 1.1) et Marshall 2002 pour l’Amérique
du Nord ainsi que les relevés palynologiques et de macrofossiles (Gavin et al., 2014).
L'absence de pollen ou de macrofossiles à une date donnée n’est cependant pas suffisante
pour conclure avec certitude que l’espèce ou le genre n’était pas présent (Davis et al., 1991;
Birks, 2003). C’est pourquoi les inférences phylogéographiques intégratives à partir des
données génétiques et fossiles deviennent de plus en plus incontournables (Jaramillo-Correa
et al., 2009).
1.2 Diversité génétique
La diversité génétique est le degré de variation génétique à l’intérieur d’un taxon
donné. Toute différence dans la séquence d’ADN des individus à l’intérieur de ce taxon est
un polymorphisme et sert d’unité de base à la diversité génétique. Un locus (région spécifique
du génome, ex. : un gène) pour lequel on ne retrouve aucune variation génétique est dit
6
monomorphe, tandis qu’un locus retrouvé sous plusieurs formes est considéré polymorphe.
Il existe quatre processus évolutifs qui agissent sur la diversité génétique et l’abondance de
polymorphismes : la mutation, la sélection naturelle, la dérive génétique et la migration.
1.2.1 Mécanismes affectant la diversité génétique
La mutation est le processus à l'origine de toute variation génétique. Elle agit
directement sur l'ADN des individus en modifiant leur séquence nucléotidique. Les
mécanismes de réplication de l’ADN n’étant pas infaillibles, chaque erreur de réplication
introduite crée un variant génétique du brin copié. Ces mutations peuvent être éliminées par
la sélection naturelle, mais elles sont parfois transmises à la prochaine génération (Thompson
et al., 1998). La progéniture possédera alors un code génétique unique et différent de celui
de ses parents.
La sélection naturelle est une force évolutive favorisant les polymorphismes qui
confèrent un phénotype avantageux à l’individu qui les porte. L’étude des polymorphismes
sous sélection ne présente pas d’intérêt en phylogéographie car ils reflètent des processus
récents (i.e. adaptation à un milieu). Par opposition, les marqueurs de choix en
phylogéographie sont dits neutres et ne reflètent que des processus historiques découlant de
façons évolutives particulières (Avise, 2000).
La dérive génétique résulte simplement de l'échantillonnage aléatoire des allèles d'une
population qui seront transmis à la nouvelle génération. Il s'agit donc d'un processus évolutif
neutre qui modifie aléatoirement la fréquence des allèles des populations au fil des
générations. Ce processus a un effet plus important dans les populations isolées avec une
petite taille efficace où le flux génique avec les autres populations est limité.
L'échantillonnage aléatoire des allèles qui intervient à chaque génération confère aux allèles
moins fréquents une chance statistiquement plus faible d’être transmis. On observe
généralement dans ces populations une diminution de la fréquence des allèles rares et, si
l’isolement persiste, leur disparition. On associe à la dérive une perte de diversité génétique
ainsi qu’une différenciation accrue entre les populations (Wright, 1932; Allendorf, 1986). En
phylogéographie, un tel phénomène peut impliquer une perte significative d’information car
ces allèles peuvent représenter des données historiques essentielles.
7
La migration représente le déplacement des individus ou de leurs gamètes dans
l’espace. Le terme migration est généralement utilisé lorsque l’on réfère au déplacement
physique des individus, mais peut également faire référence au flux génique, soit à l’échange
d’allèles entre différentes populations ou différents taxons. Chez les espèces animales, la
migration est associée au déplacement des individus alors que chez les plantes, puisque
l’individu devient sessile une fois établi, la migration s’opère lors de la dissémination des
graines. En outre chez les plantes, le flux de gènes entre deux populations peut intervenir via
la dissémination du pollen et cela, sur de plus ou moins grandes distances. En règle générale,
le flux génique augmente la diversité des populations car il résulte en un apport d’allèles
exogènes.
La migration est parfois la cause d’événements fondateurs caractérisés par une chute
de la diversité lors de la colonisation d’un nouveau territoire par une fraction de la population
migratrice. Dans un contexte de colonisation postglaciaire, ce genre d’événement est attendu.
Le résultat net sur la diversité est semblable à celui d’une chute rapide de la population
effective par une mortalité accrue (Allendorf, 1986). On appelle ces événements des goulots
d’étranglements (« bottleneck »).
1.2.2 Propriétés génétiques des refuges glaciaires
Les refuges sont généralement les zones où la diversité génétique régionale est la plus
grande (Comes & Kadereit, 1998; Taberlet et al., 1998). En effet, lorsque les refuges sont
compris dans l’aire de répartition actuelle de l’espèce, les populations bénéficient
généralement d’un grand laps de temps sans subir de fluctuation démographique pour se
différencier. Cependant, les populations dans les refuges peuvent être soumises à des effets
de dérive génétique dépendamment de leur taille efficace. Dans ce cas, on observera une
perte en diversité génétique et une possible différenciation génétique. Les populations des
refuges situés à l’extérieur de l’aire de répartition actuelle n’ont pas d’équivalent
contemporain. Leur signature génétique ne peut donc qu’être inférée à partir de celle des
populations actuelles. Lors d’une colonisation rapide, les territoires colonisés à partir des
refuges ont généralement une diversité génétique plus faible puisqu’un sous-ensemble
aléatoire et partiel des allèles est transmis lors de la colonisation (goulot d’étranglement;
8
(Ibrahim et al., 1996; Provan & Bennett, 2008). Par opposition, la diversité génétique peut
être maintenue lorsque la colonisation est lente et progressive.
1.2.3 Marqueurs génétiques
Une variation d’un nucléotide est appelée polymorphisme simple de séquence ou SNP
(Single Nucleotide Polymorphism). Il se produit lorsque l’ADN polymérase remplace une
base par une autre lors de la réplication. Le SNP peut être non-synonyme s’il engendre une
modification dans la protéine traduite et altère donc potentiellement le phénotype, ou
synonyme s’il n’engendre pas de modification de la protéine et du phénotype.
Les microsatellites ou SSRs (Simple Sequence Repeats) sont des répétitions d’un à
quelques nucléotides. La réplication de l’ADN peut causer l’ajout ou le retrait d’une des
répétitions de la séquence et donc créer du polymorphisme que l’on dénome insertion-
délétion ou indel. Ces marqueurs sont utiles en génétique des populations car leur taux de
mutation est relativement élevé (Di Rienzo et al., 1994). Il est donc fréquent de retrouver
plusieurs allèles pour un même locus dans une population. Les SSRs se retrouvent le plus
souvent dans des régions non codantes, qui sont souvent flanquées par des séquences
conservées à l’intérieur d’une espèce et parfois même entre les espèces voisines, ce qui
facilite le développement d’amorces universelles de PCR (Polymerase Chain Reaction)
(Tautz, 1989). Certains microsatellites du génome chloroplastique (cpSSRs) sont reconnus
pour être polymorphes chez de nombreux conifères (Vendramin et al., 1996; Parducci et al.,
2001)
Dans une étude phylogéographique où l’on cherche à retracer l’histoire d’une espèce,
il est important que les marqueurs utilisés soient le moins possible soumis à la sélection
naturelle, c’est-à-dire que leurs fréquences alléliques soient les plus représentatives des
phénomènes démographiques passés (Avise, 2000).
1.2.4 Analyse des données génétiques
Différents indices estimant la diversité génétique sont utilisés en génétique des
populations. La richesse allélique (A) représente le nombre moyen d’allèles à un ou plusieurs
loci dans une population. Le pourcentage de loci polymorphes (P) correspond au pourcentage
9
de loci qui possèdent plusieurs allèles dans une population. On peut également évaluer
l’hétérozygotie attendue (He), soit l’hétérozygotie que devrait avoir une population si cette
dernière se comportait comme une population idéale (à l'équilibre d'Hardy-Weinberg).
L’hétérozygotie est calculée en fonction des fréquences alléliques dans une population où la
sélection des allèles qui seront transmis d’une génération à l’autre est complètement aléatoire.
On peut aussi estimer différents indices de différenciation génétique entre les populations,
qui mesurent la proportion de la variabilité génétique qui est due à la fragmentation d’une
grande population en plusieurs sous-populations. On trouve parmi ces indices le FST (Wright,
1949), le GST (Nei, 1973), le RST (Slatkin, 1995) et le NST (Pons & Petit, 1996), qui sont des
indices d’apparentement standardisés compris entre 0 à 1. Une valeur de 1 indique que la
différenciation entre les populations est complète, tandis qu’une valeur de 0 signifie qu’il n’y
a aucune différence entre les populations. Le FST et le GST sont des indices d’apparentement
qui ne tiennent compte d’aucun modèle de mutation et considèrent que chaque allèle est
génétiquement équidistant des autres (Nei, 1973). Le NST tient compte de la distance
génétique entre les formes alléliques observées (Pons & Petit, 1996). Le RST est un indice
d’apparentement qui tient compte de la répartition des allèles au sein des populations, mais
également de la distance génétique entre les allèles, soit du nombre de pas mutationnels
nécessaires pour passer d’un allèle à un autre. Il est typiquement utilisé pour les marqueurs
moléculaires contenant des répétitions (microsatellites, minisatellites), car il prend en compte
un modèle de mutation « pas à pas » caractéristique de ces marqueurs (Slatkin, 1995).
1.3 Les génomes cytoplasmiques des conifères
1.3.1 Génome mitochondrial
Chez les conifères, la mitochondrie possède un génome d’une taille qui dépasse les 4
Mb (Nystedt et al., 2013). Le génome mitochondrial est ordinairement haploïde (Birky et al.,
1989), c’est-à-dire qu’il ne possède qu’une copie de chaque locus. Relativement à l’ADNcp,
les mutations nucléotidiques s’y accumulent à un taux très bas chez les plantes (Wolfe et al.,
1987; Laroche et al., 1997; Jaramillo-Correa & Bousquet, 2003). En contrepartie, le
réarrangement des gènes y est possible et parfois fréquent (Jaramillo-Correa & Bousquet,
2005; Petit & Vendramin, 2007). Les polymorphismes de l’ADN mitochondrial sont
10
généralement considérés comme neutres lorsqu’ils sont localisés dans l’ADN non-codant.
Les fréquences alléliques dans les populations ne sont alors pas influencées par la sélection
naturelle (Avise et al., 1987). Le fait qu’ils soient transmis maternellement, et donc
disséminés uniquement par la graine sur de courtes distances à chaque génération, permet
d’observer avec une plus grande résolution les structures géographiques anciennes. Ainsi,
l’ADNmt est considéré comme le génome de choix pour les études phylogéographiques chez
les conifères. Puisqu’il est haploïde, l’effet des processus démographiques sur la diversité
génétique et les fréquences alléliques est plus important que sur le génome nucléaire qui
possède plus d’une copie de ses gènes. Les effets anciens d’isolement génétique et de dérive
génétique seront donc plus facilement détectables à l’aide de polymorphismes du génome
mitochondrial.
1.3.2 Génome chloroplastique
Le chloroplaste des plantes photosynthétiques possède un génome variant de 120 kb
à 217 kb (Downie & Palmer, 1992). Chez les conifères, sa taille est d’environ 120 kb (Nystedt
et al., 2013; Yi et al., 2013). Le taux de substitutions nucléotidiques y est plus élevé que chez
le génome mitochondrial (environ 3 fois plus élevé) (Wolfe et al., 1987). Transmis
paternellement, l’ADNcp est disséminé séquentiellement par le pollen et ensuite par la graine
et peut donc voyager sur de longues distances. La structure géographique observée des
différents allèles de l’ADNcp sera donc généralement plus uniforme que celle de l’ADNmt,
car le flux génique est plus important et les allèles peuvent rapidement être disséminés sur
de grandes distances (Ennos, 1994; Petit et al., 2005).
1.4 Espèce à l’étude : le mélèze laricin
1.4.1 Le genre Larix
La divergence évolutive du genre Larix date de l’époque du Miocène. Le genre est
donc relativement récent dans l’arbre phylogénique des conifères (Wang et al., 2000). Il
comprend 11 espèces, dont trois sont retrouvées en Amérique du Nord (Larix laricina [Du
Roi] K. Koch, Larix lyallii Parl. et Larix occidentalis Nutt.). Ces trois espèces forment un
groupe phylogénétiquement distinct des autres espèces du genre Larix (Gros-Louis et al.,
11
2005). Le mélèze subalpin (L. lyallii) et le mélèze occidental (L. occidentalis) ont des aires
de répartition restreintes au sud-ouest du Canada et au nord-ouest des États-Unis,
respectivement. Les aires de répartition de ces deux espèces ne chevauchent pas celle du
mélèze laricin (L. laricina, Figure 1.2). Des études phylogéographiques ont été réalisées sur
diverses espèces de mélèze asiatiques et européennes comme Larix sibirica Ledeb.,
(Semerikov et al., 2007; Araki et al., 2008), L. gmelinii Rupr. (Khatab et al., 2008;
Polezhaeva et al., 2010), ainsi que L. cajanderi, L. sukaczewii et L. kaempferi (Araki et al.,
2008; Khatab et al., 2008). À l’heure actuelle, aucune étude phylogéographique n’a été
réalisée sur les espèces de mélèze du continent nord-américain. Quelques marqueurs
permettant d’identifier les différentes espèces ont été développés chez Larix pour les trois
génomes (Nadeem et al., 2003; Gros-Louis et al., 2005). Cependant, peu de polymorphismes
du génome mitochondrial ont été trouvés, ce qui indique que même au niveau interspécifique,
Larix possède une faible diversité chez ce génome.
1.4.2 Larix laricina
L'aire de répartition transcontinentale du mélèze laricin (mélèze d'Amérique, L.
laricina) s'étend longitudinalement des Maritimes et Terre-Neuve/Labrador jusqu’au Yukon,
allant du sud de la Nouvelle-Angleterre aux Grands Lacs, en passant par le Québec, l’Ontario,
quelques états du centre-nord des États-Unis d’Amérique, les provinces des Prairies
(Manitoba, Saskatchewan et Alberta) et une partie des territoires du Nord-Ouest (Figure 1.2).
À cela s’ajoute la partie centrale de l’Alaska qui est disjointe du reste de l’aire de répartition
(Ritchie, 1987). Une répartition aussi étendue fait du mélèze laricin une espèce d’intérêt en
phylogéographie comparative puisque son aire de distribution géographique chevauche
plusieurs facteurs de vicariance potentiels. De plus, L. laricina couvre l’aire de nombreuses
autres espèces boréales, ce qui peut permettre d’identifier des facteurs communs de
vicariance à l’échelle transcontinentale (Bermingham & Moritz, 1998; Jaramillo-Correa et
al., 2009). Le mélèze laricin se retrouve dans plusieurs assemblages forestiers comme espèce
compagne, dans des communautés dominées par d’autres espèces (ex. : épinette noire,
épinette blanche, sapin baumier). Son principal compétiteur est l’épinette noire qui est plus
compétitive. Il possède la capacité de pousser sur plusieurs types de sol, mais est plus souvent
12
retrouvé dans les tourbières (Burns & Honkala, 1990). Les populations de mélèze sont en
général petites et discontinues (Cheliak et al., 1988).
Figure 1.2. Carte représentant l’aire de répartition des trois espèces du genre Larix en
Amérique du Nord. L’aire de répartition est montrée en vert pour Larix laricina, en bleu pour
Larix lyallii et en rouge pour Larix occidentalis.
1.4.2.1 Éco-physiologie de l’espèce
Lorsque l’on monte en latitude à travers la forêt boréale fermée nord-américaine, on
observe une transition du couvert forestier allant d’une forêt mixte, composée d'un mélange
de conifères et de feuillus, vers des peuplements de plus en plus dominés par les conifères
généralement sempervirents (à l'exception du mélèze). La température basse du sol ayant des
effets limitants sur la décomposition, la minéralisation et l’absorption de l’eau et des
nutriments, cette caractéristique de sempervirence permet de conserver les ressources
investies dans le feuillage lors de la saison de croissance et ainsi de réduire le stress sur
l’individu (Chabot & Hicks, 1982; Gower & Richards, 1990). Les mélèzes se différencient
des autres espèces de conifères par le fait qu’ils perdent leurs aiguilles pendant la saison
froide où l’ensoleillement est plus court. Ils arrivent cependant à coloniser les mêmes
environnements que les espèces à aiguilles pérennes. Il a été démontré que les espèces à
aiguilles décidues produisent des aiguilles avec un taux de photosynthèse plus grand par unité
13
de masse que les espèces à aiguilles pérennes (Chabot & Hicks, 1982; Gower et al., 1989).
Cela confère aux espèces décidues une saison de croissance où la productivité primaire sera
beaucoup plus élevée et pourra donc compenser la perte en carbone associée à la chute des
aiguilles. Le mélèze laricin est une espèce monoïque et peut s’établir et se reproduire dans
des conditions très variables. Dépendamment du moment de l’année et de la latitude, les
températures dans l’aire de répartition peuvent varier de -29°C en janvier à 24°C en juillet.
L. laricina est une espèce boréale pionnière que l'on retrouve habituellement en début
de succession écologique (Johnston, 1990). Elle est efficace pour recoloniser rapidement les
sites après feu (Eyre, 1980). Elle est intolérante à l’ombre, ce qui la rend peu compétitive en
fin de succession (Henry et al., 1973). Elle peut toutefois se maintenir comme espèce
forestière dominante en absence de compétition interspécifique dans des milieux stressants
(ex. : tourbières, affleurements de serpentine, limite des arbres). Les peuplements matures de
L. laricina existant sur des milieux productifs et bien drainés auraient été décimés par des
épidémies de tenthrède du mélèze lors des derniers siècles. La larve de la tenthrède cause la
défoliation des individus en début saison et lorsque l’épidémie s’échelonne sur plusieurs
saisons de croissance, l’arbre ne peut compenser et est éliminé. Les peuplements affectés
peuvent difficilement demeurer compétitifs. Ils sont repoussés et restreints aux milieux peu
productifs et mal drainés où la compétition est plus faible (Perron & Ménétrier, 2013).
Les graines, disséminées par le vent, parcourent habituellement une distance de moins
de deux fois la hauteur de l’arbre (Brown et al., 1988). Bien que le pollen de Larix arrive à
être disséminé sur de longues distances, son potentiel de dispersion est en général faible
puisqu’il ne possède pas de ballonnets. Il est habituellement retrouvé dans un rayon proximal
de l’arbre (Richard, 1993; Jackson et al., 1997). Puisque sa production de pollen est faible il
est peu représenté dans les carottes de sédiments. La présence de pollen de Larix dans une
carotte de sédiments est donc considérée suffisante pour indiquer la présence d’une espèce
du genre à un endroit et un âge donné (Lisitsyna et al., 2011).
1.4.2.2 Diversité génétique
L’analyse de 19 loci nucléaires d’isoenzymes sur un échantillonnage pris sur
l’ensemble de l’aire de répartition indique que L. laricina possède une diversité génétique
14
élevée (surtout au niveau intrapopulationnel) et que les populations de l’est et de l’ouest du
lac Supérieur seraient génétiquement distinctes (Cheliak et al., 1988). Une autre étude basée
sur trois loci d’isoenzymes a montré que les populations géographiquement proches
présentaient une similitude quant à leurs fréquences alléliques tout en ayant une diversité
allélique semblable aux autres conifères nord-américains (Knowles et al., 1992).
1.4.2.3 Hybridation
L’hybridation interspécifique est un phénomène commun dans le genre Larix,
notamment chez les espèces d’Europe et d’Asie (Semerikov & Lascoux, 2003). Elle influe
de façon importante sur la diversité génétique des espèces de Larix de ces régions du globe.
Cependant, en Amérique du Nord, l’hybridation entre L. laricina et ses voisins L. occidentalis
et L. lyalii est peu documentée. Même si l’hybridation est possible, elle est seulement
réalisable de façon artificielle puisque leurs moments de floraison sont décalés (Pâques,
1992). De plus, ces espèces possèdent des aires de répartition allopatriques. L’hybridation en
milieu naturel est donc peu probable entre L. laricina et ses congénères.
1.5 Objectifs et hypothèses
L’objectif de l’étude sera d’utiliser des marqueurs génétiques de génomes
cytoplasmiques et le registre fossile pour retracer l’histoire postglaciaire du mélèze nord-
américain Larix laricina (Du Roi) K. Koch.
Étant donnée la faible diversité génétique du génome mitochondrial préalablement
détectée entre les différentes espèces du genre Larix (Gros-Louis et al. 2005), la première
hypothèse veut que l’on détecte peu de polymorphismes génétiques au niveau intraspécifique
dans le génome mitochondrial de L. laricina.
Les régions adjacentes de l’aire de répartition transcontinentale du mélèze laricin
englobent plusieurs facteurs de vicariance potentiels pouvant avoir conduit à l’isolement
géographique des populations et à leur différenciation génétique durant la dernière période
glaciaire. Par conséquent, la deuxième hypothèse veut que l’on détecte une structure
génétique au sein des populations suivant un patron est-ouest et reflétant l’existence de
plusieurs populations glaciaires génétiquement distinctes. Un tel patron géographique a déjà
15
été rapporté chez la plupart des conifères boréaux à grande distribution et qui sont
sympatriques avec le mélèze laricin (Jaramillo-Correa et al., 2004; Godbout et al., 2005; de
Lafontaine et al., 2010; Gérardi et al., 2010; Cinget et al., 2015).
Considérant que la dissémination du génome chloroplastique se fait par le biais du
pollen et de la graine, et que le génome mitochondrial n’est disséminé que par la graine, la
troisième hypothèse veut que l’on s’attende à observer des patrons phylogéographiques
différents dépendamment du génome étudié. Les différences de fréquences alléliques entre
les populations devraient également être plus prononcées pour les polymorphismes du
génome mitochondrial que pour ceux du génome chloroplastique en raison d'un flux génique
plus faible.
16
1.6 Littérature citée
Allendorf, F.W. (1986) Genetic drift and the loss of alleles versus heterozygosity. Zoo
Biology, 5, 181–190.
Anderson, L.L., Hu, F.S., Nelson, D.M., Petit, R.J. & Paige, K.N. (2006) Ice-age endurance:
DNA evidence of a white spruce refugium in Alaska. Proceedings of the National
Academy of Sciences of the United States of America, 103, 12447–12450.
Araki, N.H.T., Khatab, I.A., Hemamali, K., Inomata, N., Wang, X.R. & Szmidt, A.E. (2008)
Phylogeography of Larix sukaczewii Dyl. and Larix sibirica L. inferred from
nucleotide variation of nuclear genes. Tree Genetics & Genomes, 4, 611–623.
Arbogast, B.S. & Kenagy, G.J. (2001) Comparative phylogeography as an integrative
approach to historical biogeography. Journal of Biogeography, 28, 819–825.
Avise, J.C. (2000) Phylogeography: The history and formation of species. Harvard
University Press.
Avise, J.C., Arnold, J., Ball, R.M., Bermingham, E., Lamb, T., Neigel, J.E., Reeb, C.A. &
Saunders, N.C. (1987) Intraspecific phylogeography - The mitochondrial-DNA
bridge between population-genetics and systematics. Annual Review of Ecology and
Systematics, 18, 489–522.
Bermingham, E. & Moritz, C. (1998) Comparative phylogeography: concepts and
applications. Molecular Ecology, 7, 367–369.
Birks, H.H. (2003) The importance of plant macrofossils in the reconstruction of Lateglacial
vegetation and climate: examples from Scotland, western Norway, and Minnesota,
USA. Quaternary Science Reviews, 22, 453–473.
Birky, C.W.J., Fuerst, P. & Maruyama, T. (1989) Organelle gene diversity under migration,
mutation and drift: Equilibrium expectations, approach to equilibrium, effects of
heteroplasmic cells, and comparison to nuclear genes. Genetics, 121, 613–627.
Bousquet, J., Strauss, S.H. & Li, P. (1992) Complete congruence between morphological and
rbcL-based molecular phylogenies in birches and related species (Betulaceae).
Molecular Biology and Evolution, 9, 1076–1088.
Brown, K.R., Zobel, D.B. & Zasada, J.C. (1988) Seed dispersal, seedling emergence, and
early survival of Larix laricina (DuRoi) K. Koch in the Tanana Valley, Alaska.
Canadian Journal of Forest Research, 18, 306–314.
Brubaker, L.B., Anderson, P.M., Edwards, M.E. & Lozhkin, A.V. (2005) Beringia as a
glacial refugium for boreal trees and shrubs: new perspectives from mapped pollen
data. Journal of Biogeography, 32, 833–848.
Burns, R.M. & Honkala, B.H. (1990) Silvics of North America. Forest Service, United States
Department of Agriculture, Washington, D.C.
Chabot, B.F. & Hicks, D.J. (1982) The ecology of leaf life spans. Annual Review of Ecology
and Systematics, 13, 229–259.
Cheliak, W.M., Wang, J. & Pitel, J.A. (1988) Population structure and genic diversity in
tamarack, Larix laricina (DuRoi) K. Koch. Canadian Journal of Forest Research,
18, 1318–1324.
Cinget, B., Gérardi, S., Beaulieu, J. & Bousquet, J. (2015) Less pollen-mediated gene flow
for more signatures of glacial lineages: congruent evidence from balsam fir cpDNA
and mtDNA for multiple refugia in eastern and central North America. PLoS
ONE 10(4): e0122815 (25p.).
17
Comes, H.P. & Kadereit, J.W. (1998) The effect of Quaternary climatic changes on plant
distribution and evolution. Trends in Plant Science, 3, 432–438.
Davis, M.B. & Shaw, R.G. (2001) Range shifts and adaptive responses to Quaternary climate
change. Science, 292, 673–679.
Davis, M.B., Schwartz, M.W. & Woods, K. (1991) Detecting a species limit from pollen in
sediments. Journal of Biogeography, 18, 653–668.
de Lafontaine, G., Turgeon, J. & Payette, S. (2010) Phylogeography of white spruce (Picea
glauca) in eastern North America reveals contrasting ecological trajectories. Journal
of Biogeography, 37, 741–751.
Di Rienzo, A., Peterson, A.C., Garza, J.C., Valdes, A.M., Slatkin, M. & Freimer, N.B. (1994)
Mutational processes of simple-sequence repeat loci in human populations.
Proceedings of the National Academy of Sciences, 91, 3166–3170.
Dong, J. & Wagner, D.B. (1993) Taxonomic and population differentiation of mitochondrial
diversity in Pinus banksiana and Pinus contorta. Theoretical and Applied Genetics,
86, 573–578.
Downie, S. & Palmer, J. (1992) Use of Chloroplast DNA Rearrangements in Reconstructing
Plant Phylogeny. Molecular Systematics of Plants (ed. by P.S. Soltis, D.E. Soltis and
J.J. Doyle), pp. 14–35. Springer, New York, USA.
Dyke, A.S. (2004) An outline of North American deglaciation with emphasis on central and
northern Canada. Quaternary Glaciations: Extent and Chronology, Part II (ed. by J.
Ehlers and P.L. Gibbard), pp. 373–424. Elsevier, Amsterdam, Netherlands.
Dyke, A.S., Andrews, J.T., Clark, P.U., England, J.H., Miller, G.H., Shaw, J. & Veillette, J.J.
(2002) The Laurentide and Innuitian ice sheets during the Last Glacial Maximum.
Quaternary Science Reviews, 21, 9–31.
Ennos, R.A. (1994) Estimating the relative rates of pollen and seed migration among plant
populations. Heredity, 72, 250–259.
Eyre, F.H. (1980) Forest Cover Types of the United States and Canada. Society of American
Foresters, Washington, D.C., USA.
Gavin, D.G., Fitzpatrick, M.C., Gugger, P.F., Heath, K.D., Rodríguez‐Sánchez, F.,
Dobrowski, S.Z., Hampe, A., Hu, F.S., Ashcroft, M.B., Bartlein, P.J., Blois, J.L.,
Carstens, B.C., Davis, E.B., de Lafontaine, G., Edwards, M.E., Fernandez, M.,
Henne, P.D., Herring, E.M., Holden, Z.A., Kong, W.-s., Liu, J., Magri, D., Matzke,
N.J., McGlone, M.S., Saltré, F., Stigall, A.L., Tsai, Y.-H.E. & Williams, J.W. (2014)
Climate refugia: joint inference from fossil records, species distribution models and
phylogeography. New Phytologist, 204, 37-54.
Gérardi, S., Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2010) From glacial refugia
to modern populations: new assemblages of organelle genomes generated by
differential cytoplasmic gene flow in transcontinental black spruce. Molecular
Ecology, 19, 5265–5280.
Godbout, J., Beaulieu, J. & Bousquet, J. (2010) Phylogeographic structure of jack pine (Pinus
banksiana; Pinaceae) supports the existence of a coastal glacial refugium in
northeastern North America. American Journal of Botany, 97, 1903–1912.
Godbout, J., Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2005) A mitochondrial DNA
minisatellite reveals the postglacial history of jack pine (Pinus banksiana), a broad-
range North American conifer. Molecular Ecology, 14, 3497–3512.
Godbout, J., Fazekas, A., Newton, C.H., Yeh, F.C. & Bousquet, J. (2008) Glacial vicariance
in the Pacific Northwest: evidence from a lodgepole pine mitochondrial DNA
18
minisatellite for multiple genetically distinct and widely separated refugia. Molecular
Ecology, 17, 2463–2475.
Gower, S.T. & Richards, J.H. (1990) Larches: deciduous conifers in an evergreen world.
Bioscience, 40, 818–826.
Gower, S.T., Grier, C.C. & Vogt, K.A. (1989) Aboveground production and N and P use by
Larix occidentalis and Pinus contorta in the Washington Cascades, USA. Tree
Physiology, 5, 1–11.
Gros-Louis, M.C., Bousquet, J., Pâques, L.E. & Isabel, N. (2005) Species-diagnostic markers
in Larix spp. based on RAPDs and nuclear, cpDNA, and mtDNA gene sequences,
and their phylogenetic implications. Tree Genetics & Genomes, 1, 50–63.
Henry, R., Brooks, B. & Davis, C. (1973) Population density of Larix laricina in a sphagnum
bog mat habitat. Michigan Academician, 5, 529–535.
Hewitt, G. (2000) The genetic legacy of the Quaternary ice ages. Nature, 405, 907–913.
Hopkins, D.M. (1982) Aspects of the paleogeography of Beringia during the late Pleistocene.
Paleoecology of Beringia. Academic Press, New York, 3–28.
Humphries, C.J. (2000) Form, space and time; which comes first? Journal of Biogeography,
27, 11–15.
Ibrahim, K.M., Nichols, R.A. & Hewitt, G.M. (1996) Spatial patterns of genetic variation
generated by different forms of dispersal. Heredity, 77, 282–291.
Jackson, S.T., Overpeck, J.T., Webb, T., Keattch, S.E. & Anderson, K.H. (1997) Mapped
plant-macrofossil and pollen records of late quaternary vegetation change in Eastern
North America. Quaternary Science Reviews, 16, 1–70.
Jackson, S.T., Webb, R.S., Anderson, K.H., Overpeck, J.T., Webb, T., Williams, J.W. &
Hansen, B.C.S. (2000) Vegetation and environment in Eastern North America during
the Last Glacial Maximum. Quaternary Science Reviews, 19, 489–508.
Jaramillo-Correa, J.P. & Bousquet, J. (2003) New evidence from mitochondrial DNA of a
progenitor-derivative species relationship between black spruce and red spruce.
American Journal of Botany, 90, 1801–1806.
Jaramillo-Correa, J.P. & Bousquet, J. (2005) Mitochondrial genome recombination in the
zone of contact between two hybridizing conifers. Genetics, 171, 1951–1962.
Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2004) Variation in mitochondrial DNA
reveals multiple distant glacial refugia in black spruce (Picea mariana), a
transcontinental North American conifer. Molecular Ecology, 13, 2735–2747.
Jaramillo-Correa, J.P., Beaulieu, J., Khasa, D.P. & Bousquet, J. (2009) Inferring the past
from the present phylogeographic structure of North American forest trees: seeing
the forest for the genes. Canadian Journal of Forest Research, 39, 286–307.
Johnston, W.F. (1990) Larix laricina (Du Roi) K. Koch. Silvics of North America: Vol. 1
Conifers (ed. by R.M. Burns and B.H. Honkala), pp. 26–35. Agriculture handbook
654, US Department of Agriculture, Forest Service, Washington, D.C., USA.
Keppel, G., Van Niel, K.P., Wardell‐Johnson, G.W., Yates, C.J., Byrne, M., Mucina, L.,
Schut, A.G., Hopper, S.D. & Franklin, S.E. (2012) Refugia: identifying and
understanding safe havens for biodiversity under climate change. Global Ecology and
Biogeography, 21, 393–404.
Khatab, I.A., Ishiyama, H., Inomata, N., Wang, X.R. & Szmidt, A.E. (2008) Phylogeography
of Eurasian Larix species inferred from nucleotide variation in two nuclear genes.
Genes & Genetic Systems, 83, 55–66.
19
Knowles, P., Perry, D.J. & Foster, H.A. (1992) Spatial genetic structure in two tamarack
Larix laricina (Du Roi) K. Koch populations with differing establishment histories.
Evolution, 46, 572–576.
Laroche, J., Li, P., Maggia, L. & Bousquet, J. (1997) Molecular evolution of angiosperm
mitochondrial introns and exons. Proceedings of the National Academy of Sciences
of the United States of America, 94, 5722–5727.
Lisitsyna, O.V., Giesecke, T. & Hicks, S. (2011) Exploring pollen percentage threshold
values as an indication for the regional presence of major European trees. Review of
Palaeobotany and Palynology, 166, 311–324.
MacArthur, R.H. (1967) The theory of island biogeography. Princeton University Press,
Princeton, USA.
McLachlan, J.S., Clark, J.S. & Manos, P.S. (2005) Molecular indicators of tree migration
capacity under rapid climate change. Ecology, 86, 2088–2098.
Mix, A.C., Bard, E. & Schneider, R. (2001) Environmental processes of the ice age: land,
oceans, glaciers (EPILOG). Quaternary Science Reviews, 20, 627–657.
Nadeem, S., Jaquish, B., Newton, C. & Khasa, D.P. (2003) Use of diagnostic SSR markers
for identification of Larix lyallii and L. occidentalis (Pinaceae). Edinburgh Journal
of Botany, 60, 49–56.
Neale, D.B. & Sederoff, R.R. (1988) Inheritance and evolution of conifer organelle genomes.
Genetic Manipulation of Woody Plants (ed. by J.W. Hanover, D.E. Keathley, C.M.
Wilson and G. Kuny), pp. 251–264, Michigan State University, East Lansing, USA.
Nei, M. (1973) Analysis of gene diversity in subdivided populations. Proceedings of the
National Academy of Sciences of the United States of America, 70, 3321–3323.
Nystedt, B., Street, N.R., Wetterbom, A., Zuccolo, A., Lin, Y.-C., Scofield, D.G., Vezzi, F.,
Delhomme, N., Giacomello, S. & Alexeyenko, A. (2013) The Norway spruce genome
sequence and conifer genome evolution. Nature, 497, 579–584.
Pâques, L.E. (1992) Performance of vegetatively propagated Larix decidua, L. kaempferi and
L. laricina hybrids. Annals of Forest Science, 49, 63–74.
Parducci, L., Szmidt, A.E., Madaghiele, A., Anzidei, M. & Vendramin, G.G. (2001) Genetic
variation at chloroplast microsatellites (cpSSRs) in Abies nebrodensis (Lojac.) Mattei
and three neighboring Abies species. Theoretical and Applied Genetics, 102, 733–
740.
Perron, M. & Ménétrier, J. (2013) Le mélèze laricin. Le guide sylvicole du Québec - Tome 1
- Les fondements biologiques de la sylviculture, pp. 132–133. Les publications du
Québec, Québec, Canada.
Petit, R.J. & Vendramin, G.G. (2007) Plant phylogeography based on organelle genes: an
introduction. Phylogeography of Southern European Refugia (ed. by S. Weiss and N.
Ferrand), pp. 23–97. Springer, New York, USA.
Petit, R.J., Duminil, J., Fineschi, S., Hampe, A., Salvini, D. & Vendramin, G.G. (2005)
Invited review: comparative organization of chloroplast, mitochondrial and nuclear
diversity in plant populations. Molecular Ecology, 14, 689–701.
Pielou, E.C. (1991) After the ice age: the return of life to glaciated North America. The
University of Chicago Press, Chicago, USA.
Polezhaeva, M.A., Lascoux, M. & Semerikov, V.L. (2010) Cytoplasmic DNA variation and
biogeography of Larix Mill. in Northeast Asia. Molecular Ecology, 19, 1239–1252.
Pons, O. & Petit, R.J. (1996) Measuring and testing genetic differentiation with ordered
versus unordered alleles. Genetics, 144, 1237–1245.
20
Provan, J. & Bennett, K.D. (2008) Phylogeographic insights into cryptic glacial refugia.
Trends in Ecology & Evolution, 23, 564–571.
Richard, P.J.H. (1993) Origine et dynamique postglaciaire de la forêt mixte au Québec.
Review of Palaeobotany and Palynology, 79, 31–68.
Ritchie, J.C. (1987) Postglacial Vegetation of Canada. Cambridge University Press,
Cambridge, United Kingdom.
Semerikov, V.L. & Lascoux, M. (2003) Nuclear and cytoplasmic variation within and
between Eurasian Larix (Pinaceae) species. American Journal of Botany, 90, 1113–
1123.
Semerikov, V.L., Iroshnikov, A.I. & Lascoux, M. (2007) Mitochondrial DNA variation
pattern and postglacial history of the Siberian larch (Larix sibirica Ledeb.). Russian
Journal of Ecology, 38, 147–154.
Shafer, A.B.A., Cullingham, C.I., Cote, S.D. & Coltman, D.W. (2010) Of glaciers and
refugia: a decade of study sheds new light on the phylogeography of northwestern
North America. Molecular Ecology, 19, 4589–4621.
Slatkin, M. (1995) A measure of population subdivision based on microsatellite allele
frequencies. Genetics, 139, 457–462.
Soltis, D.E., Morris, A.B., McLachlan, J.S., Manos, P.S. & Soltis, P.S. (2006) Comparative
phylogeography of unglaciated eastern North America. Molecular Ecology, 15,
4261–4293.
Taberlet, P., Fumagalli, L., Wust-Saucy, A.G. & Cosson, J.F. (1998) Comparative
phylogeography and postglacial colonization routes in Europe. Molecular Ecology,
7, 453–464.
Tautz, D. (1989) Hypervariability of simple sequences as a general source for polymorphic
DNA markers. Nucleic Acids Research, 17, 6463–6471.
Thompson, J.N., Woodruff, R.C. & Huai, H. (1998) Mutation rate: a simple concept has
become complex. Environmental and Molecular Mutagenesis, 32, 292–300.
Tremblay, N.O. & Schoen, D.J. (1999) Molecular phylogeography of Dryas integrifolia:
glacial refugia and postglacial recolonization. Molecular Ecology, 8, 1187–1198.
Vendramin, G.G., Lelli, L., Rossi, P. & Morgante, M. (1996) A set of primers for the
amplification of 20 chloroplast microsatellites in Pinaceae. Molecular Ecology, 5,
595–598.
Wang, X.-Q., Tank, D.C. & Sang, T. (2000) Phylogeny and divergence times in Pinaceae:
evidence from three genomes. Molecular Biology and Evolution, 17, 773–781.
Webb, T. & Bartlein, P.J. (1992) Global changes during the last 3 million years: climatic
controls and biotic responses. Annual Review of Ecology and Systematics, 23, 141–
173.
Wei, X.-X., Beaulieu, J., Khasa, D.P., Vargas-Hernández, J., López-Upton, J., Jaquish, B. &
Bousquet, J. (2011) Range-wide chloroplast and mitochondrial DNA imprints reveal
multiple lineages and complex biogeographic history for Douglas-fir. Tree Genetics
& Genomes, 7, 1025–1040.
Wolfe, K.H., Li, W.H. & Sharp, P.M. (1987) Rates of nucleotide substitution vary greatly
among plant mitochondrial, chloroplast, and nuclear DNAs. Proceedings of the
National Academy of Sciences of the United States of America, 84, 9054–9058.
Wright, S. (1932) The roles of mutation, inbreeding, crossbreeding and selection in
evolution. Proceedings of the Sixth International Congress on Genetics, pp. 356–366.
Wright, S. (1949) The genetical structure of populations. Annals of Eugenics, 15, 323–354.
21
Yi, X., Gao, L., Wang, B., Su, Y.-J. & Wang, T. (2013) The Complete Chloroplast Genome
Sequence of Cephalotaxus oliveri (Cephalotaxaceae): Evolutionary Comparison of
Cephalotaxus Chloroplast DNAs and Insights into the Loss of Inverted Repeat Copies
in Gymnosperms. Genome Biology and Evolution, 5, 688–698.
Zazula, G.D., Telka, A.M., Harington, C.R., Schweger, C.E. & Mathewes, R.W. (2006) New
spruce (Picea spp.) macrofossils from Yukon Territory: implications for Late
Pleistocene refugia in Eastern Beringia. Arctic, 59, 391–400.
23
Chapitre 2 – Histoire postglaciaire du mélèze laricin
Cette étude sera soumise à un périodique scientifique sous le titre « Postglacial history of
transcontinental tamarack (Larix laricina) using cytoplasmic DNA variation and the fossil
pollen record » et sera cosignée par E. Warren, G. de Lafontaine, S. Gérardi, S. Senneville,
J. Beaulieu, M. Perron, J.P. Jaramillo-Correa et J. Bousquet.
24
2.1 Résumé
La structure des populations de mélèze d'Amérique (mélèze laricin; Larix laricina
[Du roi] K. Koch) a été étudiée à l’aide de polymorphismes de l’ADN mitochondrial et
chloroplastique. Deux populations, de l’Alaska et du Labrador, étaient génétiquement
distinctes des autres, suggérant l'existence de refuges glaciaires nordiques à ces endroits. La
répartition spatiale des haplotypes a révélé deux groupes de populations occupant
respectivement l’est et l’ouest de l'aire de répartition. Ces groupes témoigneraient de la
présence de deux lignées glaciaires génétiquement distinctes provenant d’autant de refuges
localisés au sud de l'inlandsis Laurentidien. Les données polliniques ont permis de confirmer
la présence de refuges glaciaires au sud des Grands Lacs et à l’ouest des Appalaches, en plus
de possibles refuges en Alaska et au Labrador. La compétition interspécifique avec Picea et
Abies lors de la colonisation aurait influencé la structure de population moderne de Larix
dans l’ouest nord-américain.
25
Postglacial history of transcontinental tamarack (Larix laricina) using cytoplasmic
DNA variation and the fossil pollen record
Emile Warren*, Guillaume de Lafontaine*, Sébastien Gérardi*, Sauphie Senneville*, Jean
Beaulieu*†, Martin Perron‡, Juan-Pablo Jaramillo-Correa*§ and Jean Bousquet*
* Canada Research Chair in Forest and Environmental Genomics, Center for Forest
Research and Institute for Systems and Integrative Biology, 1030 Avenue de la Médecine,
Université Laval, Québec, QC, Canada G1V0A6. †Natural Resources Canada, Canadian
Wood Fibre Centre, 1055 du P.E.P.S., PO Box 10380 Québec, QC, Canada G1V 4C7.
‡Ministère des Forêts, de la Faune et des Parcs du Québec, Direction de la recherche
forestière, 2700, rue Einstein, Sainte-Foy, QC G1P 3W8, Canada. §Present address:
Departamento de Ecología Evolutiva, Instituto de Ecología, Universidad Nacional
Autónoma de México, Apartado Postal 70-275, México, D.F., Mexico.
2.2 Abstract
Aim: Tamarack (Larix laricina) is an early-successional boreal tree species within the
spruce-fir dominated forest. The aim was to uncover the rangewide biogeographic history of
tamarack since the last glacial with a focus on assessing the putative genetic imprint of
interspecific competition during postglacial migration.
Location: Forty-five locations were sampled across the transcontinental range spanning the
North American boreal forest from Labrador to Alaska.
Methods: A total of 621 trees were scanned for mitochondrial and chloroplast genetic
polymorphisms used to reveal geographical patterns of genetic diversity, differentiation, and
cpDNA population structure. Published pollen records were analyzed to assess the
chronology of postglacial colonization of Larix sp. relative to more competitive tree taxa,
Picea sp. and Abies sp..
Results: Polymorphism was found at one mtDNA locus, yiedling two mitotypes. All but
three populations were fixed for a single mitotype. The rare mitotype was predominant in the
easternmost population from Labrador. Three polymorphic microsatellite loci found within
the chloroplast genome (cpSSRs) yielded 24 chlorotypes. A Bayesian assignment test
detected three cpDNA genetic groups in eastern and western North America, as well as in
Alaska. Higher level of cpDNA interpopulation differentiation was detected within the
26
western part of the range relative to eastern North America. Pollen records indicate that Larix
colonized western North America at least 2000 years after Picea and Abies, but shortly
preceded them in eastern North America.
Main conclusions: The three cpDNA groups and the unusual mitotype composition of a
Labrador population are interpreted as the genetic imprints of distinct glacial lineages. While
two of them persisted south of the Laurentide ice sheet, the data provide support for northern
refugia in Beringia and Labrador. Larix establishment was probably hindered by earlier
colonization by more competitive taxa Abies and Picea in western North America. This likely
resulted in higher genetic differentiation among populations in the western part of the range.
These results provide support for a putative role of interspecific competition in structuring
the standing genetic variation at the time of postglacial colonization.
Keywords: chloroplast DNA, conifers, genetic diversity, glacial refugia, mitochondrial DNA,
phylogeography, pollen analysis, postglacial colonization, tamarack (Larix laricina)
2.3 Introduction
Climatic oscillations of the Quaternary ice ages have caused recurrent reorganizations of the
Earth’s biota, including modifications in species abundance, large scale displacements of
taxa, and alteration of biodiversity patterns at all levels (Webb & Bartlein, 1992; Davis &
Shaw, 2001). Specifically, the last glacial event is largely responsible for the current
distribution of species genetic diversity (Hewitt, 2000). In North America, the expansion of
the ice sheets forced species to migrate southward in suitable environments (i.e., glacial
refugia), while species recolonized previously inhospitable territories when the ice sheets
receded (Ritchie, 1987). The genetic imprint of these range contractions and expansions is
still recognizable in most North American boreal conifers (Jaramillo-Correa et al., 2004;
Godbout et al., 2005, 2008, 2012; de Lafontaine et al., 2010; Gérardi et al., 2010; Cinget et
al., 2015).
Broadscale phylogeographic surveys of North American boreal conifers revealed
several common glacial refugia and postglacial migration pathways (reviewed in Jaramillo-
Correa et al., 2009). The distribution of DNA variation typically shows distinct lineages in
the central and eastern part of the continent. These are thought to originate from two glacial
27
refugia separated by the Appalachians Mountains (Jaramillo-Correa et al., 2009). However,
molecular and fossil evidence indicating that other populations also persisted outside of these
southern macrorefugia accumulate. Fossil and molecular data suggest that a number of boreal
tree species persisted in Beringia (Brubaker et al., 2005; Anderson et al., 2006; Zazula et al.,
2006; Gérardi et al., 2010). Parts of Labrador were also free of ice during the last glacial
maximum (LGM; Ives, 1960) and molecular evidence suggests the persistence of Picea
mariana (Jaramillo-Correa et al., 2004) and Abies balsamea (Cinget et al., 2015) in this
region. A coastal microrefugium along the shelf of Nova Scotia and Magdalen Islands in the
Gulf of St. Lawrence was also suggested from phylogeographic evidence (Walter &
Epperson, 2005; Godbout et al., 2010).
As for most Pinaceae, larch (Larix sp.) mitochondrial and chloroplast genomes are
transmitted bilaterally. Mitochondrial DNA (mtDNA) is inherited by the female gamete
(Dong & Wagner, 1993) and is dispersed by seeds usually on short distances (Petit &
Vendramin, 2007), while chloroplast DNA (cpDNA) is paternally inherited and dispersed
sequentially by pollen and seeds (Neale & Sederoff, 1988) over larger distances due to the
higher dispersal potential of pollen relative to seeds. As a result, chlorotype frequencies tend
to homogenize at a much faster rate than mitotype frequencies among Pinaceae (Burban &
Petit, 2003; Gérardi et al., 2010; Godbout et al., 2010). However, mtDNA polymorphism is
generally scarce since plant mtDNA is well-conserved with a slow nucleotide substitution
rate (Wolfe et al., 1987; Laroche et al., 1997). This is especially true in the Larix genus,
where only few mtDNA sequence polymorphisms were found at the interspecific level (Gros-
Louis et al., 2005).
Tamarack (eastern larch; Larix laricina [Du Roi] K. Koch) is a widespread North
American conifer ranging from Labrador to Alaska, with a discontinuity in Yukon (Rowe &
Halliday, 1972; Ritchie, 1987). The transcontinental range of tamarack overlaps that of
several other largely-distributed boreal conifer species (e.g., Picea mariana, Picea glauca,
Pinus banksiana, Abies balsamea), with whom it could share phylogeographic patterns due
to common past vicariance factor. Larix laricina is an early-successional, shade intolerant
species, which typically hinders its competitive ability during late ecological succession.
Although larch is tolerant to a wide range of edaphic and climatic conditions, old-growth
28
monospecific stands are restricted to sites characterized by poorly drained soils (e.g., fens
and bogs), low-nutrients or stressful soils (e.g., serpentine outcrops), and extremely cold and
dry environments (e.g., arctic and alpine treelines) where other boreal tree species cannot
outcompete (Cheliak et al., 1988; Knowles et al., 1992; Payette, 2013). Consequently, it is a
minor component of the extensive spruce-fir dominated boreal forest (Henry et al., 1973;
Johnston 1990) and late-successional populations are typically small and most often
discontinuous over the species range (Cheliak et al., 1988). At least two mutually exclusive
postglacial scenarios can lead to the current biogeographic pattern (Figure 2.1). In a first
scenario (Figure 2.1A), the newly exposed territory following ice sheets retreat was initially
colonized by early successional tree species (e.g., larch). Typically generalists and low
resource-demanding, these species can tolerate a wide range of ecological conditions and
thus establish in most environments (including unproductive or extreme sites). Over time,
late-seral tree species (e.g., spruces and fir) gradually outcompete pioneers on mesic sites,
ultimately restricting the latter to unproductive and extreme sites. Such a scenario implying
that early-successional species were also early colonists during postglacial migration is
commonly assumed (e.g., Matthews, 1992; Petit et al., 2003; Bhagwat & Willis, 2008;
Feurdean et al., 2013; Guichoux et al. 2013). However, it was also suggested that the
chronology and spatial patterns of species postglacial migration was idiosyncratic and
dependent on dispersal opportunities and interspecific competition (Davis, 1981). Hence, it
is also possible that the early postglacial colonists were late-seral species during ecological
succession (Figure 2.1B). In such a case, delayed postglacial establishment of early-
successional species can only occur on restricted unproductive and/or extreme sites since
these species cannot compete with established late-serals on mesic sites. Noteworty, the two
biogeographic scenarios differ only by the chronology of postglacial colonization between
early- and late-successional species (compare Figure 2.1A and 2.1B). In turn, these two
colonization scenarios might leave contrasted long-standing genetic imprints still traceable
in modern populations.
29
Figure 2.1. Biogeographic model illustrating contrasted scenarios of postglacial
recolonization by early-successional and late-sucessional species. Large ellipses represent a
modeled terrestrial landscape recently deglaciated (barren landscape; white), colonized by
early-successional species (yellow), or colonized by late-successional species (green). The
four small circles represent unproductive sites where more extreme ecological conditions
with respect to the surrounding landscape prevail. These sites are either virtually treeless
(white circles) or colonized by early-successional, low resource-demanding species (yellow
circles) but late-successional, high resource-demanding, species cannot establish there. Both
scenarios begin with a recently deglaciated barren landscape and end with the current
landscape dominated by late-successional species interspaced by small, disjunct populations
of the early-successional species. The difference between the two scenarios is the chronology
of postglacial recolonization with the recently deglaciated landscape initially colonized by
an early-successional (A) or a late-successional (B) species.
Independent inferences regarding range contractions and expansions can be drawn
from the fossil record. Mapped pollen data displaying continental-scale time-transgressive
increases of arboreal pollen allow tracing back the postglacial migration of boreal species
(Ritchie & MacDonald, 1986; Ritchie, 1987; Payette, 1993). However, because the genus
Larix is underrepresented in fossil pollen assemblages, due to poor pollen dispersal and low
production (Richard, 1993; Jackson et al., 1997; Lisitsyna et al., 2011), a range-wide
biogeographic reconstruction of Larix postglacial history has been overlooked in early
interpretations made by palynologists. Indeed, pollen analysis of the boreal forest was readily
skewed towards better represented taxa (i.e. spruces and pines; MacDonald & Cwynar, 1985;
Ritchie & MacDonald, 1986; McLeod & MacDonald, 1997). Yet, international
30
palaeoecological databases have now made extensive networks of published pollen records
easily accessible. Given the large amount of data available from such public databases, we
expect it should now be possible to use this information to infer locations of glacial refugia
and the timing of post-glacial colonization from paleorecords even for typically poorly
represented taxa such as Larix.
The main objective of this study was to infer the rangewide biogeographic history of
tamarack since the last glacial period by integrating the analysis of genetic data from
cytoplasmic DNA (cpDNA and mtDNA) and published pollen records. Because these two
cytoplasmic genomes experience different levels of gene flow in Pinaceae, a discrepancy
between the spatial distribution of mtDNA and cpDNA variation is expected. Contrary to
other North America boreal conifers, tamarack is typically a poor competitor, early-
successional species. Thus, we expect that the genetic imprint of postglacial colonization will
be similar to that of other transcontinental boreal species if larch establishment was
unimpeded by interspecific competition; that is if larch postglacial colonization occurred
before other boreal species (Figure 2.1A). By contrast, delayed establishment of larch
populations with respect to later seral species (Figure 2.1B) should leave a peculiar genetic
imprint reflecting the historical demographic dynamics at the time of postglacial
colonization. Mapped published pollen data was used to infer the chronology of postglacial
colonization of Larix sp., as well as late-succesionnal Picea sp. and Abies sp. the dominant
conifers of the boreal forest and tamarack’s main competitors.
2.4 Materials and methods
2.4.1 Sampling and DNA Extraction
A total of 621 trees from 45 populations were collected across the transcontinental range of
L. laricina (see Appendices S1 and S2 in Supporting Information), at a rate of 10 to 15 trees
per location. Needles, buds and seeds were sampled from 27, 10, and eight populations,
respectively. All samples were kept frozen at -30°C until DNA extraction. Needles and buds
were dissected, frozen in liquid nitrogen and ground mechanically, while megagametophytes
were extracted from seeds and ground manually. Total DNA was extracted from plant tissues
31
using the DNeasy 96 Plant Kit (Qiagen, Canada), following the protocol provided by the
manufacturer.
2.4.2 MtDNA polymorphism screening, PCR conditions and genotyping
The detection of polymorphism was conducted on a panel of 24 randomly selected trees from
12 populations across the range. Twenty of the 97 mtDNA primer pairs assayed yielded
consistent amplifications (see Appendix S3 in Supporting Information). In order to detect
polymorphism, both strands were sequenced for each of these 20 mtDNA loci using Sanger
technology in a 3730xl DNA Analyzer (Applied Biosystems, USA) and aligned using
BioEdit (Hall, 1999). Polymorphism was found at one locus: a single nucleotide
polymorphism (SNP) located within the nad1(exon1)/trnC-ori intergenic region was detected
(primers F-[CACCAAGTAGTGCTAATTTATTTCT] / R-
[TACTAAGAGTCCTCTCACTACCAAC]). Since these primers were originally designed
on the basis of Cycas taitungensis mitochondrial genome, sequences obtained were analyzed
using a BLASTn search against NCBI sequence database in order to confirm the identity of
the amplified fragment. Next, all samples were amplified, sequenced, and 606 were
successfully genotyped.
The amplification mix for mtDNA contained 1x reaction buffer, 1.5 mM MgCl2 0.2
mM of each dNTPs, 0.65 unit of Platinum Taq polymerase (Invitrogen, USA), 0.2 µM of
each primers and 10 ng of DNA template. PCRs were performed in a Master cycler
(Eppendorf, Canada) through a 3-step program of 1) 5 minute denaturation at 94°C; followed
by 2) 35 cycles of 1 minute denaturation at 94°C, 1 minute annealing step at 55°C and a 2
minutes elongation time at 72°C; topped with 3) 8 minutes final elongation step at 72°C.
2.4.3 CpDNA polymorphism screening, PCR conditions and genotyping
The detection of polymorphism was conducted on the same panel of tree used for the
screening of mtDNA polymorphism. CpDNA regions known to bear simple sequence repeats
(SSRs) in conifers were amplified using 20 primer pairs designed by Vendramin et al. (1996).
Each forward primer was enhanced with a M13 sequence (5’-
CACGACGTTGTAAAACGA-3’) on the 5’ end. Each PCR mix contained 1x reaction
buffer, 1.5 mM MgCl2, 0,1 mM of each dNTPS, 0.16µM of each primers, 0.16µM of
32
fluorescent-labeled M13 primer (M13R/IRD800, MWG-Biotech, USA), 0.5 unit of Platinum
Taq polymerase and 10 ng of template DNA. Amplification was performed through a 3-step
program of 1) 2 minutes denaturation at 94°C; followed by 2) 35 cycles of 30 seconds
denaturation at 94°C, 30 seconds annealing step at 55°C and a 2 minutes elongation time at
72°C; topped with 3) a 5 minutes final elongation step at 72°C.
Fragment length polymorphisms were identified by electrophoretic migration in
polyacrylamide gel using a LI-COR 4200 sequencer (LI-COR, USA). Using the sample panel
of 24 trees, three markers showed polymorphism, namely Pt26081, Pt30204, and Pt63718
(Vendramin et al., 1996). These three loci were amplified for all sampled trees and migrated
in a 3130XL genetic analyser in 50 cm capillary using POP7 polymer and Liz500 ladder.
Fragments were then scored using Peak Scanner v1.0 (Applied Biosystems). Chlorotypes
were obtained by concatenating alleles obtained at the three loci. In total, 589 individuals
were successfully genotyped for cpDNA. Chlorotypes were compared to that of closely
related Larix species in North America (Larix occidentalis and Larix lyallii) in order to detect
possible past introgression and interspecific gene flow.
2.4.4 Genetic diversity, population structure and differentiation
Each of the two mtDNA alleles was considered as a distinct mitotype. Due to the lack of
variation, diversity and differentiation estimates were not calculated for this genome. All
three cpDNA loci were considered simultaneously to define multi-locus chlorotypes. Within-
population chlorotype diversity (HS; equivalent to expected heterozygosity for diploid data,
HE (Weir, 1996)) was calculated in FSTAT 2.9 (Goudet, 1995).
A Bayesian Analysis of Population Structure (BAPS) implemented in BAPS 6.0 was
conducted to identify groups of genetically homogeneous populations based on cpDNA
polymorphisms. The analysis was performed using the “spatial clustering of groups” module.
BAPS allocates populations in a user-defined number of groups (k-value) in order to
maximise the differentiation among groups considering the number of groups and their allele
frequencies as varying parameters. The optimal partition was determined using k-values
ranging from 2 to 10 with 10 replicates for each k-value. The partition showing the highest
estimated probability and the lowest log marginal likelihood was considered optimal.
33
Population differentiation was estimated with (RST) and without (FST) taking into
account relatedness among alleles using the softwares CPSSR (Pons & Petit, 1996) and
FSTAT 2.9 (Goudet, 1995), respectively. The presence of a phylogeographic structure was
then tested by comparing RST and FST (RST > FST) with 10,000 permutations using the
software CPSSR (Pons & Petit, 1996).
A geographic map of the genetic differentiation among populations was obtained
using the “genetic landscape shapes” procedure implemented in Alleles In Space (AIS)
(Miller, 2005). The procedure first builds a connectivity network between all sampled
locations in the data set based on Delaunay triangulations. Then, each network connection is
assigned a genetic distance based on the average proportions of nucleotide differences
between pairs of individuals from contiguous populations. Finally, relative genetic distances
are interpolated (inverse distance weighted - IDW) using a grid defined by the user depending
on the interpolation desired resolution. Interpolation was performed with a grid of 100×100
and a distance weighting parameter of 1 covering as much of the range as possible. This
analysis was performed using only cpDNA data to illustrate patterns of population
differentiation that could not be easily visualized, unlike mtDNA.
2.4.5 Analysis of published pollen paleorecords
The pollen paleorecord was analysed to corroborate the phylogeographic inferences
regarding historical occurrence of Larix in glacial refugia and the chronology of larch
postglacial colonization. The same paleobotanical approach was also used to infer the
chronology of postglacial colonization from Picea and Abies, tamarack's main competing
taxa in order to assess the putative impact of interspecific competition during Larix
postglacial colonization. The Neotoma Paleaoecology Database
(http://www.neotomadb.org/) was searched for fossil pollen data using the web application
Neotoma Explorer (http://apps.neotomadb.org/explorer/). First, all paleorecords at latitudes
between 25 and 70°N (i.e., from southern Florida to the treeline) and longitudes between 45
and 166°W containing pollen from Picea sp., Abies sp., or Larix sp. between 20,000 and
4,000 calibrated years before present (cal yr BP) were identified. The pollen percentage
threshold values used to infer historical local presence of tamarack or spruce in the vicinity
of a coring site differed between taxa due to contrasted pollen production, dispersal, and other
34
taphonomic issues (Lisitsyna et al., 2011). Specifically, according to Lisitsyna et al. (2011)
while Larix and Abies can be considred locally present whenever traces of pollen are found
(pollen percentage > 0%), the pollen percentage thershold value for Picea was set to 10%.
The geographical coordinates (latitude °N and longitude °W) and the date of the first presence
(i.e., arrival time) of Larix and its main competitors’ pollen (cal yr BP) corresponding to each
paleorecord were mapped in successive 2kyr time-intervals between 20,000 and 4,000 cal yr
BP to estimate the chronology of postglacial recolonization of larch, fir, and spruce.
2.5 Results
2.5.1 Genetic diversity
MtDNA polymorphism was found in one of the 20 loci initially screened. Locus
nad1(exon1)/trnC-ori carried one SNP, yielding two mitotypes. A BLASTn search
confirmed that the fragment amplified corresponded to a mtDNA intergenic region located
between nad1 first exon and trnC replication origin in Cycas taitungensis (E-value = 1e-120).
Most of the samples (97 %) carried mitotype I (Figure 2.2A, Appendix S1), while mitotype
II was found in the remaining individuals.
Fragment length variation was found in three of 20 cpSSRs assayed. In total, 24
chlorotypes were found, from which 14 (58 %) had a frequency higher than 1 % in the whole
sample (Figure 2.2B, Appendix S2). Average intra-population diversity (HS) reached 0.68.
35
Figure 2.2. Geographic distribution of mitotypes (A), chlorotypes (B), and (C) Bayesian
clustering of 45 Larix laricina populations. Chlorotypes with a frequency below 0.01 were
pooled as “Others”. Bayesian clustering based on chlorotype frequencies using the “spatial
clustering of groups” option implemented in BAPS 6.0 (Corander et al., 2008). Population
numbers correspond to those in Table 2.1.
36
2.5.2 Population structure and differentiation
MtDNA provided limited insights regarding population structure and differentiation due to a
lack of variation. Mitotype II occurred in three eastern populations and was predominant in
the easternmost population from Labrador (population #2, Figure 2.2A, Appendix S1).
For cpDNA, overall FST across the range was estimated at 0.12. The comparison of
RST and FST revealed no significant phylogeographic structure (RST < FST), implying that
closely related chlorotypes did not necessarily co-occur within populations. However, the
Bayesian analysis of population structure revealed three distinct groups of populations based
on chlorotype variation (Figure 2.2C, Table 2.1). The first group included all eastern
populations (#1 - #29) and three populations from western Canada (#34, #36, #44). The
second group comprised the remaining western populations except one population from
Alberta (#43) that paired up with the remote population from Alaska, forming a third group.
Population differentiation varied greatly between eastern (#1 - #29) and western
populations (#30 - #44) subsets (excluding the remote population from Alaska). FST was
significantly higher among western populations than among eastern populations (partial FST
= 0.18 and 0.04, respectively; P = 0.027), while average diversity was slightly lower (HS =
0.65 and 0.70, respectively) (Table 2.1). The genetic landscape analysis illustrates this trend,
with differentiation between adjacent populations decreasing gradually eastward (Figure
2.3). No chlorotype was shared between tamarack and other North American larches (L.
occidentalis and L. lyallii (data not shown)).
2.5.3 Analysis of published pollen paleorecords
Of the 995 pollen paleorecords analyzed within the study area, 408, 466, and 490 contained
Larix (> 0%), Picea (> 10%) and Abies (> 0%) between 20,000 and 4,000 cal yr BP,
respectively. These were used to map postglacial recolonization of these genera (Figure 2.4
and 2.5). Pollen records extending back to the LGM revealed the persistence of Larix close
to the margin of the Laurentide ice sheet between the Great lakes and the Atlantic (20,000-
18,000 cal yr BP interval). During the same period, tamarack was also present as far south as
Tennessee and North Carolina. Following the retreat of the Laurentide ice sheet, the species
readily spread northward into eastern North America until it reached its current northern limit
37
at ca. 5000 cal yr BP (Short & Nichols, 1977). Pollen records indicated that larch occupied
Labrador as early as 13,400 cal yr BP (Lamb, 1980), when most of the Quebec-Labrador
peninsula was still covered with ice (Dyke, 2004) and northward time-transgressive spread
was only reaching southern Newfoundland. Larix pollen was also present in unglaciated
territories of Beringia sporadically during LGM, and more continuously since 13,400 cal yr
BP (Brubaker et al., 2005).
Figure 2.3. Among-population relative genetic distances using cpDNA data across Larix
laricina natural range. The analysis was carried out with the Alleles in Space (AIS) software
using the “genetic landscape shapes” procedure (Miller, 2005). The “height” value represents
population differentiation at a given point. The higher the “height”, the higher the relative
population differentiation. Interpolation performed with a grid of 100 × 100 and a distance
weighting parameter of 1 (see Miller et al., 2006 for details).
38
Table 2.1. Population genetic diversity estimates and Bayesian group assignment based on
three cpSSRs markers for 45 Larix laricina populations.
Lineage Population
number Population name Province/state n1 HS
Allelic
Richness
BAPS
groups
Eastern
1 Port Hope Simpson Newfound Land 11 0.87 3.33 1 2 Cartwright Newfound Land 15 0.77 2.77 1
3 Goose River North Newfound Land 15 0.62 1.87 1
4 Happy Valley Newfound Land 15 0.56 1.36 1 5 Churchill Falls Newfound Land 15 0.37 1.20 1
6 Stanley New Brunswick 13 0.56 1.41 1
7 Amqui Québec 11 0.80 3.00 1 8 Fermont Québec 15 0.84 3.30 1
9 Manic 5 Québec 15 0.51 1.31 1
10 Reservoir Bersimis-2 Québec 14 0.84 3.06 1 11 La Malbaie Québec 15 0.85 3.27 1
12 Jackman Maine 15 0.87 3.25 1
13 Roberval Québec 9 0.67 1.67 1 14 South Wallingford Vermont 15 0.36 1.06 1
15 Grenville Bay Québec 14 0.91 3.79 1
16 Elzevir Ontario 15 0.78 2.91 1 17 Englehart Ontario 14 0.66 2.08 1
18 Shelburne Ontario 14 0.91 3.79 1
19 Holly Michigan 14 0.87 3.50 1 20 Fushimi Lake Provincial Park Ontario 14 0.50 1.55 1
21 Tittabawassee River Michigan 15 0.76 2.67 1
22 Wilderness State Park Michigan 14 0.74 2.56 1 23 White Lake Provincial Park Ontario 15 0.60 1.71 1
24 Hiawatha National Forest Michigan 12 0.64 1.91 1
25 Shebandowan Ontario 15 0.69 2.13 1 26 Apostle Islands National Lakeshore Wisconsin 13 0.77 2.72 1
27 Saint Croix State Forest Minnesota 15 0.84 3.30 1
28 Blackberry Minnesota 15 0.60 1.71 1 29 Richer Manitoba 13 0.63 2.12 1
Mean east - - - 14 0.70 2.42
Total east - - - 405 0.73 Number of rare chlorotypes in the eastern lineage (f < 0.01) = 8
Western
30 Grahamdal Manitoba 11 0.80 3.00 2
31 Minago River Manitoba 13 0.90 3.60 2 32 Cranberry Portage Manitoba 9 0.75 2.32 2
33 Granit Lake Saskatchewan 13 0.68 1.90 2
34 Southend Saskatchewan 13 0.42 1.39 1 35 Big Sandy Lake Saskatchewan 13 0.90 3.72 2
36 Prince Albert Saskatchewan 9 0.67 1.67 1
37 Morin Lake Saskatchewan 13 0.92 3.92 2 38 Lac la Plonge Saskatchewan 6 0.73 2.00 2
39 Patuanak Saskatchewan 11 0.76 2.57 2
40 Aubichon Lake Saskatchewan 10 0.89 3.50 2 41 Meadow River Saskatchewan 13 0.56 1.41 2
42 Goodsoil Saskatchewan 6 0.87 3.00 2
43 Glendon Alberta 15 0.26 0.40 3 44 Whitecourt Alberta 15 0.13 0.80 1
Mean west - - - 11 0.65 2.35
Total west - - - 170 0.78 Number of rare chlorotypes in the western lineage (f < 0.01) = 3
Alaskan 45 Fairbanks Alaska 14 0.14 0.43 3
Number of rare chlorotypes in the Alaskan lineage (f < 0.01) = 0 1Number of genotyped individuals per populations.
39
Figure 2.4. Mapped pollen paleorecords of Larix sp. and Picea sp. between 20 and 4
calibrated kiloyears before present (cal kyr BP) reconstructed from 408 and 466 pollen cores,
respectively. Black and pink dots indicate the presence of larch and spruce pollen in the
paleorecord during each 2 kyr time-interval, respectively.
40
Figure 2.5. Mapped pollen paleorecords of Larix sp. and Abies sp. between 20 and 4
calibrated kiloyears before present (cal kyr BP) reconstructed from 408 and 490 pollen cores,
respectively. Black and green dots indicate the presence of larch and fir pollen in the
paleorecord during each 2 kyr time-interval, respectively.
41
The chronology of postglacial colonization of larch and its main competitors differed
between the western and eastern parts of Larix range. While spruces and fir colonization
chronologies were fairly similar, tamarack postglacial colonization lagged behind these
species in the western part of the range. The first occurrence of larch west of Manitoba was
recorded after 10,000 cal yr BP, at least 2,000 yr after spruces (Figure 2.4) and fir (Figure
2.5) establishment. The opposite sequence of postglacial establishment was recorded in
eastern North America. From 14,000 cal yr BP onwards, Larix shortly preceed Picea and
Abies (Payette, 1993). Indeed, while Larix pollen often occured by itself at the margin of
retreating Laurentide ice sheet, Picea and Abies pollen was either absent or associated with
larch pollen (Figure 2.4 and 2.5). In boreal Quebec, Larix pollen reached 54°N at 8300 cal
yr BP while Picea sp. and Abies sp. pollen did not occur further north than 50°N (data not
shown), even when a less conservative pollen percentage threshold value (> 0%) was used
to infer spruce presence.
2.6 Discussion
2.6.1 Genetic diversity and population differentiation
Genetic variation tends to be scarce in plant mitochondrial DNA (Wolfe et al., 1987; Laroche
et al., 1997) and conifers in general (Jaramillo-Correa & Bousquet, 2003). Mitochondrial
DNA diversity was expected to be particularly low in Larix laricina given the little variation
found at the interspecific level (Gros-Louis et al., 2005) perhaps due to the relatively recent
divergence of the genus dating back to the Miocene (Wang et al., 2000). Indeed, although 20
mtDNA regions were sequenced, polymorphism was found in a single region, which yielded
only two mitotypes. Hence, in this species, phylogeographical inferences derived from
mtDNA polymorphisms were limited relatively to other conifers.
Chloroplast DNA diversity (HS = 0.68) was lower than North American conifers (0.73
in Tsuga canadensis (Lemieux et al., 2011), 0.78 in Pinus banksiana (Godbout et al., 2010),
0.80 in Picea mariana (Gérardi et al., 2010), 0.77 (Cinget et al., 2015)) and seven species of
North Asian Larix (mean = 0.80, Polezhaeva et al. 2010). Mean cpDNA population
differentiation (FST = 0.12) was higher than for other North American conifers (GST = 0.10
42
in P. mariana, (Gérardi et al., 2010), FST = 0.04 in P. banksiana (Godbout et al., 2010), FST
= 0.10 in A. balsamea (Cinget et al., 2015)).
2.6.2 Population structure and phylogeographic inferences
A population from Labrador (#2) had a remarkably high frequency of the rare mitotype II, a
distinctive genetic pattern contrasting with all other sampled populations. This peculiar
genetic signature suggests the possible existence of a distinct lineage in this geographically
limited region, as reported for Picea mariana (Jaramillo et al., 2004) and Abies balsamea
(Cinget et al., 2015). Pollen records also indicate the presence of L. laricina in Labrador as
early as 13,400 years ago (Lamb, 1980) when most of the Quebec-Labrador peninsula was
still covered with ice (Dyke, 2004). Since Larix pollen grains usually occur only in the
vicinity of trees which produced them (Lisitsyna et al., 2011), this result corroborates genetic
evidence for an early presence of larch in the region instead of a migration from a southern
refugium. However, the absence of Larix pollen in the fossil record between southern
Newfoundland and Labrador is not a formal proof for the absence of the species. A regional-
scale analysis assessing the validity of each scenario is deemed necessary.
The cpDNA Bayesian analysis of population structure showing a clear subdivision
between eastern and western populations (Figure 2.2C) and the high number of private
chlorotypes in each BAPS group suggest the existence of two genetically differentiated
glacial lineages. This pattern was reported in L. laricina using allozyme polymorphisms
(Cheliak et al., 1988) and in other transcontinental North American conifers (e.g. jack pine,
black spruce, and white spruce; Godbout et al. 2005; Gérardi et al. 2010; de Lafontaine et al.
2010).
Eastern populations likely persisted in a large refugial area located south of the
Laurentide ice sheet and expanded northward via Ontario, Quebec, and the Atlantic
Provinces of Canada after the retreat of the Laurentide ice sheet. Molecular data suggest that
populations located between western Ontario and the Atlantic coast belong to the same
lineage, contrary to most other North American conifers which likely persisted on both sides
of the Appalachians during the LGM (Jaramillo-Correa et al., 2009). However, pollen
records indicate that Larix occurred between ca. 20,000 and ca. 15,000 cal yr BP east of the
43
Appalachian Mountains, near the Atlantic shore of North Carolina (Whitehead, 1981).
Hence, it is possible that increasing sampling effort and developing additional molecular
markers might uncover evidence of vicariance caused by the Appalachians.
The western part of Larix range was probably colonized by another lineage
originating from a refugium located west of the Great Lakes, at the margin of the Laurentide
ice sheet (Driftless Area). The hypothesis of a cryptic refugium in this region was also
proposed recently for Abies balsamea, based on mtDNA, cpDNA, and fossil evidence
(Cinget et al., 2015), as well as in temperate tree species (McLachlan et al., 2005). This
scenario is also well supported by Larix pollen data, showing a remote occurrence of Larix
close to the ice sheet in Minnesota, between 20,000 and 18,000 cal yr BP (Figure 2.4 and 2.5;
Birks 1976, 1981).
A third BAPS group included the Alaskan population and a geographically disjunct
population from Alberta. This result supports the existence of a glacial lineage originating
from a Beringia refugium, as was previously reported in several tree species from fossil
(Brubaker et al., 2005; Zazula et al. 2006) and molecular evidence (Anderson et al., 2006;
Godbout et al., 2008; Gérardi et al., 2010). Moreover, pollen paleorecords confirmed
sporadic occurrences of L. laricina in Alaska during the LGM (Brubaker et al., 2005). The
lack of samples in the Northwest Territories and northern Alberta prevents making rigorous
inferences about the direction of postglacial colonization in this region.
2.6.3 High cpDNA population differentiation and competition in western Canada
The genetic landscape analysis revealed a distinctive geographic pattern in the distribution
of cpDNA interpopulation differentiation throughout the range. Differentiation among
western populations was significantly higher than among eastern populations, which is
reflected by puzzling Bayesian population assignments in this region (i.e. populations #34,
36 43, and 44 were assigned to geographically distant BAPS groups). Given that all these
populations occur sporadically within the western lineage only, it is possible that they
experienced stochastic divergence instead of being founded by migrants originating from
remote lineages (de Lafontaine et al. 2013). Similarly, the level of cpDNA differentiation
among eastern populations of tamarack is analogous to rangewide differentiation reported
44
for other boreal North American conifer species for the same cpSSR loci. This suggests that
the higher level of differentiation among western populations could result from regional
demographic effects rather than a species-specific property hindering genetic
homogenization of populations. It should be noted that introgression cannot account for such
higher level of differentiation in western populations because no chlorotypes were shared
with other North American larch species (L. occidentalis and L. lyallii).
Tamarack is a companion species within the boreal forest ecosystem where spruces
(Picea glauca and P. mariana) and balsam fir (Abies balsamea) are the dominant late-seral
tree species (Eyre, 1980). The pollen paleorecord suggests that northwestern expansion of
Larix occured between 10,000 and 8,000 cal yr BP. At that time, the late-successional species
were already well established in western North America (Figure 2.4 and 2.5). Indeed, Picea
and Abies spread throughout the western interior of North America as early as 14,000 cal yr
BP and reached their current range limits by ca. 12,000 cal yr BP (Ritchie & MacDonald,
1986; Ritchie, 1987). Because mesic sites were likely already colonized by the dominant late-
seral species, delayed postglacial establishment of early-successional Larix could only occur
on unproductive and/or extreme sites where higher resource demanding spruces cannot
establish, hence cannot outcompete. Under this colonization scenario, limited gene flow
across isolated larch populations would have hindered genetic homogenization among
western populations at the outset. By contrast, the paleobotanical record indicates that eastern
North America was colonized by tamarack shortly before the dominant species and larch was
present in the initial afforestation phase (Payette, 1993). Populations could therefore establish
without facing high competition from spruces and fir, perhaps resulting in more genetic
connectivity and increased gene flow among populations at the outset. Therefore, such
contrasted demographic histories between populations of western and eastern lineages at the
time of postglacial colonization could explain their distinct patterns of genetic differentiation.
One could also expect that limited gene flow during establishment of western populations
would translate into a loss of genetic diversity. According to population genetics theory
(Leberg 1992), rare alleles are likely to be lost if populations experienced bottlenecks during
postglacial colonization. In line with this hypothesis, the number of rare chlorotypes was
lower within the western lineage than the eastern lineage (Table 2.1). A rarefaction analysis
indicated that the vast majority of cpDNA haplotype diversity was captured in the two
45
lineages, hence this comparison remains valid despite unequal sampling intensity within the
two lineages (see Appendix S4 in supporting information).
2.7 Conclusions
The present broadscale phylogeographic survey represents a first attempt to uncover the
postglacial history of Larix laricina across its natural range. The integrative analysis of
molecular and fossil data brought evidence for the existence of at least three and perhaps four
genetically distinct glacial lineages, which would have persisted in refugia presumably
located in Labrador, southeast of the Great Lakes, west of the Great Lakes and in Beringia.
The modern boreal landscape is dominated by extensive tracts of spruce-fir forest
interspaced by small, disjunct populations of tamarack restricted to unproductive sites where
more extreme ecological conditions with respect to the surrounding matrix prevail. This
fragmented geographical pattern is common throughout the range of Larix and it
encompasses the two major genetic lineages identified for this species (i.e., western and
eastern). A homogeneous genetic imprint should have been expected across the range were
it caused by similar processes that lead to common modern-day biogeographical pattern. The
high differentiation and loss of rare chlorolotypes in the western lineage appear mostly
independent of the current fragmentation of Larix populations within the boreal landscape.
A major difference between western and eastern lineages dates back to the chronology of
postglacial colonization, when larch from the eastern lineage readily colonized the eastern
part of the continent (Figure 2.1A), while this early-successional species lagged behind the
establishment of more competing, late-seral taxa in western North America (Figure 2.1B).
The results reported in this study provide support for a putative role of interspecific
competition in structuring the standing genetic variation at the time of postglacial
colonization. Recent studies emphasized the importance of including closely related
evolutionary taxa when reconstructing the biogeographical history of a focal species from
broadscale phylogeographic surveys. This allows disentangling the genetic imprint of
intraspecific lineage sorting from that of introgression between related species (Zhou et al.
2010, Godbout et al. 2012; Cinget et al. 2015b). The present study extends this idea by
stressing the importance of considering ecologically interacting taxa as well. Biological
46
interactions can impact population demographic history and leave a genetic signature still
traceable today.
2.8 Acknowledgements
We are grateful to B. Cinget and J. Godbout (Canada Research Chair in Forest and
Environmental Genomics, Univ. Laval) for their help with sampling of needles and seeds.
We also thank S. Blais, F. Gagnon, M. Laurent-Estrada and F. Tremblay (Canada Research
Chair in Forest & Environmental Genomics, Univ. Laval) for their laboratory assistance. This
research was supported by a grant to J. Bousquet from the National Sciences and Engineering
Research Council of Canada (NSERC).
Supporting information
Additional Supporting Information may be found in the online version of this article:
Appendix S1. Mitotype counts for one mtDNA polymorphic locus in 45 Larix laricina
populations.
Appendix S2. Chlorotype counts for three cpDNA polymorphic SSRs in 45 Larix laricina
populations.
Appendix S3. List of mtDNA loci scanned for Larix laricina mtDNA polymorphism, primer
sequences, annealing temperature, and sequencing results.
Appendix S4. Estimation of chlorotype diversity in relation to the number of populations
sampled based on rarefaction resampling.
Biosketches
This work was conducted as part of Emile Warren’s MSc thesis focusing on the
phylogeography of Larix laricina. The research team focus on studying genetic diversity and
its evolutionary implications at the population and genome structure levels in forest trees
(more information available at: http://www.genomiqueforestiere.chaire.ulaval.ca). EW, JBe,
and JBo conceived the experiment. EW, MP, and SS performed the sampling, laboratory
experiments and produced the data. JPJC designed the mtDNA primers. EW, GdL and SG
analyzed the data, conceived the ideas, and wrote the paper, under the supervision of JBo.
47
2.9 Literature cited
Anderson, L.L., Hu, F.S., Nelson, D.M., Petit, R.J. & Paige, K.N. (2006) Ice-age endurance:
DNA evidence of a white spruce refugium in Alaska. Proceedings of the National
Academy of Sciences of the United States of America, 103, 12447–12450.
Bhagwat, S.A. & Willis, K.J. (2008) Species persistence in northerly glacial refugia of
Europe: a matter of chance or biogeographical traits? Journal of Biogeography, 35,
464–482.
Birks, H.J.B. (1976) Late-Wisconsinan vegetational history at Wolf Creek, central
Minnesota. Ecological Monographs, 395–429.
Birks, H.J.B. (1981) Late Wisconsin vegetational and climatic history at Kylen Lake,
northeastern Minnesota. Quaternary Research, 16, 322–355.
Brubaker, L.B., Anderson, P.M., Edwards, M.E. & Lozhkin, A.V. (2005) Beringia as a
glacial refugium for boreal trees and shrubs: new perspectives from mapped pollen
data. Journal of Biogeography, 32, 833–848.
Burban, C. & Petit, R.J. (2003) Phylogeography of maritime pine inferred with organelle
markers having contrasted inheritance. Molecular Ecology, 12, 1487–1495.
Cheliak, W.M., Wang, J. & Pitel, J.A. (1988) Population structure and genic diversity in
tamarack, Larix laricina (DuRoi) K. Koch. Canadian Journal of Forest Research,
18, 1318–1324.
Cinget, B., Gérardi, S., Beaulieu, J. & Bousquet, J. (2015) Less pollen-mediated gene flow
for more signatures of glacial lineages: congruent evidence from balsam fir cpDNA
and mtDNA for multiple refugia in eastern and central North America. PLoS
ONE 10(4): e0122815 (25p.).
Cinget, B., de Lafontaine, G., Gérardi, S. & Bousquet, J. (2015) Integrating phylogeography
and paleoecology to investigate the origin and dynamics of hybrid zones: insights
from two widespread North American firs. Molecular Ecology (in press).
Corander, J., Sirén, J. & Arjas, E. (2008) Bayesian spatial modeling of genetic population
structure. Computational Statistics, 23, 111–129.
Davis, M.B. (1981) Quaternary history and the stability of forest communities. Forest
Succession (ed. by D.C. West, H.H. Shugart and D.B. Botkin), pp. 132–153. Springer,
New York, USA.
Davis, M.B. & Shaw, R.G. (2001) Range shifts and adaptive responses to Quaternary climate
change. Science, 292, 673–679.
de Lafontaine, G., Turgeon, J. & Payette, S. (2010) Phylogeography of white spruce (Picea
glauca) in eastern North America reveals contrasting ecological trajectories. Journal
of Biogeography, 37, 741–751.
de Lafontaine, G., Ducousso, A., Lefèvre, S., Magnanou, E. & Petit, R.J. (2013) Stronger
spatial genetic structure in recolonized areas than in refugia in the European beech.
Molecular Ecology, 22, 4397–4412.
Dong, J. & Wagner, D.B. (1993) Taxonomic and population differentiation of mitochondrial
diversity in Pinus banksiana and Pinus contorta. Theoretical and Applied Genetics,
86, 573–578.
Dyke, A.S. (2004) An outline of North American deglaciation with emphasis on central and
northern Canada. Quaternary Glaciations: Extent and Chronology, Part II (ed. by J.
Ehlers and P.L. Gibbard), pp. 373–424. Elsevier, Amsterdam, Netherlands.
48
Eyre, F.H. (1980) Forest Cover Types of the United States and Canada. Society of American
Foresters, Washington, D.C., USA.
Feurdean, A., Bhagwat, S.A., Willis, K.J., Birks, H.J.B., Lischke, H. & Hickler, T. (2013)
Tree migration-rates: narrowing the gap between inferred post-glacial rates and
projected rates. PLoS ONE, 8, e71797.
Gérardi, S., Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2010) From glacial refugia
to modern populations: new assemblages of organelle genomes generated by
differential cytoplasmic gene flow in transcontinental black spruce. Molecular
Ecology, 19, 5265–5280.
Godbout, J., Fazekas, A., Newton, C.H., Yeh, F.C. & Bousquet, J. (2008) Glacial vicariance
in the Pacific Northwest: evidence from a lodgepole pine mitochondrial DNA
minisatellite for multiple genetically distinct and widely separated refugia. Molecular
Ecology, 17, 2463–2475.
Godbout, J., Beaulieu, J. & Bousquet, J. (2010) Phylogeographic structure of jack pine (Pinus
banksiana; Pinaceae) supports the existence of a coastal glacial refugium in
northeastern North America. American Journal of Botany, 97, 1903–1912.
Godbout, J., Yeh, F.C. & Bousquet, J. (2012) Large‐scale asymmetric introgression of
cytoplasmic DNA reveals Holocene range displacement in a North American boreal
pine complex. Ecology and Evolution, 2, 1853–1866.
Goudet, J. (1995) FSTAT (version 1.2): a computer program to calculate F-statistics. Journal
of Heredity, 86, 485–486.
Gros-Louis, M.C., Bousquet, J., Pâques, L.E. & Isabel, N. (2005) Species-diagnostic markers
in Larix spp. based on RAPDs and nuclear, cpDNA, and mtDNA gene sequences,
and their phylogenetic implications. Tree Genetics & Genomes, 1, 50–63.
Guichoux, E., Garnier‐Géré, P., Lagache, L., Lang, T., Boury, C. & Petit, R. (2013) Outlier
loci highlight the direction of introgression in oaks. Molecular Ecology, 22, 450–462.
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98.
Henry, R., Brooks, B. & Davis, C. (1973) Population density of Larix laricina in a sphagnum
bog mat habitat. Michigan Academician, 5, 529–535.
Hewitt, G. (2000) The genetic legacy of the Quaternary ice ages. Nature, 405, 907–913.
Ives, J.D. (1960) The deglaciation of Labrador-Ungava, an outline. Cahiers de géographie
du Québec, 4, 323–343.
Jackson, S.T., Overpeck, J.T., Webb, T., Keattch, S.E. & Anderson, K.H. (1997) Mapped
plant-macrofossil and pollen records of late quaternary vegetation change in Eastern
North America. Quaternary Science Reviews, 16, 1–70.
Jaramillo-Correa, J.P. & Bousquet, J. (2003) New evidence from mitochondrial DNA of a
progenitor-derivative species relationship between black spruce and red spruce.
American Journal of Botany, 90, 1801–1806.
Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2004) Variation in mitochondrial DNA
reveals multiple distant glacial refugia in black spruce (Picea mariana), a
transcontinental North American conifer. Molecular Ecology, 13, 2735–2747.
Jaramillo-Correa, J.P., Beaulieu, J., Khasa, D.P. & Bousquet, J. (2009) Inferring the past
from the present phylogeographic structure of North American forest trees: seeing
the forest for the genes. Canadian Journal of Forest Research, 39, 286–307.
49
Johnston, W.F. (1990) Larix laricina (Du Roi) K. Koch. Silvics of North America: Vol. 1
Conifers (ed. by R.M. Burns and B.H. Honkala), pp. 26–35. Agriculture handbook
654, US Department of Agriculture, Forest Service, Washington, D.C., USA.
Knowles, P., Perry, D.J. & Foster, H.A. (1992) Spatial genetic structure in two tamarack
Larix laricina (Du Roi) K. Koch populations with differing establishment histories.
Evolution, 46, 572–576.
Lamb, H.F. (1980) Late Quaternary vegetational history of southeastern Labrador. Arctic and
Alpine Research, 12, 117–135.
Laroche, J., Li, P., Maggia, L. & Bousquet, J. (1997) Molecular evolution of angiosperm
mitochondrial introns and exons. Proceedings of the National Academy of Sciences
of the United States of America, 94, 5722–5727.
Lemieux, M.J., Beaulieu, J. & Bousquet, J. (2011) Chloroplast DNA polymorphisms in
eastern hemlock: range-wide genogeographic analyses and implications for gene
conservation. Canadian Journal of Forest Research, 41, 1047–1059.
Lisitsyna, O.V., Giesecke, T. & Hicks, S. (2011) Exploring pollen percentage threshold
values as an indication for the regional presence of major European trees. Review of
Palaeobotany and Palynology, 166, 311–324.
Matthews, J.A. (1992) The ecology of recently deglaciated terrain. A geoecological
approach to glacier forelands and primary succession. Cambridge University Press,
Cambridge, United Kingdom.
MacDonald, G.M. & Cwynar, L.C. (1985) A fossil pollen based reconstruction of the late
Quaternary history of lodgepole pine (Pinus contorta ssp. latifolia) in the western
interior of Canada. Canadian Journal of Forest Research, 15, 1039–1044.
McLeod, T. & MacDonald, G. (1997) Postglacial range expansion and population growth of
Picea mariana, Picea glauca and Pinus banksiana in the western interior of Canada.
Journal of Biogeography, 24, 865–881.
McLachlan, J.S., Clark, J.S. & Manos, P.S. (2005) Molecular indicators of tree migration
capacity under rapid climate change. Ecology, 86, 2088–2098.
Miller, M.P. (2005) Alleles In Space (AIS): computer software for the joint analysis of
interindividual spatial and genetic information. Journal of Heredity, 96, 722–724.
Miller, M.P., Bellinger, M.R., Forsman, E.D. & Haig, S.M. (2006) Effects of historical
climate change, habitat connectivity, and vicariance on genetic structure and diversity
across the range of the red tree vole (Phenacomys longicaudus) in the Pacific
Northwestern United States. Molecular Ecology, 15, 145–159.
Neale, D.B. & Sederoff, R.R. (1988) Inheritance and evolution of conifer organelle genomes.
Genetic Manipulation of Woody Plants (ed. by J.W. Hanover, D.E. Keathley, C.M.
Wilson and G. Kuny), pp. 251–264, Michigan State University, East Lansing, USA.
Payette, S. (1993) The range limit of boreal tree species in Quebec-Labrador: An ecological
and paleoecological interpretation. Review of Palaeobotany and Palynology, 79, 7–
30.
Payette, S. (2013) Flore nordique du Québec et du Labrador, volume 1. Presses de
l’Université Laval, Québec, Canada.
Petit, R.J., Aguinagalde, I., de Beaulieu, J.-L., Bittkau, C., Brewer, S., Cheddadi, R., Ennos,
R., Fineschi, S., Grivet, D., Lascoux, M., Mohanty A., Müller-Starck G., Demesure-
Musch B., Palmé A., Martín, J.P., Rendell S. & Vendramin G.G. (2003) Glacial
refugia: hotspots but not melting pots of genetic diversity. Science, 300, 1563–1565.
50
Petit, R.J. & Vendramin, G.G. (2007) Plant phylogeography based on organelle genes: an
introduction. Phylogeography of Southern European Refugia (ed. by S. Weiss and N.
Ferrand), pp. 23–97. Springer, New York, USA.
Polezhaeva, M.A., Lascoux, M. & Semerikov, V.L. (2010) Cytoplasmic DNA variation and
biogeography of Larix Mill. in Northeast Asia. Molecular Ecology, 19, 1239–1252.
Pons, O. & Petit, R.J. (1996) Measuring and testing genetic differentiation with ordered
versus unordered alleles. Genetics, 144, 1237–1245.
Richard, P.J.H. (1993) Origine et dynamique postglaciaire de la forêt mixte au Québec.
Review of Palaeobotany and Palynology, 79, 31–68.
Ritchie, J.C. (1987) Postglacial Vegetation of Canada. Cambridge University Press,
Cambridge, United Kingdom.
Ritchie, J.C. & MacDonald, G.M. (1986) The patterns of post-glacial spread of white spruce.
Journal of Biogeography, 527–540.
Rowe, J.S. & Halliday, W.E.D. (1972) Forest Regions of Canada. Department of the
Environment, Canadian Forestry Service, Ottawa, Canada.
Short, S.K. & Nichols, H. (1977) Holocene pollen diagrams from subarctic Labrador-
Ungava: vegetational history and climatic change. Arctic and Alpine Research, 9,
265–290.
Vendramin, G.G., Lelli, L., Rossi, P. & Morgante, M. (1996) A set of primers for the
amplification of 20 chloroplast microsatellites in Pinaceae. Molecular Ecology, 5,
595–598.
Walter, R. & Epperson, B.K. (2005) Geographic pattern of genetic diversity in Pinus
resinosa: contact zone between descendants of glacial refugia. American Journal of
Botany, 92, 92–100.
Wang, X.-Q., Tank, D.C. & Sang, T. (2000) Phylogeny and divergence times in Pinaceae:
evidence from three genomes. Molecular Biology and Evolution, 17, 773–781.
Webb, T. & Bartlein, P.J. (1992) Global changes during the last 3 million years: climatic
controls and biotic responses. Annual Review of Ecology and Systematics, 23, 141–
173.
Wei, X.-X., Beaulieu, J., Khasa, D.P., Vargas-Hernández, J., López-Upton, J., Jaquish, B. &
Bousquet, J. (2011) Range-wide chloroplast and mitochondrial DNA imprints reveal
multiple lineages and complex biogeographic history for Douglas-fir. Tree Genetics
& Genomes, 7, 1025–1040.
Weir, B.S. (1996) Genetic data analysis 2. Sinauer Associates, Sunderland, USA.
Whitehead, D.R. (1981) Late-Pleistocene vegetational changes in northeastern North
Carolina. Ecological Monographs, 451–471.
Wolfe, K.H., Li, W.H. & Sharp, P.M. (1987) Rates of nucleotide substitution vary greatly
among plant mitochondrial, chloroplast, and nuclear DNAs. Proceedings of the
National Academy of Sciences of the United States of America, 84, 9054–9058.
Zazula, G.D., Telka, A.M., Harington, C.R., Schweger, C.E. & Mathewes, R.W. (2006) New
spruce (Picea spp.) macrofossils from Yukon Territory: implications for Late
Pleistocene refugia in Eastern Beringia. Arctic, 59, 391–400.
Zhou, Y.F., Abbott, R.J., Jiang, Z.Y., Du, F.K., Milne, R.I. & Liu, J.Q. (2010) Gene flow and
species delimitation: a case study of two pine species with overlapping distributions
in southeast China. Evolution, 64, 2342–2352.
51
Chapitre 3 - Conclusions et perspectives de recherche
3.1 Retour sur les objectifs et hypothèses de recherche
Tel que stipulé dans notre première hypothèse, sur l’ensemble des loci d’ADN
mitochondrial testés, un seul s’est avéré polymorphe et ce polymorphisme était faiblement
représenté dans les populations de Larix laricina. Ce résultat était attendu puisque peu de
polymorphismes avaient été découverts au niveau interspécifique chez le genre Larix (Gros-
Louis et al., 2005). Cela suggère que les espèces du genre Larix sont particulièrement jeunes,
nonobstant que l’ADN mitochondrial est généralement très conservé chez les plantes
(Laroche et al., 1997).
La seconde hypothèse de l’étude voulait que les informations obtenues à partir de
l’étude des polymorphismes de l’ADN mitochondrial et de l’ADN chloroplastique ne
seraient pas les mêmes puisque ces génomes ont des potentiels de dissémination inégaux
dans l’environnement. Ce phénomène a été identifié chez une population du Labrador qui est
nettement différente de son entourage quant à l’ADN mitochondrial mais ne montre aucune
signature distincte pour l’ADN chloroplastique. Par opposition, la population de l’Alaska
possède une signature génétique chloroplastique particulière dont on ne retrouve pas la trace
dans l’ADN mitochondrial.
Plusieurs études phylogéographiques portant sur les conifères nord-américains à
grande aire de répartition ont montré un clivage entre les populations de l’est et de l’ouest de
leur aire de répartition, indiquant la présence de lignées glaciaires génétiquement distinctes
dues à des facteurs de vicariance communs (Jaramillo-Correa et al., 2004; Godbout et al.,
2005; de Lafontaine et al., 2010). La troisième hypothèse voulait que l’on retrouve ce clivage
chez le mélèze laricin. L’ADNcp nous a révélé qu’un tel clivage existait bel et bien et que la
zone de suture entre les groupes se trouvait à l’ouest de l’Ontario, soit plus à l’ouest que celle
inférée pour d’autres espèces sympatriques (Jaramillo-Correa et al. 2009, voir section 3.2).
52
3.2 Inférences phylogéographiques
Les génomes cytoplasmiques du mélèze laricin nous ont permis de corroborer
l’existence potentielle de quatre refuges glaciaires génétiquement distincts, dont la
localisation approximative correspondrait à ce qui avait été proposé antérieurement pour
d’autres espèces. Premièrement, l’ADNmt a mis en évidence la singularité d’une population
du Labrador par rapport aux autres populations en termes de fréquences mitotypiques. Une
partie du Labrador et du plateau continental n’aurait pas été recouvert de glace lors du LGM
(Ives, 1960) et le registre de pollen a confirmé la présence de l’espèce dans cette région dès
13 400 ans cal. BP. (Lamb, 1980). Ces éléments laissent croire à la persistance de l’espèce
dans cette zone lors de la dernière glaciation. Étant donné que cette population glaciaire était
probablement de petite taille efficace, il est possible que le mitotype prédominant dans cette
population ait atteint une fréquence particulière par dérive génétique. Un patron semblable
avait déjà été rapporté pour l’épinette noire dans cette région (Jaramillo-Correa et al., 2004).
L’ADNcp du sapin baumier laisse également croire à la persistance de cette espèce au
Labrador pendant le dernier évènement glaciaire (Cinget et al., 2014). Ces trois espèces ont
probablement subi le même scénario dans cette région. En ce sens, l’ADNmt du mélèze
laricin a permis de corroborer l’hypothèse d’un refuge glaciaire cryptique pour plusieurs
espèces de conifères boréaux au Labrador, ce qui représente une avancée importante de notre
connaissance de la phylogéographie nord-américaine.
Deuxièmement, même si une population unique a été analysée pour l’Alaska, le
patron de diversité génétique de l’ADNcp de cette dernière suggère également une
persistance de l’espèce à cet endroit pendant la dernière glaciation. Des preuves moléculaires
de l’existence de populations glaciaires à cet endroit ont été rapportées chez l’épinette
blanche (Anderson et al., 2006) et l’épinette noire (Gérardi et al., 2010). De plus, l’aire de
répartition du mélèze laricin est disjointe au Yukon. Il est donc probable que les deux
fractions n’ont pas été en contact depuis le LGM et que le flux génique entre les deux soit
demeuré restreint. Les registres polliniques ont de plus confirmé une présence sporadique du
mélèze en Alaska lors du LGM ainsi qu’une présence continue depuis 13 400 ans (Brubaker
et al., 2005). L’analyse Bayesienne de structure de populations implantée dans BAPS a
regroupé la population de l’Alaska avec une autre population d’Alberta génétiquement
53
semblable. Il est possible que le nord-ouest de l’aire de répartition ait été colonisé par le
refuge Bérigien lors de la déglaciation, dû à un délai de colonisation par la lignée glaciaire
venant du sud-est par rapport à la position de l’islandsis continental. Selon ce scénario, qui
reste à vérifier avec un échantillonnage intensif dans cette région, on s’attendrait à ce que les
populations situées entre l’Alaska et l’Alberta aient des fréquences chlorotypiques
semblables à celles observées chez les deux populations de ce groupement BAPS. Il est
également possible que la population d’Alberta ait atteint de telles fréquences de chlorotypes
par dérive génétique. Il est donc difficile de déterminer avec certitude l’origine de cette
similitude d’après nos données puisqu’aucune population n’a été échantillonnée dans la zone
séparant ces deux populations. Un échantillonnage dans cette zone permettrait de mieux
comprendre l’histoire postglaciaire du nord-ouest de l’aire de répartition, et d’identifier si la
recolonisation postglaciaire s’est faite par le nord ou par le sud-est.
Les polymorphismes de l’ADNcp ont aussi révélé chez le mélèze laricin un clivage
est-ouest de leur diversité génétique, semblable au clivage retrouvé chez les autres conifères
boréaux (Jaramillo-Correa et al., 2009). Chez les autres espèces, le clivage se retrouve
cependant plus à l’est et témoigne de la rencontre entre des lignées glaciaires distinctes
provenant de l’est et de l’ouest des Appalaches (Jaramillo-Correa et al., 2009). Le décalage
longitudinal de ce point de rencontre pourrait indiquer que la provenance des lignées
glaciaires ne correspondrait pas à celles rapportées chez les autres conifères. Pour le mélèze
laricin, la lignée de l’ouest aurait été localisée à l’ouest des Grands Lacs, près du lac
Supérieur, et la lignée de l’est proviendrait de l’ouest des Appalaches. Les deux groupes
BAPS identifiés dans cette région sont donc probablement formés de populations issues de
ces deux lignées glaciaires provenant du sud de l’inlandsis Laurentidien. De telles
populations glaciaires distinctes situées à l’ouest des Appalaches ont récemment été mis en
évidence chez le sapin baumier (Cinget et al., 2014).
L’étude des données polliniques s’est avérée indispensable pour identifier
l’emplacement potentiel de ces refuges glaciaires. Le registre fossile nous a permis de
confirmer la présence de l’espèce à l’ouest des Grands Lacs, révélant l’existence probable
d’un refuge cryptique sortant du patron traditionnellement observé chez les espèces de
conifères nord-américains à large distribution longitudinale. Il a également été possible
54
d’observer la présence de pollens de mélèze au Labrador et en Alaska tôt après le LGM,
corroborant ainsi les inférences faites à partir des données moléculaires. En ce sens, la valeur
des résultats intégrés de différentes disciplines a permis d’obtenir une compréhension plus
complète des résultats moléculaires obtenus et de bonifier les inférences phylogéographiques
(Hu et al., 2008; Gavin et al., 2014).
Les données polliniques ont également révélé la présence de Larix à l’est des
Appalaches à cette époque lors du LGM. La chaîne de montagnes alors recouverte d’un
glacier pourrait avoir limité le flux de gènes entre les populations réparties à l’est et à l’ouest
de la chaîne, et ainsi donner lieu à deux populations génétiquement distinctes en réponse à
leur isolement géographique. Chez la plupart des autres conifères boréaux, les populations
colonisées à partir de ces refuges avaient des signatures génétiques spécifiques en raison de
l’effet de vicariance créé par cette chaîne de montagnes (Jaramillo-Correa et al., 2009). Or,
au niveau moléculaire, aucune trace d’un tel effet de vicariance sur les fréquences
d’haplotypes dans les populations de mélèze laricin de la région et aucun indice de la
présence d’une lignée glaciaire génétiquement distincte à l’Est des Appalaches ne fut relevée.
La taille efficace des populations glaciaires autour des Appalaches était peut-être
suffisamment importante pour contrer la divergence due aux effets de dérive génétique. Il est
également possible que le signal de cette lignée n’ait pu être détecté par la faible diversité
retrouvée dans l’ADNmt et se serait estompé chez l’ADNcp par un flux de gènes constant
provenant de l’ouest des Appalaches suivant les vents dominants (Bartlein et al., 1998),
comme noté pour l’ADNcp chez d’autres espèces conifériennes, malgré une forte
structuration géographique des polymorphismes de leur ADNmt (Gérardi et al., 2010;
Godbout et al., 2010). Il est probable que la découverte d’autres polymorphismes de l’ADN
mitochondrial pourrait permettre de détecter un signal de vicariance dû aux Appalaches.
3.3 Différenciation génétique des populations de l’ouest
La répartition des chlorotypes au sein des populations de l’ouest de l’aire de
répartition montre peu d’uniformité comparativement aux populations de l’est. Cette
structure de populations plus importante n’est probablement pas due à une propriété
intrinsèque à l’espèce (i.e. dissémination limitée du pollen et du flux de gènes) puisque la
55
fraction est de la distribution naturelle montre un indice de différenciation des populations
(FST) semblable à celui retrouvé pour la plupart des autres espèces de conifères partageant
l’aire de répartition du mélèze laricin. Cette forte différenciation pourrait être ancienne et
avoir été causée par des processus de compétition interspécifique lors de la colonisation
postglaciaire. Le mélèze laricin est une espèce de début de succession de la forêt boréal
dominée par les épinettes (noire et blanche) et le sapin baumier au climax. Ces espèces
partagent les mêmes habitats (stations froides et humides pour l’épinette noire, sols jeunes et
perturbés pour l’épinette blanche et le sapin baumier). Cependant, les épinettes et le sapin
baumier sont plus tolérants à l'ombre que le mélèze, donc plus compétitifs en fin de
succession. L'étude du registre fossile a révélé que les épinettes et le sapin baumier avaient
colonisé l'ouest du continent avant le mélèze, tandis que le scénario inverse se serait produit
dans l’est nord-américain (recensement réalisé avec la base de données Neotoma;
http://apps.neotomadb.org/explorer/). Dans l’ouest de son aire de distribution, le mélèze se
serait alors établi en petites populations fragmentées durant la recolonisation postglaciaire en
raison d'une faible disponibilité en habitats. Le scénario aurait été différent dans l’est puisque
le mélèze était parmi les premiers colonisateurs et n’aurait pas été soumis à une telle
compétition interspécifique lors de la colonisation.
Cette étude est une première étape dans la compréhension des impacts de la
compétition interspécifique lors de la colonisation postglaciaire sur la structure génétique des
populations modernes des espèces. Elle illustre l’importance de tenir compte, en
phylogéographie comparative, des interactions écologiques entre les taxons en plus des
refuges glaciaires et des facteurs de vicariance communs. L’histoire postglaciaire d’une
espèce est complexe et requiert un savoir approfondi et une étude minutieuse de
l’environnement dans lequel elle évolue pour démystifier correctement son passé. En ce sens,
l’intégration de plusieurs disciplines comme la génétique des populations, l’analyse du
registre fossile et la phylogéographie comparative, s’est avérée indispensable à la
compréhension de l’histoire postglaciaire du mélèze laricin.
56
3.4 Littérature citée
Anderson, L.L., Hu, F.S., Nelson, D.M., Petit, R.J. & Paige, K.N. (2006) Ice-age endurance:
DNA evidence of a white spruce refugium in Alaska. Proceedings of the National
Academy of Sciences of the United States of America, 103, 12447–12450.
Bartlein, P.J., Anderson, K.H., Anderson, P.M., Edwards, M.E., Mock, C.J., Thompson, R.S.,
Webb, R.S. & Whitlock, C. (1998) Paleoclimate simulations for North America over
the past 21,000 years: Features of the simulated climate and comparisons with
paleoenvironmental data. Quaternary Science Reviews, 17, 549–585.
Brubaker, L.B., Anderson, P.M., Edwards, M.E. & Lozhkin, A.V. (2005) Beringia as a
glacial refugium for boreal trees and shrubs: new perspectives from mapped pollen
data. Journal of Biogeography, 32, 833–848.
Cinget, B., Gérardi, S., Beaulieu, J. & Bousquet, J. (2015) Less pollen-mediated gene flow
for more signatures of glacial lineages: congruent evidence from balsam fir cpDNA
and mtDNA for multiple refugia in eastern and central North America. PLoS
ONE 10(4): e0122815 (25p.).
de Lafontaine, G., Turgeon, J. & Payette, S. (2010) Phylogeography of white spruce (Picea
glauca) in eastern North America reveals contrasting ecological trajectories. Journal
of Biogeography, 37, 741–751.
Gavin, D.G., Fitzpatrick, M.C., Gugger, P.F., Heath, K.D., Rodríguez‐Sánchez, F.,
Dobrowski, S.Z., Hampe, A., Hu, F.S., Ashcroft, M.B., Bartlein, P.J., Blois, J.L.,
Carstens, B.C., Davis, E.B., de Lafontaine, G., Edwards, M.E., Fernandez, M.,
Henne, P.D., Herring, E.M., Holden, Z.A., Kong, W.-s., Liu, J., Magri, D., Matzke,
N.J., McGlone, M.S., Saltré, F., Stigall, A.L., Tsai, Y.-H.E. & Williams, J.W. (2014)
Climate refugia: joint inference from fossil records, species distribution models and
phylogeography. New Phytologist, 204, 37-54.
Gérardi, S., Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2010) From glacial refugia
to modern populations: new assemblages of organelle genomes generated by
differential cytoplasmic gene flow in transcontinental black spruce. Molecular
Ecology, 19, 5265–5280.
Godbout, J., Beaulieu, J. & Bousquet, J. (2010) Phylogeographic structure of jack pine (Pinus
banksiana; Pinaceae) supports the existence of a coastal glacial refugium in
northeastern North America. American Journal of Botany, 97, 1903–1912.
Godbout, J., Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2005) A mitochondrial DNA
minisatellite reveals the postglacial history of jack pine (Pinus banksiana), a broad-
range North American conifer. Molecular Ecology, 14, 3497–3512.
Gros-Louis, M.C., Bousquet, J., Pâques, L.E. & Isabel, N. (2005) Species-diagnostic markers
in Larix spp. based on RAPDs and nuclear, cpDNA, and mtDNA gene sequences,
and their phylogenetic implications. Tree Genetics & Genomes, 1, 50–63.
Hu, F.S., Hampe, A. & Petit, R.J. (2008) Paleoecology meets genetics: deciphering past
vegetational dynamics. Frontiers in Ecology and the Environment, 7, 371–379.
Ives, J.D. (1960) The deglaciation of Labrador-Ungava, an outline. Cahiers de géographie
du Québec, 4, 323–343.
Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2004) Variation in mitochondrial DNA
reveals multiple distant glacial refugia in black spruce (Picea mariana), a
transcontinental North American conifer. Molecular Ecology, 13, 2735–2747.
57
Jaramillo-Correa, J.P., Beaulieu, J., Khasa, D.P. & Bousquet, J. (2009) Inferring the past
from the present phylogeographic structure of North American forest trees: seeing
the forest for the genes. Canadian Journal of Forest Research, 39, 286–307.
Khasa, D.P., Jaramillo-Correa, J.P., Jaquish, B. & Bousquet, J. (2006) Contrasting
microsatellite variation between subalpine and western larch, two closely related
species with different distribution patterns. Molecular ecology, 15, 3907–3918.
Lamb, H.F. (1980) Late Quaternary vegetational history of southeastern Labrador. Arctic and
Alpine Research, 12, 117–135.
Laroche, J., Li, P., Maggia, L. & Bousquet, J. (1997) Molecular evolution of angiosperm
mitochondrial introns and exons. Proceedings of the National Academy of Sciences
of the United States of America, 94, 5722–5727.
Talbot, P., Schroeder, W.R., Bousquet, J. & Isabel, N. (2012) When exotic poplars and native
Populus balsamifera L. meet on the Canadian Prairies: Spontaneous hybridization
and establishment of interspecific hybrids. Forest Ecology and Management, 285,
142–152.
59
Liste entière de la littérature citée
Acheré, V., Rampant, P.F., Pâques, L.E. & Prat, D. (2004) Chloroplast and mitochondrial
molecular tests identify European × Japanese larch hybrids. Theoretical and Applied
Genetics, 108, 1643–1649.
Allendorf, F.W. (1986) Genetic drift and the loss of alleles versus heterozygosity. Zoo
Biology, 5, 181–190.
Anderson, L.L., Hu, F.S., Nelson, D.M., Petit, R.J. & Paige, K.N. (2006) Ice-age endurance:
DNA evidence of a white spruce refugium in Alaska. Proceedings of the National
Academy of Sciences of the United States of America, 103, 12447–12450.
Araki, N.H.T., Khatab, I.A., Hemamali, K., Inomata, N., Wang, X.R. & Szmidt, A.E. (2008)
Phylogeography of Larix sukaczewii Dyl. and Larix sibirica L. inferred from
nucleotide variation of nuclear genes. Tree Genetics & Genomes, 4, 611–623.
Arbogast, B.S. & Kenagy, G.J. (2001) Comparative phylogeography as an integrative
approach to historical biogeography. Journal of Biogeography, 28, 819–825.
Avise, J.C. (2000) Phylogeography: The history and formation of species. Harvard
University Press.
Avise, J.C., Arnold, J., Ball, R.M., Bermingham, E., Lamb, T., Neigel, J.E., Reeb, C.A. &
Saunders, N.C. (1987) Intraspecific phylogeography - The mitochondrial-DNA
bridge between population-genetics and systematics. Annual Review of Ecology and
Systematics, 18, 489–522.
Bartlein, P.J., Anderson, K.H., Anderson, P.M., Edwards, M.E., Mock, C.J., Thompson, R.S.,
Webb, R.S. & Whitlock, C. (1998) Paleoclimate simulations for North America over
the past 21,000 years: Features of the simulated climate and comparisons with
paleoenvironmental data. Quaternary Science Reviews, 17, 549–585.
Bermingham, E. & Moritz, C. (1998) Comparative phylogeography: concepts and
applications. Molecular Ecology, 7, 367–369.
Bhagwat, S.A. & Willis, K.J. (2008) Species persistence in northerly glacial refugia of
Europe: a matter of chance or biogeographical traits? Journal of Biogeography, 35,
464–482.
Birks, H.H. (2003) The importance of plant macrofossils in the reconstruction of Lateglacial
vegetation and climate: examples from Scotland, western Norway, and Minnesota,
USA. Quaternary Science Reviews, 22, 453–473.
Birks, H.J.B. (1976) Late-Wisconsinan vegetational history at Wolf Creek, central
Minnesota. Ecological Monographs, 395–429.
Birks, H.J.B. (1981) Late Wisconsin vegetational and climatic history at Kylen Lake,
northeastern Minnesota. Quaternary Research, 16, 322–355.
Birky, C.W.J., Fuerst, P. & Maruyama, T. (1989) Organelle gene diversity under migration,
mutation and drift: Equilibrium expectations, approach to equilibrium, effects of
heteroplasmic cells, and comparison to nuclear genes. Genetics, 121, 613–627.
Bonen, L., Williams, K., Bird, S. & Wood, C. (1994) The NADH dehydrogenase subunit 7
gene is interrupted by four group II introns in the wheat mitochondrial genome.
Molecular and General Genetics, 244, 81–89.
Bouillé, M., Senneville, S. & Bousquet, J. (2011) Discordant mtDNA and cpDNA
phylogenies indicate geographic speciation and reticulation as driving factors for
the diversification of the genus Picea. Tree Genetics & Genomes, 7, 469–484.
60
Bousquet, J., Strauss, S.H. & Li, P. (1992) Complete congruence between morphological and
rbcL-based molecular phylogenies in birches and related species (Betulaceae).
Molecular Biology and Evolution, 9, 1076–1088.
Brown, K.R., Zobel, D.B. & Zasada, J.C. (1988) Seed dispersal, seedling emergence, and
early survival of Larix laricina (DuRoi) K. Koch in the Tanana Valley, Alaska.
Canadian Journal of Forest Research, 18, 306–314.
Brubaker, L.B., Anderson, P.M., Edwards, M.E. & Lozhkin, A.V. (2005) Beringia as a
glacial refugium for boreal trees and shrubs: new perspectives from mapped pollen
data. Journal of Biogeography, 32, 833–848.
Burban, C. & Petit, R.J. (2003) Phylogeography of maritime pine inferred with organelle
markers having contrasted inheritance. Molecular Ecology, 12, 1487–1495.
Burns, R.M. & Honkala, B.H. (1990) Silvics of North America. Forest Service, United States
Department of Agriculture, Washington, D.C.
Chabot, B.F. & Hicks, D.J. (1982) The ecology of leaf life spans. Annual Review of Ecology
and Systematics, 13, 229–259.
Cheliak, W.M., Wang, J. & Pitel, J.A. (1988) Population structure and genic diversity in
tamarack, Larix laricina (DuRoi) K. Koch. Canadian Journal of Forest Research,
18, 1318–1324.
Cinget, B., de Lafontaine, G., Gérardi, S. & Bousquet, J. (2015) Integrating phylogeography
and paleoecology to investigate the origin and dynamics of hybrid zones: insights
from two widespread North American firs. Molecular Ecology (in press).
Cinget, B., Gérardi, S., Beaulieu, J. & Bousquet, J. (2015) Less pollen-mediated gene flow
for more signatures of glacial lineages: congruent evidence from balsam fir cpDNA
and mtDNA for multiple refugia in eastern and central North America. PLoS
ONE 10(4): e0122815 (25p.).
Colwell, R.K. & Coddington, J.A. (1994) Estimating terrestrial biodiversity through
extrapolation. Philosophical Transactions of the Royal Society B: Biological
Sciences, 345, 101–118.
Comes, H.P. & Kadereit, J.W. (1998) The effect of Quaternary climatic changes on plant
distribution and evolution. Trends in Plant Science, 3, 432–438.
Corander, J., Sirén, J. & Arjas, E. (2008) Bayesian spatial modeling of genetic population
structure. Computational Statistics, 23, 111–129.
Davis, M.B. & Shaw, R.G. (2001) Range shifts and adaptive responses to Quaternary climate
change. Science, 292, 673–679.
Davis, M.B. (1981) Quaternary history and the stability of forest communities. Forest
Succession (ed. by D.C. West, H.H. Shugart and D.B. Botkin), pp. 132–153.
Springer, New York, USA.
Davis, M.B., Schwartz, M.W. & Woods, K. (1991) Detecting a species limit from pollen in
sediments. Journal of Biogeography, 18, 653–668.
de Lafontaine G., Turgeon, J. & Payette, S. (2010) Phylogeography of white spruce (Picea
glauca) in eastern North America reveals contrasting ecological trajectories.
Journal of Biogeography, 37, 741–751.
de Lafontaine, G., Ducousso, A., Lefèvre, S., Magnanou, E. & Petit, R.J. (2013) Stronger
spatial genetic structure in recolonized areas than in refugia in the European beech.
Molecular Ecology, 22, 4397–4412.
61
Demesure, B., Sodzi, N. & Petit, R.J. (1995) A set of universal primers for amplification of
polymorphic non‐coding regions of mitochondrial and chloroplast DNA in plants.
Molecular Ecology, 4, 129–134.
Di Rienzo, A., Peterson, A.C., Garza, J.C., Valdes, A.M., Slatkin, M. & Freimer, N.B. (1994)
Mutational processes of simple-sequence repeat loci in human populations.
Proceedings of the National Academy of Sciences, 91, 3166–3170.
Dong, J. & Wagner, D.B. (1993) Taxonomic and population differentiation of mitochondrial
diversity in Pinus banksiana and Pinus contorta. Theoretical and Applied Genetics,
86, 573–578.
Downie, S. & Palmer, J. (1992) Use of Chloroplast DNA Rearrangements in Reconstructing
Plant Phylogeny. Molecular Systematics of Plants (ed. by P.S. Soltis, D.E. Soltis
and J.J. Doyle), pp. 14–35. Springer, New York, USA.
Duff, R.J. & Nickrent, D.L. (1999) Phylogenetic relationships of land plants using
mitochondrial small-subunit rDNA sequences. American Journal of Botany, 86,
372–386.
Duminil, J., Pemonge, M.H. & Petit, R.J. (2002) A set of 35 consensus primer pairs
amplifying genes and introns of plant mitochondrial DNA. Molecular Ecology
Notes, 2, 428–430.
Dumolin-Lapegue, S., Pemonge, M.H. & Petit, R.J. (1997) An enlarged set of consensus
primers for the study of organelle DNA in plants. Molecular Ecology, 6, 393–397.
Dyke, A.S. (2004) An outline of North American deglaciation with emphasis on central and
northern Canada. Quaternary Glaciations: Extent and Chronology, Part II (ed. by
J. Ehlers and P.L. Gibbard), pp. 373–424. Elsevier, Amsterdam, Netherlands.
Dyke, A.S., Andrews, J.T., Clark, P.U., England, J.H., Miller, G.H., Shaw, J. & Veillette, J.J.
(2002) The Laurentide and Innuitian ice sheets during the Last Glacial Maximum.
Quaternary Science Reviews, 21, 9–31.
Ennos, R.A. (1994) Estimating the relative rates of pollen and seed migration among plant
populations. Heredity, 72, 250–259.
Eyre, F.H. (1980) Forest Cover Types of the United States and Canada. Society of American
Foresters, Washington, D.C., USA.
Feurdean, A., Bhagwat, S.A., Willis, K.J., Birks, H.J.B., Lischke, H. & Hickler, T. (2013)
Tree migration-rates: narrowing the gap between inferred post-glacial rates and
projected rates. PLoS ONE, 8, e71797.
Gavin, D.G., Fitzpatrick, M.C., Gugger, P.F., Heath, K.D., Rodríguez‐Sánchez, F.,
Dobrowski, S.Z., Hampe, A., Hu, F.S., Ashcroft, M.B., Bartlein, P.J., Blois, J.L.,
Carstens, B.C., Davis, E.B., de Lafontaine, G., Edwards, M.E., Fernandez, M.,
Henne, P.D., Herring, E.M., Holden, Z.A., Kong, W.-s., Liu, J., Magri, D., Matzke,
N.J., McGlone, M.S., Saltré, F., Stigall, A.L., Tsai, Y.-H.E. & Williams, J.W. (2014)
Climate refugia: joint inference from fossil records, species distribution models and
phylogeography. New Phytologist, 204, 37-54.
Gérardi, S., Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2010) From glacial refugia
to modern populations: new assemblages of organelle genomes generated by
differential cytoplasmic gene flow in transcontinental black spruce. Molecular
Ecology, 19, 5265–5280.
Godbout, J., Beaulieu, J. & Bousquet, J. (2010) Phylogeographic structure of jack pine (Pinus
banksiana; Pinaceae) supports the existence of a coastal glacial refugium in
northeastern North America. American Journal of Botany, 97, 1903–1912.
62
Godbout, J., Fazekas, A., Newton, C.H., Yeh, F.C. & Bousquet, J. (2008) Glacial vicariance
in the Pacific Northwest: evidence from a lodgepole pine mitochondrial DNA
minisatellite for multiple genetically distinct and widely separated refugia.
Molecular Ecology, 17, 2463–2475.
Godbout, J., Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2005) A mitochondrial DNA
minisatellite reveals the postglacial history of jack pine (Pinus banksiana), a broad-
range North American conifer. Molecular Ecology, 14, 3497–3512.
Godbout, J., Yeh, F.C. & Bousquet, J. (2012) Large‐scale asymmetric introgression of
cytoplasmic DNA reveals Holocene range displacement in a North American boreal
pine complex. Ecology and Evolution, 2, 1853–1866.
Goudet, J. (1995) FSTAT (version 1.2): a computer program to calculate F-statistics. Journal
of Heredity, 86, 485–486.
Gower, S.T. & Richards, J.H. (1990) Larches: deciduous conifers in an evergreen world.
Bioscience, 40, 818–826.
Gower, S.T., Grier, C.C. & Vogt, K.A. (1989) Aboveground production and N and P use by
Larix occidentalis and Pinus contorta in the Washington Cascades, USA. Tree
Physiology, 5, 1–11.
Gros-Louis, M.C., Bousquet, J., Pâques, L.E. & Isabel, N. (2005) Species-diagnostic markers
in Larix spp. based on RAPDs and nuclear, cpDNA, and mtDNA gene sequences,
and their phylogenetic implications. Tree Genetics & Genomes, 1, 50–63.
Guichoux, E., Garnier‐Géré, P., Lagache, L., Lang, T., Boury, C. & Petit, R. (2013) Outlier
loci highlight the direction of introgression in oaks. Molecular Ecology, 22, 450–
462.
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98.
Henry, R., Brooks, B. & Davis, C. (1973) Population density of Larix laricina in a sphagnum
bog mat habitat. Michigan Academician, 5, 529–535.
Hewitt, G. (2000) The genetic legacy of the Quaternary ice ages. Nature, 405, 907–913.
Holdridge, L.R., Grenke, W.C., Hatheway, W.H., Liang, T. & Tosi, J.A. (1971) Forest
environments in tropical life zones: a pilot study. Pergamon Press, Oxford, United
Kingdom.
Hopkins, D.M. (1982) Aspects of the paleogeography of Beringia during the late Pleistocene.
Paleoecology of Beringia. Academic Press, New York, 3–28.
Hu, F.S., Hampe, A. & Petit, R.J. (2008) Paleoecology meets genetics: deciphering past
vegetational dynamics. Frontiers in Ecology and the Environment, 7, 371–379.
Humphries, C.J. (2000) Form, space and time; which comes first? Journal of Biogeography,
27, 11–15.
Ibrahim, K.M., Nichols, R.A. & Hewitt, G.M. (1996) Spatial patterns of genetic variation
generated by different forms of dispersal. Heredity, 77, 282–291.
Ives, J.D. (1960) The deglaciation of Labrador-Ungava, an outline. Cahiers de géographie
du Québec, 4, 323–343.
Jackson, S.T., Overpeck, J.T., Webb, T., Keattch, S.E. & Anderson, K.H. (1997) Mapped
plant-macrofossil and pollen records of late quaternary vegetation change in Eastern
North America. Quaternary Science Reviews, 16, 1–70.
Jackson, S.T., Webb, R.S., Anderson, K.H., Overpeck, J.T., Webb, T., Williams, J.W. &
Hansen, B.C.S. (2000) Vegetation and environment in Eastern North America
during the Last Glacial Maximum. Quaternary Science Reviews, 19, 489–508.
63
Jaramillo-Correa, J.P. & Bousquet, J. (2003) New evidence from mitochondrial DNA of a
progenitor-derivative species relationship between black spruce and red spruce.
American Journal of Botany, 90, 1801–1806.
Jaramillo-Correa, J.P. & Bousquet, J. (2005) Mitochondrial genome recombination in the
zone of contact between two hybridizing conifers. Genetics, 171, 1951–1962.
Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2004) Variation in mitochondrial DNA
reveals multiple distant glacial refugia in black spruce (Picea mariana), a
transcontinental North American conifer. Molecular Ecology, 13, 2735–2747.
Jaramillo-Correa, J.P., Beaulieu, J., Khasa, D.P. & Bousquet, J. (2009) Inferring the past
from the present phylogeographic structure of North American forest trees: seeing
the forest for the genes. Canadian Journal of Forest Research, 39, 286–307.
Jaramillo‐Correa, J.P., Beaulieu, J., Ledig, F.T. & Bousquet, J. (2006) Decoupled
mitochondrial and chloroplast DNA population structure reveals Holocene collapse
and population isolation in a threatened Mexican‐endemic conifer. Molecular
Ecology, 15, 2787–2800.
Jeandroz, S., Bastien, D., Chandelier, A., Du Jardin, P. & Favre, J.M. (2002) A set of primers
for amplification of mitochondrial DNA in Picea abies and other conifer species.
Molecular Ecology Notes, 2, 389–392.
Johnston, W.F. (1990) Larix laricina (Du Roi) K. Koch. Silvics of North America: Vol. 1
Conifers (ed. by R.M. Burns and B.H. Honkala), pp. 26–35. Agriculture handbook
654, US Department of Agriculture, Forest Service, Washington, D.C., USA.
Keppel, G., Van Niel, K.P., Wardell‐Johnson, G.W., Yates, C.J., Byrne, M., Mucina, L.,
Schut, A.G., Hopper, S.D. & Franklin, S.E. (2012) Refugia: identifying and
understanding safe havens for biodiversity under climate change. Global Ecology
and Biogeography, 21, 393–404.
Khasa, D.P., Jaramillo-Correa, J.P., Jaquish, B. & Bousquet, J. (2006) Contrasting
microsatellite variation between subalpine and western larch, two closely related
species with different distribution patterns. Molecular ecology, 15, 3907–3918.
Khatab, I.A., Ishiyama, H., Inomata, N., Wang, X.R. & Szmidt, A.E. (2008) Phylogeography
of Eurasian Larix species inferred from nucleotide variation in two nuclear genes.
Genes & Genetic Systems, 83, 55–66.
Kindt, R. & Coe, R. (2005) Tree diversity analysis: A manual and software for common
statistical methods for ecological and biodiversity studies. World Agroforestry
Centre (ICRAF), Nairobi, Kenya.
Knowles, P., Perry, D.J. & Foster, H.A. (1992) Spatial genetic structure in two tamarack
Larix laricina (Du Roi) K. Koch populations with differing establishment histories.
Evolution, 46, 572–576.
Kubo, T., Nishizawa, S., Sugawara, A., Itchoda, N., Estiati, A. & Mikami, T. (2000) The
complete nucleotide sequence of the mitochondrial genome of sugar beet (Beta
vulgaris L.) reveals a novel gene for tRNACys (GCA). Nucleic Acids Research, 28,
2571–2576.
Lamb, H.F. (1980) Late Quaternary vegetational history of southeastern Labrador. Arctic and
Alpine Research, 12, 117–135.
Laroche, J., Li, P., Maggia, L. & Bousquet, J. (1997) Molecular evolution of angiosperm
mitochondrial introns and exons. Proceedings of the National Academy of Sciences
of the United States of America, 94, 5722–5727.
64
Lemieux, M.J., Beaulieu, J. & Bousquet, J. (2011) Chloroplast DNA polymorphisms in
eastern hemlock: range-wide genogeographic analyses and implications for gene
conservation. Canadian Journal of Forest Research, 41, 1047–1059.
Lisitsyna, O.V., Giesecke, T. & Hicks, S. (2011) Exploring pollen percentage threshold
values as an indication for the regional presence of major European trees. Review of
Palaeobotany and Palynology, 166, 311–324.
Lu, M.-Z., Szmidt, A.E. & Wang, X.-R. (1998) RNA editing in gymnosperms and its impact
on the evolution of the mitochondrial coxI gene. Plant Molecular Biology, 37, 225–
234.
MacArthur, R.H. (1967) The theory of island biogeography. Princeton University Press,
Princeton, USA.
MacDonald, G.M. & Cwynar, L.C. (1985) A fossil pollen based reconstruction of the late
Quaternary history of lodgepole pine (Pinus contorta ssp. latifolia) in the western
interior of Canada. Canadian Journal of Forest Research, 15, 1039–1044.
Maréchal-Drouard, L., Kumar, R., Remacle, C. & Small, I. (1996) RNA editing of larch
mitochondrial tRNAHis precursors is a prerequisite for processing. Nucleic Acids
Research, 24, 3229–3234.
Matthews, J.A. (1992) The ecology of recently deglaciated terrain. A geoecological
approach to glacier forelands and primary succession. Cambridge University Press,
Cambridge, United Kingdom.
McLachlan, J.S., Clark, J.S. & Manos, P.S. (2005) Molecular indicators of tree migration
capacity under rapid climate change. Ecology, 86, 2088–2098.
McLeod, T. & MacDonald, G. (1997) Postglacial range expansion and population growth of
Picea mariana, Picea glauca and Pinus banksiana in the western interior of Canada.
Journal of Biogeography, 24, 865–881.
Miller, M.P. (2005) Alleles In Space (AIS): computer software for the joint analysis of
interindividual spatial and genetic information. Journal of Heredity, 96, 722–724.
Miller, M.P., Bellinger, M.R., Forsman, E.D. & Haig, S.M. (2006) Effects of historical
climate change, habitat connectivity, and vicariance on genetic structure and
diversity across the range of the red tree vole (Phenacomys longicaudus) in the
Pacific Northwestern United States. Molecular Ecology, 15, 145–159.
Mix, A.C., Bard, E. & Schneider, R. (2001) Environmental processes of the ice age: land,
oceans, glaciers (EPILOG). Quaternary Science Reviews, 20, 627–657.
Nadeem, S., Jaquish, B., Newton, C. & Khasa, D.P. (2003) Use of diagnostic SSR markers
for identification of Larix lyallii and L. occidentalis (Pinaceae). Edinburgh Journal
of Botany, 60, 49–56.
Neale, D.B. & Sederoff, R.R. (1988) Inheritance and evolution of conifer organelle genomes.
Genetic Manipulation of Woody Plants (ed. by J.W. Hanover, D.E. Keathley, C.M.
Wilson and G. Kuny), pp. 251–264, Michigan State University, East Lansing, USA.
Nei, M. (1973) Analysis of gene diversity in subdivided populations. Proceedings of the
National Academy of Sciences of the United States of America, 70, 3321–3323.
Nystedt, B., Street, N.R., Wetterbom, A., Zuccolo, A., Lin, Y.-C., Scofield, D.G., Vezzi, F.,
Delhomme, N., Giacomello, S. & Alexeyenko, A. (2013) The Norway spruce
genome sequence and conifer genome evolution. Nature, 497, 579–584.
Pâques, L.E. (1992) Performance of vegetatively propagated Larix decidua, L. kaempferi and
L. laricina hybrids. Annals of Forest Science, 49, 63–74.
65
Parducci, L., Szmidt, A.E., Madaghiele, A., Anzidei, M. & Vendramin, G.G. (2001) Genetic
variation at chloroplast microsatellites (cpSSRs) in Abies nebrodensis (Lojac.)
Mattei and three neighboring Abies species. Theoretical and Applied Genetics, 102,
733–740.
Payette, S. (2013) Flore nordique du Québec et du Labrador, volume 1. Presses de
l’Université Laval, Québec, Canada.
Payette, S. (1993) The range limit of boreal tree species in Quebec-Labrador: An ecological
and paleoecological interpretation. Review of Palaeobotany and Palynology, 79, 7–
30.
Perron, M. & Ménétrier, J. (2013) Le mélèze laricin. Le guide sylvicole du Québec - Tome 1
- Les fondements biologiques de la sylviculture, pp. 132–133. Les publications du
Québec, Québec, Canada.
Petit, R.J. & Vendramin, G.G. (2007) Plant phylogeography based on organelle genes: an
introduction. Phylogeography of Southern European Refugia (ed. by S. Weiss and
N. Ferrand), pp. 23–97. Springer, New York, USA.
Petit, R.J., Aguinagalde, I., de Beaulieu, J.-L., Bittkau, C., Brewer, S., Cheddadi, R., Ennos,
R., Fineschi, S., Grivet, D., Lascoux, M., Mohanty A., Müller-Starck G., Demesure-
Musch B., Palmé A., Martín, J.P., Rendell S. & Vendramin G.G. (2003) Glacial
refugia: hotspots but not melting pots of genetic diversity. Science, 300, 1563–1565.
Petit, R.J., Duminil, J., Fineschi, S., Hampe, A., Salvini, D. & Vendramin, G.G. (2005)
Invited review: comparative organization of chloroplast, mitochondrial and nuclear
diversity in plant populations. Molecular Ecology, 14, 689–701.
Pielou, E.C. (1991) After the ice age: the return of life to glaciated North America. The
University of Chicago Press, Chicago, USA.
Polezhaeva, M.A., Lascoux, M. & Semerikov, V.L. (2010) Cytoplasmic DNA variation and
biogeography of Larix Mill. in Northeast Asia. Molecular Ecology, 19, 1239–1252.
Pons, O. & Petit, R.J. (1996) Measuring and testing genetic differentiation with ordered
versus unordered alleles. Genetics, 144, 1237–1245.
Provan, J. & Bennett, K.D. (2008) Phylogeographic insights into cryptic glacial refugia.
Trends in Ecology & Evolution, 23, 564–571.
R development team. (2012) R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna, Austria.
Richard, P.J.H. (1993) Origine et dynamique postglaciaire de la forêt mixte au Québec.
Review of Palaeobotany and Palynology, 79, 31–68.
Ritchie, J.C. & MacDonald, G.M. (1986) The patterns of post-glacial spread of white spruce.
Journal of Biogeography, 527–540.
Ritchie, J.C. (1987) Postglacial Vegetation of Canada. Cambridge University Press,
Cambridge, United Kingdom.
Rowe, J.S. & Halliday, W.E.D. (1972) Forest Regions of Canada. Department of the
Environment, Canadian Forestry Service, Ottawa, Canada.
Semerikov, V.L. & Lascoux, M. (2003) Nuclear and cytoplasmic variation within and
between Eurasian Larix (Pinaceae) species. American Journal of Botany, 90, 1113–
1123.
Semerikov, V.L., Iroshnikov, A.I. & Lascoux, M. (2007) Mitochondrial DNA variation
pattern and postglacial history of the Siberian larch (Larix sibirica Ledeb.). Russian
Journal of Ecology, 38, 147–154.
66
Semerikov, V.L., Vendramin, G.G., Sebastiani, F. & Lascoux, M. (2006) RAPD-derived,
PCR-based mitochondrial markers for Larix species and their usefulness in
phylogeny. Conservation Genetics, 7, 621–625.
Shafer, A.B.A., Cullingham, C.I., Cote, S.D. & Coltman, D.W. (2010) Of glaciers and
refugia: a decade of study sheds new light on the phylogeography of northwestern
North America. Molecular Ecology, 19, 4589–4621.
Short, S.K. & Nichols, H. (1977) Holocene pollen diagrams from subarctic Labrador-
Ungava: vegetational history and climatic change. Arctic and Alpine Research, 9,
265–290.
Slatkin, M. (1995) A measure of population subdivision based on microsatellite allele
frequencies. Genetics, 139, 457–462.
Soberón, J.M. & Llorente, J.B. (1993) The use of species accumulation functions for the
prediction of species richness. Conservation Biology, 7, 480–488.
Soltis, D.E., Morris, A.B., McLachlan, J.S., Manos, P.S. & Soltis, P.S. (2006) Comparative
phylogeography of unglaciated eastern North America. Molecular Ecology, 15,
4261–4293.
Soranzo, N., Provan, J. & Powell, W. (1999) An example of microsatellite length variation
in the mitochondrial genome of conifers. Genome, 42, 158–161.
Taberlet, P., Fumagalli, L., Wust-Saucy, A.G. & Cosson, J.F. (1998) Comparative
phylogeography and postglacial colonization routes in Europe. Molecular Ecology,
7, 453–464.
Talbot, P., Schroeder, W.R., Bousquet, J. & Isabel, N. (2012) When exotic poplars and native
Populus balsamifera L. meet on the Canadian Prairies: Spontaneous hybridization
and establishment of interspecific hybrids. Forest Ecology and Management, 285,
142–152.
Tani, N., Maruyama, K., Tomaru, N., Uchida, K., Araki, M., Tsumura, Y., Yoshimaru, H. &
Ohba, K. (2003) Genetic diversity of nuclear and mitochondrial genomes in Pinus
parviflora Sieb. & Zucc. (Pinaceae) populations. Heredity, 91, 510–518.
Tautz, D. (1989) Hypervariability of simple sequences as a general source for polymorphic
DNA markers. Nucleic Acids Research, 17, 6463–6471.
Thompson, J.N., Woodruff, R.C. & Huai, H. (1998) Mutation rate: a simple concept has
become complex. Environmental and Molecular Mutagenesis, 32, 292–300.
Tian, S., López-Pujol, J., Wang, H.-W., Ge, S. & Zhang, Z.-Y. (2010) Molecular evidence
for glacial expansion and interglacial retreat during Quaternary climatic changes in
a montane temperate pine (Pinus kwangtungensis Chun ex Tsiang) in southern
China. Plant Systematics and Evolution, 284, 219–229.
Tremblay, N.O. & Schoen, D.J. (1999) Molecular phylogeography of Dryas integrifolia:
glacial refugia and postglacial recolonization. Molecular Ecology, 8, 1187–1198.
Vendramin, G.G., Lelli, L., Rossi, P. & Morgante, M. (1996) A set of primers for the
amplification of 20 chloroplast microsatellites in Pinaceae. Molecular Ecology, 5,
595–598.
Walter, R. & Epperson, B.K. (2005) Geographic pattern of genetic diversity in Pinus
resinosa: contact zone between descendants of glacial refugia. American Journal of
Botany, 92, 92–100.
Wang, X.-Q., Tank, D.C. & Sang, T. (2000) Phylogeny and divergence times in Pinaceae:
evidence from three genomes. Molecular Biology and Evolution, 17, 773–781.
67
Webb, T. & Bartlein, P.J. (1992) Global changes during the last 3 million years: climatic
controls and biotic responses. Annual Review of Ecology and Systematics, 23, 141–
173.
Wei, X.-X., Beaulieu, J., Khasa, D.P., Vargas-Hernández, J., López-Upton, J., Jaquish, B. &
Bousquet, J. (2011) Range-wide chloroplast and mitochondrial DNA imprints
reveal multiple lineages and complex biogeographic history for Douglas-fir. Tree
Genetics & Genomes, 7, 1025–1040.
Weir, B.S. (1996) Genetic data analysis 2. Sinauer Associates, Sunderland, USA.
Whitehead, D.R. (1981) Late-Pleistocene vegetational changes in northeastern North
Carolina. Ecological Monographs, 451–471.
Wolfe, K.H., Li, W.H. & Sharp, P.M. (1987) Rates of nucleotide substitution vary greatly
among plant mitochondrial, chloroplast, and nuclear DNAs. Proceedings of the
National Academy of Sciences of the United States of America, 84, 9054–9058.
Wright, S. (1932) The roles of mutation, inbreeding, crossbreeding and selection in
evolution. Proceedings of the Sixth International Congress on Genetics, pp. 356–
366.
Wright, S. (1949) The genetical structure of populations. Annals of Eugenics, 15, 323–354.
Wu, J., Krutovskii, K.V. & Strauss, S.H. (1998) Abundant mitochondrial genome diversity,
population differentiation and convergent evolution in pines. Genetics, 150, 1605–
1614.
Yi, X., Gao, L., Wang, B., Su, Y.-J. & Wang, T. (2013) The Complete Chloroplast Genome
Sequence of Cephalotaxus oliveri (Cephalotaxaceae): Evolutionary Comparison of
Cephalotaxus Chloroplast DNAs and Insights into the Loss of Inverted Repeat
Copies in Gymnosperms. Genome Biology and Evolution, 5, 688–698.
Zazula, G.D., Telka, A.M., Harington, C.R., Schweger, C.E. & Mathewes, R.W. (2006)
New spruce (Picea spp.) macrofossils from Yukon Territory: implications for Late
Pleistocene refugia in Eastern Beringia. Arctic, 59, 391–400.
Zhou, Y.F., Abbott, R.J., Jiang, Z.Y., Du, F.K., Milne, R.I. & Liu, J.Q. (2010) Gene flow and
species delimitation: a case study of two pine species with overlapping distributions
in southeast China. Evolution, 64, 2342–2352.
69
Annexes
Appendix S1. Mitotype counts for one mtDNA polymorphic locus in 45 Larix laricina
populations.
Latitude Longitude Mitotype
counts
Population Name Province/state n1 (°N) (°E) I II
1 Port Hope Simpson Newfound Land 11 52.53 -56.29 11 0
2 Cartwright Newfound Land 15 53.71 -57.00 3 12
3 Goose River North Newfound Land 13 53.40 -60.43 13 0
4 Happy Valley Newfound Land 15 53.20 -62.23 15 0
5 Churchill Falls Newfound Land 15 53.56 -63.91 15 0
6 Stanley New Brunswick 15 46.27 -66.65 15 0
7 Amqui Québec 11 48.44 -67.35 11 0
8 Fermont Québec 15 52.79 -67.40 15 0
9 Manic 5 Québec 13 50.66 -68.68 13 0
10 Reservoir Bersimis-2 Québec 15 49.17 -69.34 15 0
11 La Malbaie Québec 14 47.40 -70.20 14 0
12 Jackman Maine 15 45.49 -70.22 11 4
13 Roberval Québec 15 48.17 -72.16 15 0
14 South Wallingford Vermont 15 43.34 -72.99 15 0
15 Grenville Bay Québec 14 45.65 -74.63 14 0
16 Elzevir Ontario 15 44.63 -77.27 15 0
17 Englehart Ontario 14 47.90 -79.95 11 3
18 Shelburne Ontario 15 44.07 -80.24 15 0
19 Holly Michigan 14 42.77 -83.66 14 0
20 Fushimi Lake Provincial Park Ontario 15 49.84 -83.92 15 0
21 Tittabawassee River Michigan 15 44.09 -84.29 15 0
22 Wilderness State Park Michigan 14 45.70 -85.01 14 0
23 White Lake Provincial Park Ontario 13 48.69 -85.64 13 0
24 Hiawatha National Forest Michigan 13 45.96 -87.00 13 0
25 Shebandowan Ontario 15 48.62 -90.18 15 0
26 Apostle Islands National Lakeshore Wisconsin 15 46.93 -90.72 15 0
27 Saint Croix State Forest Minnesota 15 46.12 -92.67 15 0
28 Blackberry Minnesota 15 47.22 -93.36 15 0
29 Richer Manitoba 14 49.66 -96.28 14 0
30 Grahamdal Manitoba 14 52.08 -98.84 14 0
31 Minago River Manitoba 13 54.19 -99.18 13 0
32 Cranberry Portage Manitoba 9 54.55 -101.38 9 0
33 Granit Lake Saskatchewan 13 54.84 -102.59 13 0
34 Southend Saskatchewan 14 56.16 -103.20 14 0
35 Big Sandy Lake Saskatchewan 13 54.50 -104.16 13 0
36 Prince Albert Saskatchewan 11 53.36 -105.47 11 0
37 Morin Lake Saskatchewan 13 55.10 -105.99 13 0
38 Lac la Plonge Saskatchewan 6 55.21 -107.49 6 0
39 Patuanak Saskatchewan 13 55.88 -107.70 13 0
40 Aubichon Lake Saskatchewan 10 54.59 -107.82 10 0
41 Meadow River Saskatchewan 14 54.25 -108.36 14 0
42 Goodsoil Saskatchewan 6 54.40 -109.23 6 0
43 Glendon Alberta 15 54.24 -111.24 15 0
44 Whitecourt Alberta 15 54.09 -115.01 15 0
45 Fairbanks Alaska 14 64.42 -148.00 14 0
Total - - 606 - - 587 19 1Number of genotyped individuals per populations.
70
Appendix S2. Chlorotype counts for three cpDNA polymorphic SSRs in 45 Larix laricina populations. Population Latitude Longitude Chlorotype counts
Number Name Province/state n1 (°N) (°E) I II III IV V VI VII VIII IX X XI XII
1 Port Hope Simpson Newfound Land 11 52,53 -56,29 1 3 3
2 Cartwright Newfound Land 15 53,71 -57,00 7 2 2
3 Goose River North Newfound Land 15 53,40 -60,43 9 3
4 Happy Valley Newfound Land 15 53,20 -62,23 9 1
5 Churchill Falls Newfound Land 15 53,56 -63,91 1 12
6 Stanley New Brunswick 13 46,27 -66,65 4 8 1
7 Amqui Québec 11 48,44 -67,35 5 2
8 Fermont Québec 15 52,79 -67,40 2 1 6 2
9 Manic 5 Québec 15 50,66 -68,68 10 1
10 Reservoir Bersimis-2 Québec 14 49,17 -69,34 5 1 3
11 La Malbaie Québec 15 47,60 -70,20 5 4
12 Jackman Maine 15 45,49 -70,22 2 4 3
13 Roberval Québec 9 48,17 -72,16 4 4
14 South Wallingford Vermont 15 43,34 -72,99 12
15 Grenville Bay Québec 14 45,65 -74,63 1 2 3
16 Elzevir Ontario 15 44,63 -77,27 1 7 1 1
17 Englehart Ontario 14 47,90 -79,95 2 2 8
18 Shelburne Ontario 14 44,07 -80,24 1 1 1 1
19 Holly Michigan 14 42,77 -83,66 5 1 2 1
20 Fushimi Lake Provincial Park Ontario 14 49,84 -83,92 10 1
21 Tittabawassee River Michigan 15 44,09 -84,29 7 3
22 Wilderness State Park Michigan 14 45,70 -85,01 1 7 1 1 3
23 White Lake Provincial Park Ontario 15 48,69 -85,64 9
24 Hiawatha National Forest Michigan 12 45,96 -87,00 1 7
25 Shebandowan Ontario 15 48,62 -90,18 8
26 Apostle Islands National Lakeshore Wisconsin 13 46,93 -90,72 1 1 6
27 Saint Croix State Forest Minnesota 15 46,12 -92,67 1 6
28 Blackberry Minnesota 15 47,22 -93,36 1 9 1
29 Richer Manitoba 13 49,66 -96,28 1 8 1
30 Grahamdal Manitoba 11 52,08 -98,84 1 1 5
31 Minago River Manitoba 13 54,19 -99,18 3 1 3 1 2
32 Cranberry Portage Manitoba 9 54,55 -101,38 4
33 Granit Lake Saskatchewan 13 54,84 -102,59 1 6 1
34 Southend Saskatchewan 13 56,16 -103,20 1 1 10 1
35 Big Sandy Lake Saskatchewan 13 54,50 -104,16 1 2 2 1
36 Prince Albert Saskatchewan 9 53,36 -105,47 1 4
37 Morin Lake Saskatchewan 13 55,10 -105,99 1 2 1 3
71
Population Latitude Longitude Chlorotype counts
Number Name Province/state n1 (°N) (°E) I II III IV V VI VII VIII IX X XI XII
38 Lac la Plonge Saskatchewan 6 55,21 -107,49 1 2
39 Patuanak Saskatchewan 11 55,88 -107,70 5 1
40 Aubichon Lake Saskatchewan 10 54,59 -107,82 2 3 1 2
41 Meadow River Saskatchewan 13 54,25 -108,36 8 1 4
42 Goodsoil Saskatchewan 6 54,40 -109,23 1 2 2
43 Glendon Alberta 15 54,24 -111,24 1
44 Whitecourt Alberta 15 54,09 -115,01 1 13 1
45 Fairbanks Alaska 14 64,42 -148,0 1
Total - - 589 - - 17 18 4 8 260 8 6 46 3 1 13 6 1Number of genotyped individuals per populations.
Population Latitude Longitude Chlorotype counts
Number Name Province/state n1 (°N) (°E) XIII XIV XV XVI XVII XVIII XIX XX XXI XXII XXIII XXIV
1 Port Hope Simpson Newfound Land 11 52,53 -56,29 1 2 1
2 Cartwright Newfound Land 15 53,71 -57,00 1 2 1
3 Goose River North Newfound Land 15 53,40 -60,43 1 2
4 Happy Valley Newfound Land 15 53,20 -62,23 5
5 Churchill Falls Newfound Land 15 53,56 -63,91 1 1
6 Stanley New Brunswick 13 46,27 -66,65
7 Amqui Québec 11 48,44 -67,35 1 1 1 1
8 Fermont Québec 15 52,79 -67,40 1 1 1 1
9 Manic 5 Québec 15 50,66 -68,68 4
10 Reservoir Bersimis-2 Québec 14 49,17 -69,34 1 2 2
11 La Malbaie Québec 15 47,60 -70,20 1 1 1 1 1 1
12 Jackman Maine 15 45,49 -70,22 2 1 3
13 Roberval Québec 9 48,17 -72,16 1
14 South Wallingford Vermont 15 43,34 -72,99 2 1
15 Grenville Bay Québec 14 45,65 -74,63 1 3 1 2 1
16 Elzevir Ontario 15 44,63 -77,27 2 2 1
17 Englehart Ontario 14 47,90 -79,95 2
18 Shelburne Ontario 14 44,07 -80,24 3 2 2 3
19 Holly Michigan 14 42,77 -83,66 2 1 1 1
20 Fushimi Lake Provincial Park Ontario 14 49,84 -83,92 2 1
21 Tittabawassee River Michigan 15 44,09 -84,29 2 1 1 1
22 Wilderness State Park Michigan 14 45,70 -85,01 1
23 White Lake Provincial Park Ontario 15 48,69 -85,64 1 1 4
24 Hiawatha National Forest Michigan 12 45,96 -87,00 1 3
72
Population Latitude Longitude Chlorotype counts
Number Name Province/state n1 (°N) (°E) XIII XIV XV XVI XVII XVIII XIX XX XXI XXII XXIII XXIV
25 Shebandowan Ontario 15 48,62 -90,18 3 2 2
26 Apostle Islands National Lakeshore Wisconsin 13 46,93 -90,72 1 3 1
27 Saint Croix State Forest Minnesota 15 46,12 -92,67 1 1 2 2 1 1
28 Blackberry Minnesota 15 47,22 -93,36 4
29 Richer Manitoba 13 49,66 -96,28 2 1
30 Grahamdal Manitoba 11 52,08 -98,84 2 1 1
31 Minago River Manitoba 13 54,19 -99,18 2 1
32 Cranberry Portage Manitoba 9 54,55 -101,38 1 3 1
33 Granit Lake Saskatchewan 13 54,84 -102,59 5
34 Southend Saskatchewan 13 56,16 -103,20
35 Big Sandy Lake Saskatchewan 13 54,50 -104,16 1 4 1 1
36 Prince Albert Saskatchewan 9 53,36 -105,47 4
37 Morin Lake Saskatchewan 13 55,10 -105,99 1 2 1 2
38 Lac la Plonge Saskatchewan 6 55,21 -107,49 3
39 Patuanak Saskatchewan 11 55,88 -107,70 3 1 1
40 Aubichon Lake Saskatchewan 10 54,59 -107,82 1 1
41 Meadow River Saskatchewan 13 54,25 -108,36
42 Goodsoil Saskatchewan 6 54,40 -109,23 1
43 Glendon Alberta 15 54,24 -111,24 14
44 Whitecourt Alberta 15 54,09 -115,01
45 Fairbanks Alaska 14 64,42 -148,0 13
Total - - 589 - - 1 24 96 26 5 1 9 1 1 31 3 1 1Number of genotyped individuals per populations.
73
Appendix S3. List of mtDNA loci scanned for Larix laricina mtDNA polymorphism, primer sequences, annealing temperatures
and sequencing results.
Locus name Forward primer (F) Reverse primer (R)
Annealing
temperature
(°C)
Primer source Sequencing
result1
nad1(exon1)/trn
C-ori CACCAAGTAGTGCTAATTTATTTCT TACTAAGAGTCCTCTCACTACCAAC 55 Present study polymorph
f13 CTGTTGGTAACTTGGGG GCGCCTCTTTCGGAATAG 55 Acheré et al. 2004 monomorph
nad4/3-4 GGAGCTTTCCAAAGAAATAG GCCATGTTGCACTAAGTTAC 55 Dumolin-Lapègue et al. 1997 monomorph
nad7/1-2 ACCTCAACATCCTGCTGCTC CGATCAGAATAAGGTAAAGC 55 Dumolin-Lapègue et al. 1997 monomorph
matR CGACAGAAGCACGAAATTCC ACCCGACGATAACTAGCTTC 55 Jaramillo-C et al. 2003 monomorph
nad5 (intron 1) AGTCCAATAGGGACAGCACAC GCTTTGATAGCTGCTTTATCTGC 55 Jaramillo-C et al. 2003 monomorph
nad7 (intron 1) GGAACCGCATATTGGATCAC GTTGTACCGTAAACCTGCTC 55 Jaramillo-C et al. 2004 monomorph
rps3 (intron 2) TTTGGCTTTCGTCTCGGTAG CCCTCACTTCGTTTCGTTCT 55 Jaramillo-C et al. 2006 monomorph
cox1 TTATTATCACTTCCGGTACT AGCATCTGGATAATCTGG 55 Lu et al. 1998 monomorph
trnH GATCCAATAGCGAGTATAGACGTG AAAGGATTTGAAAACCACTCCTC 55 Maréchal-Drouard et al. 1996 monomorph
atpA GCTGGCAAATTCAACCATTT GCAATTAAGGCTGGCTTTCC 55 Polezhaeva et al. 2010 monomorph
rps2-nad5end GCTTCGTCACAGTACTTACTCAT TCTATCCCATTTCATATATGTCC 55 Present study monomorph
SSU rRNA ACACATGCAAGTCGAACGTG AGTCGAAGACCCCACCGT 55 Present study monomorph
B11 TACCCGCCTTAACCGTAAGA GACCCGTAGTTTGGCTGAGA 55 Semerikov et al. 2006 monomorph
nad3-rps12 CAGAAGTCGTTTCGATATACG TTTCTCCGAAGCTCGGGTACG 55 Soranzo et al. 1999 monomorph
cox1-2 GATGCAGCGGAACCATGGCA TCCGATACCATTGATGTCC 55 Tian et al. 2010 monomorph
nad5 GGAAATGTTTGATGCTTCTTGGG CTGATCCAAAATCACCTACTCG 55 Wang et al. 2000 monomorph
cox3 GTAGATCCAAGTCCATGGCCT GCAGCTGCTTCAAAGCC 55 Wu et al. 1998 monomorph
cob AGTTATTGGTGGGGGTTCGG CCCCAAAAGCTCATCTGACCCC 55 Wu et al. 1998 monomorph
atp1 TTTGCCAGCGGTGTGAAAGG CTTCGCGATATTGTGCCAATTC 55 Wu et al. 1998 monomorph
nad7 (intron 3) TAGGATCCTGATCGAGCAAG CTGGACAAGCTTTAGGGGAA 55 Bonen et al. 1994 n.a.
nad1-1 GGTCGGATGTTACCCTAACC ACCTACCCCTCGCTACTATCTC 58 Bouillé et al. 2011 n.a.
nad1-2 GGGTGCCGCAGGGTTATAC GGATAAGGATAAGGCCAAGG 57 Bouillé et al. 2011 n.a.
nad1-2b GATGATGATGCCCCTATTGAT GATCTCCTCTCAAGGCCAAC 57 Bouillé et al. 2011 n.a.
nad1-3 ACTTACCAGTAAAGGCCCGA GCCATGAAAAGACTTCCCTG 54 Bouillé et al. 2011 n.a.
nad1-4 CCCTACCCCTTCGGATACT GTAGCGAGGTTACCGCTTAGT 54 Bouillé et al. 2011 n.a.
nad1-5 GCCATGAAAAGCCCTGTA GTGTTGCTCTATCTCGGCAT 54 Bouillé et al. 2011 n.a.
nad1-6 CCACATGAGTAGTTCGCTCC TACGGGGAACAAGGGAATAC 58 Bouillé et al. 2011 n.a.
nad1-e AAGGATAGGATAATAAAAAGACCAAA AAAGTATGGGCCGCCATTAA 54 Bouillé et al. 2011 n.a.
nad1/4-5 GCATTACGATCTGCAGCTCA GGAGCTCGATTAGTTTCTGC 57.5 Demesure et al. 1995 n.a.
74
Locus name Forward primer (F) Reverse primer (R)
Annealing
temperature
(°C)
Primer source Sequencing
result1
nad4/1-2 CAGTGGGTTGGTCTGGTATG TCATATGGGCTACTGAGGAG 57.5 Demesure et al. 1995 n.a.
rps14-cob CACGGGTCGCCCTCGTTCCG GTGTGGAGGATATAGGTTGT 57.5 Demesure et al. 1995 n.a.
SSU rRNA (V1) GAGTTTGATCCTGGCTCAGA AGTYGCAGTGTGGCTG 64 Duff and Nickrent 1999 n.a.
SSU rRNA (V7) CTGCATGGCTGTCGTC CCACCTTCCTCCAGT 58 Duff and Nickrent 1999 n.a.
ccb203 ASGTTCTACGGACCGATGCC CACGGGGAGGGAGCRGGCGA 62 Duminil et al. 2002 n.a.
ccb256 GGAAGTTAGCAAAGTTAGAC TTGTTCTTAACAGCGATGGC 56 Duminil et al. 2002 n.a.
cox2/2-3 TAGRAACAGCTTCTACGACG GRGTTTACTATGGTCAGTGC 52 Duminil et al. 2002 n.a.
nad4/2-3 CTCCTCAGTAGCCCATATGA AACCAGTCCATGACTTAACA 55 Duminil et al. 2002 n.a.
nad7/2-3 GCTTTACCTTATTCTGATCG TGTTCTTGGGCCATCATAGA 57 Duminil et al. 2002 n.a.
nad7/3-4 TCTATGATGGCCCAAGAACA ACACCAAATTCTCCTTTAGG 47 Duminil et al. 2002 n.a.
orf25 AAGACCRCCAAGCYYTCTCG TTGCTGCTATTCTATCTATT 50 Duminil et al. 2002 n.a.
rpl5 AGTGGTAAAGTCTCATCT ATYGTGTGAAATAAGAGTAG 50 Duminil et al. 2002 n.a.
nad1/4-5 GCCAATATGATCTTAATGAG TCACCTTGATACTAAACCAG 47 Dumolin-Lapègue et al. 1997 n.a.
nad5/1-2 TTTTTTCGGACGTTTTCTAG TTTGGCCAAGTATCCTACAA 57 Dumolin-Lapègue et al. 1997 n.a.
nad5/4-5 CCAATTTTTGGGCCAATTCC CATTGCAAAGGCATAATGAT 47 Dumolin-Lapègue et al. 1997 n.a.
cox2/1-2 TTTTCTTCCTCATTCTKATTT CCACTCTATTGTCCACTTCTA 50 Dumolin-Lapègue et al. 1997 n.a.
mp6 CGCTTCACTCTAACCCTTCC CCTTCACTCTTACAAACGCC 62 Jaramillo-C et al. 2003 n.a.
rps3 (intron 1) CCGAATCGTAGTTCAGATCCA GTGCAACGCCTCTGACATAA 58 Jaramillo-C et al. 2006 n.a.
mh02 TTTTAGGGCCATTTGCCTGC TCTATGGACAAGAGCCCGACCT 53 Jeandroz et al. 2002 n.a.
mh05 GGGAGTCAGCGAAAGAAGTAAG AGTCTCAGAGCCAGAAGCAG 54 Jeandroz et al. 2002 n.a.
mh08 GTCATCCCTATCTCCTGGAC CTAGTAGGATTAAGTGGCAACC 55 Jeandroz et al. 2002 n.a.
mh09 TCATCCATCCTCCAGCAACA TCATCCCCAGAAAGAGACAG 52 Jeandroz et al. 2002 n.a.
mh09' CCATCCAGCCATGTCTCATC AGGGCTTCACATAGAGCATC 53 Jeandroz et al. 2002 n.a.
mh10 CACTGCTCACCTTCACATTC CTTCACATAGAGCATCGATCAC 54 Jeandroz et al. 2002 n.a.
mh27 TGCTTTCCAATTTACCACGAG GATACGCTTTCCTGGCATAC 55 Jeandroz et al. 2002 n.a.
mh33 TTCCCCAGACAGAACAGATAG GCTCTTAAGTGCTGGTTGATG 52 Jeandroz et al. 2002 n.a.
mh33' CGAAGGAAGGAATGAAGGTG GCTCTTAAGTGCTGGTTGATG 52 Jeandroz et al. 2002 n.a.
mh34 TTGGATCACCCACTTCCT TAAGCACACCTCTGCATCC 54 Jeandroz et al. 2002 n.a.
mh35 CGATGACATCTCTTAGCTTCC TGGGGAATAGGATTCGGGTAAG 54 Jeandroz et al. 2002 n.a.
mh38 CCGTCCCCTATCCATCAAAC CCCTGAGCGAGATTGAATTAG 52 Jeandroz et al. 2002 n.a.
mh44 ATGACTGGAAGAATTGCTCAC TTCACTTGATACTCACCCCC 56 Jeandroz et al. 2002 n.a.
mh50 AGAATGGCAGCAACTAATAAGC ACTATGCACTTCCCTCCCTC 50 Jeandroz et al. 2002 n.a.
nad4L-orf25 TATTACTTTCCGAGTCCGGGG TCTTCTTCGAACTTGATGCAC 53 Kubo et al. 2000 n.a.
75
Locus name Forward primer (F) Reverse primer (R)
Annealing
temperature
(°C)
Primer source Sequencing
result1
nad4 (3c-4r) GATGCCGGAAGCACGACT AAGGTTATCCACCACACCAG 55 Polezhaeva et al. 2010 n.a. 18S-ETS/SST-ETS ACTTACACATGCATGGCTTAATCT GGCWTGTKTGGGTATGTTGGAT 55 Present study n.a.
ccmC-trnSend CTTCAAAATAGTAAAAGCTCTGTTC CAATATCATTGTATGTTGATTTAGC 55 Present study n.a.
ccmC-trnSint ATTGAAATAAGAATGATCAGGTAGA TTGTCCTTATTTGGGGAAGG 55 Present study n.a.
ccmC-trnSori ACATTGTTTACCTTAGTAACTGGAG CCTTTTAATGAAATAAAGAGAGAGA 55 Present study n.a.
ccmFCori-a CTGGAGCTTAGTGGGAATTAT CAGAACTTCTTCTTTTTCATTACTT 55 Present study n.a.
ccmFCori-b AAAATAAGAGGCAGTTCCATTA AAAAGAGAGGTCGTGATGATAC 55 Present study n.a.
cox3-rps13end CAGTGATAACATAAAGGTTAATGAG CTAATTGGGAAGAGATGTAAAATAG 55 Present study n.a.
cox3-rps13ori ATTGATGTCCAATAGCTTTTATAGT TTTAGATCAGGCCTATAACTATCTC 55 Present study n.a. nad1ex1-trnCend GTAGTGAACGAACAGTACGAGTAG GATACATTGCCATTATGTTACCT 55 Present study n.a.
nad1ex1-trnCint GTATGGAAACATATTACCCATCTTA AGAAGATAGATCACTATTGGATCAG 55 Present study n.a.
nad2-1Ab TTTCAAGACTGGGTAATATCGT CATGCATATTGAGCCTAATACTAA 55 Present study n.a.
nad7-rps1end TTTCTCTTTCTCTTTAGTGGTAGAC CAATAATTCGTATGCAAGATGA 55 Present study n.a.
nad7-rps1int GTAGCGAAGGGAAGGTTATC GCCTATATTTGAACGATAATGC 55 Present study n.a.
nad7-rps1ori CGTTCATTTCCGATACTGAT GATAACCTTCCCTTCGCTAC 55 Present study n.a.
nad9-trnHend ATTAAAGTCTTTTGTGTGTTAGGTT ACTAAGATAGTGTCATCTTCGATTT 55 Present study n.a.
nad9-trnHori TCTAAGAGATACTTCACCCAGTAAA AATAGGGCTGTTAGCGAATAA 55 Present study n.a.
rps12-rps7 ATTCGTCATGGTAGAGAGAAAA CTTATCACACTCGGAAGAGTTTA 55 Present study n.a.
rps2-nad5int CCCAAGACCTTACTTATCAAATAG GGGAGTCTTTTTGTAGGATACTT 55 Present study n.a.
rps2-nad5ori TATCTGCATTCATTATTACTACACG GCTATTTGATAAGTAAGGTCTTGG 55 Present study n.a.
tnrL-trnF TCGGACTTGAACCGATAACC AGTGGTTCTTTTCTTTCAGGTAG 55 Present study n.a.
trnL-trnFint CTATCGGTAACCGGACTGGA TCGCTACGCGGAGTAAAACT 55 Present study n.a.
trnN-trnYend CGCTACTAAATAGAAAAGGTTCTT AATACCAATCCGGTTGTAGAC 55 Present study n.a.
trnN-trnYori GGTAGAGCATTGGACTGTTAAT AAAAGAATCGCTGAGAGATAGA 55 Present study n.a.
C8 GGATCGTAGCGTGGGAACTA AGGGAACTTGTGAACGTTGG 55 Semerikov et al. 2006 n.a.
r11 CATCCCGTCGCTTGTTTAAT CCGGTTGGCACCTAAATAGA 55 Semerikov et al. 2006 n.a.
UBC460 AACCTAGAGCCAACAGCAGCACCT CCCAACTTCCTCGAAAGCAGATG 55 Semerikov et al. 2006 n.a.
nad3-1 TTCCCCATGAATGGAAGAAG ATTGATTCGATGTAGGCATCG 60 Soranzo et al. 1999 n.a.
nad3-2 GTTCGCTAGTTTGTTTGATCCC TCCCAGCAAATCCTTGACTC 60 Soranzo et al. 1999 n.a.
cob CCCCGAGCAATCTTAGTTAT GGAGAAATTTGTCAAATAGT 55 Tani et al. 2003 n.a.
nad3 TCCCACTTGGTGTTCCTTTT ATTTAGATCTGCCCCTTTTT 55 Tani et al. 2003 n.a.
nad4 (intron1) ATACGATTGATTGGTCTGTG TGAACTGGTACCATAGGCACTTT 60 Wu et al. 1998 n.a.
nad5 (intron 4) ATAAGTCAACTTCAAAGTGGA CATTGCAAAGGCATAATGAT 65 Wu et al. 1998 n.a.
atp6 GGAGGAGGAAACTCAGTACCAA TAGCATCATTCAAGTAAATACA 58 Wu et al. 1998 n.a.
Abbreviation: not applicable (n.a.); 1 Not applicable when sequencing results couldn’t reveal whether the locus was monomorph or polymorph.
76
Appendix S3 – Literature cited
Acheré, V., Rampant, P.F., Pâques, L.E. & Prat, D. (2004) Chloroplast and mitochondrial
molecular tests identify European × Japanese larch hybrids. Theoretical and Applied
Genetics, 108, 1643–1649.
Bonen, L., Williams, K., Bird, S. & Wood, C. (1994) The NADH dehydrogenase subunit 7
gene is interrupted by four group II introns in the wheat mitochondrial genome.
Molecular and General Genetics, 244, 81–89.
Bouillé, M., Senneville, S. & Bousquet, J. (2011) Discordant mtDNA and cpDNA
phylogenies indicate geographic speciation and reticulation as driving factors for the
diversification of the genus Picea. Tree Genetics & Genomes, 7, 469–484.
Demesure, B., Sodzi, N. & Petit, R.J. (1995) A set of universal primers for amplification of
polymorphic non‐coding regions of mitochondrial and chloroplast DNA in plants.
Molecular Ecology, 4, 129–134.
Duff, R.J. & Nickrent, D.L. (1999) Phylogenetic relationships of land plants using
mitochondrial small-subunit rDNA sequences. American Journal of Botany, 86, 372–
386.
Duminil, J., Pemonge, M.H. & Petit, R.J. (2002) A set of 35 consensus primer pairs
amplifying genes and introns of plant mitochondrial DNA. Molecular Ecology Notes,
2, 428–430.
Dumolin-Lapegue, S., Pemonge, M.H. & Petit, R.J. (1997) An enlarged set of consensus
primers for the study of organelle DNA in plants. Molecular Ecology, 6, 393–397.
Jaramillo-Correa, J.P. & Bousquet, J. (2003) New evidence from mitochondrial DNA of a
progenitor-derivative species relationship between black spruce and red spruce.
American Journal of Botany, 90, 1801–1806.
Jaramillo-Correa, J.P., Beaulieu, J. & Bousquet, J. (2004) Variation in mitochondrial DNA
reveals multiple distant glacial refugia in black spruce (Picea mariana), a
transcontinental North American conifer. Molecular Ecology, 13, 2735–2747.
Jaramillo‐Correa, J.P., Beaulieu, J., Ledig, F.T. & Bousquet, J. (2006) Decoupled
mitochondrial and chloroplast DNA population structure reveals Holocene collapse
and population isolation in a threatened Mexican‐endemic conifer. Molecular
Ecology, 15, 2787–2800.
Jeandroz, S., Bastien, D., Chandelier, A., Du Jardin, P. & Favre, J.M. (2002) A set of primers
for amplification of mitochondrial DNA in Picea abies and other conifer species.
Molecular Ecology Notes, 2, 389–392.
Kubo, T., Nishizawa, S., Sugawara, A., Itchoda, N., Estiati, A. & Mikami, T. (2000) The
complete nucleotide sequence of the mitochondrial genome of sugar beet (Beta
vulgaris L.) reveals a novel gene for tRNACys (GCA). Nucleic Acids Research, 28,
2571–2576.
Lu, M.-Z., Szmidt, A.E. & Wang, X.-R. (1998) RNA editing in gymnosperms and its impact
on the evolution of the mitochondrial coxI gene. Plant Molecular Biology, 37, 225–
234.
Maréchal-Drouard, L., Kumar, R., Remacle, C. & Small, I. (1996) RNA editing of larch
mitochondrial tRNAHis precursors is a prerequisite for processing. Nucleic Acids
Research, 24, 3229–3234.
77
Polezhaeva, M.A., Lascoux, M. & Semerikov, V.L. (2010) Cytoplasmic DNA variation and
biogeography of Larix Mill. in Northeast Asia. Molecular Ecology, 19, 1239–1252.
Semerikov, V.L., Vendramin, G.G., Sebastiani, F. & Lascoux, M. (2006) RAPD-derived,
PCR-based mitochondrial markers for Larix species and their usefulness in
phylogeny. Conservation Genetics, 7, 621–625.
Soranzo, N., Provan, J. & Powell, W. (1999) An example of microsatellite length variation
in the mitochondrial genome of conifers. Genome, 42, 158–161.
Tani, N., Maruyama, K., Tomaru, N., Uchida, K., Araki, M., Tsumura, Y., Yoshimaru, H. &
Ohba, K. (2003) Genetic diversity of nuclear and mitochondrial genomes in Pinus
parviflora Sieb. & Zucc. (Pinaceae) populations. Heredity, 91, 510–518.
Tian, S., López-Pujol, J., Wang, H.-W., Ge, S. & Zhang, Z.-Y. (2010) Molecular evidence
for glacial expansion and interglacial retreat during Quaternary climatic changes in a
montane temperate pine (Pinus kwangtungensis Chun ex Tsiang) in southern China.
Plant Systematics and Evolution, 284, 219–229.
Wang, X.-Q., Tank, D.C. & Sang, T. (2000) Phylogeny and divergence times in Pinaceae:
evidence from three genomes. Molecular Biology and Evolution, 17, 773–781.
Wu, J., Krutovskii, K.V. & Strauss, S.H. (1998) Abundant mitochondrial genome diversity,
population differentiation and convergent evolution in pines. Genetics, 150, 1605–
1614.
79
Appendix S4. Estimation of chlorotype diversity as a function of the number of populations
sampled, based on rarefaction resampling.
To assess whether most chlorotype diversity have been captured given the sampling effort,
we computed asymptotic accumulation curves from the data. The asymptotic accumulation
curve is a plot of the cumulative number of chlorotypes discovered within a lineage (western
or eastern) as a function of the number of population sampled (similar to species
accumulation curves; see Soberón & Llorente, 1993; Colwell & Coddington, 1994). For each
lineage, 100 random permutations of the accumulation curve were computed using R package
BIODIVERSITYR (Kindt & Coe, 2005) and the mean accumulation curve was used for fitting
the extrapolation curve. To build the accumulation curves, the number of chlorotypes [C(n)]
was plotted against the number of population sampled (n). We then extrapolated an expected
cumulative number of chlorotypes (Cmax) by fitting an asymptotic, negative exponential
function C(n) = Cmax(1-eKn) where Cmax, the asymptote, is the estimated cumulative number
of chlorotypes, and K is a fitted constant that controls the shape of the accumulation curve
(Holdridge et al. 1971; Soberón & Llorente 1993). Parameters of the extrapolation curve
were calculated using nonlinear least-squares estimates in R 3.0 (R Development Core Team,
2012).
Within the western lineage, the number of chlorotypes reaches a plateau at 12 populations
(Cmax = 15), indicating that we have likely uncovered most of the chlorotype variation by
sampling of 15 populations (Figure S1). Within the eastern lineage, the number of
chlorotypes reaches a plateau at 20 populations (Cmax = 19), indicating that we have
uncovered most of the chlorotype variation by sampling 29 populations (Figure S1). These
results suggest that the vast majority of cpDNA haplotype diversity was captured in both
lineages.
Figure S1. Accumulation curves of the number of chlorotypes uncovered as a function of the number of
populations sampled. Western and Eastern lineages are represented by red and blue colors, respectively. Each
polygon represents 95% confidence interval envelopes of 100 randomly permuted accumulation curves.
Boxplots of the 100 permutations indicate lower quartile, median and upper quartile; whiskers length are 1.5 ×
interquartile ranges. Filled lines are the extrapolation curves fitted from each mean accumulation curve using
an asymptotic, negative exponential function.
80
Appendix S4 – Literature cited
Colwell, R.K. & Coddington, J.A. (1994) Estimating terrestrial biodiversity through
extrapolation. Philosophical Transactions of the Royal Society B: Biological
Sciences, 345, 101–118.
Holdridge, L.R., Grenke, W.C., Hatheway, W.H., Liang, T. & Tosi, J.A. (1971) Forest
environments in tropical life zones: a pilot study. Pergamon Press, Oxford, United
Kingdom.
Kindt, R. & Coe, R. (2005) Tree diversity analysis: A manual and software for common
statistical methods for ecological and biodiversity studies. World Agroforestry
Centre (ICRAF), Nairobi, Kenya.
R development team. (2012) R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna, Austria.
Soberón, J.M. & Llorente, J.B. (1993) The use of species accumulation functions for the
prediction of species richness. Conservation Biology, 7, 480–488.