3/

and

his, wey known intialS rRNA,dataset,

ogs’). Wethe use ofy advise

éous nouschoisi deux

ielles deS ADNr,)

s (« 30De plus,marqueursonnées

C. R. Biologies 328 (2005) 1009–1024

http://france.elsevier.com/direct/CRASS

Taxonomy / Taxinomie

Phylogenetic relationships and biodiversity in Hylids(Anura: Hylidae) from French Guiana

Marie-Dominique Salduccia,∗, Christian Martyb, Antoine Fouqueta,c, André Gillesa

a Laboratoire d’hydrobiologie, EA EGEE 3178, université de Provence, 3, place Victor-Hugo, 13331 Marseille, Franceb Impasse Jean-Galot, 97354 Montjoly, French Guiana

c Molecular Ecology Laboratory, School of Biological Sciences, University of Canterbury, Private Bag 4800, Christchurch, New Zeal

Received 7 December 2004; accepted after revision 13 July 2005

Available online 26 September 2005

Presented by Pierre Buser

Abstract

We evaluated two biodiversity criteria, higher taxonomic diversity and phylogenetic diversity in French Guiana. For tused a recent assessment of the knowledge accumulated since 30 years of study on the amphibian species currentlFrench Guiana. We focused on two well-represented genera,Hyla andScinax, belonging to the subfamily Hylinae. We used parsequences of two mitochondrial genes (16S rDNA and 12S rDNA, 813 bp) and two nuclear genes (tyrosinase and 181590 bp) covering a total of 2403 bp. According to the high bootstrap support in phylogenetic analysis of the completethe genusScinaxis a homophyletic clade formed by two species groups (rubra androstrata) in French Guiana. The genusHylawas confirmed to be a paraphyletic group formed by two species groups as well (30 chromosomes and the ‘gladiator frconfirmed that these genera should be taxonomically reconsidered. Moreover, at the genus, subfamily and family levels,only morphological characters or only molecular DNA markers would hamper estimations of biodiversity. Thus, we stronglthe combined use of both morphology and molecular data (nuclear and mitochondrial markers).To cite this article: M.-D. Salducciet al., C. R. Biologies 328 (2005). 2005 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Résumé

Relations phylogénétiques et biodiversité chez les Hylidés (Anura : Hylidae) de Guyane française. Nous avons évaludeux critères de biodiversité, la diversité taxonomique et la diversité phylogénétique en Guyane française. À cet effet, nsommes appuyés sur une étude récente faisant le bilan de toutes les espèces d’Amphibiens de cette région. Nous avonsgenres bien représentés,Hyla et Scinax, appartenant à la sous-famille des Hylinae. Nous avons analysé les séquences partdeux gènes mitochondriaux (16S ADNr et 12S ADNr, pour un total 813 pb) et de deux gènes nucléaires (tyrosinase et 18l’ensemble représentant 2403 pb. Les proportions debootstrapélevées pour le jeu de données complet montrent que le genreScinaxest un clade homophylétique en Guyane. Le genreHyla s’est avéré être un groupe paraphylétique, constitué de deux groupechromosomes » etgladiator frog). Nous avons confirmé que ces genres doivent être reconsidérés sur un plan taxonomique.pour les unités taxonomiques (genre, sous-famille et famille), la seule utilisation des caractères morphologiques ou desmoléculaires ADN biaiserait l’estimation de la biodiversité. Ainsi, nous conseillons fortement l’utilisation à la fois des d

* Corresponding author.E-mail address:salducci@up.univ-mrs.fr(M.-D. Salducci).

1631-0691/$ – see front matter 2005 Académie des sciences. Published by Elsevier SAS. All rights reserved.doi:10.1016/j.crvi.2005.07.005

1010 M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024

morphologiques et moléculaires (marqueurs nucléaires et mitochondriaux).Pour citer cet article : M.-D. Salducci et al., C. R.Biologies 328 (2005). 2005 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Keywords: Amphibia; Scinax; Hyla; Centrolenidae; Phylogenetic diversity; French Guiana

Mots-clés : Amphibia; Scinax; Hyla ; Centrolenidae ; Diversité phylogénétique ; Guyane française

are

ity isecieciesf a

ite-iver-

nlymic

hee-

thethe

iffer-flectthe

todi-notd/or

ere

s is

inl re-rityri-di-ns.areroupry-

wn

f po-

e di-s. It

icor

icalworkerns

l di-thetri-abi-theli-art

nies,

arethr-salnlyn-

gh-uthrth-

--cies

a-tand

ps insix

1. Introduction

Some of the greatest challenges for biologiststo understand and to evaluate biodiversity[1]. One ofthe measures commonly used to assess biodiversspecies richness, as defined by the number of spat a site or habitat. However, the evaluation of sperichness is strongly dependent on the definition ospecies, an intensively debated question[2]. Therefore,higher taxon richness, mostly on morphological crria, is often used as a surrogate to evaluate biodsity rather than species richness[3,4]. This approach isvalid only if there is no systematics bias, i.e., when omonophyletic groups are used and when the taxonoboundaries are similar among groups.

Another way of measuring biodiversity involves tscreening of genetic variability among populations. Gnetic variability may be at least partly reflected byphylogenetic diversity (PD), which is estimated assum of the branch lengths in a phylogenetic tree[5]. Thegenetic and morphological approaches generate dent assessments of biodiversity values, perhaps reing differences in the temporal and spatial scales ofdetermining processes[6]. It is therefore necessaryclarify their practical utility for the assessment of bioversity in taxa in which an exhaustive inventory canbe compiled due to the high number of species anthe environmental conditions.

This is often the case in tropical environments, whthe greatest species diversity is recorded[7–10], as foramphibians. The rate of description of new speciealso higher in these zones than anywhere else[11].

The Guianan region is one of the last wild areasSouth America and among the three richest tropicagions on Earth (Guiana Shield Conservation PrioSetting Workshop, 5–9 April 2002, Paramaribo, Sunam). However, it is extremely difficult to assess theversity of many taxa in this region for practical reasoThis is the case for amphibians, for which biologistsextremely concerned since few years. Indeed, this gis subject to a fast worldwide decline particularly woring in South America[12–16]. Even though collectingefforts have intensified in many previously unknoareas, especially in this part of the world[17], large

s

-

regions remain unknown and many reduced areas otentially high diversity have not been examined[18].There is therefore an urgent need to characterise thversity of amphibians by using rigorous approacheis unclear whether this should involve higher taxonombiodiversity analysis, phylogenetic diversity analysisboth.

Here, we used a recent taxonomical, geographand ecological assessment based on 30 years ofon the species present in French Guiana. It conc110 amphibian species over 90 000 km2 [19]. We con-sidered taxonomy as a surrogate of morphologicaversity. Thus, we chose a group for which we knownumber of morphologically distinct species, their disbution area and basic aspects of their ecology (the htat). We concentrated on amphibians belonging tosecond largest frog family in South America: the Hydae (neotropical tree frogs), with 25 genera in this pof the world [17]. The family Hylidae is divided intofour subfamilies[20], only two of which are present iFrench Guiana: the Phyllomedusinae, with four specand the Hylinae, with 38 species[19,21,22].

Members of the subfamily Phyllomedusinaewidely distributed in tropical parts of Middle and SouAmerica[23]. In this group, the constricted pupil is vetically elliptical. These tree frogs, with a green dorcoloration, are adapted to an arboreal lifestyle. Oone genus,Phyllomedusa, among the three genera costituting this group, is present in French Guiana[19].

Members of the subfamily Hylinae are found throuout the temperate and tropical parts of North and SoAmerica, in temperate Eurasia, Japan, extreme noern Africa, and the West Indies[24]. Five genera arefound in French Guiana:Hyla, Scinax, Osteocephalus,PhrynohyasandSphaenorhynchus. The two largest Hyline genera areHyla and Scinax, containing respectively 45 and 7 species groups (or currently five spegroups[25]).

The genusHyla does not share any unique fetures and two major groups withinHyla are presenin French Guiana, the Gladiator frogs sensu latothe 2n = 30-chromosome lineage[24,26]. The Gladi-ator frogs are represented by seven species grouFrench Guiana and the 30-chromosome Hyla by

M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024 1011

-ra-

enusialpor-is

ca-

ch

in

and

ro-o-

aging

-

on

resti-andty-useilie

lec-ies,e of

ersf-

ndus.

ershol-rk-gsto

ent

tud-

ted

s

s:

col-am-

Na-s).inedsmeci-d in

les

u)ch-6Ssein

of18S

species groups[19]. This is the only genus within hylines found in North, Central and South America, Eusia and the extreme north of Africa[24,27]. We havepreviously shown that some representatives of the gHyla form a monophyletic group according to part16S rRNA gene sequences, but the bootstrap protion was low[28]. In contrast, morphological analysrevealed that this genus was paraphyletic[27]. Theseresults seem to be contradictory and require clarifition.

The genusScinaxis divided into seven[19] or fivegroups[25,29]. Two of these are represented in FrenGuiana. The first is therostrata group, which includesScinax jolyi, Scinax proboscideusandScinax nebulosa.The second is therubra group, which includesSci-nax rubra, S x-signatus, Scinax boesemaniandScinaxcruentomma[19,25]. Faivovich[29] found therostratagroup to be nested within therubra group, making itnon-monophyletic.Scinaxspecies were initially infor-mally grouped in aHyla rubra group [29], mainly onthe basis of sperm cell morphology, then includeda genus namedOlolygon. It was only in 1992 that thenameScinaxtook priority overOlolygon[30]. In a pre-vious study based on 16S rRNA gene sequencesa few species, we showed that theScinaxgenus washomophyletic and supported by a high bootstrap pportion [28]. Moreover, based on morphology, this hmophyly is supported by ten synapomorphies[29].

In the light of this systematic framework, we usesubset of species constituted by 33 specimens belonto the family Hylidae (generaScinax, Osteocephalus,Hyla, andPhrynohyas), three specimens from the family Centrolenidae (HyalinobatrachiumandCochranellagenera) were used to verify the impact of outgroupHylinae phylogenetics relationships[28,31,32], and twoEleutherodactylus(Leptodactylidae) specimens weused as outgroups. Phylogenetic diversity was emated by sequencing two mitochondrial genes (16S12S rDNA) and two nuclear genes (18S rDNA androsinase). These sequences have been successfullyto assess the relationships among some orders, famand species of amphibians[31–40].

In this paper, we tested congruence between moular and morphological/taxonomic data at the specgenus and family levels in one subset representativamphibian diversity in the Guianan region.

If there is congruence between molecular markand morphology, the morphological criteria will be suficient for the study of neotropical frog biodiversity athe higher taxonomic diversity criteria will be a rigoroalternative for the conservation of divergent lineages

ds

If there is no congruence between molecular markand morphology in this representative subset, morpogy must be systematically coupled to molecular maers when studying the biodiversity of neotropical froand the higher taxonomic diversity must be coupledphylogenetic diversity for the conservation of divergand reticulate lineages.

2. Materials and methods

2.1. Biological samples

Twenty-nine new species were added to those sied by Salducci et al.[28]. Thus, a total of 143 newsequences were obtained from 33 Hylidae constituby 11 individuals belonging to the genusScinax(fourspecies assigned to therubra group and four specieto the rostrata group), 14 to the genusHyla (Gladia-tor frogs: four species of thegeographicagroup, twoof thealbopunctatagroup and one for theboansgroupand one for thegranosagroup; Hyla 30 chromosometwo species of thenana group, one of theleucophyl-lata group, one of theluteocellatagroup 1 of themin-uta group, one of theparvicepsgroup), three to thegenusOsteocephalus, two to the genusPhrynohyas, andthree to the genusPhyllomedusa. Three specimens fromthe Centrolenidae (HyalinobatrachiumandCochranellagenera) and two Leptodactylidae (Eleutherodactylus)were used as outgroups. Thirty-six specimens werelected in French Guiana over a four-year period. Sples ofScinax rostrataandScinax elaeochroawere col-lected respectively in Venezuela and in Costa Rica (tional Museum of Natural History of The NetherlandThe geographical ranges of the specimens examare given inTable 1, and a map of collecting localitieis given in Fig. 1. Tissue samples were derived fromuscle by performing a biopsy. From preserved spmens in collections, we used liver tissues preserveethanol.

2.2. Molecular data

Total DNA was extracted from muscle tissue sampby digestion with proteinase K for 12 h at 37◦C fol-lowed by standard phenol/chloroform extraction[41].Two partial mitochondrial (mt) and two nuclear (nDNA fragments were amplified by standard PCR teniques. The mt DNA fragments were: 430 bp of the 1rDNA gene and 397 bp of the 12S rDNA gene. Thefragments were amplified using the primers listedTable 2. The nuclear DNA fragments were: 403 bpexon 1 of the tyrosinase gene and 1187 bp of the

1012M

.-D.S

ald

uccie

tal./C

.R.B

iolog

ies

32

8(2

00

5)

10

09

–1

02

4

bank accessionber tyrosinase

Origin locality number

Guiana Antecum Pata 6Guiana Grand Santi 7Guiana Mountain of Kaw 3

Guiana Mountain of Kaw 3Guiana Swamp of Kaw 3Guiana Creek of Gabrielle 2Guiana Regina Road St Georges 4

Guiana Mountain of Kaw 3Guiana Grand Santi 7VenezuelaCosta RicaGuiana Mountain of Kaw 3Guiana Mountain of Kaw 3Guiana Mana 9Guiana ChutesVoltaires 8Guiana Yi-Yi’s Creek 1Guiana Mountain of Kaw 3

Guiana Mountain of Kaw 3Guiana Mountain of Kaw 3Guiana Mountain of Kaw 3Guiana Mountain of Kaw 3Guiana Mont Bakra 11Guiana Grand Santi 7Guatemala 14Guiana Creek of Margot 13Guiana Mountain of Kaw 3

Guiana Saül 12Guiana Creek of Margot 13Guiana Mountain of Kaw 3Guiana Guatemala 14Guiana Mountain of Kaw 3Guiana Grand Santi 7Guiana Saül 12Guiana Creek of Gabrielle 2

Guiana Tibourou 10Guiana Mont Bakra 11Guiana Mountain of Kaw 3Guiana Tibourou 10

Table 1List of batrachians used for this study, with the locality number (seeFig. 1)

Family Subfamily Species Genbank accessionnumber 16S

Genbank accessionnumber 12S

Genbank accessionnumber 18S

Gennum

Hylidae Hylinae Scinax rubra 1 AF467264 – – –Scinax rubra 2 – – – –Scinax cruentomma 1 AF467263 – – –Scinax cruentomma 2 – – – –Scinax jolyi 1 AF467261 – – –Scinax jolyi 2 AF467261 – – –Scinax nebulosa AF467262 – – –Scinax proboscideus – – – –Scinax boesemani – – – –Scinax rostrata – – – –Scinax elaeochroa – – – –Hyla leucophyllata – – – –Hyla sp1 – – – –Hyla minuscula – – – –Hyla ornatissima – – – –Hyla raniceps AF467269 – – –Hyla dentei AF467270 – – –Hyla brevifrons – – – –Hyla multifasciata – – –Hyla nana – – – –Hyla minuta – – – –Hyla boans – – – –Hyla geographica – – – –Hyla fasciata – – – –Hyla calcarata – – – –

Hylidae Hylinae Osteocephalus oophagus AF467267 – – –Osteocephalus taurinus – – – –Osteocephalus leprieurii – – – –Phrynohyas coriacea – – – –Phrynohyas venelosa – – – –

Phyllomedusinae Phyllomedusa tomopterna – – – –Phyllomedusa hypochondrialis– – – –Phyllomedusa bicolor

Centrolenidae Hyalinobatrachium taylori AF467268 – – –Hyalinobatrachium taylori 2 – – – –Cochranellasp – – – –

Leptodactylidae Eleutherodactylinae Eleutherodactylus zeuctotylus1– – – –Eleutherodactylus zeuctotylus 2– – – –

M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024 1013

ples

as

in

f

f

g anthe

eenentforg-

ty-

ces

ribedheec-rre-sed

sSat-age

ree

ith

onyn-

ing

e

4)

s

e.trapth-

if-rvedces

In-

This

Fig. 1. Map of French Guiana showing the localities of the samcollected. 2000 ‘Service du patrimoine naturel’, MNHN, Paris.

rRNA gene. The primers used for amplification weredescribed by Bossuyt and Milinkovitch[42] for tyrosi-nase and by Miquelis et al.[43] for 18S rDNA.

PCR was performed in a 50-µl total volume asGilles et al.[44]. Cycle parameters were as follows:

– for 16S rDNA, 2 min at 92◦C; then five cycles o15 s at 92◦C, 45 s at 46◦C, 1 min 30 s at 72◦C;then 30 cycles of 15 s at 92◦C, 45 s at 48◦C, 1 minat 72◦C; and finally 7 min at 72◦C;

– for 12 S rDNA and 18S rDNA, 2 min at 92◦C; then5 cycles of 15 s at 92◦C, 45 s at 48◦C, 1 min 30 s at72◦C; then 30 cycles of 15 s at 92◦C, 45 s at 52◦C,1 min at 72◦C; and finally 7 min at 72◦C;

– for tyrosinase, 2 min at 92◦C; then five cycles o15 s at 92◦C, 45 s at 50◦C, 1 min 30 s at 72◦C;then 30 cycles of 15 s at 92◦C, 45 s at 54◦C, 1 minat 72◦C; and finally 7 min at 72◦C.

The purified PCR products were sequenced usinautomated sequencer (Genome Express S.A.) andsame PCR primers as used in amplifications. Fiftnew sequences were obtained for the 410-bp fragmof 16S rDNA and 24 new sequences were obtainedthe 403-bp fragment of 12S rDNA, for the 1197-bp frament of 18S rDNA and for the 393-bp fragment ofrosinase. SeeTable 1for accession numbers.

2.3. Data analysis

The 16S rDNA and 12S rDNA gene sequenwere aligned using Clustal X[45] and compared withthe alignment based on secondary structure[46]. The16S secondary structure was visualised as descin [28]. We carried out a similar procedure with tRana pipienssequence as a model for the 12S sondary structure. The amplified 12S fragments cosponded to the helices 1 to 26. For this study, we uthe software SOAP[47] to identify unstable blockin alignments for the 16S and the 12S datasets.uration was visualised using the software packMUST [48].

Phylogenetic analyses were performed using thdifferent approaches:

(1) the Neighbour-Joining (NJ) method[49], using amatrix based on the Tamura–Nei distance wgamma parameter[50];

(2) a cladistic approach using the Maximum-Parsim(MP) criterion and the heuristic search with 10 radom additions of taxa and TBR branch-swappas implemented in PAUP 4b10[51];

(3) the maximum-likelihood (ML) method using thevolutionary model retained by MODELTEST[52]:– Lset mitochondrial (GTR+ I + G selected by

AIC) Base= (0.2671 0.1631 0.2136) Nst= 6Rmat= (0.1829 5.4352 1.1539 0.2491 1.754Rates = gamma Shape= 0.6890 Pinvar=0.2813;

– Lset nuclear Base= equal Nst= 2 TRatio =1.9683 Rates= gamma Shape= 0.6991 Pinvar= 0;

– Lset combined (GTR+ I + G selected by AIC)Base= (0.2427 0.2246 0.2452) Nst= 6 Rmat=(0.2603 4.6592 1.3927 0.3127 1.7642) Rate=gamma Shape= 0.5049 Pinvar= 0.5292.

The procedure described by Rogers and Swofford[53]was used to reduce the preliminary computing timThe robustness of nodes was estimated by bootsanalysis with 1000 replicates for the NJ and MP meods [51], and 500 replicates for the ML method. Dferences in topology between trees based on conseversus variable regions of the 16S rDNA sequenwere tested as described in Salducci et al.[28] andwere shown to be non-significant. We used thecongruence Length Difference (ILD) test[54] as im-plemented in PAUP 4b10 withα = 0.05 to comparethe trees obtained in stable and unstable zones.

1014 M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024

r

y

yyyy

y

Table 2Primers used for amplifying and sequencing segments of mitochondrial genes F at the end of the primer name= forward, R at the end of the primename= reverse

Name Gene Sequence 5′-3′ Reference

N-934F 16S CGCCTGTTTACCAAAAACATCG [72]3259R 16S CCGCTTTGAGCTCAGATCA [73]N16F 16S TATCCCTAGGGTAACTTG This studN16R 16S TTACCAAAAACATCGCCT This studyN316F 16S GGAGGTTATTTTTTGTTC This studN316R 16S CGAGAAGACCCTATGGAG This studN12F 12S GGTATCTAATCCCAGTTTGT This studN12R 12S AGGTTTGGTCCTAGCCTT This stud12LPF tRNA phe-L 12S GCRCTGAARATGCTRAGATGARCCC [74]12HSR 12SF-H 12S CTTGGCTCGTAGTTCCCTGGCG [74]Tyr1A Tyrosinase AGGTCCTCTTRAGCAAGGAATG [42]Tyr1E Tyrosinase GAGAAGAAAGAWGCTGGGCTGAG [42]18SF 18S1 CCACATCCAAGGAAGGCAGCAGGC [43]18SR 18S1 CCCGTGTTGAGTCAAATTAA [43]18S2F 18S2 CGTAGTTCCGACCATAAA This studrev-Hillis18g-S 18S2 GGAAACCTTGTTACGACTT [74]

fer-rthe

–thear-ly,ing

se-ncetw

cesthe

di-ups

he-thatdertwotlywobeletheith

het-

awaeesataotalnot

g16Slackfew

nd

us-13as

WeTheRI

ylo-yli-epa--

theby

test is useful to detect incongruence between difent partitions[43,55–57], but has only limited poweto detect incongruence caused by differences inevolutionary process or in the tree topology[58] orwhen two datasets differ markedly in size[59]. TheWilcoxon sign-rank test[60] and the ShimodairaHasegawa test[61] were also calculated to assesssignificance of topology differences respectively in psimony and maximum-likelihood frameworks. Finaldeparture from the molecular clock was tested usrelative rate tests as implemented in PHYLTEST[62].We studied the mismatch distribution between thequences by using the Kimura two-parameter distaas genetic distance. The average distance betweengroups is the arithmetic mean of all pairwise distanbetween taxa in the inter-group comparisons andwithin-group means are arithmetic means of all invidual pairwise distances between taxa within grobelonging to: the genusHyla, the genusScinax, the sub-family Hylinae, the family Hylidae, and between tfamiliesHylidaeandCentrolenidae, using the morphological hierarchical level and under the hypothesisthere is no departure from the molecular clock. Unthis assumption, the mismatch distribution betweencomparable hierarchical levels will not be significandifferent and the mismatch distribution between tdifferent levels (i.e., genus versus subfamily) willsignificantly different. Due to the difference in sampsize, the Kolmogorov–Smirnov test was used to testhomogeneity between the different distributions wα = 0.05.

o

3. Results

3.1. Combined analysis of mitochondrial datasets

3.1.1. Phylogenetic analysisThe incongruence test detected no significant

erogeneity between the 12S and 16S datasets (p =0.018). Indeed, according to the Shimodaira–Hasegand Wilcoxon sign-rank tests, the 16S constraint trwere significantly different to the 12S and total dtrees (considering the 12S rDNA dataset and the tdataset). However, the 12S and total data trees diddiffer significantly from the 16S rDNA tree accordinto the Shimodaira–Hasegawa test (considering therDNA dataset). This pattern seems to be due to theof phylogenetic information in the 16S dataset sincenodes were supported.

Saturation was observed from the transition atransversion substitution patterns (Fig. 2A, C, and E).The homophyly of the Hylinae genera was testeding an 813-bp region of the total dataset. Of the 8positions, 394 were informative (gaps were treatedmissing for the unweighted parsimony analysis).found one single parsimonious tree (2035 steps).g1 value was−0.76, the CI was equal to 0.387, thewas equal to 0.620.

The combination of the two datasets showed phgenetic relationships within the French Guianan Hdae at a better resolution than fragments analysed srately (Fig. 3). The genusScinaxconstituted a homophyletic group with a high bootstrap support (BP=100/100/97, ML/MP/NJ). We detected two groups:first one, therostrataspecies group was constituted

M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024 1015

ngck

ngck

3f

pecies,A;2S

Fig. 2. (A) Scatter plots obtained from 813 positions of the 16S rDNA and 12S rDNA of 38 species.X axis: pairwise number of substitutions usithep distance;Y axis: pairwise number of substitutions using the Tamura–Nei model with alpha= 0.30 (open circle) and Jukes and Cantor (blacircle). (B) Scatter plots obtained from 1590 positions of the tyrosinase and 18S rDNA of 38 species.X axis: pairwise number of substitutions usithep distance;Y axis: pairwise number of substitutions using the Tamura–Nei model with alpha= 0.21 (open circle) and Jukes and Cantor (blacircle). (C) Distribution of the transition–transversion ratio using the 16S rDNA and 12S rDNA of 38 species (µ = 1.26;σ = 0.49). (D) Distributionof the transition–transversion ratio using the tyrosinase and 18S rDNA of 38 species (µ = 1.81; σ = 0.57). (E) Scatter plots obtained from 81positions of the 16S rDNA and 12S rDNA of 38 species.X axis: pairwise number of substitutions using transversions;Y axis: pairwise number osubstitutions using the transition. (F) Scatter plots obtained from 1590 positions of the tyrosinase and 18S rDNA of 38 species.X axis: pairwisenumber of substitutions using transversions;Y axis: pairwise number of substitutions using the transition. (G) Scatter plots obtained for 38 sX axis: pairwise number of substitutions using the Tamura–Nei model with alpha= 0.21 from 1590 positions of the tyrosinase and 18S rDNY axis: pairwise number of substitutions using the Tamura–Nei model with alpha= 0.30 obtained from 813 positions of the 16S rDNA and 1rDNA. (H) Distribution of the transition–transversion ratio using the tyrosinase, 18S rDNA, 16S rDNA and 12S rDNA of 38 species (µ = 1.62;σ = 0.40). (I) Scatter plots obtained from 2403 positions of the tyrosinase, 18S rDNA, 16S rDNA and 12S rDNA of 38 species.X axis: pairwisenumber of substitutions using transversions;Y axis: pairwise number of substitutions using the transition.

e,

ofi--

oo-

gy

Scinax jolyi, Scinax proboscideus, Scinax rostrataandScinax nebulosa(BP= 92/100/100) and the second ontherubra species group byScinax rubra, Scinax cruen-tomma, Scinax boesemaniand Scinax elaeochroa(BP= 98/100/100).

The homophyly of genusHyla was not supported(Fig. 3). The homophyly of the two major groupsHyla was confirmed by the ‘mitochondrial total evdence’ approach (BP= 89/74/85 for the first 30 chro

mosomes groupH. minuscula, Hyla nana, H. sp1,H. leucophyllata, H. brevifrons, H. minuta, and bp=99/98/99 for the ‘Gladiator frogs’ groupH. multifasci-ata, H. raniceps, H. calcarata, H. fasciata, H. dentei,H. geographica, H. boans, H. ornatissima). Further-more, the speciesPhrynohyaswas the sister group tOsteocephalus(BP = 61/86/99). We observed the hmophyly of the Centrolenidae (BP= 83/90/100), whichwas the sister group to the Hylidae, but this topolo

1016 M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024

vel,

rti-be-atedt.

an-

en-

heer-

r-

the-and

eraernaeen

asyl-

e-

ndto

et-

and

tedWeg1

as

-daereo-

a

am-e.

-

Fig. 2.Continued.

was only supported in NJ. On a lower systematic lewe noted that theHyla geographicaand theH. nanaspecies group are paraphyletic. IndeedH. geographicaclustered withH. boansandH. sp.1with H. minusculawith high bootstrap supports.

3.1.2. Genetic diversity of the 16S rRNA and 12SrRNA genes

Considering the homogeneity between the two pations (12S and 16S) and the correlation coefficienttween the two distance matrices (0.837), we estimthe genetic variability[63] using the complete dataseAccording to the Tamura–Nei genetic distance alph=0.30 (Table 3), the variability between the different geera of family Hylidae ranged from 0.129± 0.019 to0.852±0.151. The genetic divergence between the Ctrolenidae (Hyalinobatrachiumand Cochranella) andthe Hylidae ranged from 0.279± 0.041 with Phryno-hyasto 0.685± 0.125 with Phyllomedusa. The genusScinaxdisplayed a within group average of 0.417±0.067 (data not shown) and the genusHyla yielded

an average of 0.392± 0.05. Genetic diversity withinthe two clades was respectively 0.223± 0.026 (Hyla30-chromosome group) and 0.278± 0.03 (‘gladiatorfrogs’). The diversity within the genusHyla is huge,but we need to reconsider this result in light of tpolyphyletic pattern of this group. The genetic divsity between the two groups ofHyla was 0.512± 0.078and the variability between the two groups ofScinaxwas 0.556± 0.109. By comparison, the genetic divesity betweenOsteocephalusandPhrynohyasis equal to0.129± 0.019. These results were corroborated bymismatch analyses (Table 5), which revealed no congruence between the taxonomic levels (subfamilyfamily) and the molecular features.

The genetic diversity between the different genwithin the subfamily Hylinae was significantly highthan that estimated between the subfamilies Hyliand Phyllomedusinae. A similar result was found whthe genetic diversity within the subfamily Hylinae wcompared with that estimated between the families Hidae and Centrolenidae.

Moreover, we found no significant difference btween the genetic diversity within the genusScinaxandthe genetic diversity between the families Hylidae aCentrolenidae. However, this pattern could be duesaturation effects.

3.2. Combined analysis of nuclear datasets

The incongruence test did not detect significant herogeneity between the two nuclear datasets(p = 0.94)and no saturation was observed for the transitiontransversion substitution patterns (Fig. 2B, D, F). Of the1590 positions, 221 were informative (gaps were treaas missing for the unweighted parsimony analysis).found 192 equiparsimonious tree (623 steps). Thevalue was−0.68, the CI was equal to 0.594, the RI wequal to 0.797.

Considering theEleutherodactylusspecies as outgroup, we observed the homophyly of the Centroleni(BP= 99/97/99) (Fig. 4). Moreover, these species wesister groups to the Hylidae, which constituted a homphyletic group (BP= 79/–/69). Within French GuianHylidae, we observed that the genusPhyllomedusa(Phyllomedusinae) was the sister group to the subfily Hylinae (BP = 78/92/93). Within the Hylinae, thgenusScinaxwas homophyletic (BP= 100/100/100)Therostrataspecies groups constituted byScinax jolyi,Scinax proboscideus, Scinax rostrataandScinax nebulosa (BP = 100/100/100) and therubra species group(BP= 61/58/–) were supported.

M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024 1017

ofon

ors estimated

Fig. 3. Bootstrap analyses carried out with 1000 iterations using the 813 pb of the 16S rDNA and 12S rDNA among 38 ‘species’Hyla,Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, CochranellaandHyalinobatrachiumgenera: using Maximum-Likelihood bootstrap valuethe left, Maximum-Parsimony bootstrap value on the middle, Neighbour-Joining on a matrix of the Tamura–Nei (alpha= 0.30) model rightbootstrap value. The Maximum-Likelihood tree is shown(− ln = 9450.77869). The tree was rooted onEleutherodactylusas outgroup.

Table 3Between group average using the Tamura–Nei (alpha parameter for the gamma shape equal to 0.30) for the seven genera standard errby bootstrap method (1000 replications) for the 16S and 12S mitochondrial DNA (813 bp)

1 2 3 4 5 6 7

[1] Hyla 0.048 0.068 0.064 0.102 0.124 0.153[2] Phrynohyas 0.371 0.019 0.041 0.092 0.078 0.111[3] Osteocephalus 0.466 0.129 0.066 0.102 0.081 0.156[4] Centrolenidae 0.490 0.279 0.382 0.102 0.125 0.123[5] Scinax 0.683 0.529 0.590 0.646 0.151 0.258[6] Phyllomedusa 0.785 0.453 0.495 0.685 0.852 0.218[7] Eleutherodactylus 0.866 0.624 0.707 0.648 1.188 0.985

Above diagonal:Hylidae [Hylinae Hyla Phrynohyas Osteocephalus ScinaxPhyllomedusinaePhyllomedusa]; Centrolenidae Hyalinobatrachium,Cochranella; Leptodactylidae Eleutherodactylus.

1018 M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024

rors estimated

e text for

pial genes

Table 4Between group average using the Tamura–Nei (alpha parameter for the gamma shape equal to 0.21) for the seven genera standard erby bootstrap method 1000 replications for the 18S and Tyrosinase nuclear DNA (1590 pb)

1 2 3 4 5 6 7

[1] Hyla 0.004 0.003 0.006 0.005 0.008 0.008[2] Phrynohyas 0.032 0.003 0.006 0.005 0.010 0.008[3] Osteocephalus 0.032 0.014 0.006 0.005 0.010 0.009[4] Centrolenidae 0.049 0.045 0.046 0.007 0.009 0.006[5] Scinax 0.051 0.042 0.039 0.058 0.009 0.009[6] Phyllomedusa 0.079 0.083 0.085 0.080 0.089 0.011[7] Eleutherodactylus 0.066 0.063 0.066 0.055 0.073 0.091

Above diagonal:Hylidae [Hylinae Hyla Phrynohyas Osteocephalus ScinaxPhyllomedusinaePhyllomedusa]; Centrolenidae Hyalinobatrachium,Cochranella; Leptodactylidae Eleutherodactylus.

Table 5Test of the homogeneity between the different mismatch distributions using the Kolmogorov–Smirnov test with alpha equal to 0.05 (semore details)

2 Within GenusHyla

Within GenusScinax

WithinHylinae

Between Hylinae-Phyllomedusinae

Between Hylidae-Centrolenidae1

Within GenusHyla 1 > 2 1< 2 1< 2 1< 2Within GenusScinax NS 1< 2 1< 2 1< 2Within Hylinae 1> 2 1> 2 1< 2 1< 2Between Hylinae-Phyllomedusinae 1> 2 1> 2 1 < 2 1 > 2Between Hylidae-Centrolenidae 1> 2 NS 1 < 2 NS

NS: non significant, 1> 2: distance distribution of the first group significantly higher than the second, 1< 2: distance distribution of the first grousignificantly lower than the second. In bold: result not congruent with the morphological taxonomic level. The results for the mitochondrare below the diagonal and for the nuclear genes above the diagonal.

,

sti-e-

-up-

ha-

the

of

-

e--lr-

sityub-anichole-

nd

et-rialb-tionreun-par-

The paraphyly of genusHyla was supported by MLMP, and NJ methods (BP= 52/56/55), due to therelationship between the homophyletic group contuted byOsteocephalusandPhrynohyasspecies and thHyla 30-chromosome group bp= 97/94/99). The homophyly of the two groups ofHyla was confirmed bythe ‘nuclear total evidence’ approach (BP= 95/88/97for the 30-chromosomeHyla and bp= 90/93/99 forthe Gladiator frogs. Paraphyly of theH. geographicaspecies group and thenana species group are confirmed. For the second group, this paraphyly is not sported.

3.2.1. Genetic diversity of the Tyrosinase and 18SrDNA genes

According to the Tamura–Nei distance with alp= 0.21 (Table 4), the variability between the different genera of Hylidae ranged from 0.014± 0.003 to0.089 ± 0.009. The genetic divergence betweenCentrolenidae (Hyalinobatrachiumand Cochranella)and the Hylidae ranged from 0.045 ± 0.006 withPhrynohyasto 0.080± 0.009 with Phyllomedusa. Thegenus Scinax displayed a within group average0.026± 0.003 (data not shown) and the genusHylayielded an average of 0.030± 0.003. Genetic diver

sity within the two groups ofHyla was respectively0.016± 0.002 for 30-chromosome Hyla, and 0.018±0.003 for Gladiator frogs. The genetic diversity btween the two groups was 0.04± 0.006 and the variability between the two groups ofScinaxwas equato 0.032± 0.004. By comparison, the genetic divesity betweenOsteocephalusand Phrynohyasis only0.014± 0.003.

Pairwise comparison showed that genetic diverwas significantly higher between the two different sfamilies Hylidae (Hylinae and Phyllomedusinae) thbetween the families Hylidae and Centrolenidae, whis another incongruence between morphology and mcular data (Table 5).

3.3. Combined analysis of total datasets (nuclear amitochondrial)

The incongruence test did not detect significant herogeneity between the two partition (mitochondversus nuclearp = 0.09) and weak saturation was oserved for the mitochondrial versus nuclear substitupatterns (Fig. 2G–I). Of the 2403 positions, 615 weinformative (gaps were treated as missing for theweighted parsimony analysis). We found one single

M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024 1019

’ ofon

Fig. 4. Bootstrap analyses carried out with 1000 iterations using the 1590 pb of the tyrosinase and 18S rDNA among 38 ‘speciesHyla,Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, CochranellaandHyalinobatrachiumgenera: Maximum-Likelihood using bootstrap valuethe left, Maximum-Parsimony bootstrap value on the middle, Neighbour-Joining on a matrix of the Tamura–Nei (alpha= 0.21) model rightbootstrap value. The Maximum-Likelihood tree is shown(− ln = 5853.9177). The tree was rooted onEleutherodactylusas outgroup. The arrowindicated the incongruence for one node between the Maximum-Likelihood tree and the three bootstrapped trees (ML, MP, NJ).

, the

on-

teo-

ysis-

n-.

simonious tree (2674 steps). The g1 value was –0.79CI was equal to 0.430, and RI was equal to 0.662.

Combined nuclear and mitochondrial analysis cfirmed the previous results: paraphyly of the genusHylaand the relationship between Phrynohyas and Oscephalus with theHyla 30 chromosomes group (Fig. 5).The genusScinaxwas the sister group toHyla plusOs-teocephalusplus Phrynohyas; however, this topologwas not supported. The Phyllomedusinae was theter group to the Hylinae (55/90/88).

4. Discussion

4.1. The genusHyla

Our results confirmed that two major groups costitute the paraphyletic genusHyla in French GuianaThe first group is constituted byH. brevifrons, H. leuco-phyllata, H. nana, H. minuta, H. sp1andH. minusculaand the second group byH. boans, H. fasciata, H. cal-carata, H. dentei, H. geographica, H. raniceps, H. mul-

1020 M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024

s’ ofon

Fig. 5. Bootstrap analyses carried out with 1000 iterations using the 2403 pb of the mitochondrial and nuclear genes among 38 ‘specieHyla,Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, CochranellaandHyalinobatrachiumgenera: Maximum-Likelihood using bootstrap valuethe left, Maximum-Parsimony bootstrap value on the middle, Neighbour-Joining on a matrix of the Tamura–Nei (alpha= 0.25) model rightbootstrap value. The Maximum-Likelihood tree is shown(− ln = 15785.73299). The tree was rooted onEleutherodactylusas outgroup.

nte

sese

ndr-

sdif-thee toesetreeilvatic

tifaciata and H. ornatissima. These species represethe 30-chromosomeHyla group[9] and the second onthe Gladiator frogs, respectively groups[26]. The pa-raphyly of the genusHyla confirmed herein underlinethe necessity to reconsider the taxonomy of one of thgroup.

We detected incongruence between the mitochoial and the nuclear gene trees. Indeed, the generaOs-

teocephalusand Phrynohyasclustered with the genuHyla on the nuclear gene tree. This pattern wasferent considering the mitochondrial gene tree butbootstrap values are too low and thus might be dusaturation and homoplasy on mitochondrial data. Thnuclear gene results were in agreement with theconstructed on the basis of morphology by Da S[27], which revealed two groups in the paraphyle

M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024 1021

upofrlyeden

d

iricy of

the

thee inn are-

thei

-nbyof-

byng.ria-

onnerand

ne)

ce

6Sr-the

of

ousec-

ingeslong

neraen-

icaler-nyl-ith

me-thusn ismo-ces

inaeer-ilies

ion.-learbe

nes

me

ith

leticpsmi-

ce

genusHyla. The first group(2n = 30) was polyphyleticaccording to the analysis by Da Silva (Hyla + Phyl-lodytes+ Xenohyla) and the node for the second gro(2n = 24) was not supported by the synapomorphythis group, i.e., shape of the first distal prepollex neacylindrical (CI = 0.033); four elements anterior to thdistal prehallux (CI= 0.088). However, our results adinformation on the phylogenetic relationships betwe‘Gladiator frogs’, Scinax, Hyla 30 chromosomes anOsteocephalus+ Phrynohyas.

We found that the clustering ofH. sp1with H. mi-nuscula(with 3% divergence) is in agreement with theacoustic signals[19]. A more accurate phylogenetanalysis coupling systematics and phylogeographthese particular groups needs to be done, as forH. leucophyllatacomplex[9].

4.2. The genusScinax

The molecular homophyly[64] of Scinaxwas sup-ported by high bootstrap proportions, whatevermolecular marker used. The molecular results weragreement with the morphological results based osingle shared derived trait, i.e., the absence of, orduced webbing between toes I and II in adults[65] andon ten synapomorphies[29].

The phylogenetic reconstruction indicated thatrubra group (S. rubra, S. cruentomma, S. boeseman,S. elaeochroa) and therostrata group (S. jolyi, S. pro-boscideus, S. rostrata and S. nebulosa) are respectively homophyletic. This result is in contradictiowith the morphological cladistic analysis madeFaivovich[29] in which the author stated the nestingthe rostrata group within therubra species group. Hierarchical positions of the species of therubra groupare also incongruent with the topology proposedFaivovich. However this could be due to taxa sampliAccording to the Tamura–Nei distance, genetic vation within Scinaxwas 0.417± 0.067 for the total mi-tochondrial DNA alignment. A previous study basedthe partial 16S[28] displayed a genetic variation withiScinaxto 0.171± 0.016. Our results indicate a highdegree of genetic diversity (whatever the distancethe marker used) within a restricted sample ofScinaxthan other studies[66]. Indeed, Kosuch et al.[67] found8 to 10% of genetic divergence in the 16S rDNA geamong the different species (African+ Asian speciesbelonging to the genusHoplobatrachusand 11% be-tween the Asian speciesRana gracilisand the AfricanspeciesR. lepus. This analysis of the genetic divergenshould be considered in light of:

(1) the varied pattern of substitutions along the 1rDNA molecule that could result in over or undeestimation of genetic distances depending onportion of the gene studied, and

(2) the homogeneity/heterogeneity of this patternsubstitutions between the lineages.

We eliminated the first artefact by using a homologregion of the 16S rDNA gene. To account for the sond, we constructed a NJ tree rooted on theXenopuslaevissequence and found no significant differencethe rate of substitution between the different linea(data not shown). These results demonstrate theevolutionary history of the genusScinax. This supportsthe opinion of Pombal et al.[25] (with respect to mor-phology, and ecology) who suggested that the geScinaxandHyla need to be separated into several gera.

4.3. Molecular vs morphological taxonomic levels

In the case of congruence between morphologand molecular data, it is clear that the genetic divsity within lower taxonomic levels will be lower thathat within higher taxonomic levels. Nevertheless, Hidae and Hylinae are supported as homophyletic wrespect to the positions of Centrolenidae and Pyllodusinae. These families and sub families level arecorroborated. The mitochondrial unresolved pattercertainly biased because of strong saturation and hoplasy. The heterogenity in branch length and distanbetween Centrolenidae, Hylinae and Phyllomedusfor mitochondrial and nuclear data (no significant diffences between the genetic distances of the two famHylidae and Centrolenidae and the genusScinax) is cer-tainly due to heterogeneous rate of molecular evolut

Our results (Table 5) clearly show that the phylogenetic signals based on mitochondrial genes and nucgenes are not congruent. This incongruence coulddue to the saturation effect. The mitochondrial gedisplayed two patterns:

(1) the first was observed at the family level, as soHylinae species (Osteocephalusand Phrynohyas)clustered with the subfamily Phyllomedusinae (wno support).

(2) The second pattern was due to the homophygenusScinax(considering the two species groupresent in French Guiana), which displayed silar degree of genetic diversity than the genusHyla,which was paraphyletic according to total evidenanalysis.

1022 M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024

ear, as

hearyfor

ityhesttionar-lli-inggda-y inforhib-calver-ntoides i

en-bly.

-

etic

mallela-

he

gyinlype--

fewualsnewt th-nd

icaltan-

in-tlylin-hate ba-dyn-

rsityon-

inns,

neon

aduised

an

a-

ofnd.

er-if-.an-45

en-ol.

ole,ari,ess-v. 7

er-if-996,

ory:gs,

This extreme difference in mitochondrial and nucldiversity may be the result of numerous phenomenalisted by Avise[68]. It seems therefore obvious that tgenusScinaxrepresents a genus of a long evolutionhistory, given that the sampling effort was identicalthe two genera in this region.

5. Conclusion

Strategies for the protection of biological diversrequire the identification of areas that shelter the higspecies and genetic diversity, and maximal protecof contiguous environmental gradients within theseeas[69]. It will be very difficult to protect neotropicafrogs efficiently, if only a few clades have been vadated using molecular markers. A recent study usmolecular markers[42] revealed evidence of strikinconvergences in larval and adult traits for the Magascan and Asian Ranidae. The level of homoplasmorphological, ecological and physiological datathe Neobatrachia is still underestimated and ampian systematic is largely still based on morphologitraits. These lead to an underestimation of the biodisity within amphibians. Moreover, it is very importato use both mitochondrial and nuclear markers to avincongruence between gene trees and species tremolecular phylogenetic reconstructions.

Indeed, the level of genetic diversity between gera within the same subfamily can vary consideraFor example, the generaScinaxand Hyla displayed amitochondrial genetic diversity of 0.417± 0.067 and0.392± 0.050, whereasOsteocephalusandPhrynohyasyielded a value of 0.129± 0.019. This can be interpreted in two ways: the generaScinaxandHyla must besplit into more than one genus (due to the high gendistance), or the generaOsteocephalusandPhrynohyasmust be merged into only one genus (due to the sgenetic distance). Considering the phylogenetic rtionships within the Hylidae, i.e., homophyly ofScinax,paraphyly ofHyla, and the nuclear genetic diversity, tfirst hypothesis seems more likely.

The species identified on the basis of morpholocould be an indicator of species richness but certaunderestimate the real number of specific entity escially in the tropics[11]. Another approach, DNA barcoding, was recently proposed by Hebert[70]. Thismethodology use large scale screening of one or areference genes in order to assign unknown individto species and thereby could enhance discovery ofspecies. However, some authors raise doubts aboucontribution of this approach[71]. For example, problems may arise in groups of frequent hybridisation a

n

e

recent radiations. The real challenge lies with troptaxa and those with limited dispersal and thus substial phylogeographic structure[71].

Considering our results, the fact that a completeventory of amphibians in French Guiana is currenimpractical and the fact that populations are decing in many parts of the world, we recommend tspecies richness should be initially assessed on thsis of morphology, systematically coupled with a stuof molecular genetic diversity (nuclear and mitochodrial gene sequences). The higher taxonomic divemust be coupled to phylogenetic diversity for the cservation: “all genera(based on morphology) are equalbut some genera are more equal than others(based onmolecular).” This approach will avoid major biasesthe estimation of the biodiversity in neotropical regiotherefore providing an important conservation tool.

Acknowledgements

We are grateful to Jean-François Martin, AnMiquelis and Nicolas Pech for useful commentsthe manuscript, and Michel Blanc for theCochranellaspecies andH. boans. This work was supported bygrant from the French ‘Ministère de l’Écologie etDéveloppement durable’. The manuscript was revby Alex Edelman & associates.

References

[1] S.E. Willams, J.M. Hero, Multiple determinants of Australitropical frog biodiversity, Biol. Conserv. 98 (2001) 1–10.

[2] A. Purvis, A. Hector, Getting the measure of biodiversity, Nture 405 (2000) 212–219.

[3] P.H. Willams, C.J. Humphries, R.J. Vane-Wright, Centresseed-plant diversity: the family way, Proc. R. Soc. LoBiol. 256 (1994) 67–70.

[4] P.H. Willams, K.J. Gaston, C.J. Humphries, Mapping biodivsity value worldwide: combining higher-taxon richness from dferent groups, Proc. R. Soc. Lond. Biol. 264 (1997) 141–148

[5] D.P. Faith, Phylogenetic pattern and the quantification of orgismal biodiversity, Phil. Trans. R. Soc. Lond., Ser. B – Biol. 3(1994) 45–58.

[6] C. Moritz, D.P. Faith, Comparative phylogeography and the idtification of genetically divergent areas for conservation, MEcol. 7 (1998) 419–429.

[7] W.J. Kress, W.R. Heyer, P. Acevedo, J. Coddington, D. CT.L. Erwin, B.J. Meggers, M. Pogue, R.W. Thorington, R.P. VM.J. Weitzman, S.H. Weitzman, Amazonian biodiversity: assing conservation priorities with taxonomic data, Biol. Conser(1998) 1577–1587.

[8] K.J. Gaston, P.H. Williams, Spatial patterns in taxonomic divsity, in: K.J. Gaston (Ed.), Biodiversity of Numbers and Dference, Blackwell Science Mississauga, Ontario, Canada, 1pp. 202–229.

[9] A.A. Chek, S.C. Lougheed, P.T. Boag, Perception and histmolecular phylogeny of a diverse group of neotropical fro

M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024 1023

.

her,Na-

na-er,

ns:4.

o-am-04)

rs,op-

s of.sityn-

thofer-

, in:on

ien-

atri-lle,

tol.

on

76.er,ane

.

leofer-

nof

fnts

-c-

aeaece,

y-m-25

nusp.

ge-Anes,

bu-ial

t,

ru-

loidces,

ye-00)

er,gsandl. 15

in6–

of292

art,of

bia:con-ular

e of

nseen0)

r-ips. Bi-

e-ub-n98)

gin,te-ysis

the 30-chromosomeHyla (Anura: Hylidae), Mol. PhylogenetEvol. 18 (2001) 370–385.

[10] B.E. Young, S.N. Stuart, J.S. Chanson, N.A. Cox, T.M. BoucDisappearing jewels: the status of new world amphibians,tureServe (2004) 1–60.

[11] M. Meegaskumbura, F. Bossuyt, R. Pethiyagoda, K. Mamendra-Arachchi, M. Bahir, M.C. Milinkovitch, C.J. SchneidSri Lanka: an amphibian hot spot, Science 298 (2002) 379.

[12] A.R. Blaustein, D.B. Wake, Declining amphibians populatioa global phenomenon?, Trends Ecol. Evol. 5 (1990) 203–20

[13] S.N. Stuart, J.S. Chanson, N.A. Cox, B.E. Young, A.S.L. Rdrigues, D.L. Fischman, R.W. Waller, Status and trends ofphibian declines and extinctions worldwide, Science 306 (201783–1786.

[14] J.E. Houlahan, C.S. Findlay, B.R. Schmidt, A.H. MeyeS.L. Kuzmin, Quantitative evidence for global amphibian pulation declines, Nature 404 (2000) 752–755.

[15] J.M. Kiesecker, A.R. Blaustein, L.K. Belden, Complex causeamphibian population declines, Nature 410 (2001) 681–684

[16] C. Azvedo-Ramos, U. Galatti, Patterns of amphibian diverin Brazilian Amazonia: conservation implications, Biol. Coserv. 103 (2002) 103–111.

[17] W.E. Duellman, Distribution pattern of amphibians in SouAmerica, in: W.E. Duellman (Ed.), Patterns of DistributionAmphibians: A Global Perspective, The Johns Hopkins Univsity Press, Baltimore, 1999, pp. 255–328.

[18] W.R. Heyer, On frog distribution patterns east of the AndesP.E. Vanzolini, W.R. Heyer (Eds.), Proceeding of a WorkshopNeotropical Distribution Patterns, Academia Brasileira de Ccias, Rio de Janeiro, 1998, pp. 225–273.

[19] J. Lescure, C. Marty, Atlas des amphibiens de Guyane, Pmoines Naturels, vol. 45, Muséum national d’histoire natureParis, 2000.

[20] L.S. Ford, D.C. Cannatella, The major clades of frogs, HerpeMonogr. 7 (1993) 94–117.

[21] J. Lescure, V. Marty, C. Marty, M. Auber-Thomas, Contributià l’étude des amphibiens de Guyane française – XI, LesPhryno-hyasAnura Hylidae, Rev. Fr. Aquar. Herpétol. 23 (1996) 69–

[22] J. Lescure, V. Marty, C. Marty, M. Auber-Thomas, F. LetelliF. Starace, Contribution à l’étude des amphibiens de Guyfrançaise – X, LesPhyllomedusaAnura Hylidae, Rev. Fr. AquarHerpétol. 22 (1995) 35–50.

[23] J.A. Campbell, Distribution pattern of amphibians in MiddAmerica, in: W.E. Duellman (Ed.), Patterns of DistributionAmphibians: A Global Perspective, The Johns Hopkins Univsity Press, Baltimore, 1999, pp. 111–210.

[24] W.E. Duellman, Evolution of hylids frogs, in: W.E. Duellma(Ed.), The Hylid Frogs of Middle America, 2 vols., MuseumNatural History, University of Kansas, 2001, pp. 765–787.

[25] J.P. Pombal, C.F.B. Haddad, S.A. Kasahara, New species oSci-nax (Anura, Hylidae) from Southeastern Brazil, with commeon the Genus, J. Herpetol. 29 (1995) 1–6.

[26] A.G. Kluge, The gladiator frogs of Middle America and Colombia – A reevaluation of their systematics (Anura: Hylidae), Ocas. Pap. Mus. Zool., Univ. Mich. 688 (1979) 24.

[27] H.R. Da Silva, Phylogenetic relationships of the family Hylidwith emphasis on the relationships within the subfamily Hylin(Amphibia: Anura), PhD thesis, University Kansas–Lawren1998.

[28] M.D. Salducci, C. Marty, R. Chappaz, A. Gilles, Molecular phlogeny of French Guiana Hylinae: implications for the systeatic and biodiversity of the neotropical frogs, C. R. Biologies 3(2002) 141–153.

[29] J. Faivovich, A cladistic analysis ofScinax Anura: Hylidae,Cladistics 18 (2002) 367–393.

[30] W.E. Duellman, J.J. Wiens, The status of the hylid frog geOlolygonand the recognition ofScinaxWagler 1830, Occas. PaMus. Nat. Hist. Univ. Kansas 151 (1992) 1–23.

[31] J.M. Hay, I. Ruvinsky, S.B. Hedges, L.R. Maxson, Phylonetic relationships of amphibian families inferred from DNsequences of mitochondrial 12S and 16S ribosomal RNA geMol. Biol. Evol. 12 (1995) 928–937.

[32] I. Ruvinsky, L.R. Maxson, Phylogenetic relationships amongfonoid frogs (Anura: Neobatrachia) inferred from mitochondrDNA sequences, Mol. Phylogenet. Evol. 5 (1996) 533–547.

[33] D.C. Cannatella, D.M. Hillis, P.T. Chippindale, L. WeigA.S. Rand, M.J. Ryan, Phylogeny of frogs of thePhysalaemuspustulosusspecies group with an examination of data incongence, Syst. Biol. 47 (1998) 311–335.

[34] C.R. Darst, D. Cannatella, Novel relationships among hyfrogs inferred from 12S and 16S mitochondrial DNA sequenMol. Phylogenet. Evol. 31 (2003) 462–475.

[35] W. Liu, A. Lathrop, J. Fu, D. Yang, R.W. Murphy, Phylogenof East Asian Bufonids inferred from mitochondrial DNA squences (Anura: Amphibia), Mol. Phylogenet. Evol. 14 (20423–435.

[36] M. Vences, J. Kosuch, S. Lötters, A. Widmer, K.H. JungfJ. Köhler, M. Veith, Phylogeny and classification of poison fro(Amphibia: Dendrobatidae) based on mitochondrial 16S12S ribosomal RNA gene sequences, Mol. Phylogenet. Evo(2000) 34–40.

[37] D.J. Harris, Reevaluation of 16S ribosomal RNA variationBufo(Anura: Amphibia), Mol. Phylogenet. Evol. 19 (2001) 32329.

[38] F. Bossuyt, M.C. Milinkovitch, Amphibians as indicatorsearly Tertiary ‘Out of India’ dispersal of vertebrates, Science(2001) 93–95.

[39] J.D. Austin, S.C. Lougheed, K. Tanner, A.A. Check, J.P. BogP.T. Boag, A molecular perspective on evolutionary affinitiesenigmatic neotropical frogAllophryne ruthveni, Zool. J. Linn.Soc. 134 (2002) 335–346.

[40] K. Roelants, J. Jiang, F. Bossuyt, Endemic ranid (AmphiAnura) genera in southern mountain ranges of the Indian subtinent represent ancient frog lineages: evidence from molecdata, Mol. Phylogenet. Evol. 31 (2004) 730–740.

[41] P. Taberlet, J. Bouvet, A single plucked feather as a sourcDNA for bird genetic studies, AUK 108 (1991) 58.

[42] F. Bossuyt, M.C. Milinkovitch, Convergent adaptative radiatioin Madagascan and Asian ranid frogs reveal covariation betwlarval and adult traits, Proc. Natl Acad. Sci. USA 97 (2006585–6590.

[43] A. Miquelis, J.F. Martin, E.W. Carson, G. Brun, A. Gilles, Peformance of 18S rDNA helix E23 for phylogenetic relationshwithin and between the Rotifera-Acanthocephala clade, C. Rologies 323 (2000) 925–941.

[44] A. Gilles, R. Chappaz, L. Cavalli, M. Lörtscher, E. Faure, Gnetic differentiation and introgression between putative sspecies ofLeuciscus soufiaTeleostei: Cyprinidae of the regioof the Mediterranean Alps, Can. J. Fish. Aquat. Sci. 55 (192341–2354.

[45] J.D. Thompson, T.J. Gibson, F. Plewniak, F. JeanmouD.G. Higgins, The ClustalX windows interface: flexible stragies for multiple sequence alignment aided by quality analtools, Nucleic Acids Res. 24 (1997) 4876–4882.

1024 M.-D. Salducci et al. / C. R. Biologies 328 (2005) 1009–1024

aseids

73–

ities264–

od7)

ub-ns

UP

of

ingse-

ce

hen40.a re-97)

az,eanlo-

dif-

ces-or ofses,

in-, in:ar-

og-ol.

ticnsti-tate

u-17

lo-

hyly

olex-

-ing

ofer)

of

vo-254.

calSer.

oS

nce

Vil-o-ved

m-onred11

[46] Y. Van de Peer, A. Caers, P. De Rijk, R. De Wachter, Databon the structure of small ribosomal subunit RNA, Nucleic AcRes. 26 (1998) 179–182.

[47] A. Löytynoja, M.C. Milinkovitch, SOAP cleaning multiplealignments from unstable blocks, Bioinformatics 17 (2001) 5574.

[48] H. Philippe, MUST: a computer package of management utilfor sequences and trees, Nucleic Acids Res. 21 (1993) 55272.

[49] N. Saitou, M. Nei, The neighbor-joining method: a new methfor reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (198406–425.

[50] K. Tamura, M. Nei, Estimation of the number of nucleotide sstitutions in the control region of mitochondrial DNA in humaand chimpanzees, Mol. Biol. Evol. 10 (1993) 512–526.

[51] D.L. Swofford, Phylogenetic analysis using parsimony, PAversion 40, Sinauer Sunderland, MA, 1998.

[52] D. Posada, K.A. Crandall, MODELTEST: testing the modelDNA substitution, Bioinformatics 14 (1998) 817–818.

[53] J.S. Rogers, D.L. Swofford, A fast method for approximatmaximum likelihoods of phylogenetic trees from nucleotidequences, Syst. Biol. 47 (1998) 77–89.

[54] J.S. Farris, M. Kallersjö, A. Kluge, C. Bult, Testing significanof congruence, Cladistics 10 (1995) 315–320.

[55] C.W. Cunningham, Can three incongruence test predict wdata should be combined?, Mol. Biol. Evol. 14 (1997) 733–7

[56] C.W. Cunningham, Is incongruence between data partitionsliable predictor of phylogenetic accuracy?, Syst. Biol. 46 (19464–478.

[57] A. Gilles, G. Lecointre, A. Miquelis, M. Loerstcher, R. ChappG. Brun, Partial combination applied to phylogeny of Europcyprinids using the mitochondrial control region, Mol. Phygenet. Evol. 19 (2001) 22–33.

[58] P. Darlu, G. Lecointre, When does the incongruence lengthference test fail?, Mol. Biol. Evol. 19 (2002) 432–437.

[59] M. Dowton, A.D. Austin, Increased congruence does not nesarily indicate increased phylogenetic accuracy – the behavithe incongruence length difference test in mixed-model analySyst. Biol. 51 (2002) 19–31.

[60] A.R. Templeton, Convergent evolution and non-parametricferences from restriction fragment and DNA sequence dataB. Weir (Ed.), Statistical Analysis of DNA Sequence Data, Mcel Dekker, New York, 1983, pp. 151–179.

[61] H. Shimodaira, M. Hasegawa, Multiple comparisons of llikelihoods with applications to phylogenetic inference, MBiol. Evol. 16 (1999) 1114–1116.

[62] S. Kumar, PHYLTEST: A Program for Testing PhylogeneHypotheses, version 20 [computer software and manual], Itute of Molecular Evolutionary Genetics, The Pennsylvania SUniversity, University Park, Pennsylvania, USA, 1996.

[63] S. Kumar, K. Tamura, I.B. Jakobsen, M. Nei, MEGA2: Moleclar Evolutionary Genetics Analysis software, Bioinformatics(2001) 1244–1245.

[64] M. Delorme, A. Dubois, J. Kosuch, M. Vences, Molecular phygenetic relationships ofLankanectes corrugatusfrom Sri Lanka:endemism of South Asian frogs and the concept of monopin phylogenetic studies, Alytes 22 (2004) 53–64.

[65] A.M. Suarez-Moyorga, J.D. Lynch, Redescription of the Tadpof Hyla vigilans(Anura: Hylidae) and notes about possible taonomic relationships, Caribb. J. Sci. 37 (2001) 116–119.

[66] M. Vences, M. Thomas, A. Meijden, Y. Chiari, D. Vieites, Comparative performance of the 16S rRNA gene in DNA barcodof amphibians, Front. Zool. 2 (2005) 1–12.

[67] J. Kosuch, M. Vences, A. Dubois, A. Ohler, W. Böhme, OutAsia: Mitochondrial DNA evidence for an oriental origin of tigfrogs genusHoplobatrachus, Mol. Phylogenet. Evol. 21 (2001398–407.

[68] J.C. Avise, Phylogeography: The History and FormationSpecies, Harvard University Press, Cambridge, MA, 2000.

[69] C. Moritz, Strategies to protect biological diversity and the elutionary processes that sustain it, Syst. Biol. 51 (2002) 238–

[70] P.D.N. Hebert, A. Cywinska, S.L. Ball, J.R. deWaard, Biologiidentifications through DNA barcodes, Proc. R. Soc. Lond.,B 270 (2003) 313–321.

[71] C. Moritz, C. Cicero, DNA barcoding: promise and pitfalls, PlBiology 2 (2004) 1529–1531.

[72] Y. Chang, F. Huang, T. Lo, The complete nucleotide sequeand gene organisation of carpCyprinus carpiomitochondrialgenome, J. Mol. Evol. 38 (1994) 138–155.

[73] T. Kocher, W. Thomas, A. Meyer, S. Edwards, S. Pääbo, F.lablanca, A.C. Wilson, Dynamics of mitochondrial DNA evlution in animals: amplification and sequencing with conserprimers, Proc. Natl Acad. Sci. USA 86 (1989) 6196–6200.

[74] A.M. Goebel, J.M. Donnelly, M.E. Atz, PCR primers and aplification methods for 12S ribosomal DNA the control regicytochrome oxydase I and cytochromeb in bufonids and othefrogs and an overview of PCR primers which have amplifiDNA in amphibians successfully, Mol. Phylogenet. Evol.(1999) 163–199.