Phylogenetic characterization of cryptic species of the ...€¦ · Phylogenetic characterization...

J. Bio. & Env. Sci. 2014

317 | Efimova et al.

RESEARCH PAPER OPEN ACCESS

Phylogenetic characterization of cryptic species of the marine

dinoflagellate, Ostreopsis sp. Shmidt, 1902, from Russian

coastal waters, the Sea of Japan

Kseniya V. Efimova*, Tatiana Yu. Orlova, Vladimir A. Brykov

A.V. Zhirmunsky Institute of Marine Biology of the Far Eastern Branch of the Russian Academy of

Sciences, Palchevskogo St. 17, Vladivostok, 690041, Russia

Article published on October 21, 2014

Key words: Ostreopsis, rDNA, toxic dinoflagellates, harmful algal bloom, Sea of Japan.

Abstract

Ostreopsis Schmidt, 1902 is a genus of benthic and epiphytic dinoflagellates known to produce palytoxin (PTX)

and its analogues. In 2006, high concentrations (10,970 cells g-1dry weight) of Ostreopsis spp. were found in

waters of Peter the Great Bay, Sea of Japan, near Vladivostok (43˚04ʹ N, 131˚57ʹ E). Since then, high numbers of

Ostreopsis spp. have been observed each year associated with the epiphytic assemblages of the bay. The current

investigation focuses on molecular-genetic analysis and phylogenetic reconstruction of Ostreopsis sp. from

Russian waters based on ribosomal DNA genes (LSU rDNA (D1/D2) and ITS1-5.8S-ITS2 region, SSU rDNA).

Single cells from environmental samples and monoclonal cultures were used to isolate DNA, which was compared

to sequences of Ostreopsis species from the northwestern Pacific, Indo-Pacific, Malaysia, and

Atlantic/Mediterranean regions. Phylogenetic analysis, based on rDNA sequence, revealed three distinctly

different Ostreopsis ribotypes: one similar to a toxic Korean strain, the second analogous to a Japanese strain

from Okinawa (Ostreopsis sp.2), and the third similar to an extremely toxic Japanese strain (Ostreopsis sp.1). The

present study has revealed high genetic homogeneity of SSU rDNA within the Russian strain that allowed us to

reliably estimate distinctions among populations from different regions and homogeneity within population.

*Corresponding Author: Kseniya V. Efimova [email protected]

Journal of Biodiversity and Environmental Sciences (JBES) ISSN: 2220-6663 (Print) 2222-3045 (Online)

Vol. 5, No. 4, p. 317-332, 2014

http://www.innspub.net



Introduction

Ostreopsis Schmidt (1902) is a genus of benthic and

epiphytic marine dinoflagellates known to produce

palytoxin (PTX) and its analogues (ovatoxin-

a/b/c/d/e/f, mascarenotoxin-a/c, ostreocin-D),

ostreotoxin-1 and ostreotoxin-3, and ostreol A.

Palytoxin is a very strong non-proteinaceous toxin,

second in toxicity only to botulinum toxin (Yasumoto,

1998; Onuma et al., 1999; Taniyama et al., 2003;

Lenoir et al., 2004; Riobó et al., 2006; Ito and

Yasumoto 2009; Deeds and Schwartz, 2010; Hwang

et al., 2013). This toxin can be bioaccumulated in

organisms at higher levels of the marine food chain

which when ingested, cause human fatalities

(Taniyama et al., 2003; Ciminiello et al., 2006).

Another mechanism of PTX exposure includes

breathing the aerosol from blooms of O. cf. ovata. In

Genova, Italy, in 2005 and 2006, this organism

caused respiratory problems in more than 150 people

who had to be hospitalized (Brescianini et al., 2006;

Durando et al., 2007). Recently, it has been reported

that PTX-like poisoning is rapidly increasing in

Japanese coastal areas (Taniyama et al., 2003, 2008;

Sato et al., 2011).

The genus Ostreopsis is one of the most unique of

Dinophyceae due to plasticity in its morphology,

ecology, and genetics. The taxonomy of genus

Ostreopsis is in dire need of revision (Parsons et al.,

2012). Like some other dinoflagellate genera,

Ostreopsis are roughly divided into the species

complexes O. cf. ovata and O. cf. siamensis, and the

species O. labens and O. lenticularis, based on

ribotyping. However, species of this genus are

considered to be cryptic. Plasticity in the morphology

of many dinoflagellate species, including Ostreopsis,

has made accurate identification difficult, but reliable

molecular markers will allow the establishment of

genotype classification that will facilitate and improve

species identifications. Presently, use of

morphological characteristics of Ostreopsis alone

enables taxonomic characterization only to the genus

level. However, phylogenetic analyses using rDNA

molecular markers could resolve taxonomy to the

species or strain level.

Nuclear ribosomal RNA genes are widely used for

inferring protist phylogeny (Moreira et al., 2007;

Fiore-Donno et al., 2010; Pillet et al., 2011) and for

species identification (Bass et al., 2009; Pawlowski

and Lecroq, 2010). Also, toxicity of dinoflagellates has

been associated with specific ribotypes (Penna et al.,

2005b; Sato et al., 2011). However, Sato et al., (2011)

have reported hypervariability of rDNA genes of the

genus Ostreopsis. The ITS regions are used to provide

clear species demarcations of dinoflagellates: a

genetic distance of p ≥ 0.04 can be used to delimit

species (Litaker et al., 2007; Stern et al., 2012). ITS-

region sequencing is commonly used to analyze

closely related and geographically different species

(Schlötterer, 1998; Coyer et al., 2001; LaJeunesse,

2001; Saito et al., 2002; Shao et al., 2004; Litaker et

al., 2007). However, ITS barcoding is not always

successful, as has been shown with many other

organisms, including dinoflagellates (Dyhrman et al.,

2010; Galluzzi et al., 2010).

In 2006, Ostreopsis spp. were found in high

concentrations (10,970 cells g-1dry weight) in waters

of Peter the Great Bay, Sea of Japan, near Vladivostok

(Selina and Orlova, 2010). This was the first

occurrence of the genus Ostreopsis in Russian marine

waters, which are characterized by extremely cold

temperatures during the winter season. Since then,

Ostreopsis have been documented each year,

associated with epiphytic assemblages in the Peter the

Great Bay. Preliminary studies have shown the

presence of two morphotypes, O. cf. ovata and O. cf.

siamensis, the morphology (Selina and Orlova, 2010)

and ultrastructure (Kreshenovskaya and Orlova, in

press) that have been examined and characterized.

Despite the absence of reported poisoning cases

caused by Ostreopsis blooms in the Russian Far East,

they are a potential threat to human health along the

southeastern coast of Russia, an important cultural

and economic zone with dependence on fisheries.

http://www.sciencedirect.com/science/article/pii/s1568988312001394#bib0055

http://www.sciencedirect.com/science/article/pii/s1568988312001394#bib0055



In this study, we performed phylogenetic analyses of

several Ostreopsis spp. strains isolated from Russian

marine waters based on LSU (large subunit) and ITS-

5.8S rDNA. Sequences from new ribotypes from the

Sea of Japan were identified and compared with those

from worldwide isolates. Thus, this study adds

information about new ribotypes of Ostreopsis from

Russian Far Eastern waters.

Materials and methods

Sample collection

Isolates were collected in September – October 2010

or 2012 from the macroalga Neorhodomela larix at

43˚04ʹ N, 131˚57ʹ E in Sobol bight, Ussuriiskiy Bay of

Peter the Great bay, Sea of Japan. Twenty eight

Ostreopsis cells were isolated and cultured in K

medium (Keller et al., 1987) on a 12:12 h light:dark

cycle at 20ºС and ~3500 lx.

Cells collected in 2012 were isolated from seawater by

microscopy using micropipetting and used directly for

DNA extraction. Ostreopsis species used for analysis

of the ITS-region and LSU rDNA are shown in Tables

1 and 2, respectively.

DNA extraction, PCR, and DNA sequencing

Genomic DNA was extracted from frozen pellets of

monoclonal cultures using the CTAB method (Doyle

and Doyle, 1990) with modifications, using powdered

glass instead 0.2% 2-mercaptoethanol. Cells, CTAB,

and powdered glass were triturated with a glass stick.

Furthermore, a rapid, single-cell DNA extraction

method (Ki et al., 2005) was used.

Species-specific PCR were carried out using the

primers Ovata F/Ostreopsis R, Siamensis F/

Ostreopsis R (Penna et al., 2005a) to target the ITS

regions for O. cf. ovata and O. cf. siamensis. Attempts

to amplify samples with species-specific primers were

not successful. Both ITS regions, including the 5.8S

rDNA (ITS-region), were amplified using the primer

pair ITSA and ITSB (Adachi et al., 1996). The PCR

reactions were carried out in a total volume of 12 µl,

containing 0.25 µM of each primer, 200 µM of each

deoxynucleotide triphosphate (dNTP), 1.25 mM

buffer with MgCl2, 5U of Taq polymerase (Fermentas,

USA), sterile deionized water and 0.1 to 2 µl of

template DNA from clonal biomass and single cells,

respectively. The amplification profile of the ITS-

region consisted of an initial denaturation step at

94°C for 3 min, followed by 35 cycles of 30 s at 94°C,

1 min at 54°C, and 90 s at 72°C, with 5 min at 72°C for

the final extension.

Table 1. Samples used for LSU rDNA analysis,

collected from Ussuriiskiy Bay (Peter the Great Bay,

the Sea of Japan, Russia). All samples are Ostreopsis

sp. ORUS (Russian population).

Accession No. Sample ID Collection date KC848711 A1 Sep2010 KC848712 A2 Sep2010 KC848713 A3 Sep2010 KC848714 A4 Sep2010 KC848715 B1 Oct 2012 KC848716 B2 Oct 2012 KC848719 E1 Sep2010 KC848720 E2 Sep2010 KC848721 F1 Oct2010 KC848722 F2 Oct2010 KC848723 F3 Oct2010 KC848724 F4 Oct2010 KC848725 F5 Oct2010 KC848726 H1 Oct2010 KC848727 H2 Oct2010 KC848728 J2 Oct2010 KC848729 J1 Oct2010 KC84873 O1 Oct2010

KC848736 O2 Oct2010 KC848737 P1 Oct2010 KC848738 P2 Oct2010 KC848717 C Oct2012 KC848718 D Oct2012 KC848730 M Oct2010 KC848731 M1 Oct2010 KC848732 M2 Oct2010 KC848733 M3 Oct2010 KC848734 M4 Oct2010

The amplification profile of the LSU rDNA D1/D2

with D2C-DIR and 28S-zoox D1/D2 F- 28S-zoox

D1/D2 R consisted of an initial denaturation step at

94°C for 3 min, followed by 30-35 cycles of 30 s at

94°C, 1 min at 56°C, and 105 s at 72°C, with 5 min at

72°C for the final extension. Amplification of SSU

(small subunit) rDNA was made from three

overlapping fragments using the primer pairs 1F-5R,

3F-18Sbi and 18a2.0-9R, respectively. The cycling

profiles were as follows: 94°C for 3 min, followed by



30 cycles of 30 s at 94°C, 90 s at 52°C, and 105 s at

72°C, with 5 min at 72°C for the final extension.

Primers are shown Table 3. The PCR products of LSU

rDNA and ITS-region were cloned into the pTZ57R/T

cloning vector (InsTAcloneTM PCR Cloning Kit,

Fermentas, USA).

Table 2. Samples used for the ITS-region analysis,

collected from Ussuriiskiy Bay (Peter the Great Bay,

the Sea of Japan, Russia). All samples are Ostreopsis

sp. ORUS (Russian population).

Accession No. Sample ID Collection date

KC991348 M2 Oct2010

KC991346 M Oct2012

KC991347 M1 Oct2010

KC991334 A4 Oct2010

KC991331 A1 Oct2010

KC991336 H1 Oct2012

KC991337 H2 Oct2012

KC991333 A3 Oct2010

KC991352 O2 Oct2012

KC991351 O1 Oct2012

KC991335 F Oct2012

KC991332 A2 Oct2010

KC991340 K Oct2012

KC991342 K2 Oct2012

KC991341 K1 Oct2012

KC991345 L3 Oct2010

KC991350 N2 Oct2010

KC991344 L2 Oct2010

KC991349 N1 Oct2010

KC991343 L1 Oct2010

KC991338 H3 Oct2010

KC991339 H4 Oct2010

All clones were sequenced using the universal

sequencing primers M13 with an ABI PRISM 3130 or

3500 Genetic Analyzers (Applied Biosystems, USA)

using the BigDye® Terminator v3.1 Cycle Sequencing

Kit (Applied Biosystems, USA). Sequences were

analyzed using DNA Baser Sequence Assembler v3.x

(2012 - trial), Unipro UGENE: 1.12 (Okonechnikov et

al., 2012). Molecular characterization of the

Ostreopsis genotype was performed via

BLAST/blastn suite (http://blast.ncbi.nlm.nih.gov).

The sequences were deposited in GenBank under the

accession numbers: KC848711-KC848738,

KF359996-KF360004 and KC991331-KC991352.

Alignments of all sequences were carried out

according to the following algorithms: Clustal W,

Clustal V, MUSCLE, MAFFT, Kalign. An optimal

alignment algorithm was found for each of ribosomal

regions. Thus, the ITS-region sequences were aligned

using the multiple sequence alignment program

MAFFT (http://www.biophys.kyoto-u.ac.jp/~katoh/

programs /align/mafft/); SSU sequences, with the

Clustal W program (Thompson et al., 1994); and LSU

D1/D2 with MUSCLE program (http://www.drive5.

com/muscle). The uncorrected genetic distances (p)

were estimated using MEGA 5.05 (Tamura et al.,

2011). The p-distances for ITS-region were compared

with the previously published values for genus and

species levels (Litaker et al., 2007).

Table 3. List of primers used for sequencing.

Primer Sequence (5′-3′) Direction Target region Reference

ITS A CCAAGCTTCTAGATCGTAACAAGGTHTCCGTAGGT

forward ITS1-5.8S-ITS2 Adachi et al., 1994

ITS B CCTGCAGTCGACAKATGCTTAARTTCAGCRG

reverse ITS1-5.8S-ITS2 Adachi et al., 1994

DIR ACCCGCTGAATTTAAGCATA forward LSU rDNA D1/D2 Scholin et al., 1994 D2C GTGTTATTTTGATTTCCTTG reverse LSU rDNA D1/D2 Scholin et al., 1994 28S zoox- D1/D2F

CCTCAGTAATGGCGAATGAACA forward LSU rDNA D1/D2 Loi 1998

28S zoox- D1/D2R

CCTTGGTCCGTGTTTCAAGA reverse LSU rDNA D1/D2 Loi 1998

1F TACCTGGTTGATCCTGCCAGTAG forward SSU rDNA Giribet and Ribera 2000

5R CTTGGCAAATGCTTTCGC reverse SSU rDNA Giribet et al., 1996 3F GTTCGATTCCGGAGAGGG forward SSU rDNA Giribet et al., 1996 18Sbi GAGTCTCGTTCGTTATCGGA reverse SSU rDNA Giribet et al., 1999 18a2.0 ATGGTTGCAAAGCTGAAAC forward SSU rDNA Giribet et al., 1996 9R GATCCTTCCGCAGGTTCACCTAC reverse SSU rDNA Giribet et al., 1996

http://blast.ncbi.nlm.nih.gov/



Phylogenetic analyses

All sequences were analyzed together with available

sequences from GenBank using the maximum-

likelihood (ML) method, neighbor-joining (NJ)

(Saitou and Nei, 1987) in MEGA5.05 and Bayesian

(BI) method in MrBayes (v. 3.1.2) (Ronquist and

Huelsenbeck, 2003) for phylogenetic inference.

Models of base substitutions were determined in

Modeltest 3.7 (Posada and Crandall, 1998). According

to the Akaike Information Criterion, the best-fit

model for all rDNA regions was T92+G (Tamura 3-

parameter with discrete Gamma distribution). MCMC

(Markov chain Monte Carlo) searches were run with

four chains for a million generations and sampled

every 100 generations to yield a posterior probability

distribution of 10,000 trees. Coolia monotis VGO783

was used as the outgroup. Bootstrap value analysis

was conducted using the fast stepwise addition option

in PAUP 4.0 b10 (Swofford, 2002) to evaluate the

robust nature of the groupings.

Results and discussion

Comparative analysis of the molecular data

The population of our Ostreopsis spp. was designated

as ORUS. The Ostreopsis genotype was determined

based on the previously described and named species,

clades, or ribotypes (Penna et al., 2005a, 2010; Sato

et al., 2011; Kang et al., 2013).

In total, 73 sequences of LSU rDNA from clonal

cultures and environmental cells, 22 sequences of

ITS1-5.8S rDNA-ITS2 (ITS-region) from clonal

cultures and 7 complete sequences of SSU rDNA were

successfully obtained.

The examined sequences of LSU D1/D2 rDNA were

obtained with two different pairs of primers. In both

cases, the sequences appeared to be polymorphic, but

our dataset based on primers developed by Loi (1998)

was most successful. The sequences of these primers

were more homogeneous and without deletions.

Sato et al. (2011) have noted the heterogeneity of the

LSU rDNA and ITS-region of Ostreopsis species from

different areas along the Japanese Islands.

Interestingly, the most recent report on Ostreopsis

from Jeju Island, South Korea (Kang et al., 2013)

affords no information about their intra-population

or within-strain variability. Yet, the Korean ribotype

is the closest to the Russian ribotypes based on

percent identity. The present study confirmed high

intrapopulation polymorphism of the ITS-region and

LSU rDNA of the Russian population. Therefore,

ORUS together with Korean and some Japanese

strains are firmly separated from the

Atlantic/Mediterranean, Malaysian, Oceanic, Indo-

Pacific and some of northwestern Pacific populations;

this is seen in Fig. 1-2.

Phylogenetic analyses

Bayesian, ML, and NJ analyses produced trees with

similar topologies for LSU datasets. LSU rDNA tree

demonstrates clearly divided clades with well

supported nodes (Fig. 1) The clade B further

differentiates into two subclades: Korean/Russian

(B1) and Ostreopsis sp.2 (Japan)/ORUS (Russian)

(B2). Our data show the existence of at least 2

different versions of the LSU rDNA sequences

(ribotypes) of the Ostreopsis strain from Russian

coastal waters.

Our analyses of the ITS-region performed were

analogous to those performed by Japanese

researchers (Sato et al., 2011). The topologies of all

phylogenetic trees were the same and resolved with

fairly high nodal supports. The ML phylogram with

ML and NJ bootstrap values and Bayesian posterior

probability are presented in Fig. 2. The clade of

Russian Ostreopsis was well clustered from other

species, as was the case for the subclade of O. cf.

ovata (Greece, Portugal, Indonesia, Malaysia, and

Cook Island), the clade C of O. siamensis and the

clades D/E of O. labens with Ostreopsis sp. The clade

A topologies of the Atlantic/Mediterranean/Indo-

Pacific O. ovata species-complex were not always the

same and resolved. This is evident in the BI

phylogram based on the ITS-region, which was

unresolved.



Fig. 1. Phylogeny of Ostreopsis based on LSU D1/D2 rDNA sequences aligned with MUSCLE, obtained from

T92+G model using ML, NJ, and BI reconstructions. The outgroup is Coolia monotis VGO783. Bootstrap values

and Bayesian posterior probability are shown from left to right, ML/NJ/BI.



Fig. 2. Phylogeny of Ostreopsis based on ITS-region sequences were aligned with MAFFT, obtained from T92+G

model using ML, NJ, and BI reconstructions. The outgroup is Coolia monotis VGO783. Bootstrap values and

Bayesian posterior probability are shown from left to right, ML/NJ/BI.

Further, we mainly analyzed clade B that includes

Russian, Japanese Ostreopsis sp.1/ sp.2, and S.

Korean Ostreopsis. The tree demonstrates that all of

the Russian Ostreopsis ribotypes belong to the

common clade (B) and are well separated from clade

(A) of O. ovata species-complex of Atlantic/

Mediterranean/South Pacific and some coasts of

Japan. The diversity within the Russian population of

Ostreopsis with two subclades indicates that they,

together with Korean and Japanese strains, are the

detached OTU (operational taxonomic unit). First, a

highly supported subclade B2 with three Russian

clones (KC991346.1, KC991347.1, KC991348.1) and

Japanese OdoOst6 (Ostreopsis sp.2, Sato et al., 2011)

branched off at the base clade B1 that contains ORUS,

Korean and Japanese (Ostreopsis sp.1, Sato et al.,

2011) strains. In contrast to the phylogram based on

LSU gene, four Japanese clones (Ostreopsis sp.1, Sato

et al., 2011) fell into the clade A.

High intra-specific diversity has been found in the

known species complexes of Alexandrium tamarense



(Lebour) Balech (Scholin et al., 1995; John et al.,

2005; Lily et al., 2007), and Symbiodinium clades

(Coffroth and Santos, 2005), Oxyrrhis marina

Dujardin (Al-Kandari et al., 2011), Karenia

mikimotoi (Miyake & Kominami ex Oda) Hansen &

Moestrup (Lowe et al., 2010), Cryptoperidiniopsis

brodyi Steidinger, Landsberg, Mason, P.L.,

Vogelbein, Tester & Litaker (Park et al., 2007),

Luciella masanensis P.L.Mason, Jeong, Litaker,

Reece & Steidinger (Mason et al., 2007), and

Scrippsiella trochoidea (Stein) Balech ex Loeblich III

(Montresor et al., 2003). In turn, the genus

Ostreopsis itself is extremely diverse. It should be

noted that the 5.8S rDNA is considered conservative

within the genus; therefore, obviously, this

conservation is traced within individual

subpopulations. However, the identity between some

samples of the same species-complex from different

populations is difficult to explain. For example, some

representatives of the ORUS are related to the Korean

strain; the other part of ORUS is more close to the

different Japanese strains. Nevertheless, both of them

belong to the common Northwest Pacific population.

Conversely, Sato et al. (2011) unexpectedly found that

some Japanese sequences were similar to those of

members of the Atlantic/Mediterranean O. ovata

species-complex. Compared to the Ostreopsis sp.1

and Ostreopsis sp.2 clades that fell into the common

clade of O. ovata species-complex, the Russian strain

clustering into the two subclades (B1 and B2)

corresponds to the common clade.

Taking into account the existence of pseudogenes, we

can assume that some of the fragments can be a

paralogues. As paralogous genes are in excess, they do

not suffer from the strong pressure of selection and

can change significantly compared to the baseline

over time (Bannikova et al., 2004). The ITS and LSU

diversity can be explained by the multi-copy nature of

these genes. The allelic variation in the rDNA genes

both between populations and within a single isolate

has been shown in many organisms: microalgae,

foraminifera (Pillet et al., 2012), microsporidia, fungi,

insects, and animals (Debrunner-Vossbrinck et al.,

1996; Li et al., 2012; Schoch et al., 2012). However, in

all cases, the obtained variants of rDNA sequences

belonged to the same clade.

It is known that the average number of 28S rDNA

copies per cell of O. cf. ovata and Ostreopsis sp.1 in

environmental samples tends to be more than that in

cultured samples, namely 36,000+8,000

/24,000+5,000 and 88,000+22,000/58,000 +12,000,

respectively (Hariganeya et al., 2013). This more

likely explains the high variability Russian samples

which were collected from only one site and, in

addition, samples were collected from the same

seaweed in 2010. Several known ribotypes belonging

to different subclades were identified among our

Ostreopsis spp. On the whole, considering the

phylogeny of the genus, most of the species/strains,

including individual sequences, are heterogeneous.

However, we cannot be sure and verify which of them

is a true gene and which is a paralog. Hence, no one

sequence can be excluded from our analysis.

This intra-specific variation was previously associated

with phylogeography, but it is evident now that this

absolutely not the case. ORUS samples of the same

clonal culture are in different clades and have a

greater genetic distance. The copy number of several

separate genes varies among sub-clones of a single

strain. Today, genetic variability within clonal

cultures is estimated by three genetic processes,

namely spontaneous mutations, recombination

within even completely asexual cultures, and genetic

drift (Lakeman et al., 2009).

Note that complete SSU rDNA sequences within the

Russian population were identical to each other,

while analogous studies of different organisms

(Rooney, 2004; Xu et al., 2009; Mentewab et al.,

2011; Pillet et al., 2012) demonstrated

hypervariability in this marker. However, in our study

the use of the SSU marker showed that all of ORUS

samples are one species/strain, clearly differentiated

from other known Ostreopsis species/strains. Since

only two SSU rDNA sequences of Ostreopsis are



published in GenBank, the phylogenetic

reconstructions are not presented here. The

geographical distribution of the Ostreopsis ribotypes

recorded from the Sea of Japan is presented in Fig. 3.

Fig. 3. Geographical distribution of Ostreopsis

ribotypes in the Sea of Japan. ▲ = clade B1,

Ostreopsis sp.1; ♦ = clade B1, O.cf. ovata from Jeju;

★ = clade B2, Ostreopsis sp.2.

Genetic distances

Genetic diversity was estimated using the uncorrected

p distances value between and within formed clades

for LSU rDNA and ITS-region sequences, and

between SSU rDNA sequences. The estimates of ITS-

region were compared with the p-values of

dinoflagellates (Litaker et al., 2007) in order to

elucidate the degree of relationships within the

Russian population and among other representatives

of the genus.

Genetic divergence was 1.9% (0.19) between the

ORUS and Korean strain (HE793379.1) and 5.9%

(0.59) between the ORUS and Malaysian strain

(AF244939.1). Estimates of evolutionary divergence

between SSU rDNA sequences are shown in Table 4.

A large range of genetic variation between sequences

was observed in both ITS-regions and LSU rDNA. The

p values among the inferred groups of Ostreopsis

were species level divergences according to Litaker et

al., (2007). Today, there are no approved scales to

estimate taxonomic levels within “genus” belonging to

the Dinophyta. Genetic variation in LSU rDNA

between subclades B1/B2 was 0.139, which is outside

of the range of species-level differences. The p-value

between clades A and B was 0.13. Genetic distance

within clade B of ITS-region was 0.058+0.012;

subsequently, p-values were estimated for B1 and B2

separately. Genetic distance between subclades B1/B2

was 0.158 and between clades A/B1 and A/B2 p were

0.107/0.160, respectively, which indicates species-

level distinctions. All p-values among and within

clades are shown in Tables 5-8.

Table 4. Estimates of evolutionary divergence between SSU rDNA sequences.

No GenBank Sequence 1 2 3 4 5 6 7 8 9 10 11 12

1 KF360004.1 Ostreopsis sp. ORUS J2 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009

2 KF360003.1 Ostreopsis sp. ORUS J1 0.000

0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009

3 KF360002.1 Ostreopsis sp. ORUS O2 0.000 0.000

0.000 0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009

4 KF360001.1 Ostreopsis sp. ORUS O1 0.000 0.000 0.000

0.000 0.000 0.000 0.000 0.000 0.003 0.006 0.009

5 KF360000.1 Ostreopsis sp. ORUS K2 0.000 0.000 0.000 0.000

0.000 0.000 0.000 0.000 0.003 0.006 0.009

6 KF359999.1 Ostreopsis sp. ORUS H2 0.000 0.000 0.000 0.000 0.000

0.000 0.000 0.000 0.003 0.006 0.009

7 KF359998.1 Ostreopsis sp. ORUS H1 0.000 0.000 0.000 0.000 0.000 0.000

0.000 0.000 0.003 0.006 0.009

8 KF359997.1 Ostreopsis sp. ORUS A2 0.000 0.000 0.000 0.000 0.000 0.000 0.000

0.000 0.003 0.006 0.009

9 KF359996.1 Ostreopsis sp. ORUS A1 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000

0.003 0.006 0.009

10 HE793379.2 Ostreopsis cf. ovata 0.019 0.019 0.019 0.019 0.019 0.019 0.019 0.019 0.019

0.005 0.009

11 AF244939.1 Ostreopsis cf. ovata 0.059 0.059 0.059 0.059 0.059 0.059 0.059 0.059 0.059 0.052

0.009

12 JF521619.1 Alexandrium andersoni 0.180 0.180 0.180 0.180 0.180 0.180 0.180 0.180 0.180 0.171 0.173

http://www.ncbi.nlm.nih.gov/nuccore/6942118#_blank



Alexandrium andersoni was used only as an outgroup

for estimation of evolutionary divergence between

related genera.

Values below the diagonal are genetic distances;

values under the diagonal are standard errors.

Table 5. Matrix of genetic distances based on ITS-region among clades of Ostreopsis.

No Clade 1 2 3 4 5 6 7 1 Clade A 0.027 0.033 0.053 0.109 0.064 0.181 2 Clade B1 0.107 0.034 0.066 0.107 0.071 0.184 3 Clade B2 0.160 0.158 0.065 0.170 0.078 0.173 4 Clade C 0.255 0.303 0.338 0.112 0.073 0.201 5 Clade D 0.533 0.580 0.694 0.582 0.094 0.287 6 Clade E 0.395 0.449 0.490 0.455 0.615 0.274 7 Coolia monotis 0.785 0.803 0.807 0.859 1.086 1.098

Values below the diagonal are genetic distances; values under the diagonal are standard errors.

Table 6. Genetic distances based on ITS-region

sequences within clades of Ostreopsis.

Clade p S.E. Clade A 0.007 0.002 Clade B1 0.025 0.008 Clade B2 0.047 0.013 Clade C 0 0 Clade D 0.334 0.057 Clade E 0.438 0.073 Coolia monotis n/c n/c

n/c – no common sites (single sequence within clade)

S.E.-Standard Error

However, genomic interspecies variation may differ

broadly (Caron et al., 2009) depending on

evolutionary rates within each lineage of eukaryotes,

and there is no universally correct level of similarity

(Majaneva, 2013). Consequently, there is no strictly

defined range of p-distance values for genus and

species levels of dinoflagellates. However, the ITS

marker revealed a greater genetic distance between

different species, compared to strains belonging to

the same putative species. Nevertheless, these p-

values do not enable us to conclude anything

definitely.

Conclusions

The results indicated that the genotype of ORUS is

closer to the genotype O. cf. ovata than O. cf.

siamensis. Moreover, significantly distinct cultures

and single isolates from the Sea of Japan formed a

common clade. On the other hand, the present study

confirmed the high divergence of our Sea of Japan

population from the Atlantic, Malaysian, Indo-Pacific,

and Australian (Oceania) populations.

Phylogenetic analysis of LSU rDNA data revealed two

distinctly different Ostreopsis ORUS genotypes: one

similar to the toxic Korean strain that produces

ostreol-A and the other analogous to a Japanese

strain from Okinawa (Ostreopsis sp.2). Phylogenetic

analysis based on ITS sequencing indicated one more

genotype from the Russian Far East similar to an

extremely toxic Japanese strain (Ostreopsis sp.1) that

produce palytoxin-like compounds. Thus, Ostreopsis

spp. from Russian waters have ribotypes that have

been shown to be toxic in other regions. These

ribotypes are either randomly amplified copies of a

gene from different regions or different variants of

hybrid genotypes. We suggest that further molecular-

genetic studies of the Ostreopsis genus using new

markers are needed to elucidate the phylogenetic

relationships and status of all members of the genus.

The SSU rDNA sequences from all ORUS samples

were highly conserved. The present study has

revealed high genetic homogeneity of SSU rDNA of

Russian strains and low polymorphism among other

known Ostreopsis.

Since attempts to obtain a reliable marker for the

genus have been unsuccessful thus far, it may be that

the SSU rDNA gene is the only effective molecular

marker to effectively characterize phylogenetic

relationships within the genus Ostreopsis. The use of



SSU rDNA allowed us to reliably estimate the

distinctions among populations from different

regions and homogeneity within populations.

Heterogeneous sequences of a single gene (LSU

D1/D2 or ITS-region) from different samples of the

Russian strain may suggest that despite high

polymorphism, the Ostreopsis isolates are one

phylogenetic unit, which is confirmed by their

homogeneous SSU rDNA.

Acknowledgments

The authors are grateful to Kukhlevsky A.D. (A.V.

Zhirmunsky Institute of Marine Biology of the Far

Eastern Branch of the Russian Academy of Sciences,

Russia), Trainer V.L., and Adams N.G. (Northwest

Fisheries Science Center, National Marine Fisheries

Service, National Oceanic and Atmospheric

Administration, USA) for constructive

recommendations, advice in the work and proof

reading the article. Financing of the research was

partially supported by the Russian Foundation for

Basic Research (project 10-04-01438-a) and CRDF-

12-010 RUB1-7063-VL-12 “Changes in toxic

dinoflagellate communities in the Far Eastern seas of

Russia in response to climate change” 2012-2013) and

grant of the Far Eastern Branch of the Russian

Academy of Sciences (FEB1) and by the FEB RAS

Complex Target Program Biological Safety of Far East

Seas of Russian Federation, and the APN Foundation

Grant ARCP2006-FP14-Adrianov.

References

Adachi M, Sako Y, Ishida Y. 1994 Restriction

fragment length polymorphism of ribosomal DNA

internal transcribed spacer and 5.8S regions in

Japanese Alexandrium species (Dinophyceae).

Journal of Phycology 30, 857–865. doi:

10.1111/j.0022-3646.1994.00857.x

Adachi M, Sako Y, Ishida Y. 1996. Analysis of

Alexandrium (Dinophyceae) species using sequences

of the 5.8S ribosomal DNA and internal transcribed

spacer regions. Journal of Phycology 32, 424–432.

doi: 10.1111/j.0022-3646.1996.00424.x

Al-Kandari M, Highfield A, Hall M, Hayes P,

Schroeder D. 2011. Molecular tools separate

harmful algal bloom species, Karenia mikimotoi,

from different geographical regions into distinct sub-

groups. Harmful Algae 10, 636–643. doi:

10.1016/j.hal.2011.04.017

Bannikova AA. 2004. Molecular markers and

modern phylogenetics of Mammals. Zhurnal

Obshchei Biologii 65 (4), 278–305 (in Russian)

Bass D, Howe AT, Mylnikov AP, Vickerman K,

Chao EE, Edwards Smallbone J, Snell J,

Cabral C Jr, Cavalier-Smith T. 2009. Phylogeny

and Classification of Cercomonadida (Protozoa,

Cercozoa): Cercomonas, Eocercomonas, Paracerco-

monas, and Cavernomonas gen. nov. Protist 160,

483–521. doi:10.1016/j.protis.2009.01.004

Brescianini C, Grillo C, Melchiorre N,

Bertolotto R, Ferrari A, Vivaldi B, Icardi G,

Gramaccioni L, Funari E, Scardala S. 2006.

Ostreopsis ovata algal blooms affecting human health

in Genova, Italy, 2005 and 2006. Euro surveillance

Weekly 11, p 3040. Available online:

http://www.eurosurveillance.org

Caron DA, Countway PD, Savai P, Gast RJ,

Schnetzer A, Moorthi SD, Dennett MR, Moran

DM, Jones AC. 2009. Defining DNA-based

operational taxonomic units for microbial-eukaryote

ecology. Applied and Environmental Microbiology

75, 5797–5808.

Ciminiello P, Dell'Aversano C, Fattorusso E,

Forino M, Magno GS, Tartaglione L, Grillo C,

Melchiorre N. 2006. The Genoa 2005 outbreak.

Determination of putative palytoxin in Mediterranean

Ostreopsis ovata by a new liquid chromatography

tandem mass spectrometry method. Analytical

Chemistry 78, 6153–6159. doi: 10.1021/ac060250j

http://www.eurosurveillance.org/



Coffroth MA, Santos SR. 2005. Genetic diversity

of symbiotic dinoflagellates in the genus

Symbiodinium. Protist 156, 19–34.

doi:10.1016/j.protis.2005.02.004

Coyer JA, Smith GJ, Andersen RA. 2001.

Evolution of Macrocystis spp. (Phaeophyceae) as

determined by ITS1 and ITS2 sequences. Journal of

Phycology 37, 574–585. doi: 10.1046/j.1529-

8817.2001.037001574.x

Debrunner-Vossbrinck BA, Vossbrinck CR,

Vodkin MH, Novak RJ. 1996. Restriction analysis

of the ribosomal DNA internal transcribed spacer

region of Culex restuans and mosquitoes in the Culex

pipiens complex. Journal of the American Mosquito

Control Association 12, 477–482.

Deeds JR, Schwartz MD. 2010. Human risk

associated with palytoxin exposure. Toxicon 56, 150–

162. doi: 10.1016/j.toxicon.2009.05.035

Doyle JJ, Doyle JL. 1990. Isolation of plant DNA

from fresh tissue. Focus 12, 13–15.

Durando P, Ansaldi F, Oreste P, Moscatelli P,

Marensi L, Grillo C, Gasparini R, Icardi G.

2007. Ostreopsis ovata and human health:

epidemiological and clinical features of respiratory

syndrome outbreaks from a two-year syndromic

surveillance, 2005–2006, in north-west Italy. Euro

surveillance Weekly 12 (6).

Dyhrman ST, Haley ST, Borchert JA, Lona B,

Kollars N, Erdner DL. 2010. Parallel Analyses of

Alexandrium catenella Cell Concentrations and

Shellfish Toxicity in the Puget Sound. American

Society for Microbiology 76(14), 4647–4654.

Fiore-Donno AM, Kamono A, Chao E, Fukui

M, Cavalier-Smith T. 2010. Invalidation of

Hyperamoeba by transferring its species to other

genera of Myxogastria. Journal of Eukaryotic

Microbiology 57, 189–196. doi: 10.1111/j.1550-

7408.2009.00466.x

Galluzzi L, Bertozzini E, Penna A, Perini F,

Garcés E, Magnani M. 2009. Analysis of rRNA

gene content in the Mediterranean dinoflagellate

Alexandrium catenella and Alexandrium taylori:

implications for the quantitative real-time PCR-based

monitoring methods. Journal of Applied Phycology

22, 1–9.

Giribet G, Carranza S, Baguñà J, Riutort M,

Ribera C. 1996. First molecular evidence for the

existence of a Tardigrada + Arthropoda clade.

Molecular Biology and Evolution 13, 76–84.

Giribet G, Rambla M, Carranza S, Baguñà J,

Riutort M, Ribera C. 1999. Phylogeny of the

arachnid order Opiliones (Arthropoda) inferred from

a combined approach of complete 18S and partial 28S

ribosomal DNA sequences and morphology.

Molecular Phylogenetics and Evolution 11, 296–307.

Giribet G, Ribera C. 2000. A review of arthropod

phylogeny: New data based on ribosomal DNA

sequences and direct character optimization.

Cladistics 16, 204–231.

Hariganeya N, Tanimoto Y, Yamaguchi H,

Nishimura T, Tawong W, Sakanari H,

Yoshimatsu T, Sato S, Preston CM, Adachi M.

2013. Quantitative PCR method for enumeration of

cells of cryptic species of the toxic marine

dinoflagellate Ostreopsis spp. in Coastal Waters of

Japan. PLoS ONE 8(3), e57627. doi:

10.1371/journal.pone.0057627

Hwang BS, Yoon EY, Kim HS, Yih WH, Park

JY, Jeong HJ, Rho JR. 2013. Ostreol A: a new

cytotoxic compound isolated from the epiphytic

dinoflagellate Ostreopsis cf. ovata from the coastal

waters of Jeju Island, Korea. Bioorganic & Medicinal

Chemistry Letters 23, 3023–3027. doi:

10.1016/j.bmcl.2013.03.020



Ito E, Yasumoto T. 2009. Toxicological studies on

palytoxin and ostreocin-D administered to mice by

three different routes. Toxicon 54, 244–251. doi:

10.1016/j.toxicon.2009.04.009

John U, Medlin LK, Groben R. 2005.

Development of specific rRNA probes to distinguish

between geographic clades of the Alexandrium

tamarense species complex. Journal of Plankton

Research 27, 199–204. doi: 10.1093/plankt/fbh160

Keller MD, Selvin RC, Claus W, Guillard RRL.

1987. Media for the culture of oceanic

ultraphytoplankton. Journal of Phycology 23, 633–638.

Kang NS, Jeong HJ, Lee SY, Lim AS, Lee MJ,

Kim HS, Yih WH. 2013. Morphology and molecular

characterization of the epiphytic benthic dinoflagellate

Ostreopsis cf. ovata in the temperate waters off Jeju

Island, Korea. Harmful Algae 27, 98–112.

Ki J-S, Jang GY, Han M-S. 2005 Integrated

method for Single-cell DNA extraction, PCR

amplification, and sequencing of ribosomal DNA

from harmful dinoflagellates Cochlodinium

polykrikoides and Alexandrium catenella. Marine

Biotechnology 6, 587 – 593.

Kreshchenovskaya MA, Orlova TYu. 2014.

Ultrastructural study of dinoflagellate Ostreopsis cf.

ovata, Fukuyo, 1981 (Dinophyceae) Sea of Japan.

Russian Journal of Marine Biology 4(40), 286 – 292.

LaJeunesse TC. 2001. Investigating the

biodiversity, ecology, and phylogeny of endosymbiotic

dinoflagellates in the genus Symbiodinium using the

ITS region: in search of a „„species‟‟ level marker.


10.1046/j.1529-8817.2001.01031.x

Lakeman MB, von Dassow P, Cattolico RN.

2009. The strain concept in phytoplankton ecology.

Harmful Algae 8, 746–758. doi:

10.1016/j.hal.2008.11.011

Lenoir S, Ten-Hage L, Quod JP, Bernard C,

Hennion MC. 2004. First evidence of palytoxin

analogues from an Ostreopsis mascarenensis

(Dinophyceae) benthic bloom in southwestern Indian

Ocean. Journal of Phycology 40, 1042–1051.

Li JL, Chen WF, Wu J, Peng WJ, An JD,

Schmid-Hempel P, Schmid-Hempel R. 2012.

Diversity of Nosema associated with bumblebees

(Bombus spp.) from China. International Journal for

Parasitology 42, 49–61. doi:

10.1016/j.ijpara.2011.10.005

Lilly EL, Halanych KM, Anderson DM. 2007.

Species boundaries and global biogeography of the

Alexandrium tamarense complex (Dinophyceae).


10.1111/j.1529-8817.2007.00420.x

Litaker RW, Vanderseam W, Reece KS,

Stokesn A, Yonish BA, Kibler SR, Black MND,

Steidinger KA, Lutzoni FM, Tester PA. 2007.

Recognizing dinoflagellate species using, ITS rDNA

sequences. Journal of Phycology 43, 344–355. doi:

10.1111/j.1529-8817.2007.00320.x

Loi T. 1998. Molecular diversity of the predominant

clade C zooxanthellae from scleractinian corals of the

Great Barrier Reef. Honour‟s thesis, Department of

Microbiology, Univ. of Sydney, Sydney, Australia.

Lowe CD, Montagnes DJS, Martin LE, Watts

PC. 2010. Patterns of genetic diversity in the marine

heterotrophic flagellate Oxyrrhis marina (Alveolata:

Dinophyceae). Protist 161, 212–221. doi:

10.1016/j.protis.2009.11.003

Majaneva M. 2013. Linking taxonomy and

environmental 18S-rRNA-gene sequencing of Baltic

Sea protists Walter and Andree de Andree de

Nottbeck Foundation Scietific Reports, 40 p

Martins CA, Kulis D, Franca S, Anderson DM.

2004. The loss of PSP toxin production in a formerly



toxic Alexandrium lusitanicum clone. Toxicon 43,

195–205. doi: 10.1016/j.toxicon.2003.11.023

Mason PL, Litaker RW, Jeong HJ, Ha JH,

Reece KS, Stokes N-A, Park J-Y, Steidinger K-

A, Vandersea M-W, Kibler S, Tester P-A,

Vogelbein WK. 2007. Description of a new genus of

Pfiesteria-like dinoflagellate, Luciella gen. nov.

(dinophyceae), including two new species: Luciella

masanensis sp. nov. and Luciella atlantis sp. nov.


10.1111/j.1529-8817.2007.00370.x

Mentewab AB, Jacobsen MJ, Flowers RA. 2011.

Incomplete homogenization of 18S ribosomal DNA

coding regions in Arabidopsis thaliana. BMC

Research Notes 4(93), 1–7.

Montresor M, Sgrosso S, Procaccini G,

Kooistra WCHF. 2003. Intraspecific diversity in

Scrippsiella trochoidea (Dinophyceae): Evidence for

cryptic species. Phycologia 42, 56–70.

Moreira D, Von der Heyden S, Bass D, Lopez-

Garcia P, Chao E, Cavalier-Smith T. 2007.

Global eukaryote phylogeny: Combined small- and

large-subunit ribosomal DNA trees support

monophyly of Rhizaria, Retaria and Excavata.

Molecular Phylogenetics and Evolution 44, 255–266.

Okonechnikov K, Golosova O, Fursov M. 2012.

Unipro UGENE: a unified bioinformatics toolkit.

Bioinformatics 28, 1166–1167.

Onuma Y, Satake M, Ukena T, Roux J,

Chanteau S, Rasolofonirina N, Ratsimaloto M,

Naoki H, Yasumoto T. 1999. Identification of

putative palytoxin as the cause of clupeotoxism.

Toxicon 37, 55–65. doi: 10.1016/S0041-

0101(98)00133-0

Park TG, De Salas MF, Bolch CJ, Hallegraeff

GM. 2007. Development of a real-time PCR probe for

quantification of the heterotrophic dinoflagellate

Cryptoperidiniopsis brodyi (Dinophyceae) in

environmental samples. Applied and Environmental

Microbiology 73, 2552–2560. doi:

10.1128/AEM.02389-06

Parsons ML, Aligizaki K, Dechraoui MY, Fraga

S, Morton S, Penna A, Rhodes L. 2012.

Gambierdiscus and Ostreopsis: reassessment of the

state of knowledge of their taxonomy, geography,

ecophysiology, and toxicology. Harmful Algae 14,

107–129. doi: 10.1016/j.hal.2011.10.017

Pawlowski J, Lecroq B. 2010. Short rDNA

Barcodes for Species Identification in Foraminifera.

Journal of Eukaryotic Microbiology 57, 197–205. doi:

10.1111/j.1550-7408.2009.00468.x

Penna A, Vila M, Fraga S, Giacobbe MG,

Andreoni F, Riobo P, Vernesi C. 2005a.

Characterization of Ostreopsis and Coolia

(Dinophyceae) isolates in the western Mediterranean

Sea based on morphology, toxicity and internal

transcribed spacer 5.8S rDNA sequences. Journal of

Phycology 41, 212–225. doi: 10.1111/j.1529-

8817.2005.04011.x

Penna A, Garcés E, Vila M, Giacobbe MG,

Fraga S, Luglié A, Bravo I, Bertozzini E,

Vernesi C. 2005b. Alexandrium catenella

(Dinophyceae), a toxic ribotype expanding in the NW

Mediterranean Sea. Marine Biology 148: 13–23. doi:

10.1007/s00227-005-0067-5

Penna A, Bertozzini E, Battocchi C, Galluzzi L,

Giacobbe MG, Vila M, Garces E, Luglie A,

Magnani M. 2007. Monitoring of HAB species in the

Mediterranean Sea through molecular methods.

Journal of Plankton Research 29, 19–38. doi:

10.1093/plankt/fbl053

Penna A, Fraga S, Battocchi C, Casabianca S,

Riobo P, Giacobbe MG, Vernesi C. 2010. A

phylogeography study of the toxic benthic

dinoflagellate genus Ostreopsis Schmidt. Journal of



Biogeography 37: 830–841. doi: 10.1111/j.1365-

2699.2009.02265.x

Penna A, Fraga S, Nattocchi C, Casabianca S,

Perini F, Capellacci S, Casabianca A, Riobo P,

Giacobbe MG, Totti C, Accoroni S, Vila M,

René A, Scardi M, Aligizaki K, Nguyen-Ngoc L,

Vernesi C. 2012. Genetic diversity of the genus

Ostreopsis Schmidt: phylogeographical

considerations and molecular methodology

applications for field detection in the Mediterranean

Sea. Cryptogamie Algologie 33(2),153–163.

Pillet L, De Vargas C, Pawlowski J. 2011.

Molecular identification of sequestered Diatom

chloroplasts and kleptoplastidy in Foraminifera.

Protist 162, 394–404.

Pillet L, Fontaine D, Pawlowski J. 2012. Intra-

genomic ribosomal RNA polymorphism and

morphological variation in Elphidium macellum

suggests inter-specific hybridization in Foraminifera.

PLoS ONE 7(2), e32373. doi:

10.1371/journal.pone.0032373

Posada D, Crandall KA. 1998 Modeltest testing

the model of DNA substitution. Bioinformatics 14(9),

817-818.

Pin LC, Teen LP, Ahmad A, Usup G. 2001.

Genetic diversity of Ostreopsis ovata (Dinophyceae)

from Malaysia. Marine Biotechnology 3, 246–255.

Rhodes LL, Towers N, Briggs L, Munday R,

Adamson J. 2002. Uptake of palytoxin-like

compounds by feeding shellfish with Ostreopsis

siamensis (Dinophyceae). New Zealand Journal of

Marine and Freshwater Research 36, 631–636. doi:

10.1080/00288330.2002.9517118

Riobó P, Paz B, Franco JM. 2006. Analysis of

palytoxin-like in Ostreopsis cultures by liquid

chromatography with precolumn derivitization and

fluorescence detection. Analytica Chimica Acta 566,

217–223. doi: 10.1016/j.aca.2006.03.013

Ronquist F, Huelsenbeck JP. 2003. MrBayes 3:

Bayesian phylogenetic inference under mixed models.

Bioinformatics 19, 1572–1574.

Rooney AP. 2004. Mechanisms underlying the

evolution and maintenance of functionally

heterogeneous 18S rRNA genes in Apicomplexans.

Molecular Biology and Evolution 21, 1704–1711. doi:

10.1093/molbev/msh178

Saito K, Drgon T, Robledo JAF, Krupatkina

DN, Vasta GR. 2002. Characterization of the rRNA

locus of Pfiesteria piscicida and development of

standard and quantitative PCR-based detection

assays targeted to the non-transcribed spacer.

Applied and Environmental Microbiology 68, 5394–

5407. doi: 10.1128/AEM.68.11.5394-5407.2002

Saitou N, Nei M. 1987. The neighbor-joining

method: A new method for reconstructing

phylogenetic trees. Molecular Biology and Evolution

4, 406–425.

Sato S, Nishimura T, Uehara K, Sakanari H,

Tawong W, Hariganeya N, Smith K, Rhodes L,

Yasumoto T, Taira Y, Suda S, Yamaguchi H,

Adachi M. 2011. Phylogeography of Ostreopsis along

West Pacific coast, with special reference to a novel

clade from Japan. PLoS ONE 6, e27983. doi:

10.1371/journal.pone.0027983

Schlötterer C. 1998. Ribosomal DNA probes and

primers. In Karp A, Isaac PG, Ingram DS (eds).

Molecular tools for screening biodiversity. Chapman

and Hall, London.

Schmidt J. 1902. Flora of Koh Chang. Contribution

to the knowledge of the vegetation in the Gulf of

Siam. Part IV. Peridiniales. J Botanique 23, 212–218.



Schoch CL, Seifert KA, Huhndorf S, Robert V,

Spouge JL, Levesque CA, Chen W. 2012. Nuclear

ribosomal internal transcribed spacer (ITS) region as

a universal DNA barcode marker for Fungi. PNAS

(Proceedings of the National Academy of Sciences)

USA 109(16), 6241–6246.

Scholin CA, Hallegraeff G, Anderson DM. 1995.

Molecular evolution of the Alexandrium tamarense

„species complex‟ (Dinophyceae): dispersal in the

North American and West Pacific regions. Phycologia

34, 472–485.

Scholin CA, Herzog M, Sogin M, Anderson

DM. 1994. Identification of group and strain-specific

genetic markers for globally distributed Alexandrium

(Dinophyceae). II. Sequence analysis of a fragment of

the LSU rRNA gene. Journal of Phycology 30, 999–

1011. doi: 10.1111/j.0022-3646.1994.00999.x

Selina MA, Orlova TYu. 2010 First occurrence of

the genus Ostreopsis (Dinophyceae) in the Sea of

Japan. Botanica Marina 53, 243–249. doi:

10.1515/bot.2010.033

Shao P, Chen Y, Zhou H, Yuan J, Qu LH, Zhao

D, Lin YS. 2004. Genetic variability in

Gymnodiniaceae ITS regions: implications for species

identification and phylogenetic analysis. Marine

Biology 144, 215–224. doi: 10.1007/s00227-003-

1157-x

Stern RF, Andersen RA, Jameson I, Küpper

FC, Coffroth M-A, Vaulot D, Le Gall F, Véron

B, Brand JJ, Skelton H, Kasai F, Lilly EL,

Keeling PJ. 2012. Evaluating the Ribosomal

Internal Transcribed Spacer (ITS) as a Candidate

Dinoflagellate Barcode Marker. PLoS ONE 7(8),

e42780. doi: 10.1371/journal.pone.0042780

Swofford DL. 2002. PAUP*. Phylogenetic Analysis

Using Parsimony (*and other Methods) Version 4.0

b10, Sunderland, Massachusetts: Sinauer Associates

Tamura K, Peterson D, Peterson N, Stecher G,

Nei M, Kumar S. 2011. MEGA5. Molecular

Evolutionary Genetics Analysis Using Maximum

Likelihood, Evolutionary Distance, and Maximum,

Parsimony Methods. Molecular Biology and

Evolution 28(10), 2731–2739.

Taniyama S. 2008. The occurrence of palytoxin-like

poisoning and ciguatera in parts of the main land of

Japan. Nippon Suisan Gakkaishi 74, 917–918 (In

Japanese).

Taniyama S, Arakawa O, Terada M, Nishio S,

Takatani T, Mahmud Y, Noguchi T. 2003.

Ostreopsis sp., a possible origin of palytoxin (PTX) in

parrotfish Scarus ovifrons. Toxicon 42, 29–33.

Thompson JD, Higgins DG, Gibson TJ. 1994.

Clustal W: improving the sensitivity of progressive

multiple sequence alignment through sequence

weighting, position specific gap penalties and weight

matrix choice. Nucleic Acids Research 22, 4673–

4680.

Xu J, Zhang Q, Xu X, Wang Z, Qi J. 2009.

Intragenomic variability and pseudogenes of

ribosomal DNA in Stone flounder Kareius

bicoloratus. Molecular Phylogenetics and Evolution

52, 157–166. doi: 10.1016/j.ympev.2009.03.031

Yasumoto T, Satake M. 1998. New toxins and their

toxicological evaluation. In: Reguera B et al., (eds)

Harmful Algae. Xunta de Galicia and

Intergovernmental Oceanographic Commission of

UNESCO, 461–464.

Phylogenetic characterization of cryptic species of the ...€¦ · Phylogenetic characterization...

Documents

Transcript of Phylogenetic characterization of cryptic species of the ...€¦ · Phylogenetic characterization...