PHENOTYPICAL CHANGES OF OSTEOCYTES IN - QUT Jaiprakash_Thesis.pdf · vi Phenotypical Changes of...

PHENOTYPICAL CHANGES OF OSTEOCYTES IN

OSTEOARTHRITIS

Anjali Tumkur Jaiprakash, MSc

Submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

Institute of Health and Biomedical Innovation

Queensland University of Technology

2014

Phenotypical Changes of Osteocytes in Osteoarthritis i

Keywords

Osteoarthritis, Osteocyte, Bone remodelling, Mineral metabolism, Subchondral bone

sclerosis, Cartilage, TNFα, inflammation, MLOY-4 cell line, OA-Rat model, Medial

menisectomy, WNT signalling pathway.

ii Phenotypical Changes of Osteocytes in Osteoarthritis

Dedicated to my grand parents

Phenotypical Changes of Osteocytes in Osteoarthritis iii

“The illiterate of the 21st century will not be those who cannot read and write, but those who cannot learn, unlearn and relearn” -Alvin Toffler

iv Phenotypical Changes of Osteocytes in Osteoarthritis

Abstract

Osteoarthritis (OA) is the most common musculoskeletal disorder with

inflammatory, metabolic and mechanical causes. Its aetiology is largely unknown;

however, it is multi-factorial and by a variety of means reaches a common end stage

of joint destruction. Regardless of the aetiology, the disease is progressive and is

characterised by a series of predictable clinical and radiological changes. One of the

earliest radiological changes seen, often before any joint space narrowing is

observed, is subchondral bone sclerosis [1]. Signs of abnormal subchondral bone

mineral density and enhanced production of bone turnover markers have been

demonstrated and are indicative of bone cell dysfunction in osteoblasts [2] and

osteoclasts [3] with no consideration given to osteocytes (90% of the bone cells).

Exciting discoveries in recent years have changed the idea of osteocytes from being

passive, metabolically inactive cells to endocrine cells and orchestrators of bone

remodelling, representing a paradigm shift in the bone research field. Regardless of

whether subchondral bone sclerosis is the initiating or secondary event, it is a

consistent finding in OA but its significance, particularly the role of osteocyte cells

in this disease progression, has only received limited attention.

The aim of this project was to evaluate the subchondral bone and mineral

changes and address the question of how the most abundant and longest lived bone

cell type, “osteocyte”, changes in the pathology of OA. This was achieved in three

studies. The first study focused on characterising the sclerotic and non-sclerotic

subchondral bone area from clinical samples. Based on the clinical findings, a

suitable small animal model (rat medial menisectomy) that resembles the clinical

subchondral bone situation was then established as the second study to further

understand the osteocyte and mineral changes during OA pathophysiology. Further,

in an attempt to explain the clinical and animal model findings from an osteocyte

perspective and gain an insight into the underlying mechanisms controlling the

observed changes, for the third study, a series of in vitro studies were undertaken.

Involvement of WNT signalling pathway was evaluated in an OA environment (low-

dose inflammation).

Phenotypical Changes of Osteocytes in Osteoarthritis v

The first study involved the examination of human bone samples collected

from the knees of OA patients undergoing knee replacement surgery. The

subchondral bone mineral properties and phenotypic characteristics of the osteocyte

network were characterised by determining changes in osteocyte morphology,

distribution and apoptosis as well as evaluating the expression of osteocyte markers

and matrix degradation enzymes. This study demonstrated that OA samples had

altered osteocyte morphology and dysregulated osteocytic protein expression with

hampered mineral metabolism compared to controls. It was postulated that the

phenotypic changes of osteocytes in OA patients are responsible for the active site-

specific remodelling of subchondral bone, resulting in subchondral bone thickening

and dysregulated mineral metabolism.

Based on the findings obtained from clinical samples from study one, the

second study involved establishing an animal model to further investigate the focal

mineral and osteocyte changes. For this purpose, OA was induced in twelve week old

Wistar Kyoto rats by the removal of the medial meniscus. Subchondral bone mineral

properties, bone remodelling rate and osteocyte changes were investigated and

characterised. Using this model, we demonstrated and defined the mineral and

osteocyte changes observed clinically and showed that the OA menisectomy

experimental rat model resembled the human situation closely making it suitable for

the study of OA subchondral bone osteocyte pathogenesis. Based on the finding, it

was proposed, that osteocytes play a role in this process where there is increased

focal bone remodelling with net bone formation associated with hampered mineral

metabolism. The role of osteocyte WNT β-catenin signalling pathway was also

investigated.

The third study considered a series of in vitro studies. Along with subchondral

bone sclerosis, an increased number of migratory inflammatory cells and the

substances secreted by these cells have been recognised in the OA joint tissues. This

is not nearly as prominent as in the case of rheumatoid arthritis, which is clearly an

autoimmune disease, but enough to speculate that inflammation plays a role in OA.

Increasing evidence indicates that tumour necrosis factor α (TNFα) has an important

role not only in inflammatory arthritis but also in OA [4]. The use of Anti-TNFα has

been shown as a promising therapeutic strategy for the treatment of OA [5], however

its mechanisms are unexplored and debated. To explain the question of balance in

vi Phenotypical Changes of Osteocytes in Osteoarthritis

bone remodelling and changes to osteocytes in an OA environment (low-dose

inflammation), an in vitro model was set up using an osteocyte cell line, MLOY4.

Interesting and unexpected outcomes demonstrated that osteocytes exposed to low-

dose long-term inflammation (TNFα), promoted bone formation via WNT β-catenin

signalling while high-dose inflammation indicated bone resorption. We believe that

osteocytes exposed to low-dose long-term inflammation could potentially promote

subchondral bone sclerosis in OA.

The three studies together demonstrate that the OA osteocyte phenotype exhibit

distinctive changes that could be influenced by low-dose inflammation. These

changes participate in OA subchondral bone sclerosis and/or pathogenesis via

osteocyte WNT β-catenin signalling. The OA menisectomy experimental rat model

could be used to further study the progression of subchondral bone osteocyte

pathogenesis. Activation or deactivation of signalling molecules controlling

osteocytes hold great potential to be a target for novel therapies. These may include

activation/deactivation of osteocyte signalling molecules or osteocyte WNT β-

catenin signalling pathway molecules.

In conclusion, respecting the limitations of this study, it is considered that this

thesis characterises OA osteocytes (clinically, in vitro and in vivo) and provides a

rational explanation for how OA osteocytes could play a role in subchondral bone

sclerosis. The biological relevance of these results could further the effort towards

achieving the ultimate goal of finding a therapeutic cure for OA. It is acknowledged

that further investigations into the role of osteocytes in the development of OA are

needed but this thesis provides a platform to understand the direction in which this

research could be guided.

Phenotypical Changes of Osteocytes in Osteoarthritis vii

Table of Contents Keywords ..................................................................................................................................................... i

Abstract ...................................................................................................................................................... iv

List of figures ............................................................................................................................................. x

List of tables ............................................................................................................................................ xii

List of key abbreviations ........................................................................................................................ xiii

Statement of Original Authorship ............................................................................................................ xv

List of publications and presentations ....................................................................................................xvi

Acknowledgements .................................................................................................................................xix

CHAPTER 1: INTRODUCTION ........................................................................................................ 21

1.1 Research Problem ......................................................................................................................... 22

1.2 Hypothesis ..................................................................................................................................... 25

1.3 Specific goals ................................................................................................................................ 25

1.4 Thesis Structure ............................................................................................................................ 25

CHAPTER 2: LITERATURE REVIEW ............................................................................................ 27

2.1 Osteoarthritis: an introduction to the disease ............................................................................... 28

2.1.1 History ............................................................................................................................... 28

2.1.2 Epidemiology .................................................................................................................... 28

2.1.3 Pathogenesis, aetiology and symptoms ............................................................................ 28

2.1.4 Treatment and therapy ....................................................................................................... 29

2.2 Joints ............................................................................................................................................. 30

2.3 Articular Cartilage ........................................................................................................................ 30

2.3.1 Formation, structure and homeostasis of articular cartilage ............................................ 30

2.3.2 Osteoarthritis articular cartilage ........................................................................................ 32

2.4 Bone .............................................................................................................................................. 34

2.4.1 Bone Development and growth ........................................................................................ 36

2.4.2 Bone Modelling ................................................................................................................. 37

2.4.3 Bone Remodelling ............................................................................................................. 37

2.5 Osteocytes ..................................................................................................................................... 38

2.5.1 Introduction ....................................................................................................................... 38

2.5.2 Osteocyte size .................................................................................................................... 39

2.5.3 Osteocyte morphology ...................................................................................................... 39

2.5.4 Molecular markers/ drivers of osteocytes ......................................................................... 40

viii Phenotypical Changes of Osteocytes in Osteoarthritis

2.5.5 Functional role of osteocytes ............................................................................................ 42

2.5.6 In vitro models of osteocyte ............................................................................................. 45

2.6 Osteoarthritis subchondral bone .................................................................................................. 47

2.6.1 Structure and function of subchondral bone .................................................................... 47

2.6.2 Knee osteoarthritis ............................................................................................................ 47

2.6.3 Subchondral bone changes in osteoarthritis ..................................................................... 48

2.7 Inflammation and Osteoarthritis .................................................................................................. 51

2.7.1 Cytokines .......................................................................................................................... 52

2.7.2 TNFa- Structure and Response ........................................................................................ 54

2.7.3 Biological effects of TNFa ............................................................................................... 54

2.8 WNT Signalling Pathway ............................................................................................................ 55

2.8.1 General Information ......................................................................................................... 55

2.8.2 WNT β-catenin (Canonical) Pathway .............................................................................. 55

2.8.3 WNT signalling pathway in joint homeostasis ................................................................ 57

2.8.4 WNT β-catenin signalling pathway and osteoarthritis .................................................... 57

2.8.5 Osteocyte WNT signalling in bone homeostasis and osteoarthritis ................................ 59

CHAPTER 3: PHENOTYPIC CHARACTERISATION OF OSTEOARTHRITIC

OSTEOCYTES FROM THE SCLEROTIC ZONES: A POSSIBLE PATHOLOGICAL ROLE

IN SUBCHONDRAL BONE SCLEROSIS ........................................................................................ 63

3.1 Abstract ........................................................................................................................................ 64

3.2 Introduction .................................................................................................................................. 65

3.3 Materials and Methods ................................................................................................................. 66

3.4 Results .......................................................................................................................................... 71

3.5 Discussion .................................................................................................................................... 79

3.6 Conclusion .................................................................................................................................... 82

3.7 AcknowledgEments ..................................................................................................................... 82

CHAPTER 4: ALTERED OSTEOCYTE PHENOTYPE AND THE INVOLVEMENT OF

OSTEOCYTE WNT Β-CATENIN SIGNALLING PATHWAY IN A SURGICALLY INDUCED

OSTEOARTHRITIS RAT MODEL ................................................................................................... 83

4.1 Abstract ........................................................................................................................................ 84

4.2 Introduction .................................................................................................................................. 85

4.3 Materials and Methods ................................................................................................................. 87

4.4 Results .......................................................................................................................................... 92

4.5 Discussion .................................................................................................................................. 101

Phenotypical Changes of Osteocytes in Osteoarthritis ix

4.6 Conclusion .................................................................................................................................. 104

4.7 Acknowledgements ..................................................................................................................... 105

CHAPTER 5: ROLE OF OSTEOCYTE-WNT Β-CATENIN PATHWAY IN LONG-TERM,

LOW-DOSE INFLAMMATION AND ITS POTENTIAL PATHOLOGICAL ROLE IN

OSTEOARTHRITIS ............................................................................................................................ 107

5.1 Abstract ....................................................................................................................................... 108

5.2 Introduction ................................................................................................................................. 109

5.3 Materials and Methods ............................................................................................................... 110

5.4 Results ......................................................................................................................................... 115

5.5 Discussion ................................................................................................................................... 122

5.6 Conclusion .................................................................................................................................. 125

5.7 AcknoWledgements .................................................................................................................... 125

CHAPTER 6: DISCUSSION .............................................................................................................. 127

6.1 limitations ................................................................................................................................... 132

6.2 Future directions ......................................................................................................................... 133

6.3 Concluding remarks .................................................................................................................... 134

CHAPTER 7: SUPPLEMENTARY DATA ..................................................................................... 135

7.1 Subchondral bone changes in rats induced with OA for 6 months ........................................... 136

7.2 Role of osteocyte in osteoclastogenesis in a low-dose inflammatory environment .................. 138

REFERENCES ..................................................................................................................................... 140

x Phenotypical Changes of Osteocytes in Osteoarthritis

List of figures

Figure 2-1 The structure of human adult articular cartilage ................................................................... 32

Figure 2-2 Healthy and osteoarthritic tibial plateau ............................................................................... 34

Figure 2-3 Organisation of bone ............................................................................................................. 35

Figure 2-4 Stages of bone remodelling ................................................................................................... 38

Figure 2-5 Morphology of an osteocyte .................................................................................................. 40

Figure 2-6 Differentiation of osteoblast to osteocyte and proteins expressed at specific stage of

differentiation ......................................................................................................................... 41

Figure 2-7 Different zones of cartilage and subchondral bone ............................................................. 47

Figure 2-8 Pathogenic features in a normal and osteoarthritic knee joint ............................................. 50

Figure 2-9 Activated and inactivated state of WNT signalling pathway ............................................... 56

Figure 2-10 Impact of WNT β-catenin signalling on bone cells ............................................................ 60

Figure 2-11 Signalling between bone cells to maintain homeostasis ..................................................... 61

Figure 3-1 Micro-architectural and mineral properties in OA subchondral bone ................................. 74

Figure 3-2 Disrupted osteocyte morphology and distribution in OA patients ....................................... 75

Figure 3-3 Expression of osteocyte markers and the correlation to BV/TV .......................................... 77

Figure 3-4 Defective osteoclast / osteocyte TRAP expression and increased apoptosis (TUNEL

positive) in OA osteocytes ..................................................................................................... 78

Figure 3-5 Dysregulated expression of degradative enzymes ................................................................ 79

Figure 4-1Rat surgery set-up and procedure ........................................................................................... 88

Figure 4-2 Disrupted osteocyte distribution and morphology ................................................................ 94

Figure 4-3 Altered micro-architectural and mineral properties in SHAM and MSX subchondral

bone ........................................................................................................................................ 96

Figure4-4 Macroscopic images and mineral distribution of the MSX and SHAM joint 8 weeks

post surgery ............................................................................................................................ 97

Figure 4-5 Dysregulated osteocyte markers ........................................................................................... 99

Figure 4-6 Defective osteoclast, osteocyte TRAP expression and increased apoptosis ...................... 100

Figure 4-7 Dysregulated WNT β-catenin signalling proteins .............................................................. 101

Figure 5-1 Effect of TNFα on ALP activity of osteocytes/MLOY4 and osteoblast ............................ 115

Phenotypical Changes of Osteocytes in Osteoarthritis xi

Figure 5-2 Dose and time dependent effects of TNFα on osteogenesis by osteocytes ........................ 117

Figure 5-3 Conditioned media experiments: Effect of preconditioned (TNFα) osteocytes on

osteogenic differentiation of osteoblasts. ............................................................................. 119

Figure 5-4 TNFα dose and time dependent regulation of the WNT β signalling pathway .................. 121

Figure 7-1 Representative microCT reconstructions of SHAM controls and MSX rats, 2 and 6

months post medial minesectomy surgery ........................................................................... 136

Figure 7-2 Acid etched tibial bone surface (coronal section) showing morphology of osteocytes

in SHAM controls and MSX rats 6 months post surgery .................................................... 137

Figure 7-3 Effect of TNFα on MLOY4/osteocytes on RANKLgene expression ................................. 139

xii Phenotypical Changes of Osteocytes in Osteoarthritis

List of tables

Table 2-1 Major components of human bone and their overall description. ......................................... 36

Table 2-2 Five stages of bone remodelling. ........................................................................................... 37

Table 2-3 Osteocyte specific proteins, stage of expression in differentiation and their potential

function ................................................................................................................................... 41

Table 2-4 Functions of osteocytes. .......................................................................................................... 44

Table 2-5 In vitro models of osteocyte and their phenotypic characteristics ......................................... 46

Table 2-6 Why should we be interested in cytokines? ........................................................................... 52

Table 2-7 Characteristic features and categories of cytokines ............................................................... 53

Table 3-1 A list of antibodies, sources and working dilutions used for immunohistochemistry .......... 69

Table 4-1 A list of antibodies, sources and working dilutions used for immunohistochemistry .......... 91

Table 5-1 Human and mouse specific primer sequences used for real-time PCR analysis of

gene expression .................................................................................................................... 113

Table 5-2 List of antibodies, sources and working dilutions used for western blotting ...................... 114

Phenotypical Changes of Osteocytes in Osteoarthritis xiii

List of key abbreviations

ACC Articular Cartilage Chondrocyte ADAM Ts4 /5 A Disintegrin and Metalloproteinase with Thrombospondin Motifs 4/5 ALP Alkaline Phosphatase ANOVA Analysis of Variance ACLT Anterior Crucial Ligament Tare BMU Basic Multicellular Unit BMP Bone Morphogenic Protein BSA Bovine Serum Albumin cDNA Complementary Deoxyribonucleic Acid CX43 Connexin 43 DMP1 Dentin Matrix Protein 1 DNA Deoxyribonucleic Acid DAB Diaminobenzidine DMEM Dulbecco’s Modified Eagle Medium (LG: Low Glucose; HG: High

Glucose) EDAX Energy Dispersive X-Ray Analysis ECM Extra-Cellular Matrix FBS Fetal Bovine Serum FGF23 Fibroblast Growth Factor 23 FZD Frizzled GSK 3β Glycogen Synthase Kinase 3β HGF Hepatocyte Growth Factor IDG-SW3 Immortomouse/Dmp1-GFP-SW3 / Osteocyte Cell Line IGF Insulin-Like Growth Factor iBSP Integrin-Binding Sialoprotein IFN Interferon IL Interleukin LEF Lymphoid Enhancer Factor MCSF Macrophage Colony-Stimulating Factor MIF Macrophage Migration Inhibitory Factor MEPE/OF45 Matrix Extracellular Phosphoglycoprotein MMPs Matrix-Metalloproteinases MSX Medial Minesectomy MSC Mesenchymal Stem Cell mRNA Messenger Ribo Nucleic Acid MAPK Mitogen-Activated Protein Kinase

MLOY4 Murine Long Bone Osteocyte Y4 / Osteocyte Cell Line NK cells Natural Killer Cells NASAIDS Non-Steroidal Anti-Inflammatory Drug

xiv Phenotypical Changes of Osteocytes in Osteoarthritis

OA Osteoarthritis OCN Osteocalcin OS.Lac Osteocyte Lacunae OS.N Osteocyte Nucleus OPN Osteopontin OPG Osteoprotegerin OSX Osterix PTH Parathyroid Hormone PBS Phosphate Buffered Saline PHEX Phosphate Regulating Neutral Endopeptidase PDGF Platelet-Derived Growth Factor E11/GP38 Podoplanin PGE2 Prostaglandin E2 qPCR Quantitative Polymerase Chain Reaction RANKL Receptor Activator Of Nuclear Factor Kappa-B Ligand RA Rheumatoid Arthritis RNA Ribonucleic Acid RUNX2 Runt-Related Transcription Factor 2 SEM Scanning Electron Microscope SOST Sclerostin SPSS Statistical Package for the Social Sciences TRAP Tartrate-Resistant Acid Phosphatase TCF T-Cell Factor TUNEL Terminal Deoxynucleotidyl Transferase Dutp Nick End Labelling 3D Three Dimentional T cells Thymus Cells / Thymus Lymphocytes T175 Tissue Culture Flask With A Culture Area Of 175 Cm2 TGFβ Transforming Growth Factor - β TNFα Tumour Necrosis Factor TNFR1/p55/p60 Tumour Necrosis Factor Receptor 1 TNFR2/p75/P80 Tumour Necrosis Factor Receptor 2 COL1 Type 1 Collagen COL10 Type 10 Collagen COL2 Type 2 Collagen VEGF Vascular Endothelial Growth Factor WBC White Blood Cells WNT Wingless-Type MMTV Integration Site Family

QUT Verified Signature

xvi Phenotypical Changes of Osteocytes in Osteoarthritis

List of publications and presentations

Peer reviewed journal articles related to this thesis

Anjali Jaiprakash, Indira Prasadam, Jerry Feng, Ross Crawford & Yin Xiao.“Phenotypic Characterization of Osteoarthritic Osteocytes from the Sclerotic Zones: A Possible Pathological Role in Subchondral Bone Sclerosis”. International Journal of Biological Sciences, April 2012

Anjali Jaiprakash, Marie-Luise Wille, Nishant Chakravorty, Ross Crawford & Yin Xiao. “Altered osteocyte phenotype and the involvement of osteocyte WNT β-catenin signalling pathway in a surgically induced osteoarthritis rat model” Journal of Bone & Mineral Metabolism, May 2014 (Under review)

Anjali Jaiprakash, Nishant Chakravorty, Ross Crawford & Yin Xiao. “Role of osteocyte-WNT β-catenin signalling pathway in long-term, low-dose inflammation and its potential pathological role in osteoarthritis” (Manuscript under preparation)

Conference abstracts: Oral presentations, related to this thesis

Anjali Jaiprakash, Ross Crawford, Jian Q Feng and Yin Xiao. “Role of osteocytes in osteoarthritis subchondral bone remodelling and mineral metabolism” International Chinese Musculoskeletal Research Society (ICMRS) and American Society for Bone and Mineral Research (ASBMR) International Chinese Musculoskeletal Research Conference. Suzhou, China. May 21-23, 2013

Anjali Jaiprakash, Nishant Chakravorty, Ross Crawford, Jian Q Feng, and Yin Xiao “The role of osteocyte metabolism in osteoarthritis of the knee” The Prince Chrles Hospital (TPCH) Research Forum, Education Centre, The Prince Charles Hospital, Brisbane, Australia. 18th-19th Oct., 2012. Rated as the top basic/translational research abstracts and nominated for the Michael Ray Basic / Translational Research Project Award.

Yin Xiao, Anjali Jaiprakash, Ross Crawford, Jian Q Feng. “The bone in osteoarthritis.” The seventh Clare Valley bone meeting, South Australia 23-26 March, 2012 (Invited talk)

Anjali Jaiprakash, Indira Prasadam, Jerry Feng, Ross Crawford, Yin Xiao. “Role of osteocytes in bone and mineral metabolism in osteoarthritic patients.” Australian & New Zealand Bone and Mineral society (ANZBMS) Gold Coast 4-8 September, 2011

Anjali Jaiprakash, Indira Prasadam, Jerry Feng, Ross Crawford, Yin Xiao. “Altered osteocyte function in osteoarthritis: a possible pathological role in subchondral bone sclerosis.” Australian & New Zealand Orthopaedic Research Society (ANZORS), Brisbane 1-2 September, 2011.

Phenotypical Changes of Osteocytes in Osteoarthritis xvii

Conference abstracts: Poster presentations related to this thesis

Anjali Jaiprakash, Nishant Chakravorty, Ross Crawford & Yin Xiao. “Role of osteocyte Wnt/βcatenin pathway in long term, low dose inflammation and its potential pathological role in osteoarthritis.” Second Joint meeting of The International Bone and Mineral Society (IBMS) and the Japanese Society for Bone and Mineral Research (JSBMR).Nature publishing group. Kobe Japan 28 May-1 June 2013

Anjali Jaiprakash, Marie-Luise Wille, Nishant Chakravorty, Ross Crawford & Yin Xiao. “Role of Wnt/β-Catenin signaling in an in vivo model mimicking human subchondral bone and osteocyte pathophysiological changes in osteoarthritis” Second Joint meeting of The International Bone and Mineral Society (IBMS) and the Japanese Society for Bone and Mineral Research (JSBMR). Kobe Japan, 28 May-1 June 2013

Anjali Jaiprakash, Marie-Luise Wille, Nishant Chakravorty, Ross Crawford & Yin Xiao. “An in vivo model mimicking human subchondral bone and osteocyte pathophysiological changes in osteoarthirtis.” Institute of Health & Biomedical Innovation (IHBI) Inspires Postgraduate Student Conference, 22nd-23rd Nov, 2012, Gold Coast, Australia. Winner: 1st Prize ( Best Poster )

Other publications

Book chapter

Nishant Chakravorty, Anjali Jaiprakash, Saso Ivanovski & Yin Xiao. “Implant surface modifications and osseointegration.” In Li, Qing & Mai, Yiu-Wing (Ed.) Biomaterials for Implants and Scaffolds (Springer Series in Biomaterials Science and Engineering). Springer Science+Business Media, New York (approved)

Peer reviewed journal articles

Nishant Chakravorty, Stephen Hamlet, Anjali Jaiprakash, Ross Crawford, Adekunle Oloyede, Mohammed Alfarsi, Yin Xiao & Saso Ivanovski. “Pro-osteogenic topographical cues promote early activation of osteoprogenitor differentiation via enhanced TGFβ, Wnt and Notch signaling”. Clinical and Oral Implants Research, April 2013

Julia C.Young, Anjali Jaiprakash, Sridurga Mithrapabhu, Catherine Itman, Sohei Kitazawa, Kate L. Loveland. “TGFb signaling in an in vitro seminoma model”. International Journal of Andrology, March 2011.

Conference abstracts: Oral & poster presentations

Ashkan Heidarkhan Tehrani, Sanjaleena Singh, Anjali Jaiprakash & Kunle Oloyede. “Correlating flow induced shear stress and chondrocytes activity in micro-porous scaffold using computational fluid dynamics and rapid prototyping”. 23rd Annual Conference of the Australian Society for Biomaterials and Tissue Engineering (ASBTE), 22-24 April 2014, Lorne, Victoria, Australia.

Nishant Chakravorty, Anjali Jaiprakash, Ross Crawford, Adekunle Oloyede, Saso Ivanovski & Yin Xiao. “MicroRNAs - The “missing links” in molecular

xviii Phenotypical Changes of Osteocytes in Osteoarthritis

regulation of implant osseointegration? An in vitro perspective.” 22nd Annual Australasian Society of Biomaterials and Tissue Engineering in conjunction with 5th Indo-Australian Conference on Biomaterials, Implants and Tissue Engineering, 2nd -5th Apr., 2013, Weintal Barossa Hotel, Barossa Valley, Australia.

Nishant Chakravorty, Anjali Jaiprakash, Ross Crawford, Adekunle Oloyede, Saso Ivanovski, Yin Xiao. “MicroRNAs targeting non-canonical Wnt/Ca2+ pathway potentially mediate osteo-inhibitory effects of pro-inflammatory cytokines”. Australian & New Zealand Bone and Mineral Society (ANZBMS). Perth 30-31Aug, 2012.

Julia C.Young, Anjali Jaiprakash, Sridurga Mithrapabhu, Catherine Itman,, Sohei Kitazawa, Kate L. Loveland. “TGFβ signaling in an in vitro seminoma model.” Society for Reproductive Biology Annual Conference (SRB), Adelaide 22-26 August, 2009

Nishant Chakravorty, Saso Ivanovski, Stephen Hamlet, Anjali Jaiprakash, Ross Crawford, Adekunle Oloyede & Yin Xiao “Micro-structured titanium implant surfaces guide osteoprogenitor cells towards osteogenic differentiation in vitro” Mater Medical Research Institute (MMRI) Stem Cell Symposium, Brisbane 30-31 May, 2012

Julia C.Young, Anjali Jaiprakash, Sridurga Mithrapabhu, Catherine Itman, Sohei Kitazawa, Kate L. Loveland “TGFb signaling in an in vitro seminoma model” Australian Research Council, Centre of Excellence (ARC) in Biotechnology and Development Annual Scientific Meeting. Kalorama, Australia September 2009. Winner: 1st Prize ( Best Poster )

Awards and achievements

Australian Postgraduate Award (APA) (Duration: Oct 2010-Feb2014)

PhD Top up Scholarship, Institute of Health and Biomedical Innovation- (Duration: Oct 2010-Oct 2013)

Travel Grant Award - The International Bone and Mineral Society (IBMS) and the Japanese Society for Bone and Mineral Research (JSBMR). Kobe, Japan. May, 2013

The Global Medical Discovery Target Selection team chose and listed the publication titled “Phenotypic Characterization of Osteoarthritic Osteocytes from the Sclerotic Zones: A Possible Pathological Role in Subchondral Bone Sclerosis publication” in their series, as being of special interest to the drug development sector. August 2012

Travel Grant Award - Australian & New Zealand Bone and Mineral Society (ANZBMS). Perth 30-31Aug, 2012.

Best poster award IHBI Inspires Postgraduate Student Conference November, 2012 (Cash prize 500 AUD).

Best Poster Award - Medical device domain - Dec 2012 (cash prize 500 AUD)

Best Poster Award - Australian Research Council, Centre of Excellence (ARC)-Aug 2009 (Cash prize 1000 AUD).

Best Project Award - Bangalore University - NMKRV College –March, 2005.

Phenotypical Changes of Osteocytes in Osteoarthritis xix

Acknowledgements

Although my PhD has been stimulating, motivating and filled with fun, I have

had my share of challenging days. Very normal for a long journey. In the words of

Winston Churchill, “We Shall Fight on the Beaches” and these words encapsulate the

very spirit I needed to complete this PhD (Dramatic, but I like it!).

This journey has taught me patience, redefined motivation, taught me that long

term goals and dreams are great but if you focus too far in front of you, you may not

see the shiny thing in the corner of your eyes. So, passionate dedication to the

pursuits of short term goals is very important. At the end (almost) of this journey, I

have this sense of importance and achievement! This is a pretty cool feeling!

Obviously, this would not have been possible without awesome people who

helped me bring everything (at least, most things) into perspective.

Professor Yin Xiao, Thank you for this opportunity and constant support. I have

great respect for your enthusiasm and way of life which is very motivating and

enjoyable.

Professor Ross Crawford, my mentor, my scientific and philosophical navigator in

the pursuit of answering any question. Thank you!

Nishant, thank you for helping me throughout my project. We have had great fun

with our crazy ideas and ways of working in the lab. I will cherish those moments

forever! I wish you the best.

A/Professor Travis Klein and A/Professor Maria Woodruff, Thank you for your

friendship. You guys have been my go-to people , big thank you! for helping me put

my research ideas into action and keeping me grounded at the same time.

Michelle Maynard and Alex for editing my thesis. I am sure it was a task! But hey,

you guys learnt something new!

Karsten, our conversations have been thought-provoking. Thank you for asking

many questions and keeping it interesting.

Loui, I have enjoyed our high calorie diets and hours of candy crushing! Thank you

for your friendship and helping me with all my microCT needs at crazy hours!

xx Phenotypical Changes of Osteocytes in Osteoarthritis

Parisa and Emma - I have laughed and danced a lot with you guys. Lots more to

come.

Anna, I really miss u. Your comments on our experimental set up was always

helpful.

Caroline, my all-tech supporter. You made it easy to move from 32kb to

45,000kb.Thank you for always being there and keeping me grounded.

Pelin, Thank you for checking on me everyday. You have pampered me with hugs,

the most awesome tea and desserts.

Keith, we have shared a love-hate relationship at work but its with net love feeling ;).

Thank you for helping me image some awesome knee joints.

Laure, Flavia & Fabio, Boris & Nina, Toby & Tobi, Giles, Thor, Vaida, Natalie,

Verena, Lance, Shirly, Kris, Pingping and Xufeng.You guys have been great friends

and we have had many wonderful times and shared some intense conversations. You

guys made my life at IHBI very interesting and fun!

Pavan, u have been like a perfect younger brother to me. And FYI, your jokes are

not that funny.

Kashyaps, thank you for pampering me all the time.

Yash, thank you for your unconditional love, support and immense patience

throughout this journey.

I never find the right way to express my deepest gratitude to my family. Without you

all, especially Ma and Baba, I would be lost. I hope the work in this thesis justifies in

some small way the significant sacrifices you all have made on my behalf. My

Finally, I would like to thank god, supreme power, for my beautiful world and life.

Chapter 1 Introduction 21

Chapter 1: Introduction

22 Chapter 1 Introduction

1.1 RESEARCH PROBLEM

Osteoarthritis (OA) is one of the most common and oldest known

musculoskeletal disorders, affecting more than 100 million individuals worldwide,

representing a major health burden to society [6]. OA is a result of both mechanical

and biological events that destabilise the normal coupling of degradation and

synthesis of articular cartilage chondrocytes (ACCs), extracellular matrix (ECM) and

subchondral bone. Although mechanical and biological events may be initiated by

multiple factors, (including genetic, developmental, metabolic and traumatic) OA

involves all tissues of the diathrodial joint associated with inflammation [7].

Research into the aetiology of OA has mainly concentrated on the destruction of

articular cartilage as the damage is clearly visible. In the course of OA development,

ACCs undergo typical phenotypic changes characterised by the expression of

hypertrophic differentiation markers, leading to irreversible cartilage degeneration.

However, recently, several studies have shown that subchondral bone sclerosis plays

an important role in the initiation and progression of OA [8, 9].

The subchondral bone consists of three types of bone cells; osteoblasts,

osteoclasts and osteocytes. Subchondral bone sclerosis is a well recognised

manifestation of human OA, however, the mechanisms responsible for this are

unknown [10]. The subchondral bone in OA shows signs of abnormal mineral

density and enhanced production of bone turnover markers, indicative of osteoblast

dysfunction [8, 11]. Osteoclasts are the cells that degrade bone to initiate normal

bone remodelling, and mediate bone loss in pathologic conditions by increasing their

resorptive activity [12]. With enormous knowledge/research available for osteoblasts

and osteoclasts and their role in bone function and OA, it is now time to focus on

osteocytes, as research in the last decade shows evidence that these cells are

dynamic, have multiple functions and are vital for bone homeostasis [13, 14].

Osteocytes represent 95 percent of all bone cells. These cells are terminally

differentiated osteoblasts that occupy the lacunar space and are surrounded by the

bone matrix. They possess cytoplasmic dendrites that form a canalicular network for

communication between bone cells [15]. The role of osteocytes has remained

unknown for a long time and has historically been underestimated [16]. Over the past

10 years many publications have aimed to highlight the role of these cells in


homeostasis and various bone dysplasias. Where osteoclasts, osteoblasts and lining

cells are present at the bone surface, osteocytes are distinctive and isolated cells that

are embedded within the bone matrix [15]. The difficulty in isolating these cells

within the bone matrix may explain one of the initial reasons behind why they were

ignored for so long. Recent advances in bone biology have revealed that osteocytes

cells play multiple functions in regulation of bone mineral density, cell

differentiation and bone matrix composition, as well as act as an endocrine cell [14].

It is now evident that osteocytes play a central role in the maintenance of bone matrix

homeostasis via their unique morphology and their canalicular cell network [14, 15,

17].

Substantial changes in the cartilage and subchondral bone associated with low-

dose inflammation are common in most of the patients suffering from OA [18, 19].

Much knowledge about the cartilage and bone structural changes are already known,

but as yet, researchers have had little success in elucidating the pathogenesis of OA.

The changes of the bone and cartilage in OA of the knee are more common in the

medial compartment. As the subchondral bone and cartilage changes are

synchronised, this indicates that the change in the cartilage are linked to the change

in the bone during the development of OA. In certain animal models, synchronised

changes in the subchondral bone and cartilage were observed during disease

development [20]. It was also proposed that subchondral bone sclerosis precedes and

contributes to cartilage damage [21]. However, a significant knowledge gap exists in

understanding the role of osteocytes and the extent of their changes and their

implications under normal and OA disease conditions. Therefore a new overall

working hypothesis is necessary to better understand the stages involved in the

progression of OA with respect to osteocytes.

An increased number of migratory inflammatory cells and the substances

secreted by them have been recognised in the OA joint tissues. This is not as

prominent as in the case of rheumatoid arthritis, which is clearly an autoimmune

disease, but enough to raise the question if inflammation also plays a role in the

development OA. Secreted inflammatory molecules, such as proinflammatory

cytokines like TNFα and IL-1β, are among the critical mediators of the disturbed

processes implicated in OA pathophysiology, making them prime targets for

therapeutic strategies [22]. A few clinical studies have investigated the efficacy of

24 Chapter 1 Introduction

blocking these proinflammatory cytokines in the treatment of OA in humans [23].

Animal studies also provide evidence that it could be beneficial to slow the

progression of OA [24]. To date, the mechanisms theat control the blocking of

proinflammatory cytokines are unexplored and debatable[4]. Low-grade

inflammation is detected in OA, it is viewed as a secondary phenomenon related to

the destruction of cartilage [25]. Therefore, it would be of significant interest to test

the effect of low-dose inflammation on osteocytes and how these changes could play

a potential role in the degeneration of the subchondral bone in OA.

The exact molecular mechanisms involved in the control of osteocytes in

homeostasis and diseases like OA are yet to be investigated. Fully differentiated cells

maintain their specialised character through signalling pathways, and amongst these

signalling factors, secreted proteins from WNT β-catenin pathways are reported to

regulate many critical fundamental biological factors [26]. The role of the WNT in

bone formation and remodelling has been reviewed for over half a decade and its role

in OA has been emphasised [27]. More recently, the osteocyte-WNT β-catenin

pathway has been shown to be a major signalling pathway required for

mechanotransduction in bone in vivo [28]. It is also critical for normal bone

homeostasis [29]. Given the importance of the WNT β-catenin pathway in cartilage

and bone biology, and more specifically in osteocyte biology, the decision was made

to investigate whether this pathway would play a role in the osteocyte OA

pathophysiology.

Driven by these issues, the overall aim of this thesis was to evaluate the

subchondral bone and mineral changes and address the question of how the most

abundant and longest lived bone cell type, “osteocyte”, changes in the pathology of

OA. In order to accomplish this, subchondral bone and osteocytes were characterised

in human OA samples. A clinically relevant in vivo model was established and the

role of the osteocyte-WNT β-catenin pathway was defined. Various in vitro culture

and co-culture models were set up to test the effect of low-dose inflammation on

osteocytes to study their role in subchondral bone sclerosis.


1.2 HYPOTHESIS

Osteocyte phenotypic changes play a role in OA subchondral bone sclerosis.

1.3 SPECIFIC GOALS

The specific aims of this thesis are summarized below

1. Study the subchondral bone and osteocyte changes in the development of OA in

bone collected from human OA joints (Chapter 3)

2. Establish a clinically relevant small animal model to study the progression of

subchondral bone, mineral and bone remodelling changes in OA (Chapter 4)

3. Investigate the role of low-dose long-term inflammation (TNFα) on osteocytes

(Chapter 5)

4. Investigate the role of the osteocyte WNT β-catenin pathway in the pathogenesis

of OA (Chapter 4 & 5)

1.4 THESIS STRUCTURE

This thesis consists of 7 chapters. The current chapter is a brief introduction,

discussing the research problem, stating the hypothesis and summarising the main

aims of the study. Chapter 2 provides a comprehensive literature review of the

current understandings of the topics investigated (OA, subchondral bone, osteocytes

and the WNT β-catenin signalling pathway). Chapter 3 is a published study

characterising the OA osteocytes from sclerotic zones to study their pathological role

in subchondral bone sclerosis. Chapter 4 is a recently submitted study involving the

establishment of a clinically relevant animal model. It investigates the focal mineral

and osteocyte changes and the involvement of the osteocyte-WNT β-catenin

signalling pathway in a surgically induced OA rat model (medial menisectomy).

Chapter 5 investigates the role of the osteocyte-WNT β-catenin pathway in long

term, low-dose inflammation and its potential pathological role in OA. Chapter 6

draws conclusions and discusses the studies in the preceding chapters to demonstrate

novel additions to our understanding of the aetiology of OA and osteocyte biology.

Limitations of this study and suggestions for future directions are discussed.Chapter

7 presents supplementary data and some interesting images of the osteocyte network.

Chapter 2 Literature Review 27

Chapter 2: Literature Review

28 Chapter 2 Literature Review

2.1 OSTEOARTHRITIS: AN INTRODUCTION TO THE DISEASE

2.1.1 History

Osteoarthritis (OA) is the planet’s oldest known disease found in the skeletons

of dinosaurs (50-70 million years old), Egyptian mummies and in ancient skeletons

found in England [30, 31]. In man, OA was found in different joints, however the

frequency of affected knee joints was relatively less than observed in more recent

times and this could probably be the consequence of modern factors and lifestyle.

Despite its existence and early reference by Hippocrates (460-375 BC), clinicians did

not formally recognise OA until the 18th century [30]. OA was originally grouped

together with rheumatoid arthritis until the early 19th century; this created confusion

in nomenclature and led to the delay in the recognition of the disease. In 1859 Alfred

Baring Garrod separated the two diseases and proposed the name rheumatoid

arthritis. John Kent Spender later introduced the term OA while in 1904, Joel E

Goldthwait clearly differentiated the two diseases that were later confirmed by others

in the field. Debate on the nomenclature of OA still continues to date. This is due to

limited understanding of synovitis (synovial inflammation), and the aetiology of OA

[32].

2.1.2 Epidemiology

OA is the most common debilitating condition now accepted as a major

public health problem (World Health Organisation). The prevalence of OA increases

with age and is higher in women than in men, especially among the elderly. OA

affects more than 1.6 million people in Australia and is a major cause of disability,

psychological distress and poor quality of life. The total cost impact of OA in

Australia was estimated to be almost $10.6 billion in 2007 and the prevalence of OA

is projected to increase to 3.1 million people by 2040. This is driven by a range of

factors including ageing of population and increasing rates of obesity (AIHW 2010).

2.1.3 Pathogenesis, aetiology and symptoms

OA is defined by the American College of Rheumatology as:

“Heterogeneous group of conditions that lead to joint symptoms and signs which are

associated with defective integrity of articular cartilage, in addition to related

changes in the underlying bone at the joint margins”.


OA of the knee is an incurable and debilitating musculoskeletal disorder of the entire

joint. As OA progresses over decades, patients are asymptomatic in the early stages

despite significant irreversible changes to bone structure. OA is the degeneration of

articular cartilage, that serves as a "cushion" between the bones of the joint; together

with changes in the subchondral bone [33]. Imbalance in this adaptation of the

cartilage and bone is a result of various factors disturbing the physiological

relationship between these tissues and contributes to the symptoms of OA. This

includes pain, mild inflammation and joint stiffness [34]. The aetiology of OA is

largely unknown and is multi-factorial with inflammatory, metabolic and mechanical

causes leading to a common end stage. The risk factors that increase a person’s

chance of developing OA include genetic factors, obesity, injury, joint overuse and

other diseases.

2.1.4 Treatment and therapy

At present, there is no cure for OA. The principal treatment objectives are to

control pain adequately, improve function and reduce disability [33]. Early detection

and management of OA can help reduce long-term damage; however, patients most

often notice symptoms of pain and discomfort at the later or end stage of OA

development. At present, the goal of every treatment for arthritis is to reduce pain

and stiffness, allow for greater mobility and slow the progression of the

disease. Non-Steroidal Anti Inflammatory Drugs (NSAIDS) and analgesics are used

as symptomatic treatment to reduce inflammation and pain [35-37]. Glucosamine

sulphate (GS) and chondroitin sulphate (CS) are derivatives of glycosaminoglycans

found in articular cartilage. Some patients report the effectiveness of this analgesic

for the relief of pain in OA [38-40]. Some studies with varying levels of evidence

suggest that sodium hyaluronan, doxycycline, matrix metalloproteinase (MMP)

inhibitors, bisphosphonates, calcitonin, diacerein, cyclo-oxygenase 2 specific

inhibitors (CSIs) and avocado-soybean unsaponifiables may modify disease

progression [41, 42]. The OARSI OA treatment guidelines provide useful list of

interventions that have been proved to be effective in improving OA pain. It also

provides Non-pharmacological management strategies include education and

intervention, weight loss, exercise, physiotherapy and mechanical aids [43]. In the

event that non-surgical therapies fail and joint degeneration advances, joint

prosthesis surgery is required.


2.2 JOINTS

Joints are areas where two bones meet. There are three different types of joints

classified by the degree of movement. These are: Synarthroses - immovable joints

like skull bones and the distal tibiofibular joint; Amphiarthroses - slightly moveable

joints like the vertebrae, and Diarthroses /diathrodial joints that are freely movable.

They have numerous components including synovium, synovial fluid, capsule,

hyaline cartilage and bone. Together, these components work in a synchronised

manner to facilitate movements of the body. Muscles and bones are connected via

tendons and ligaments stabilising the joint. To minimise friction, lining cells of the

synovial membrane secrete synovial fluid that acts as a lubricating and nourishing

fluid. Articular cartilage provides a smooth surface that allows easy movement with

minimal friction and wear. Mechanical support during loading is provided by

subchondral and cancellous bone (located below the cartilage). The cartilage and the

bone tissues have distinct properties that are both mechanical and biochemical [44,

45] .

2.3 ARTICULAR CARTILAGE

Cartilage is a tough yet flexible, highly specialised connective tissue that

covers joints in the body. It has distinct biochemical and mechanical properties to

maintain joint structure and allow for smooth, friction free movement. Figure 2-1

shows the structure of human adult articular cartilage.

2.3.1 Formation, structure and homeostasis of articular cartilage

Mesenchymal stem cells that reside in the bone marrow differentiate into

chondrogenic, myogenic and osteogenic lineages under specific environmental cues’

that determine the differentiation of cartilage centrally, muscle peripherally, and

bone [46]. The surrounding tissues, particularly the epithelium, influence the

differentiation of mesenchymal progenitor cells to chondrocytes in cartilage

anlagen[46]. This process can be divided into two phases. During the first phase,

mesenchymal stem cells condense and undergo chondrogenic differentiation. In the

second phase, a cartilaginous interzone appears, specifying the joint structure [47,

48]. As development continues the interzone becomes a clearly distinguishable three-

zoned structure. While articular cartilage primarily is composed of water, the solid


fraction predominantly consists of collagen fibers, aggrecan and other proteoglycans.

The ultrastructure of articular cartilage can be divided into different zones where the

functional properties of chondrocytes and the composition of ECM is different [49].

Articular cartilage is avascular; therefore the chondrocytes get nourished by diffusion

from the synovial fluid and the vasculature of the subchondral bone. As shown in

Figure 2-1 growth plate closure is shown as the “tidemark”, below which the

calcified zone exists. The calcified zone serves as an important buffer between the

non-calcified cartilage and the subchondral bone. These different layers have been

thought to arise as a consequence of their adaptation to different mechanical and

structural needs.

Chondrocytes maintain active membrane transport for the exchange of cations,

including Na+, K+, Ca2+ and H+, whose intracellular concentrations fluctuate with

load and composition changes of the cartilage matrix. Chondrocytes adapt to low

oxygen tension by expressing angiogenic factors like VEGF [46]. They also express

a number of a genes associated with anabolism and chondrocyte differentiation [19].

In contrast to the differentiating chondrocytes, ACCs also express SMAD1,

preventing progression towards endochondral ossification [50]. Several other factors

important for chondrogenesis also play critical roles in articular cartilage

homeostasis, particularly in supporting matrix metabolism. Of these, TGF-β and

BMPs have been the most widely investigated [19].

The WNT signalling pathway has also been implicated in regulating

chondrogenesis and hypertrophic maturation of chondrocytes [51, 52] . Chondrocytes

are capable of responding to mechanical forces and structural changes in the

surrounding cartilage matrix, as well as intrinsic and extrinsic growth factors,

cytokines and other inflammatory mediators [34]. All these factors regulate discrete

steps in chondrogenesis, in a synchronised manner, to maintain cartilage structure

and homeostasis.


Figure 2-1 The structure of human adult articular cartilage

This figure shows the zones of cellular distribution and the superficial, middle, and deep regions of

matrix organization. It also shows the relative diameters and orientations of collagen fibrils in the

different zones. The positions of the tidemark and subchondral bone also are noted. (Adapted from

[53]).

2.3.2 Osteoarthritis articular cartilage

Articular cartilage has remarkable durability. However, this tissue can be

damaged by trauma or inflammatory processes that may cause a multitude of skeletal

malformation syndromes as well as degradative diseases such as OA. In the early

stages, OA typically manifests as fibrillations of the articular cartilage surface, and

progressively degenerates the tissue at greater depths from the surface [54]. Early


indications of OA in the superficial zone include a reduction in the proteoglycans

content and a transition in the collagen orientation from parallel to the bone surface

to become randomly orientated [55]. In advanced cases, the articular cartilage may

be completely worn out, exposing the subchondral bone. The molecular composition

and organisation of arthritic articular cartilage (shown in Figure 2-1), leading to a

deterioration in the material properties and structural integrity of the articular surface

and underlying hyaline cartilage. In OA of the knee, the medial compartment is more

commonly affected than the lateral compartment. This is thought to be because the

medial compartment is more susceptible to weight bearing loads compared to the

lateral compartment [56, 57]. This phenomenon is directly associated with cartilage

damage and degradation as can be seen in Figure 2-2.

Given chondrocytes are the unique cellular component of adult articular

cartilage; scientists have typically focused on the role of chondrocytes in the

pathogenesis of these alterations. These cells are capable of responding to

mechanical forces and structural changes in the surrounding cartilage matrix, as well

as intrinsic and extrinsic growth factors, cytokines and other inflammatory mediators

[34]. A characteristic feature of chondrocytes in the progression of OA is clustering.

This is the result of increased cell proliferation and general upregulation of synthetic

activity associated with an increased production of specific ECM proteins.

Chondrocytes also express certain terminal differentiation markers (COL10, ALP,

OPN) suggesting that OA chondrocytes are differentiating towards an hypertropic

phenotype or matured phenotypic state [58, 59]. Further, the production of COL1 and

COL2 suggests the dedifferentiation process of chondrocytes [60]. This leads to the

production of degradative proteinase genes like MMPs and ADAMs. These changes

lead to gradual loss of proteoglycans followed by ECM degradation. Extensive

cellular changes are also accompanied by increased expression of regulatory

proteins. These cellular changes are accompanied by fibrillation of the cartilage

surface and localised production of fibrocartilage [61]. There are a number of genes

reported to be associated with the degradation of cartilage in the progression of OA.

Various studies have also shown the activation of the WNT signalling and MAPK

pathways in OA patients and in OA animal models [62, 63]. There is also a

continued debate as to whether BMP genes are up or down regulated in the

progression of OA [19, 46].


Figure 2-2 Healthy and osteoarthritic tibial plateau

Translucent, white, healthy cartilage (left panel). Degraded cartilage (right panel), more degradation is

observed in the medial compartment. From Jeon et al. 2010, [64].

2.4 BONE

An adult human skeleton contains 206 bones. Bone is a highly organised and a

dynamic tissue. The functions of bone are to provide mechanical support for soft

tissues; act as levers for muscle action; protect the central nervous system. Bone also

releases calcium and other ions for the maintenance of a constant ionic environment

in the extracellular fluid, and support haematopoiesis. There are two types of bone at

the microscopic level, woven bone and lamellar bone. Woven bone is also known as

immature bone, young bone or osteoid bone. It is found in the embryo, new born and

growth plate in adults. Similar types of woven bone are also found in pathological

conditions such as osteogenesis imperfecta and Paget disease. Woven bone has more

cells per unit area and its mineral content varies. It is cross-fibered and contains no

uniform orientation of collagen fibers. Research shows that the mechanical behaviour

of this bone is the same regardless of its orientation of applied force [65, 66].

Lamellar bone is mature bone and its collagen fibers are highly organised to

withstand strain and stress and to give it anisotropic properties. The mechanical

properties of lamellar bone depend and differ on the orientation of force applied,

with its greatest strength parallel to the longitudinal axis of the collagen fibers.

Lamellar bone is structurally organised into trabecular bone (spongy or cancellous)

and cortical bone (dense or compact), based on the porosity and unit microstructure

of the bone. The bone tissue consists of concentrical (compact bones) or parallel

(spongy bones) organised lamellae of collagen fibers. In compact bones, the

concentrically arranged lamellae surround a central channel that contains blood

vessels and nerve fibres (Haversian canal). Perpendicular to this system runs the


Volkmann’s canals that provide inter-connections between the inner and outer layers

of the bone. The organisation of bone is shown in Figure 2-3. At the molecular level,

bone forms a perfect modulation of arranged apatite crystal arrangement and at the

organ level, it has a trabecular network to withstand strain. Bone is composed of an

organic and inorganic phase. The principle component of the organic phase is

Collagen 1 (COL1). Collagen is laid in a complex pattern to provide strength to

bones. The other components of bone are listed in table Table 2-1. Over the past two

decades, research has lead to a greater understanding of the production of the ECM at

the cellular level. ECM consists of mineral, collagen, water, non-collagenous

proteins and lipids[66, 67].

Bone undergoes continuous destruction, called resorption, and formation by

the three cells of the bone: osteoclasts, osteoblasts and osteocytes. In the adult

skeleton, bone formation and bone resorption (known as bone remodelling) are in

balance, maintaining a constant homeostatically controlled amount of bone.

Figure 2-3 Organisation of bone

1. periosteum, 2. medullary canal containing marrow, 3. compact bone, 4. cancellous bone, 5.

Haversian system, 6. osteocyte, 7. Haversian canal, 8.Volkmann’s canal, 9.Osteocyte, 10. Cannaculi

11. Lacunae . (Adapted from the source: http://www.merriam-webster.com/art/med/bone.htm)


Table 2-1 Major components of human bone and their overall description

(Adapted from [68])

Bone components

Sub components description

Inorganic phase

HA= Ca (PO ) (OH)

10 4 6 2 50% of bone, rigidity, salt and calcium storage

Organic phase

Col I Serves as nucleation sites for the deposition of mineral components (HA), responsible for tensile strength (85%-90%)

Growth factors IGF, TGFβ, FGF, PDGF, HGF

Glycosaminoglycans Chondroitin sulphate, dermatan sulphate, keratin sulphate, hyaluronic acid (located pericellular osteocytes)

OPN Synthesised by pre-osteoblasts, osteoblasts, osteocytes, bone marrow cells, high affinity to calcium, binding sites for integrin receptors throughout an RGD motif, important protein for matrix-cell-interaction, attachment of osteoclasts & cancer cells

ON Secreted by osteoblasts, binding collagen & calcium, initiating mineralisation, promoting mineral crystal formation, increases production & activity of MMPs Functions of ON beneficial to tumour cells: angiogenesis, proliferation, migration

OC Secreted by osteoblasts, mineralisation & calcium homeostasis, bone gla- protein, mineral–binding ECM protein

BSP 8% of non-collagenous ECM, maybe nucleus for the formation of the first apatite crystals, inhibit crystal growth & MMP2 activation and angiogenesis, regulation of tumour growth in bone, cell attachment protein, enhances osteoblast differentiation & mineralisation

Cells Osteoblasts Located on the surface of an osteoid seam, producing a protein mix called osteoid high activity of alkaline phosphatase, responsible for matrix mineralisation

Osteocytes 90% of bone cells. Originated from osteoblasts, become trapped & embedded in the matrix they produce themselves, space they occupy is known as lacunae. Orchestrates bone remodelling, matrix maintenance, calcium homeostasis, mechano-sensory receptors (regulation of the bone’s response to stress and mechanical load)

Osteoclasts Responsible for bone resorption, large multinucleated cells on the bone surface forming resorption pits, so called Howship lacunae, bone resorption through enzymes such as the tartrate resistant phosphatase (TRAP)

2.4.1 Bone Development and growth

Bone formation begins during prenatal development and continues

throughout adulthood. Osteogenesis or bone formation occurs through two processes.

(1) Intramembranous ossification: the process by which flat bones are formed,


involving the replacement of connective tissue membrane sheets with bone tissue

occurring without a cartilage template. (2) Endochondral ossification: this process

involves the replacement of the avascular cartilage template with bone tissue (e.g-

femur, tibia). It is an essential process during the rudimentary formation of long

bones This takes place in the growth plate, a specialised cartilaginous structure

located in the area between epiphysis and the diaphysis of infants and adolescents

[69].

2.4.2 Bone Modelling

Modelling is a process where bone formation and bone resorption occurs on

separate surfaces and is not coupled. It is through this process that skeletal mass and

structure is defined during birth to adulthood [65].

2.4.3 Bone Remodelling

Bone is a dynamic tissue and is continually renewed. Bone cells that are

derived from different progenitor pools are under distinct molecular control

mechanisms. Bone cells form temporary anatomical structures called basic

multicellular units (BMU) that execute bone formation and bone remodelling. This is

essential in maintaining bone homeostasis / bone mass and skeletal micro-

architecture . This process involves the coupling of bone formation and bone

resorption [65]. Bone remodelling involves 5 stages and they are explained in Table

2-2 and Figure 2-4.

Table 2-2 Five stages of bone remodelling

(Adapted from [68, 70])

Five stages Stage description

Activation Preosteoclasts are stimulated and differentiate under

the influence of cytokines and growth factors into

mature active osteoclasts

Resorption Osteoclasts digest mineral matrix (old bone)

Reversal Formation of cement line. End of resorption

Formation Osteoblasts synthesize new bone matrix

Quiescence Osteoblasts become resting bone lining cells on the

newly formed bone surface


Figure 2-4 Stages of bone remodelling

1. Resting state; 2. Resorption; 3.Reversal; 4.Formation; 5. Mineralisation; 6.Resting state

2.5 OSTEOCYTES

Microscopically, bone has three characteristic cell types: osteoblasts,

osteocytes, and osteoclasts. The overall functions of these are listed in Table 2-1.

The core focus area of this thesis is upon osteocytes which constitute over 90% of the

bone cells that are embedded in the bone matrix.

2.5.1 Introduction

The main cellular component of the mammalian bone is the osteocyte.

Osteocytes represent more than 90% of all the bone cells (20,000 to 80,000

cells/mm3 of bone tissue). There are approximately 20-fold more osteocytes than

osteoblasts in bone [71, 72]. Osteocyte density has been evaluated at 31,900 and

93,200 cells/mm3 in bovine and murine bone respectively [73]. In human bone, the

average half life of osteocytes is postulated to be 25 years [74]. However as bone

remodeling is of 4% to 10% per year [75], the expected duration of the life of an

osteocyte is difficult to determine and is unlikely to be this long. The life duration of


osteocytes is higher than that of osteoblasts, which is an estimated 3 months in

human bone [75] and 10– 20 days in murine woven bone [76].

2.5.2 Osteocyte size

The size of osteocytes varies between species [73]. The relative size of the

lacunae and canalliculi dictate the degree of fluid flow and the maximum size of

particles that might migrate through the system extracellularly. The dimensions of

murine osteocyte lacuna is in the range of 5μm by 20μm [74] with a gap present

between the cell and the lacuna wall. Similarly, the cytoplasmic processes are

approximately half the diameter of the canalliculi (canalliculi range between 50nm

and 100 nm in diameter) [74] leaving a gap sufficient for two processes to lie side by

side at points of gap junctional communication. In humans, osteocytes are

approximately 9μm in the short axis by 20μm in the long axis [77]. It has been noted,

that a mesh of extracellular material, primarily proteoglycans, are present in at least

some volumes of canaliculi and might assist in the amplification of fluid flow driven

mechanical signals [75]. The exact location of the mechanosensor in these cells is

still to be determined but the presence of a primary (non-motile) cilium on osteocytes

has been reported and they are known to sense mechanical stimuli in other cell types

[76].

2.5.3 Osteocyte morphology

Osteocytes have a very unique dendritic morphology, while their cell body

has a fusiform shape in long bones or a rounded shape in flat bones [77]. Osteocytes

are localised in an osteocytic lacuna and are buried in the matrix [15]. The dendrites

extend into channels in the matrix, these channels are called canalliculi. Osteocytes

communicate with each other and with the cells at the surface of the bone tissue via

these dendrites (Figure 2-5). Recent research shows that osteocytes could

communicate through gap junctions [78]. The lacuno-canalicular system constitutes

a molecular exchange surface area. The extracellular fluid in the lacunar-canalicular

space is believed to be able to stimulate osteocytes by mechanical loading-induced

fluid flow shear stress [79]. Their special morphology implies multiple potential

roles such as mechanosensors and communicators. Thus, bone cells form a functional

network (well organised in cortical bone and disorganised in woven or immature

bone) within which, cells at all stages of bone formation from preosteoblast to

mature osteocytes remain connected. It is considered that the morphology of


osteocytes alter in various disease processes [80, 81]. However, these changes have

still not been visualised nor quantified adequately [80].

Figure 2-5 Morphology of an osteocyte

The Scanning Electron Microscopy image shows an osteocyte and its structure from an acid etched

human tibial bone surface – Coloured using Adobe Photoshop.

2.5.4 Molecular markers/ drivers of osteocytes

It is well accepted that osteocytes are derived from osteoblasts [71, 82]. Osteocyte

specific proteins are expressed when osteoblasts stop actively producing the bone

matrix and become embedded in their own osteoid where they differentiate into

osteocytes [79]. Functional studies have been conducted recently on a few osteocyte

specific proteins. With results indicating that E11/gp38 (Podoplanin) is expressed

most highly in the newly embedded osteocytes [83, 84]. It is inferred that E11/gp38

may be important for osteocyte dendrite formation since it is also expressed on other

dendritic cells. E11 is also known to be highly expressed in woven/young bone

compared to mature bone. The functions of DMP1(Dentin Matrix Protein 1), PHEX

(Phosphate Regulating Endopeptidase Homolog, X-linked) and MEPE (Matrix

Extracellular Phosphoglycoprotein) are related to phosphate homeostasis and mineral

metabolism [85, 86]. SOST (Sclerostin) is expressed by mature osteocytes and


functions as an osteoblast inhibitor/negative regulator of bone formation/WNT

inhibitor [87].

Based on a few functional studies and morphological observations, osteocyte

specific proteins are expressed when osteoblasts differentiate into osteocytes as

depicted in Figure 2-6.

Figure 2-6 Differentiation of osteoblast to osteocyte and proteins expressed at specific stage of

differentiation

Osteocyte proteins and their associated functions are listed in Table 2-3.

Various signalling pathways like WNT and TGFβ have been implicated in the tight

regulation of osteocytes to maintain bone homeostasis. However, the mechanisms

and implications are still unclear [14].

Table 2-3 Osteocyte specific proteins, stage of expression in differentiation and their potential

function

Protein Expression Potential function

E11/gp38 Immature osteocytes/newly

embedded Dendrite formation

PHEX, MEPE Immature and mature

osteocytes Phosphate homeostasis

DMP1 Immature and mature

osteocytes Phosphate homeostasis and

regulator of bone mineralisation

SOST Mature osteocytes/deeply

embedded Osteoblast

inhibitor/Inhibitor of bone formation


2.5.5 Functional role of osteocytes

Control of bone formation and bone resorption

Discoveries in recent years have confirmed the idea of osteocytes from being

passive metabolically inactive cells to endocrine cells and orchestrators of bone

remodelling. Research suggests that osteocytes are related to bone resorbing

osteoclasts, can resorb mineralized bone matrix and also play a vital role in

regulating bone formation. Osteocytes are now known and scientifically confirmed to

be the orchestrators of bone (re)modelling, this having been a concept in existence

for sometime [88]. The overall functions have been tabulated in Table 2-4.

Function of osteocytes in regulating bone resorption

Bone resorption has different functions that include, removal of calcified

cartilage during bone growth, maintaing mineral metabolism, and assisting in bone

modeling during growth or adaptation. Osteoclasts are relatively short lived and they

are generated continuously at sites of bone resorption. The idea that osteocytes play a

role in bone remodelling has existed for many decades and was suggested

approximately 100 years ago [89]. However, it was only recently in 2007 that the

osteocyte functional evidence was provided by Tatsumi et al [90]. Various other

researchers have since added to this knowledge using transgenic mice [91] .

Osteocytes express RANKL and when RANKL is deleted in mice osteocytes, they

have increased bone mass. These results demonstrate that RANKL is expressed 10-

fold more in osteocytes compared to osteoblasts and are better promoters/supporters

of bone formation [92]. Experiments conducted by Wysolmerski et al shows

lactation induces osteocytic lacunar and canalicular enlargement that returns to virgin

levels post lactation [89, 93, 94]. We can then infer that osteocyte perilacunar matrix

acts a source of calcium in a calcium demanding condition. In this study, the width,

lacunar size and lacunar area were significantly increased in the trabacular bone of

the lactating mice. Further, gene expression data revealed that osteocytes expressed

cathapsin K and showed TRAP activity necessary for bone resorption. Therefore

osteocytes use some of the mechanisms used by osteoclasts to remove bone matrix

and osteocyte perilacunar matrix [93] .


Function of osteocytes in regulating bone formation

The discovery of sclerostin (WNT inhibitor) in 2001 as a product of

osteocytes provided the first functional evidence that osteocytes could control the

differentiation and activity of osteoblasts and also play a role in bone formation [95,

96]. Further to Wysolmerski’s experiments as explained; post weening, the osteocyte

perilacunar membrane returns to its normal form suggesting that osteocytes replace

the perilacunar membrane [89, 93]. Further evidence shows that isolated

preosteocytes can partially dedifferentiate into matrix producing osteoblasts and

express genes required for bone formation [97]. This suggests that osteocytes can act

as a source of matrix bone forming osteoblasts.

Together, osteocytes play a role in bone formation and mineralisation. As promoters

of mineralisation they secrete proteins such as Dmp1 and Phex. As inhibitors of

mineralisation and bone formation proteins such as SOST/sclerostin and

MEPE/OF45) are highly expressed in osteocytes. These supporters and inhibitors of

bone formation and mineralisation are most likely exquisitely balanced to maintain

equilibrium and subsequently bone mass. Osteocytes also appear to play a major role

in the regulation of osteoclasts by both inhibiting and activating osteoclastic

resorption (expressing cathapsin K and TRAP). It has recently been shown that with

loading, the osteocytes send signals inhibiting osteoclast activation. In contrast,

compromised, hypoxic, apoptotic or dying osteocytes (especially with unloading),

appear to send unknown signals to osteoclasts/preosteoclasts on the bone surface to

initiate resorption. Therefore, osteocytes within the bone regulate bone formation and

mineralisation and inhibit osteoclastic resorption. These have the capacity to also

send signals of osteoclast activation under specific conditions like microgravity

which is associated with space lift [98], restricted calcium intake [99, 100] and

animals undergoing hibernation [101].

Osteocyte: Control through death

Osteocytes are cells that not only play a physiological role during their life

time, but also achieve functions through their apoptosis, necrosis and autophagy. It

has been known for a very long time that osteocytes die before the matrix is

resorbed. Modelling is a process by which bone expands and is reconstructed to

achieve the requirements of growth. Osteocytes are known to trigger signals

transmitted through the canalicular network to osteoclasts or osteoblasts [15],


resulting in bone loss or gain as needed, whereas physiological strain maintains bone

mass [102]. Remodelling is the process that begins with osteoclastic resorption, by

which bone tissue is removed and replaced [103]. A mechanism by which osteocytes

may trigger bone resorption is by undergoing premature apoptosis [104]. Osteocyte

apoptosis may also contribute to bone strength by mechanisms independent of the

amount of mineral [105]. Evidence has shown that there is a strong relationship

between osteocyte death and bone remodelling capability [90]. Previous studies have

shown that osteocyte apoptosis is associated with bone formation and bone loss

[105]. Hence, knowing the role of osteocytes in targeting bone destruction through

apoptosis, it is important to know and understand the changes with apoptosis in

various bone diseases.

Table 2-4 Functions of osteocytes

Tabulated from comprehensive review The Osteocyte: An Endocrine Cell and More (Sarah L. Dallas ,

PhD, Matthew Prideaux, PhD and Lynda F. Bonewald, PhD) [14]

Osteoid osteocytes control mineralization through PHEX/Dmp1

Play a role in calcium homeostasis in response to PTH

Can recruit osteoclasts through expression of RANKL with or without cell death.

Osteocytes express Cathepsin K and play a role in osteocytic osteolysis.

Professor Lynda Bonewald shows that osteocytes can create an acidic

microenvironment in response to PTH (long term and rapid effect) using proton

pump in an IDGT cell line (unpublished data, from her presentation at IBMS-

JSBMR 2013, Kobe, Japan)

They can regulate osteoblast activity through sclerostin, MEPE, PGE2

Osteocytes are mechanosensory cells through WNT β-catenin signalling

Produce FGF23 to target the kidney and regulate phosphate homeostasis. FGF23

is elevated in osteocytes in chronic kidney diseases and associated with cardiac

hypertrophy

They are regulators of muscle myogenesis and function

Osteocytes regulate myelopoiesis haematopoiesis through a process involving

G-CSF

Under calcium restriction, osteocytes remove calcium from bone through a

process involving the vitamin D receptor

Osteocytes can remove perilacunar matrix upon calcium demand during lactation


2.5.6 In vitro models of osteocyte

In contrast to osteoblast and osteoclasts, osteocytes have functions that are largely

unknown. Research into osteocyte function is restricted due to; the lack of suitable

cell lines; reduced availability of osteocyte-specific promoters for targeted transgenic

approaches; and it is difficult to maintain their differentiated function in vitro.

Bonewald and co-workers established a cell line with features ascribed to osteocytes.

This cell is named Murine Long Bone Osteocyte Y4 (MLO-Y4) to emphasise the

fact that it was established from long bones that respond to increased mechanical

stress with an increase in bone formation. ML0-Y4 is an immortalised bone cell of

the osteocyte phenotype derived from transgenic mice that over expressing SV40

large T-antigen oncogene driven by the osteocalcin promoter. This cell line was

characterised and its properties compared with the known properties of osteocytes,

osteoblasts and other cells [106]. MLO-Y4 is accepted as an established primary

osteocyte cell line. When seeded at low density, they display complex dendritic

processes. Their biochemical profile includes high amounts of E11/gp38/podoplanin,

CD44, osteocalcin, and osteopontin, but low levels of alkaline phosphatase (ALP)

activity. Functionally, these cells support osteoclast formation and activation in the

absence of any osteotropic factors [107]. In the presence of estrogens, their ability to

support osteoclast formation is decreased via an increase in TGFβ3 [108]. MLO-Y4

cells have also been found to support osteoblast mesenchymal stem cell

differentiation [109], supporting the hypothesis that osteocytes are orchestrators of

bone resorption and bone formation. (ML0-Y4 cells and cell culture protocols has

been kindly provided by Dr. Lynda F. Bonewald, University of Missouri-Kansas

City, Kansas City, MO, USA) for use in this study.) In the last few years a number of

other cell lines have been reported and their phenotypic characteristics are tabulated

in Table 2-5 [110].


Table 2-5 In vitro models of osteocyte and their phenotypic characteristics

(Adapted from [110])

Cell Line,

Year

established

& reference

Source

Method of

immortalization

Proliferation

Gene Expression

MLO-Y4,

1997

14 d.o mouse

long bone

Cells derived from

a mouse expressing

the SV40 T antigen

under the control

of an osteocalcin

promoter

Yes

ALP, OC, E11, CX43,

DMP1,FGF23

MLO-A5,

2001

14 d.o mouse

long bone

Cells derived from

a mouse expressing

the SV40 T antigen

under the control

of an osteocalcin

promoter

Yes

ALP, OC, E11, CX43, DMP1,

SOST, FGF23

HOB-01-C1,

1996

Human

trabecular

bone

Thermolabile

SV40 T antigen

construct, active at

34 °C, inactive at

39–40 °C allowing

conditional

immortalisation

No

(37–40 °C)

ALP,OC

OC1/14/59,

2001

E18.5 mouse

calvaria,

PTH1R −/−

Mice have an

IFNγ-inducible

promoter driving

thermolabile SV40

T antigen

expression

allowing

conditional

immortalisation

No

(37–40 °C)

ALP,OC,CX43

IDG-SW3,

2011

mouse long

bone, Dmp-

GFP +

Expression

low/absent initially

but present after 1–

2 weeks in

differentiation

conditions

No

(37–40 °C)

ALP,E11,DMP1,SOST,FGF23


2.6 OSTEOARTHRITIS SUBCHONDRAL BONE

2.6.1 Structure and function of subchondral bone

The periarticular bone can be separated into two distinct anatomic structures;

the subchondral plate at the joint margins and the subchondral trabacular bone that

exists below the calcified layer of the mature articular cartilage. The subchondral

bone plate consists of a cortical bone plate that is relatively non-porous and poorly

vascularised as shown in Figure 2-7. Although the differences between the two

distinct anatomic structures are unclear, these two tissues are organised differently to

adapt to mechanical loading [111, 112]. One of the main roles of the subchondral

bone is to provide support to the overlying articular cartilage [113]. Its unique

architecture allows it to adapt to mechanical stress [114] and absorb mechanical

force transmitted through the joint [1, 113] while playing catabolic and anabolic roles

in cartilage metabolism and joint homeostasis.

Figure 2-7 Different zones of cartilage and subchondral bone

Safronin-O-staining showing different zones of cartilage and subchondral bone (Left panel). A

scanning electron micrograph of subchondral bone (right panel), from a 75-yr-old patient suffering

with OA, showing a porous and dense texture of the bone matrix. (Scale bar 100 μm) (Image from

[115]).

2.6.2 Knee osteoarthritis

The knee is the weight bearing joint most commonly affected by OA. Each

knee has three ‘compartments’ where OA can occur; the inner (medial) or outer

(lateral) side of the joint between the thighbone (femur) and shinbone (tibia), or

between the kneecap (patella) and the thighbone. All compartments or a combination


of compartments in either or both knees may be affected [116]. In OA of the knee,

the medial compartment is more commonly affected than the lateral compartment.

Knee OA is commonly defined by structural pathology, such as on a radiograph, and

clinically using joint symptoms [7, 34].

The research conducted in this thesis focuses on knee OA and specifically the

lateral and medial compartment of the tibial plateau obtained after knee replacement

surgeries, unless stated otherwise.

2.6.3 Subchondral bone changes in osteoarthritis

The classical view for the pathogenesis of OA is the degeneration of articular

cartilage associated with subchondral bone changes. The predominant typical feature

of OA is characterised by joint space narrowing, advancement of tidemark, cartilage

fibrillation, progressive subchondral bone thickness, osteophyte formation and

development of subchondral cysts and lesions as shown in Figure 2-8.

For several decades, research has focused on the mechanisms involved in the

destruction of articular cartilage. Over, 30 years ago, Radin and Rose postulated that

the integrity of subchondral bone is directly related to the cartilage integrity although

only recently research re-emphasised the importance of subchondral bone changes

like structure, architecture, quality (sclerosis) and regulation as an important

distinguishing feature of OA [1]. Studies in humans show that the changes in bone

occur very early in OA. Studies in hand OA with isotope-labelled bone-seeking

agents found that bone turnover preceded bony changes [117, 118]. Another study,

conducted over 5 years on patients suffering with knee OA showed that elevated

subchondral bone cell activity in the baseline case predicted subsequent loss of joint

space on radiographs [119]. Although human studies typically focus on late or end

stage disease and reveal less about the progression of the disease, many animal and

in vitro studies (focussing on osteoblast and osteoclast) also support the concept of

bone changes to precede cartilage degradation. Having said this, some animal models

demonstrate conflicting results. For example: shock-load experiments in rabbits

found that changes in the mechanical properties of subchondral bone and cartilage

degeneration occurred simultaneously [120].

Another important factor is the biochemical and mineral composition of OA

subchondral bone tissue. The majority of studies (in vitro and in vivo) indicate, that


in OA, there is more subchondral bone thickness, and a view that is largely agreed

upon in this field [10, 21]. However, some arguments exist about the bone being

hypo or hyper-mineralised. Mineralisation is both a biological and physiochemical

process. Reports show that there is an increased bone mineral density with

progression of OA and an inverse relationship between osteoporosis and OA [121-

123]. This being said, other studies show an abnormally low bone mineralisation

[124] like in osteoporosis. In ideal physiological conditions, in an adult skeleton, the

bone remodelling process is perfectly balanced to provide a mechanism for repairing

damage that occurs during mechanical loading and stress [111, 125]. However in

OA, irrespective of whether bone changes precede cartilage breakdown or not, or

whether the bone is hyper or hypo mineralised, it can be definitely said the

remodelling balance is hampered and the mechanisms involved in these progressive

changes are unclear. Several signalling proteins and pathways are known to be

imperative in the regulation of bone remodelling. The interplay and cross-talk

between cell signalling pathways like TGF-β, BMP, WNT, and NOTCH have been

implicated in OA. All these studies have been conducted on osteoblasts and

osteoclasts and the associated characteristic effects of signalling pathways on

osteoblast and osteoclast. However, the direct mechanisms involved are unclear and

therapeutic interventions are far from being used. Some authors have hypothesised

that vascular disturbance could cause necrosis in the subchondral bone and may be

involved in the abnormal bone remodelling [126]. More recently some authors

hypothesise that role of low-dose cytokine expression and osteocyte apoptosis are

associated with disrupted bone remodelling in OA [127]. However, all these are

perspectives and lack evidence and functional studies.

In summary, the exact sequence of OA progression is still under debate and

unclear. Literature reveals that hampered bone remodelling exists (with net bone

formation and hampered bone mineral metabolism)[128]. Significant amount of

research has been conducted on osteoblasts and osteoclasts and it is well known that

they undergo changes in OA. Osteocytes, as mentioned previously, have been

studied only in the past decade with findings indicateing that osteocytes are central to

bone homeostasis.


Figure 2-8 Pathogenic features in a normal and osteoarthritic knee joint

Normal Healthy tissue of lateral compartment is shown: normal cartilage without any fissures and no

signs of synovial inflammation. Osteoarthritis: Early focal degenerate lesion and fibrillated cartilage,

as well as remodelling of bone, is observed in medial compartment in OA patients. Bony outgrowth

(osteophyte) and subchondral sclerosis are also noted.


2.7 INFLAMMATION AND OSTEOARTHRITIS

Inflammation is a protective pattern of response controlling tissue damage

occurring as a result of pathogenic, traumatic or toxic injury. The inflammatory

process is governed by both pro and anti-inflammatory molecules which require

distinct cell types and various factors that act (in a co-ordinated manner) to regulate

cell chemotaxis, migration and proliferation leading to tissue repair [129].

Under normal physiological conditions, inflammation is tightly regulated and

modulated by the actions of soluble proteins (cytokines and growth factors) acting

between inflammatory cells, fibroblasts and vascular ECs within the affected site

[130]. When inflammation is not properly regulated the balance is shifted away from

the initiation of the healing process towards the occurrence of persisting

inflammation [131]. Thus, the initiation and the control of inflammation are crucial

elements. Inflammation is increasingly thought to enhance structural severity in OA,

whether it is through the biochemical changes within the cartilage and the release of

the cartilage breakdown products in the synovial fluid [132] or the subchondral bone

changes. Researchers have implicated T cells in producing pro-inflammatory

cytokines and MMPs within the inflamed synovial membranes [133], as well as

increased infiltration of mononuclear cell and an over expression of mediators of

inflammation process in early OA [134]. Considerable amounts of evidence from in

vitro and in vivo studies support the view that a link exists between: increased levels

of catabolic enzymes; and inflammatory mediators in OA synovial fluid; and joint

tissue [135, 136]. Mechanical forces in OA may also produce metabolic changes that

result in cytokine production by the synovium [137]. A heightened number of

migratory inflammatory cells and the substances secreted by these have been

recognised in the osteoarthritic joint tissues. This is considered not nearly as much as

in the case of rheumatoid arthritis, which is clearly an autoimmune disease.

However, it is considered enough to raise the question if inflammation is also a major

player in OA [138]. This view is strongly supported by Professor William Robinson

from Stanford University School of Medicine, who believes that OA is largely driven

by an inflammatory process [18].


2.7.1 Cytokines

Biological activities mediated by cell-derived factors were suggested for the

first time by Rich and Lews in 1932. When lymphocytes were exposed to antigens,

the migration of normal macrophages was inhibited by macrophage migration

inhibitory factors (MIFs). MIF’s generated during the interaction of sensitised

lymphocytes with specific antigens was termed cytokines. Tumor necrosis factor

(TNFα) was the first monocyte/macrophage derived cytokine that was originally

identified as cytotoxic protein present in the serum of animals sensitised with

Bacillus Calmette-Gurin [139]. Cytokines can be defined as regulatory proteins

secreted by WBCs and a variety of other cells in the body and their actions include

numerous effects on cells of the immune system and modulation of the inflammatory

response [140]. Characteristic features (cell source, cell target and primary effects) of

cytokines and key categories have been tabulated in Table 2-7.

It is important to remember that cytokines are produced by, and act on many

different cells, making any attempt to categorise them subject to limitations.

Cytokines feature at the forefront of biomedical research [141]. An

understanding of their properties is essential for any therapeutic/biological cure for

disease or condition. Some reasons to be interested in cytokines have been tabulated

in Table 2-6.

For the purpose of this study and thesis, further discussion will follow about

Tumor necrosis factor family, specifically Tumor necrosis factor α (TNFα).

Table 2-6 Why should we be interested in cytokines?[141]

Important consideration of cytokines include:

Recombinant cytokines provide useful laboratory probes for studying different mechanisms

Orchestrators of host defence mechanism involved in response to exogenous and endogenous insults, repair and restoration of homeostasis

Believed to play a role in embryonic inductive factors

Maintain our capacity for daily survival in our germ-laden environment

The study of cytokine is unique and interdisciplinary

They act over short distances as autocrine or paracrine intercellular signals in local tissues and only occasionally spill over into the circulation and initiate systemic reactions.

Cytokines are short lived


Table 2-7 Characteristic features and categories of cytokines[140]

1) Mediators of natural immunity

Cytokine Cell source Cell target Primary effects

TNFα (Type I Interferon)

Macrophages; T cells

T cells; B cells Endothelial cells Hypothalamus Liver

Costimulatory molecule Activation (inflammation) Fever Acute phase reactants

IL-1

Monocytes Macrophages Fibroblasts Epithelial cells Endothelial cells Astrocytes

T cells; B cells Endothelial cells Hypothalamus Liver

Costimulatory molecule Activation (inflammation) Fever Acute phase reactants

IL-10 T cells (TH2) Macrophages T cells

Inhibits APC activity Inhibits cytokine production

IL-12 Macrophages; NK cells Naive T cells Differentiation into a TH 1 cell

TNF-gamma T cells; NK cells

Monocytes Endothelial cells Many tissue cells - especially macrophages

Activation Activation Increased class I and II MHC

Chemokines leukocyte recruit leukocytes lymphocyte trafficking.

2) Mediators of adaptive immunity

IL-2 T cells; NK cells T cells B cells Monocytes

Growth Growth Activation

IL-4 T cells Naive T cells T cells B cells

Differentiation into a TH 2 cell Growth Activation and growth; Isotype switching to IgE

IL-5 T cells B cells Eosinophils

Growth and activation

TGF-β T cells; Macrophages T cells Macrophages

Inhibits activation and growth Inhibits activation

3) Stimulators of haematopoiesis

GM-CSF T cells; Macrophages; Endothelial cells, Fibroblasts

Bone marrow progenitors

Growth and differentiation

MCSF monocytes and macrophages

growth and differentiation


2.7.2 TNFa- Structure and Response

TNFα (also known as cachectin) belongs to the Tumor Necrosis Factor (TNF)

superfamily of cytokines representing a multifunctional group of pro-inflammatory

cytokines which activate signalling pathways for cell survival, apoptosis,

inflammatory responses, and cellular differentiation. It is a 17 kDa protein that is

produced by macrophages and other cells. The main sources in vivo are stimulated

monocytes, fibroblasts, and endothelial cells, while additional producers of TNFα

after stimulation are: macrophages, T-cells and B-lymphocytes, granulocytes, smooth

muscle cells, eosinophils, chondrocytes, osteoblasts, mast cells, glial cells, and

keratinocytes. Glioblastoma cells constitutively produce TNFα and the factor can be

detected also in the cerebrospinal fluid. Human milk also contains TNFα [142].

The gene for human TNFα is located on chromosome 6 (murine chromosome

17). It has a length of approximately 5 kb and contains four exons and three introns.

Interestingly, more than 80% of the mature TNFα sequence is encoded in the fourth

exon. The nucleotide sequences of TNFα and G-CSF genes resemble each other in a

way that suggests a possible evolutionary relationship [143, 144].

TNFR1/p55/p60 (molecular mass: 55-60kDa) and TNFR2/p75/p80 (molecular

mass: 75-80kDa) are the two forms of transmembrane TNFα receptors. Both these

receptors differ in their affinity and are believed to be present on virtually all cell

types except for the red blood cells [145]. TNFα binds to its receptors with high

affinity however there are some species specificity in terms of the receptor subtype

and TNFα binding. Binding of TNFα to TNFR1 is considered to be an irreversible

mechanism, whereas TNFα binding to TNFR2 is considered both rapid on and off

kinetics. However less is known about the mechanisms of signal transduction and

biological function of TNFR2 [143, 145-147].

2.7.3 Biological effects of TNFa

TNFα is considered a key mediator of inflammation. Its biological effects are

influenced by complex array of factors like the level of tissue exposure to free and

unbound TNFα; interaction of TNFα with other cytokines; duration of exposure to

TNFα, paracrine effects of TNFα produced locally in different tissues; and the

development of tolerance. The biological effects of TNFα have been studied for

decades and some of these activities have been summarised in Table 2-7.


TNFα has been implicated in a number of diseases including OA, RA, AIDS,

Anaemia, Cachexia, Cerebral malaria, Diabetes mellitus, Disseminated intravascular

coagulopathy, Hepatitis, Insulin resistance, Meningitis, Multiple sclerosis, Obesity,

Rejection of implanted organs, Stroke and Tuberculosis [143, 148].

2.8 WNT SIGNALLING PATHWAY

2.8.1 General Information

WNTs are a family of 19 cysteine–rich secreted glycoproteins that locally

activate receptor-mediated signalling pathways. The WNT Signalling pathway and

its functions in bone homeostasis are well documented. WNTs are associated with

postnatal cartilage differentiation, cartilage matrix catabolism and inhibition of

chondrocyte apoptosis. In addition, these are known to play an important role by

controlling differentiation of bone forming osteoblasts and bone resorbing osteoclasts

[149]. Although WNT proteins signal through several pathways, the canonical

pathway appears to be particularly important for bone biology. This is due to its

complexities and current understandings of critical aspects of skeletal biology that

has been reviewed by many researchers [150, 151].

2.8.2 WNT β-catenin (Canonical) Pathway

This Pathway involves the interaction of WNT ligands with low-density

lipoprotein receptor–related protein 5 or 6 (LRP 5 or 6) and the frizzled (FZD).

When WNT’s bind to frizzled and LRP5/6 in a ternary complex, glycogen synthase

kinase 3 (GSK-3β) is inhibited, leading to the accumulation of β-catenin.

Accumulated β-catenin then translocates into the nucleus and activates the lymphoid

enhancer factor (LEF)/ T-cell factor (TCF)-mediated gene transcription. In the

absence of WNTs, GSK-3β phosphorylates β-catenin and this phosphorylated β-

catenin is conjugated with ubiquitin and degraded by proteosome. WNT signalling is

modulated not only through fine tuning by a large number of WNT ligands and also

by extracellular antagonists or WNT inhibitors like DKK1, SOST (which binds to

LRP5/6) and sFRP. The WNT signalling is also activated by three other pathways,

including the planar cell polarity pathway, the protein kinase pathway and the

WNT/ca2+ pathway [152, 153] however, its mechanisms are currently not as well

understood in skeletal development and disease.


A simplified view of the canonical pathway (active and inactivate) has been

explained in Figure 2-9.

Figure 2-9 Activated and inactivated state of WNT signalling pathway

Adapted from [154]


2.8.3 WNT signalling pathway in joint homeostasis

A critical step in skeletal morphogenesis is the formation of synovial joints

which define the relative size of discrete skeletal elements and are required for the

mobility of vertebrates. The WNT signalling cascades have essential roles in the

development, growth and homeostasis of joints and the skeleton. The WNT β-catenin

pathway has been associated with postnatal cartilage matrix catabolism [155],

articular chondrocyte dedifferentiation and the inhibition of chondrocyte apoptosis

[156, 157]. The majority of available data provides circumstantial and/or direct

evidence (both in vivo and in vitro), that activation of WNT β-catenin signalling

leads to reprogramming of articular chondrocytes towards catabolism or loss of

stable phenotype with subsequent loss of tissue structure and function. During

skeletal development, WNT’s have been implicated initially in proximal-distal

outgrowth and dorsoventral limb patterning and later, in chondrogenesis,

osteogenesis, myogenesis and adipogenesis [158, 159]. Mutant mice with reduced

expression of LRP 5/6 resulted in defective limbs [160], whereas mouse embryos

lacking in WNT co-receptors or β-catenin resulted in defective bone cartilage and

joints. Mutations in co-receptors LRP 4 resulted in webbed toes through bone fusions

[161, 162] and limb malformations in mice to have found with altered gene doses of

SOST [163]. Skeletal malformations were also found in humans with mutation of

WNT3a. WNT 4a and WNT 14 are required for joint formation and WNT5a

mediated signalling is also essential for skeletal development. Therefore, WNT’s

play a critical role in mesenchymal stem cell lineage commitment and progression,

by indirectly repressing osteoclast (haematopoietic lineage) differentiation and bone

resorption through the increased secretion of osteoprotegrin (OPG). The impact of

WNT β-catenin signalling on bone cells is illustrated in Figure 2-10. Across all

studies to WNT signalling pathway, increases in bone mass have been observed as a

result of pathway activation. Decreases in bone mass were observed as a result of

pathway inhibition, although the relative impact on bone formation and resorption

varied, reflecting the complex fine tuning of the WNT regulatory network.

2.8.4 WNT β-catenin signalling pathway and osteoarthritis

The joint is a complex organ composed of different tissues (articular

cartilage, subchondral bone, joint capsule, synovial membrane and soft tissue

structures like ligaments, tendons, and meniscus). A number of factors (mechanical


and biochemical) act in a synergistic fashion to maintain homeostasis. OA is a

common disease and is manifested by swelling, joint pain, inflammation and

progressive loss of function. Considering this, there has been increasing attention

targeted towards understanding the biology, mechanisms and pathways of the bone-

cartilage unit driving this disease progression with modulation of these pathways as a

target to slow or retard the disease progression.

A number of animal experiments, clinical samples and genetic studies

indicate that WNT is critically involved in the progression of OA [27, 164, 165].

Genomic studies from twins and siblings suffering with OA show WNT antagonists

such as FRZB also known as sFRP-3 to be associated with OA howver FRZB knock

out animals also reveal the complexity of WNT signalling in joint homeostasis [166,

167]. Further, FRZB-/- mice induced with OA and were found to be more prone to

loss of proteoglycans from the articular cartilage of the knee with increased cortical

mineral content and thickness, resulting in stiffer bones. These effects were in

contrast to the changes seen in LRP5-/- mice [168]. Therefore, results from FRZB-/-

mice experiments suggest an increased WNT signalling with a negative effect on the

cartilage.

AXIN2 is a target gene in the WNT β-catenin signalling pathway and is

implicated in OA. However, literature reveals that the expression and production of

AXIN2 leads to the binding of AXIN2 to other molecules (GSK3/APC) and causes

the phosphorylation of β-cateninwhich is degraded in a proteosome complex

Osteoblast proliferation and differentiation were significantly increased and

osteoclast formation was significantly reduced in AXIN2 Knock-out mice [169].

Like SOST and FRZB, DKK1 is a soluble inhibitor and a master regulator of

the WNT signalling pathway, playing a balancing role where increased expression

is associated with bone resorption and decreased expression is associated with bone

formation. DKK1-/- mice die because of failure of head induction [170] and

DKK1+/- mice show increased bone formation without any changes to bone

resorption [171]. Evidence from blocking TNFα and DKK1 in hTNFtg mice, shows

that DKK1 can regulate osteophyte formation [172]. The appearance of osteophytes

upon blockage of DKK1 identifies WNT signalling as a key trigger in the formation

of osteophytes. This concept is also fostered by consistent results in two other

models of inflammatory arthritis, CIA and GPI-induced arthritis. These showed

rapid emergence of osteophytes upon blockade of DKK1 [172] however, their role


and levels of expression in OA have been debated [173]. Increased expression of

plasma and synovial DKK1 was reported and their levels inversely correlated with

the radiographic severity with knee OA patients [174]. The protective and

deleterious roles of DKK1 and its association with tissue expression is not known

to date [154], however, DKK1 is well evidenced to be a negative regulator of bone

formation and may indirectly influence osteoclastogenisis. These results indicate a

close relationship of inflammation and osteophyte formation in OA. Literature also

shows that mechanical injury up regulates WNT target genes in the bone. In

addition, microarray gene expression profiling of OA bone tissue reveals activation

of the WNT signalling pathway [175].

2.8.5 Osteocyte WNT signalling in bone homeostasis and osteoarthritis

Significant progress has been made in understanding the role of WNT β-

catenin pathway in osteogenesis and in particular in osteoblast biology. However,

much less is known about osteocytes in this pathway. Osteocyte biology research is

becoming prominent with new evidence suggesting that osteocytes use the WNT β-

catenin signalling pathway to communicate and control bone mass, confirming that

osteocytes are the key regulators of bone homeostasis [29].

Summarising sections 2.5.4 and 2.8.3, the WNT signalling pathway has been

closely linked to hampered cartilage-bone homeostasis, mineral metabolism and

inflammation in OA [27, 173]. However, no targeted approach for therapy has been

elucidated [176-178]. It is now evident that osteocyte β-cateninsignalling is

specifically required for normal bone homeostasis [29, 179]. Osteocytes appear to

use β-cateninpathway to transmit signals to cells on the bone surface. Recent

evidence also suggests that osteocytes may be triggered by cross-talks with different

pathways that respond to loading, leading to decreased expression of negative

regulators of bone formation such as SOST and DKK1 [172, 180]. Mechanical injury

down regulates β-cateninin joints [27, 181]. Studies have shown that WNT β-catenin

signalling is activated as a result of mechanical loading on osteocytes and is a major

signalling pathway for mechanotransduction [29]. This pathway has also been

implicated in osteocyte survival and osteocyte apoptosis correlating with the

increased osteoclast recruitment and bone resorption [182, 183]. Osteocyte WNT β-

catenin signalling also cross-talks with other signalling pathways to signal between

bone cells and this cross-talk has been illustrated in Figure 2-11.


Figure 2-10 Impact of WNT β-catenin signalling on bone cells

WNT β-catenin signalling is required for the commitment of mesenchymal stem cells to the

osteoblastic lineage and further its proliferation and differentiation to form osteocytes. WNT β-

catenin signalling pathway is also required for the expression of the anti-osteoclastic factor OPG by

osteoblasts and osteocytes (Adapted from [26]).


Figure 2-11 Signalling between bone cells to maintain homeostasis

Bone formation is controlled by osteocytes via the WNT signalling antagonists SOST and DKK.The

expression of these antagonist are regulated by PTH and BMP. PTH represses, whereas BMPR1A-

mediated BMP signaling induces, expression of these antagonists. Osteocytes also control the

expression of OPG via the WNT signalling pathway. In a feedback loop for bone remodeling,

osteoclasts stimulate the local differentiation of osteoblasts at the end of the resorption phase by

secreting WNT ligands. (Adapted from [26]).

Chapter 3 Phenotypic characterisation of osteoarthritic osteocytes from the sclerotic zones: a possible

pathological role in subchondral bone sclerosis 63

Chapter 3: Phenotypic characterisation of

osteoarthritic osteocytes from

the sclerotic zones: a possible

pathological role in subchondral

bone sclerosis

Statement of Contribution of Co-Authors

Contributors Statement of contribution Anjali Jaiprakash Involved in the conception and design of the project.

Performed laboratory experiments, analyzed data and wrote the manuscript.

Indira Prasadam Involved in the design of the project. Performed laboratory experiments and assisted in manuscript preparation.

Jerry Feng Assisted in reviewing the manuscript and helped in data generation

Ross Crawford Involved in the conception of the project, assisted in reviewing the manuscript.

Yin Xiao Involved in the conception and design of the project, manuscript preparation and reviewing.

Principal Supervisor Confirmation

I have sighted email or other correspondence from all co-authors confirming

their certifying authorship

64 Chapter 3 Phenotypic characterisation of osteoarthritic osteocytes from the sclerotic zones: a possible

pathological role in subchondral bone sclerosis

3.1 ABSTRACT

Introduction: Subchondral bone sclerosis is a well-recognised manifestation of

osteoarthritis (OA). The osteocyte cell network is now considered to be central to

the regulation of bone homeostasis; however, it is not known whether the integrity of

the osteocyte cell network is altered in OA patients. The aim of this study was to

investigate OA osteocyte phenotypic changes and its potential role in OA

subchondral bone pathogenesis.

Methods: The morphological and phenotypic changes of osteocytes in OA samples

were investigated by micro-CT, SEM, histology, immunohistochemistry, TRAP

staining, apoptosis assay and real-time PCR studies.

Results: We demonstrated that in OA subchondral bone, osteocyte morphology was

altered showing rough and rounded cell body with fewer and disorganized dendrites

compared with the osteocytes in control samples. OA osteocytes also showed

dysregulated expression of osteocyte markers, apoptosis, and degradative enzymes,

indicating that phenotypical changes in OA osteocytes could be responsible for OA

subchondral bone remodelling (increased osteoblast and osteoclast activity) and

increased bone volume with altered mineral content.

Conclusion: Significant alteration of OA osteocytes was identified in OA samples,

indicating a potential regulatory role of osteocytes in subchondral bone remodelling

and mineral metabolism during OA progression.



3.2 INTRODUCTION

Osteoarthritis (OA) is the most common musculo-skeletal disorder yet still the

aetiology is unknown. Regardless of the aetiology the disease is progressive and is

characterised by a series of predictable clinical and radiological changes. More than

30 years ago, Radin et al suggested that an increase in stiffness of subchondral bone,

rendering it less capable of attenuating and distributing load throughout the joint,

increased stress in the overlying articular cartilage, leading to the deterioration in OA

[1, 184]. One of the earliest changes seen radiographically, often before any joint

space narrowing is observed, is subchondral bone sclerosis. This sclerosis is

recognised as a radiographic sign of OA but its significance has been little explored.

Subchondral bone is made up of a specialized connective tissue formed by a

mineralized matrix containing specific type I collagen, proteoglycans, and several

growth factors, as well as bone specific cell types: osteoblasts, osteocytes, and

osteoclasts. It has been reported that OA subchondral bone shows dysregulated

osteoblast [185] and osteoclast phenotype [186]. However, it is currently not known

whether osteocyte cells undergo phenotypic changes during OA progression.

Osteocytes are terminally differentiated osteoblasts and they reside within the

mineralized bone matrix and make up more than 90-95% of all bone cells in the adult

skeleton. The osteocyte-canalicular cell network is now considered to play a central

and multi-functional role in regulating skeletal homeostasis [187]. The most accepted

theory for osteocytic function places these cells as transducers of mechanical strains

that are translated into biochemical signals affecting the communication among

osteocytes and between osteocytes and osteoblasts or osteoclasts [188]. This cascade

of events may ultimately regulate bone remodelling and mineral metabolism [189].

Since mechanical knee misalignment and altered joint geometry were known causes

of OA [190], it is likely that osteocytes might undergo enormous changes given their

function is to act as transducers of mechanical strains.

This study was designed to understand the pathophysiology of osteocyte

network in OA patients by determining changes in osteocyte morphology,

distribution, apoptosis, and evaluating the expression of osteocyte makers and matrix

degradation enzymes. It was noted that phenotypic changes of osteocytes in OA



patients induced active site-specific remodelling of subchondral bone resulting in

subchondral bone thickening and dysregulated mineral metabolism.

3.3 MATERIALS AND METHODS

Patients

OA patients undergoing total knee replacement were recruited for this study after

informed consent was given. This study was approved by The Queensland

University of Technology and Prince Charles Hospital ethics committees. Patient

variables i.e., height, weight and age were recorded and preoperative radiographs of

the knee, anteroposterially and laterally, were taken. The Subchondral bone was

classified using scoring system set by The American College of Rheumatology

[191]. OA cartilage was classified according to the modified Mankin score [192].

According to the previous studies [185], the patients were classified as OA (n=5)

with a Mankin score greater than 5 and control (n=5) with a score less than 3.

Micro-CT

Morphological changes of subchondral bone in control vs. OA specimens were

determined using Micro-CT. Tibial plate samples were scanned with micro CT

(Scanco 40, Switzerland) with isotropic voxel size of 18 μm after tissues were fixed

in 4% paraformaldehyde (PFA) in PBS as scanning medium. The x-ray tube voltage

was 55 kV and the current was 145 μA, with a 0.5 mm aluminium filter. The

exposure time was 1180 ms. The data set was segmented with an inbuilt software. In

the medial and the lateral part of each tibia, a volume of interest (VOI) was selected

with automatic contouring method. The circles were located in the middle of the

load-bearing and non-load bearing sites of subchondral bone areas. Selected areas

contained subchondral plate, but did not contain subchondral trabecular bone or

growth-plate tissue. A total of 30 consecutive tomographic slices were analysed. The

meaningful subchondral bone plate measurements such as bone volume (mg

HA/ccm) and BV/TV (%) were analysed using inbuilt software. Subchondral bone

thickness was measured quantitatively using Axio Vision software by converting

number of pixels to micro meters.



Scanning electron microscopy (SEM) analysis for osteocytes

SEM and backscatter SEM was performed as described previously [193]. For resin-

casted SEM, samples were dissected and fixed in 2.5% glutaraldehyde in 0.1 M

sodium cacodylate buffer containing 0.05% tannic acid. The tissue specimens were

dehydrated in ascending concentrations of ethanol (from 70% to 100%), embedded

in methyl methacrylate, and then surface polished using 1 μm and 0.3 μm Alpha

Micropolish Alumina II (Buehler) in a soft-cloth rotating wheel. The bone surface

was acid etched with 37% phosphoric acid for 2–10 seconds, followed by 5% sodium

hypochlorite for 5 min. The samples were then coated with gold and palladium as

described previously [194] and examined using an FEI/Philips XL30 Field-Emission

Environmental Scanning Electron Microscope.

For back-scattered SEM (BSEM), the samples were fixed overnight in 2%

paraformaldehyde and 2% glutaraldehyde buffered at pH 7.4 with 0.1 M sodium

cacodylate. Samples were then rinsed three times (20 min each time) in 0.1 M

cacodylate buffer solution followed by secondary fixation (1 h) in a solution of 1%

osmium tetroxide in 0.1 M cacodylate buffer. The BSEM samples were then coated

with carbon and examined using an FEI/ Philips XL30 Field-Emission

Environmental Scanning Electron Microscope.

Histology tissue preparation

All samples containing any overlying cartilage and subchondral bone were dissected

to an approximate depth of 1cm. All of the samples for histology and

immunohistochemical analysis were washed in saline and immediately fixed in 4 %

paraformaldehyde for 24 hours. The samples were washed in phosphate buffer

solution (PBS) for one hour and then placed in 10% ethylene diamine tetraacetic acid

(EDTA) for decalcification. The EDTA solution (PH 7.0) was changed weekly for

four weeks and decalcification was confirmed by radiographic analysis. Tissue

specimens were embedded in paraffin wax once the decalcification was complete.

Tissue slices of 5 µm thick were sectioned using microtome, placed on 3-

aminopropyltriethoxy-silane coated glass slides, air-dried and stored at 4°C prior to

analysis. Each specimen was H&E stained to visualize the general morphology.



H&E staining

Tissue slices were dewaxed in xylene and dehydrated in descending concentrations

of ethanol (100% to 70%), sections were then stained with Mayers’s haemotoxylin

for 1-2 minutes before washing with tap water for 5 minutes. The slides were

dehydrated in ascending concentration of ethanol (70% to 100%) and stained with

eosin for 15 seconds and cleared with xylene and mounted on DePeX mounting

medium (BDH Laboratory Supplies, England).

Immunohistochemistry

Immunohistochemistry was carried out using an indirect immunoperoxidase method.

Tissue slices were dewaxed in xylene and dehydrated. Endogenous peroxidases were

blocked by incubation in 0.3% peroxide for 30 min followed by repeated washing in

PBS. The sections were then incubated with proteinases K (DAKO Multilink, CA,

USA) for 20 min for antigen retrieval. Next, all sections were treated with 0.1%

bovine serum albumin (BSA) with 10% swine serum in PBS. Sections were then

incubated with optimal dilution of primary antibody overnight at 4 °C. Optimum

concentration of antibody was determined by using a series of dilutions. After 24

hours, sections were incubated with a biotinylated swine-anti-mouse, rabbit, goat

antibody (DAKO Multilink, CA, USA) for 15 min, and then incubated with

horseradish perioxidase-conjugated avidin-biotin complex for 15 min. Antibody

complexes were visualized by the addition of a buffered diaminobenzidine (DAB)

substrate for 3 min and the reaction was stopped by rinsing sections in PBS. Sections

were counterstained with Mayer’s haematoxylin for 10 sec each, and rinsed with

running tap water. Following this, dehydrated with ascending concentrations of

ethanol solutions, cleared with xylene and mounted with coverslip using DePeX

mounting medium. Controls for the immunostaining procedures included conditions

where the primary antibody and the secondary (anti-mouse IgG) antibodies were

omitted. In addition, an irrelevant antibody (anti CD-15), which was not present in

the test sections, was used as a control. A list of antibody sources and dilutions used

for this study are summarized in Table 3-1.



Table 3-1 A list of antibodies, sources and working dilutions used for immunohistochemistry

Protein Dilution Source

Sclerostin 1:100 Gift from Prof Jian Q Feng

DMP-1 1:1000 Gift from Prof Jian Q Feng

MMP9 RB1539-PO 1:250 Labvision, Fremont, CA

ADAMTS4 RB1442-PO 1:100 Labvision, Fremont, CA

MMP1 AB52631 1:200 Labvision, Fremont, CA

Distribution of osteocyte cell number and lacunae

Subchondral bone plate was defined as starting from the calcified cartilage (CC)

bone junction and ending at the marrow space. Meaningful parameters to describe

our area of interest were determined by measuring the thickness of the subchondral

plate in all samples under 10 x magnification and calculating the average length

(0.98mm) and calculating the average area. Average osteocyte nucleus (Avg OS.N)

and average osteocyte empty lacunae (Avg OS.L) were counted per unit area, within

the defined area of interest using AxioVision Rel 4.8 Software. The Avg OS.N and

Avg OS. Lac between control and OA are represented in a bar graph.

In situ cell death detection (apoptosis) using TUNEL

Osteocyte apoptosis was assessed principally at single cell level, based on labelling

of DNA strand breaks (Terminal deoxynucleotidyl transferase dUTP nick end

labelling or TUNEL technology) using In Situ Cell Death Detection Kit, Fluorescein

(Roche, Germany) according to manufacturer’s protocol. Tissue sections were

permeabilised for 30min at 37 °C with Proteinase K solution (Roche, Germany). As a

positive control, sections were treated with DNase1 for 10 min at room temperature

prior to labelling procedure was used to induce DNA strand breaks. The TUNEL

reaction mixture / terminal transferace was omitted for the negative control.

Subchondral bone plate was defined as starting from the calcified cartilage (CC)



plate in all samples under 10 x magnifications and calculating the average length



(0.98 mm) and calculating the average area. TUNEL positive osteocytes were

counted in 3 fields per section within the defined area of interest using AxioVision

Rel 4.8 Software. The average TUNEL positive osteocyte between control and OA

are represented in a bar graph.

Quantitative real time polymerase reaction (qPCR)

qPCR was performed to detect the gene expression differences in control and OA

bone lysates. Briefly, for total RNA extraction, the fresh bone tissues were obtained

from OA patients (collected in RNAse later solution) and graded according to the

disease severity. Small fragments of bone were cut by using a bone cutter and tissues

were homogenised using a bead beater for one minute. Total RNA was extracted

using the Trizol method and qPCR was performed as described previously [2, 195].

The quality and integrity of the RNA extracted were confirmed on 1% wt/vol

ethidium bromide-stained agarose gels.

Western blot

Total tissue protein was harvested by lysing the subchondral bone in a lysis buffer

containing 1 M Tris HCl (pH 8), 5 M NaCl, 20% Triton X-100, 0.5 M EDTA and a

protease inhibitor cocktail (Roche, Dee Why, NSW, Australia). The cell lysate was

clarified by centrifugation and the protein concentration determined by a

bicinchoninic acid protein assay (Sigma-Aldrich). 10 g of protein was separated by

sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 12% gel. The protein

was transferred to a nitrocellulose membrane, and blocked in a Tris-Tween buffer

containing 5% non-fat milk. The membranes were incubated with primary antibodies

against ALP (1:1,000) and OCN (1:2,000) overnight at 4ºC. The membranes were

washed three times in TBS-Tween buffer, and then incubated with an anti-rabbit

secondary antibody at 1:2,000 dilutions for 1 hr. The protein bands were visualized

using the ECL Plus™ Western Blotting Detection Reagents (GE Healthcare,

Rydalmere, NSW, and Australia) and exposed on X-ray film (Fujifilm, Stafford,

QLD, Australia). Immunoblot negatives were analyzed by densitometry using Image

J software.



Tartrate resistant acid phosphatase (TRAP) staining of paraffin embedded

samples

To detect osteoclast activity, TRAP staining was performed as described previously

by Erlebacher et al [196]. Paraffin sections of 5 μm thickness were deparaffinised in

two changes of xylene (8 min each) and rehydrated (2 changes 95% ethanol, 2 min

each; 1 change 70% and 50% ethanol each 5 min, deionised water 5 min). After

rehydration, samples were placed in 0.2 M Acetate Buffer (0.2 M sodium acetate and

50 mM L(+) tartaric acid in ddH2O, pH 5.0) for 20 min at room temperature.

Subsequently sections were incubated with 0.5 mg/ml naphtol AS-MX phosphate

(Sigma) and 1.1 mg/ml fast red TR salt (Sigma) in 0.2 M acetate buffer for 1-4 h at

37ºC until osteoclasts appeared bright red. Samples were counterstained with

Haematoxylin, air dried and mounted with ProLong® Gold (Invitrogen) mounting

solution.

Statistical analysis

Paired Student’s t-test was used to determine any significance between control vs.

OA subchondral bone, by counting the % positive staining cells in the field of view

for immunohistochemistry, by counting the Avg OS.N and Avg OS.L (per unit area),

and for distribution studies. p ≤ 0.05 was considered significant.

3.4 RESULTS

Patient Demographics and specimen characterization

The mean age of all patients was 72 years (range 63 – 79), mean weight was

93.4 kg (range 64-105) and mean height was 173 cm (range 162-185). H&E staining

was performed to confirm the site specific changes in the samples. All control

specimens showed normal appearing articular cartilage with underlying subchondral

bone. The outer (radial) layer of noncalcified cartilage (NC) was separated from the

underlying calcified cartilage (CC) layer by the tidemark (TM). Immediately

adjacent to the CC was the subchondral bone plate (SB). In contrast, OA specimens

showed cartilage loss with a small region on the edge of the slide where there was

some preservation of the deep and middle zone cartilage layers. The NC was much

thinner and the CC was relatively thicker in OA samples when compared to the



control specimens. Therefore, the distance between the TM and the SB was thicker

than in the normal specimens. SB advancement in the OA specimens was seen in all

the patients indicating extensive bone remodeling. Collectively, these results show

significant site-specific changes in OA patients.

Altered gene expression, micro-architectural and mineral properties in OA

subchondral bone

A representative of the 3-D reconstruction of subchondral bone from micro-

CT images (Figure 3-1a, i-ii) showed significant changes in the microstructure of

subchondral bone in OA patients. Compared with control, OA subchondral bone was

significantly thicker and denser with a plate-like structure. Quantitative micro-CT

data revealed that OA specimens had a 20% increase in bone volume fraction

compared to the control group (p = 0.049) (Figure 3-1a, iii). Similarly, an increase in

the subchondral bone thickness and mean density was observed in OA patients

(Figure 3-1a, iv-v). To further investigate these at the molecular level, it was noted

that the mRNA (Figure 3-1b, i-iii) and protein (Figure 3-1b, iv) synthesis of alkaline

phosphatase (ALP), osteopontin (OPN) and osteocalcin (OCN) were significantly

higher in OA samples compared to patient matched controls. These results indicate

abnormal site-specific OA bone phenotypic properties. Goldner’s trichrome staining

showed that there were statistically significantly increased un-mineralized areas

(stained orange) in OA subchondral bone compared with controls (Figure 3-1c, i-ii).

This was further confirmed by Von kossa staining on the un-decalcified tissue

samples, which showed that the mineral content distribution was statistically

significantly altered in OA subchondral bone, showing increased less mineralized

areas compared with controls (Black staining shows the distribution of mineral

content and white shows the distribution of un-mineralized areas) (Figure 3-1c, iii-

iv). Similarly, backscatter SEM images showed significantly disorganized mineral

distribution compared with the controls where the white/grey areas show the

distribution of mineral content and the black areas show the lack of mineral content

(Figure 3-1c, v-vi).



Distorted osteocyte distribution and morphology in OA samples

A representative H&E staining of the subchondral bone of OA and patient

matched control shows the histological appearance of osteocyte morphology, number

and distribution. Arrows represent osteocyte nucleus and arrow heads represent

empty osteocyte lacunae (Figure 3-2a, i-ii). Average osteocyte lacunae (Avg.OS.Lac)

density was significantly increased in the OA patients compared to controls (p =

0.0041). However, no significant differences were observed with respect to Average

osteocyte nucleus (Avg.OS.N) (p=0.0691) or viable osteocyte count (Figure 3-2a, iii-

iv). We examined the morphology of OA osteocytes using back scatter SEM (Figure

3-2b, i-ii) and SEM (Figure 3-2b, iii-vi) and it revealed that the osteocytes in OA

samples were markedly deformed with a rough, lysed (Figure 3-2b, iv&vi) and

rounded appearance (Figure 3-2b, ii) with very few dendrites compared to spindle

shaped (Figure 3-2b, i), well organised and well connected osteocytes (Figure 3-2b,

iii&v) in the control specimens. Furthermore, mineral distribution was disorganised,

showing woven appearance in OA (Figure 3-2b, ii) compared with well organised

and consistent mineral distribution in normal samples (Figure 3-2b, i). Blood vessel

invasion in OA subchondral bone was also observed (Figure 3-2b, iv).



Figure 3-1 Micro-architectural and mineral properties in OA subchondral bone

A representative 3-D reconstructions of tibial bone specimens of control and OA from micro-CT

scans (figure 3-1a, i-ii) and quantitative results show OA subchondral bone plate has a higher bone

volume fraction, mineral content and thickness compared to control specimens (figure 3-1a, iii-v) .

Molecular marker changes: qRT-PCR was used to measure the gene expression levels of ALP, OPN

and OCN. ALP and OPN showed a significant increase in OA bone (figure 3-1b, i-iii), Bars equals

mean±SD, n=5, y-axis is the relative expression. At the protein level, a similar trend was observed

using western bolt (figure 3-1b, iv). Tubulin was used as an internal loading control. *p≤0.05. Goldner

staining of control and OA samples (figure 3-1c, i-ii). Von kossa stained sections (figure 3-1c,iii-iv).

Back scatter SEM (BS-SEM) images (figure 3-1c, v-vi).



Figure 3-2 Disrupted osteocyte morphology and distribution in OA patients

H&E staining of the subchondral bone of OA and patient matched control showing the histological

appearance of osteocyte morphology, number and distribution. Arrows represent osteocyte nucleus

and arrow heads represent osteocyte lacunae (Figure 3-2a, i-ii). OA subchondral plate showed no

significant increase in the Avg OS.N (p=0.0691) compared to control (Figure 3-2a, iii). OA

subchondral plate showed a significant increase in the Avg OS.Lac (p=0.0041) compared to control

(Figure 3-2a, iv). Bars equal mean±SD, n=5, *p≤ 0.05.(Figure 3-2b, i-ii) Back scatter image and

(Figure 3-2b, iii-vi) SEM images show clear morphological differences which include rough lysed and

rounded appearance with fewer dendrites in OA osteocytes and blood vessel (arrows) invasion in OA

samples (Figure 3-2b, iv).



Dysregulated osteocyte markers in OA osteocytes:

Osteocytes selectively express sclerostin (SOST), which is well characterised

as negative regulator of bone formation. We performed a comparative

immunohistochemical analysis of SOST expression in OA and patient matched

control samples. When quantified by assessing the percentage fraction of SOST-

positive osteocytes among total osteocytes, major differences became evident. SOST

expression was observed in more than half of the osteocytes in the control specimens

but was significantly reduced in OA samples (p=0.001), indicating a suppressed

expression of this bone regulatory protein in OA (Figure 3-3, a-b). In contrast to

these findings the expression of Dentin Matrix Protein 1 (DMP1, regulator of bone

mineralisation) staining was stronger in OA osteocytes and the percentage of DMP1

positive osteocytes were higher in OA compared to control specimens (p=0.0002)

(Figure 3-3, d-e). The expression of DMP1 and SOST has been correlated to the ratio

of bone volume to total volume (BV/TV) showing that increase in bone volume was

correlated with the expression of increased DMP1 and decreased SOST (Figure 3-3,

c&f).

Increased apoptosis and TRAP positive staining in OA osteocyte

The number of average TUNEL and TRAP positive osteocytes was

significantly higher in OA osteocytes compared to controls. In OA subchondral bone

there were increased osteoclast activity showing TRAP positive (Figure 3-4a, ii)

compared to the control (Figure 3-4a, i). Interestingly, osteocytes in OA samples also

showed positive staining of TRAP (Figure 3-4a, iv) compared with the controls

(Figure 3-4a, iii), where osteocytes showed negative TRAP staining. A representative

TUNEL stained section showed more number of osteocytes undergoing apoptosis in

OA samples (figure 3-4b, ii) compared to controls (Figure 3-4b, i). The average

TUNEL positive osteocyte between control and OA are represented in a bar graph

(Figure 3-4b, iii).

Dysregulated expression of degradative enzyme expression in OA osteocytes

Matrix metalloproteinases (MMPs) are well recognized as mediators of

matrix degradation, and their activity by virtue of the cleavage of matrix substrates

are well known. We showed that the intensity of MMP-1. (Figure 3-5, a-c), MMP-9

(Figure 3-5, d-f), and ADAMTS4 (Figure 3-5, g-i) signals were stronger and the



percentage of positive osteocytes were significantly higher in OA samples compared

to control patient specimens.

Figure 3-3 Expression of osteocyte markers and the correlation to BV/TV

Immunohistochemical analysis shows a decrease in the average % positive stained osteocytes for

SOST in OA patients compared to controls (p=0.001) (Figure 3-3, d-e). and an increase in the

average % positive stained osteocytes for DMP1 in OA patients compared to controls (p=0.003)

(Figure 3-3, a-b) Correlation studies reveals that the expression of SOST decreases with the increase

in bone volume to total volume (BV/TV) (Figure 3-3, c) and the expression of DMP1 increases with

increase in BV/TV (Figure 3-3, f).



Figure 3-4 Defective osteoclast / osteocyte TRAP expression and increased apoptosis (TUNEL

positive) in OA osteocytes

A representative TRAP stained section shows an increased in the number of osteoclasts (Figure 3-4a,

i-ii). Increased TRAP positive osteocytes were observed in OA subchondral bone (Figure 3-4a, iii-iv).

A representative TUNEL stained section shows that increased number of OA osteocytes are

undergoing apoptosis compared to controls. Arrows represent TUNEL positive osteocytes and arrow

heads represents live/nuclear stain (Figure 3-4, i-ii). Figure 3-4b, iii is the bar graph showing increased

TUNEL positive OA osteocytes. Bars equal mean±SD, n=5, *p≤ 0.05.



Figure 3-5 Dysregulated expression of degradative enzymes

Significant increase in the average percentage positive stained osteocytes in OA samples was

observed with (Figure 3-5, a-c) MMP1 (p=0.001), (Figure 3-5, d-f) MMP9 (p=0.0026), (Figure 3-5, g-

i) ADAMTs4 (p=0.0042) compared controls. Scale bars = 20μ; Bars on graphs = mean±SD, (n=5),

*p≤ 0.05.

3.5 DISCUSSION

Subchondral bone sclerosis is a major patho-physiological manifestation of

OA, and it is still unknown if it precedes cartilage breakdown in this disease.

Regardless of whether bone sclerosis is the initiating event, it perturbs the overlying

cartilage in OA patients; therefore, preventing subchondral bone sclerosis may

contribute to improving the comfort and mobility of OA patients [11]. It is evident

that subchondral bone cells such as osteoblasts and osteoclasts undergo significant

changes in OA [19]. However, recent studies emphasise the importance of osteocyte

in maintaining the bone homeostasis. Studies have demonstrated that osteocytes

regulate the behaviour of osteoblasts and osteoclasts by communicating through gap

junctions [197]. With this evidence, we hypothesised that osteocyte function may be

hampered in OA leading to an OA osteocyte phenotype and this could play an



important pathological role in subchondral bone sclerosis. Our findings suggest that

the various functional properties of osteocytes appear to be changed in patients with

OA.

In OA, the increase in bone volume, density, and stiffening of subchondral

bone has been reported and the possible reason for this change might be due to bone

remodelling in response to repetitive micro-damage/fracture as a result of an

imbalance in mechanical loading of the joint [56]. In this study we identified that OA

subchondral bone showed an increased bone volume and the bone mineral content

was significantly altered. We further demonstrated that these subchondral bone

changes in OA were correlated with the expression of osteocyte markers, which

showed decreased SOST and increased DMP1 expression in OA samples. Osteocyte

expression of SOST is a delayed event and it is produced only by mature osteocytes

after they become embedded in matrix that has been mineralized. From then on,

mature osteocytes appear to express SOST whether they are located in bone. SOST

knockout mice have a progressive high bone mass phenotype [95, 198]. The precise

physiological role of SOST in osteocytes is not yet fully understood, but numerous

studies indicate that loss of SOST expression enhance osteogenesis [87]. Currently, it

is thought that SOST passes through the osteocytic canalicular network to the bone

surface where it inhibits osteoblastic canonical WNT β-catenin signaling, which is

implicated in bone mass regulation [96, 199, 200]. Therefore, decreased SOST

expression in OA osteocytes may be responsible for the increased bone volume in

OA subchondral bone.

In contrast to the expression of SOST, increased expression of DMP1 can

induce impairment in mineralization [201, 202] with poorly organized mineral and

an apparent delay in the transition from osteoblasts to osteocytes. In this study it was

found that OA subchondral bone showed significant dysregulation in mineral

metabolism. This may be due to the increased expression of DMP1 in OA osteocytes.

DMP-1 is a secretory protein and an osteocyte marker essential for normal postnatal

chondrogenesis and subsequent osteogenesis [203]. In vivo studies show that DMP1

actively participates in bone homeostasis and mineralization. In addition, mechanical

loading stimulates dentin matrix protein 1 (Dmp1) expression in osteocytes [86, 204,

205]. It can be assumed that increased expression of DMP1 in OA osteocytes may

disrupts the normal mineralization process in OA subchondral bone, resulting



increased osteoid volume and irregular mineralization of OA subchondral bone. The

surprising finding of decreased SOST and increased DMP1 expression in OA

osteocytes may be indicative of elevated bone turnover resulting in increased

subchondral bone volume in OA samples, a characteristic feature of OA. Indeed, we

demonstrated that bone turnover markers (ALP, OPN, OCN, MMPs, and TRAP)

were significantly up regulated in OA samples compared with controls, indicating an

underlying potential mechanism of osteocytes in OA subchondral bone changes. This

also may indicate defective osteocyte phenotype in OA progression to produce

SOST, instead with more DMP1 production.

Osteocytes and the connections among them are highly dynamic, as

evidenced by constant contraction and expansion of osteocyte bodies within the

lacunae and by the extension and retraction of dendrites thus adapting to mechanical

load [206] . This may imply that the shape of osteocytes is determined by external

loading and imbalanced mechanical stimulation can lead to morphological changes.

Our SEM results showed that OA subchondral bone osteocytes (OA osteocyte

phenotype) were more sphere-shaped, rough and were not aligned in any particular

direction. However, the patient matched control osteocytes (Normal osteocyte

phenotype) showed stretched shape and aligned distribution. These results indicate

that an irregular morphology of osteocytes might predispose OA that might alter the

ability of bone to sense mechanical stimuli leading to significant changes in the

structure and mineral density. It could be interpreted as phenomena where the signals

passing through osteoblasts and osteoclasts could be hampered. Indeed, increased

osteogenic activities (ALP, OPN and OCN expression) and increased osteoclastic

activity (TRAP staining) were noted in OA subchondral bone.

An adequate number of osteocytes are essential to remove bone

microdamage, and the osteocyte density correlates with the quality of bone [207]. In

this study we found that average osteocyte lacunae (Avg.OS.Lac) number was

significantly higher in OA bone compared to normal’s, however no significant

differences were observed with respect to total number of osteocyte nucleus count.

This could be explained by the increased osteocyte apoptosis, showing TUNEL

positive osteocytes in OA samples.

Our results clearly showed that rough, lysed and rounded appearance of the

lacunae and canaliculi of osteocytes in OA samples. To adapt to mechanical stimuli,



osteocytes modulate their own mechanical environment through increase and

decrease in its attachment to the matrix [208]. MMPs are well recognized as

mediators of matrix degradation, and their activity by virtue of the cleavage of matrix

substrates are well known. As expected we found that MMP-1, MMP-9 and

ADAMTS4 were all significantly increased in OA compared to control samples

giving a possible indication to assume that the osteocyte morphology will corrode its

coupling to the matrix by producing digesting enzymes such as MMPs. The function

of osteocyte through death and the expression MMPs in bone remodelling and joint

disease has been emphasised in various independent research [209-211]. Role of

osteocytes in the regulation of bone resorption has been largely unknown. TRAP

staining has been regarded as one of the reliable markers of osteoclasts. Few studies

have shown the expression of TRAP in osteocytes close to the bone resorbing surface

and its relation to MMPs [212-214]. With this in view, TRAP positive and MMPs

positive osteocytes could be viable and it could control the direction of osteoclastic

resorption in OA subchondral bone. However, these results need further investigation

to understand the cellular interactions between TRAP positive osteocytes and

osteoclasts during bone resorption.

3.6 CONCLUSION

Our study provides evidence that OA osteocyte phenotype has distinctive

changes both phenotypically and morphologically. We conclude that the OA

osteocyte phenotypic changes are responsible for the OA subchondral bone

pathogenesis that could be caused by the activation/deactivation of osteocyte

signalling molecules in the OA microenvironment.

3.7 ACKNOWLEDGEMENTS

This study is supported by the Prince Charles Hospital Foundation (MS2010-02) in

Brisbane, NHMRC project fund (APP1032738), and the Australian Orthopaedics

Association Research Foundation.

Chapter 4 Altered osteocyte changes and the involvement of osteocyte WNT β-catenin signalling pathway in a

surgically induced osteoarthritis rat model 83

Chapter 4: Altered osteocyte phenotype and

the involvement of osteocyte

WNT β-catenin signalling

pathway in a surgically induced

osteoarthritis rat model




Marie-Luise Wille Performed microCT and reviewed the manuscript.

Nishant Chakravorty

Assisted in laboratory experiments and critiquing the manuscript.

Siamak Saifzadeh Performed the surgery on rats. Ross Crawford Involved in the conception of the project, manuscript

preparation and reviewing. Yin Xiao Involved in the conception and design of the project,

manuscript preparation and reviewing.




84 Chapter 4 Altered osteocyte changes and the involvement of osteocyte WNT β-catenin signalling pathway

in a surgically induced osteoarthritis rat model

4.1 ABSTRACT

Introduction Subchondral bone sclerosis is recognized as a clinical sign in

osteoarthritis (OA). Although osteocytes play a central role in regulating bone

remodelling, their involvement in OA subchondral bone pathophysiology is poorly

defined. Our recent studies suggest that dysregulated osteocytic proteins contribute to

the pathological changes in subchondral bone of OA patients. The aim of this study

was to investigate whether surgically induced rat OA model (medial minesectomy)

could induce similar subchondral bone changes identified at the clinical situation.

Methods OA was induced in twelve week-old Wistar Kyoto rats by the removal of

the medial meniscus (MSX). For bone remodelling study, fluorochrome calcein was

injected 6 weeks post-surgery intraperitoneally and fluorochrome alizarin was

injected 10 days after calcein injection. Rats were sacrificed at 8 weeks post-surgery

and tissue samples were collected and processed by both decalcified and

undecalcified methods for the study of subchondral bone and osteocyte phenotype by

micro-CT, scanning electron microscope (SEM), histology and

immunohistochemistry.

Results Increased progression of subchondral bone remodelling was detected in rat

MSX model with significant accumulation of calcein and alizarin, indicating

increased net bone formation at both time points of fluorochrome injection in MSX

surgery compared to the SHAM. Micro-CT and SEM showed high subchondral bone

volume with altered osteocyte morphology in the MSX group. Further histological

analysis of the MSX group demonstrated higher numbers of osteocytes expressing

DMP1, E11, apoptosis, and TRAP compared to SHAM controls, whereas a

decreased number of SOST expressing osteocytes were found. WNT signalling

pathway proteins (β-catenin, AXIN2) were significantly increased in MSX

osteocytes. Conversely, DKK1 was significantly decreased in MSX osteocytes

compared to SHAM controls.

Conclusion These results demonstrated the changes of subchondral bone and

osteocytes in a rat MSX model, which is similar to human OA, indicating a potential

regulatory role of osteocytes in subchondral bone remodelling and mineral

metabolism via WNT β-catenin signalling pathway during OA pathogenesis.



4.2 INTRODUCTION

Joint instability, particularly following trauma, has long been considered a

predisposition to OA in humans and animals. The key pathophysiological features of

OA joints include abnormal subchondral bone metabolism and articular cartilage

degeneration [176]. OA is a heterogeneous condition in which various different

pathways culminate in a common clinically characteristic joint/organ failure [19,

111]. OA is one of the oldest known diseases and yet its aetiology is largely

unknown and widely debated [215]. A fine balance between bone resorption and

bone formation is required to maintain skeletal homeostasis. In OA, this balance is

site-specifically altered with hampered mineral metabolism.

The lack of accurate correlation between characteristic clinical features and

pathobiological changes of human joints has placed animal models and in vitro

studies as the corner stone to explore and clarify the molecular pathogenic events that

occur at onset and progression of OA [116, 216]. These animal models serve also to

help us better understand this complex, multidisciplinary, organ level disease. These

models are necessary, dynamic and cannot simply be replaced by in vitro studies

[215]. Various studies and characterisation of therapeutic targets have been tested on

different OA animal models including rats due to their similar histopathological

features to humans and their minimal spontaneous degeneration in knee joints.

Therefore, the changes in the knee joints can be directly associated to the surgical

intervention [217].

The MSX rat model is well characterised and widely used to study the

detection and progression of OA [218-220] as well as test the efficacy of new

therapeutic drugs [42, 221]. However, biological, mechanical and pharmaceutical

investigations have mainly focused on chondrocyte, osteoblast and osteoclast

changes, not osteocytes. Osteocytes, the “embedded warriors” make up 90% of the

bone cells but they are the least studied cell in the literature indicating that their role

has been underestimated until now [15, 88]. Several challenges have constrained and

are still limiting researchers from exploring the role of osteocyte in physiology and

pathology due to its unique location and morphology [222, 223]. However, research

in the last few years has focused extensively on osteocytes and places these cells as

vital communicators, central to the regulation of mineral metabolism and bone



remodelling [79, 224]. Given OA is a multifactorial disease with altered joint

geometry and mechanical knee misalignment, for the first time, our research

demonstrated that osteocytes undergo dramatic morphological and phenotypical

changes in human knee OA patients and this could lead to or be the cause of the

observed altered bone and mineral metabolism [225]; however, it is unknown how

these changes correlate with the rat menisectomy model, which is routinely used to

understand OA. Therefore, it is important to understand if the integrity of the

osteocyte cell network and mineral metabolism is altered in an OA MSX rat model

and if it closely mimics the human situation to explore and assess the OA disease

progression. Apart from phenotypic changes, understanding the molecular

mechanisms such as WNT signalling that govern osteocytes is critical to explore

disease-modifying drugs.

WNTs are a family of cysteine–rich, 19 secreted glycoproteins that locally

activate receptor-mediated signalling pathways. The WNT Signalling pathway and

its function in bone homeostasis are well documented. WNTs are associated with

postnatal cartilage differentiation, cartilage matrix catabolism and inhibition of

chondrocyte apoptosis. In addition, it is known to play an important role by

controlling differentiation of bone forming osteoblasts and bone resorbing osteoclast

[149]. Although WNT proteins signal through several pathways, the canonical

pathway appears to be particularly important for bone biology, its complexities and

its current understandings in critical aspects of skeletal biology have been reviewed

by many researchers [150, 151]. However, osteocyte biology research is becoming

intense with new evidence suggesting that osteocytes use the WNT β-catenin

signalling pathway to communicate and control bone mass, confirming that

osteocytes are the key regulators of bone homeostasis [29]. Adding to this fact,

WNT signalling pathway has also been closely linked to hampered cartilage-bone

homeostasis, mineral metabolism and inflammation in OA [27, 173].

This study therefore evaluated and assessed the MSX rat model to recapture the

observed subchondral bone, mineral metabolism and osteocyte phenotype in OA

patients; and to allow the investigation of subchondral bone, osteocyte changes and

the involvement of osteocyte WNT β-catenin signalling in OA pathophysiology.




Animals and OA induction:

Animal ethics approval for this project was granted by Queensland University of

Technology and Prince Charles Hospital Ethics Committees . Male Wistar Kyoto rats

(12 weeks and weighing approximately 320 g) were purchased from the Medical

Engineering Research Facility (Brisbane, Australia). The animals were housed under

conditions that included a controlled light cycle (light/dark: 12 h each), controlled

temperature (23 ± 1°C), and were allowed to habituate themselves to the housing

facilities for at least 7 days before surgeries.

OA was induced surgically by removing the medial meniscus (MSX group-Figure

4-1, a-c), the medial collateral ligament was transected to open the joint space and

the meniscus was reflected towards the femur. The meniscus was then cut at its

narrowest point without damaging the tibial surface resulting in complete medial

meniscus transection. The surgical wounds were closed by suturing the subcutaneous

tissue layers using 3/0 Vicryl sutures and the skin was closed using skin staples.

Induction of general anaesthesia was achieved in an isoflurane chamber (mixture of 2

lit/min O2 and 5% isoflurane), and anaesthesia was maintained with 2% isoflurane in

1 lit/min O2 using a rat size nose cone. The left knee was used as the Sham/Control

group and subjected to the same surgical procedure without the excision of the

ligament or any meniscus manipulation. The control group was injected with 0.9%

saline only.



Figure 4-1Rat surgery set-up and procedure

Surgery room set up (a); (b-c) Medial menisectomy surgery: The medial collateral ligament was

transected to open the joint space and the meniscus is reflected towards the femur. The meniscus was

then cut at its narrowest point without damaging the tibial surface resulting in complete medial

meniscus transection. (d-f) Rats injected intra-peritoneally with bone markers (calcein and alizarin).

Tissue processing and morphological characterisation

Whole knee joints were removed by dissection, fixed in 4% paraformaldehyde and

decalcified in 10% EDTA for paraffin embedding as described previously [225] and

these were used for histology and immunohistochemical stains or whole knee joints

were processed for hard tissue embedding using Technovit 9100 New® as described

below and these sections were used for TRAP and H&E staining. Each specimen was

H&E stained to visualize the general morphology. OA severity in the tibial plateau

was evaluated according to a modified Mankin histological grading system [226] and

a cartilage destruction score was assigned for each knee joint by three independent

assessors.

Histology tissue preparation – Hard tissue embedding and sectioning

Technovit 9100 New® (Heraeus Kulzer GmbH, Germany) is a low temperature

MMA embedding system used for non decalcified bone. The standard manufacturer

guide was used to embed fixed samples. Briefly, fixed samples (4% PFA) were

dehydrated in increasing concentrations of alcohol (70%, 80%, 90%, 100% - 3 days

each concentration at 4C). Samples were defatted in xylene for 5 hours and pre-



infiltrated for 5 days followed by infiltration for 5 days at 4C. Polymerization was

performed by mixing polymerisation solutions made according to Technovit 9100

New® brochure. EXAKT cutting and grinding system (Germany) was used to obtain

sections of 60-90microns for staining and analysis.

Bone marker injections:

Figure 4-1,d-f shows calcein (10mg/kg, Sigma Aldrich) was injected intra

peritoneally 6 weeks post-surgery (MSX-Medial Menisectomy). Alizarin (20mg/kg,

Sigma Aldrich) was also injected intraperitoneally 10 days after calcein. Rats were

sacrificed at 8 weeks post surgery.

Equilibrium Partitioning of an Ionic Contrast agent via microcomputed

tomography (EPIC-microCT)

Knee joints (after fixing in 4% paraformaldehyde) were soaked for 30 mins in an

ionic contrast agent Hexabrix (40% Hexabrix/60% phosphate buffered saline

solution). The severities of OA subchondral bone changes in MSX with its sham

group were determined using a high resolution microCT scanner (μCT40, SCANCO

Medical AG, Switzerland) Femur and Tibia were scanned with isotropic voxel size

of 16 μm (nominal resolution) in PBS as scanning medium. The x-ray tube voltage

was 45 kV and the current was 177 μA, with a 0.5 mm aluminium filter. The

integration time was 200 ms. The obtained images were segmented with an inbuilt

software using constant thresholds to distinguish bone and cartilage. A circular area

(0.004 cm2) of interest was selected in the middle of the load bearing subchondral

bone areas. The selected area included only the subchondral bone plate and not the

subchondral trabecular bone and growth plate tissue. A total of 30 consecutive

tomographic slices were analysed. The meaningful subchondral bone plate

measurements such as bone volume (mg HA/ccm) and BV/TV (%) were analysed

using inbuilt software. Subchondral bone thickness was measured quantitatively

using Axio Vision software by converting number of pixels to micro meters.

Tartrate resistant acid phosphatase (TRAP) staining of paraffin embedded

samples

To detect osteoclast activity, TRAP staining was performed as described previously

[225]. Paraffin sections of 5 μm thickness were deparaffinised in two changes of

xylene (8 min each) and rehydrated (2 changes 95% ethanol, 2 min each; 1 change



70% and 50% ethanol each 5 min, deionised water 5 min). After rehydration,

samples were placed in 0.2 M Acetate Buffer (0.2 M sodium acetate and 50 mM L(+)

tartaric acid in ddH2O, pH 5.0) for 20 min at room temperature. Sections were then

incubated with 0.5 mg/ml naphtol AS-MX phosphate (Sigma) and 1.1 mg/ml fast red

TR salt (Sigma) in 0.2 M acetate buffer for 1-4 h at 37ºC until osteoclasts appeared

bright red. Samples were counterstained with Haematoxylin, air dried and mounted

with ProLong® Gold (Invitrogen) mounting solution.

H&E staining

Tissue slices were dewaxed in xylene and dehydrated in descending concentrations

of ethanol (100% to 70%), and sections were then stained with Mayers’s

haemotoxylin for 1-2 minutes before washing with tap water for 5 minutes. The

slides were dehydrated in ascending concentration of ethanol (70% to 100%), stained

with eosin for 15 seconds and cleared with xylene to be mounted on DePeX

mounting medium (BDH Laboratory Supplies, England).

Immunohistochemistry

Immunohistochemistry was conducted using an indirect immunoperoxidase method.

Tissue slices were dewaxed in xylene and rehydrated. Endogenous peroxidases were

blocked by incubation in 0.3% peroxide for 30 min followed by repeated washing in

PBS. The sections were then incubated with proteinases K (DAKO Multilink, CA,

USA) for 20 min for antigen retrieval. The next step treated all sections with 0.1%

bovine serum albumin (BSA) with 10% swine serum in PBS. Sections were then

incubated with optimal dilution of primary antibody overnight at 4 °C ( Table 4-1).

Optimum concentration of antibodies was determined using a series of dilutions.

After 24 hours, sections were incubated with a biotinylated swine-anti-mouse, rabbit,

goat antibody (DAKO Multilink, CA, USA) for 15 min, and then incubated with

horseradish perioxidase-conjugated avidin-biotin complex for 15 min. Antibody

complexes were visualized by adding buffered diaminobenzidine (DAB) substrate

for 3 min and the reaction was stopped by rinsing sections in PBS. Sections were

counterstained with Mayer’s haematoxylin for 10 sec each, and rinsed with running

tap water. Following this, slides were dehydrated with ascending concentrations of

ethanol solutions, cleared with xylene and mounted with a coverslip using DePeX

mounting medium. Controls for the immunostaining procedures included conditions



where the primary antibody and the secondary (anti-mouse IgG) antibodies were

omitted. An irrelevant antibody (anti CD-15), not present in the test sections, was

used as an additional control. A list of antibody sources and dilutions used for this

study are in Table 4-1. Meaningful parameters to describe area of interest were

determined by measuring the thickness of the subchondral plate in all samples under

10 x magnification and calculating the average length and calculating the average

area. The percentage of positive staining cells in 3 fields of view per sample was

counted to quantify.

Table 4-1 A list of antibodies, sources and working dilutions used for immunohistochemistry


Sclerostin 1:100 Gift from Prof Jian Q Feng

DMP-1 1:1000 Gift from Prof Jian Q Feng

E11 ab10288 1:250 Abcam

DKK1 ab109416 1:100 Abcam

β-Catenin #9581 1:200 Cell Signaling

AXIN-2 ab107613 1:200 Abcam

In situ cell death detection (apoptosis) using TUNEL

Osteocyte apoptosis was assessed principally at a single cell level, based on labelling

of DNA strand breaks (Terminal deoxynucleotidyl transferase dUTP nick end

labelling or TUNEL technology) using In Situ Cell Death Detection Kit, Fluorescein

(Roche, Germany) according to manufacturer’s protocol. Tissue sections were

permeabilised for 30min at 37 °C with Proteinase K solution (Roche, Germany). As a

positive control, sections were treated with DNase1 for 10 min at room temperature

prior to the labelling procedure which was used to induce DNA strand breaks. The

tunel reaction mixture / terminal transferace was omitted for the negative control.

The subchondral bone plate was defined as starting from the calcified cartilage (CC)





plate in all samples under 10 x magnifications and calculating the average length and

calculating the average area. TUNEL positive osteocyte was counted in 3 fields per

section within the defined area of interest using AxioVision Rel 4.8 Software. The

average TUNEL positive osteocyte between control and OA are represented in a bar

graph.

Statistical analysis:

Paired Student’s t-test was used to determine any significance between control vs.

OA subchondral bone, by counting the % positive staining cells in the field of view

for immunohistochemistry, by counting the Avg OS.N and Avg OS.L (per unit area)

for distribution studies, within the area of interest. * p ≤ 0.05 was considered

significant.

4.4 RESULTS

Changes in gross morphology of the joints and disrupted osteocyte distribution

in MSX

Animals recovered quickly after surgery with no wound healing complications.

Animal behaviour and weight was monitored and no significant differences were

found between SHAM and MSX rats. All rats were initially assessed using H&E and

micro-CT data. MSX showed high subchondral bone volume compared to SHAM

control at 8 weeks post-surgery similar to human OA changes reported previously

[225]. Figure 4-2 (a-b) shows representative images of safranin-o stained coronal

sections of SHAM and MSX rat tibia, 8 weeks post surgery. Sham controls shows

smooth cartilage surface with well-ordered cartilage zones. MSX group shows

fibrillated articular cartilage and proteoglycan depletion compared to SHAM

controls. Distribution of osteocytes is very evident in the subchondral bone. Red

arrows represent osteocyte nucleus and yellow arrows represent empty osteocyte

lacunae. Bar graph shows (Figure 4-2, c&d) average osteocyte lacunae (Avg.OS.Lac)

density (p=0.001) and average osteocyte nucleus (Avg.OS.N) density (p=0.001) or

viable osteocyte count, per unit area that was significantly increased in MSX group

compared to SHAM controls. (Figure 4-2, e&f) shows representative SEM images of

osteocytes from the subchondral area of MSX and SHAM. Osteocytes in the MSX

group were disorganised with broken canalicular network compared to



well-organised and preserved canalicular network in SHAM controls. These results

show typical OA subchondral bone changes with hampered osteocyte distribution

and morphology indicating drastic subchondral bone changes.

Chapter 4 Altered osteocyte changes and the involvement of osteocyte WNT β-catenin signalling pathway in a surgically induced osteoarthritis rat model 94

Figure 4-2 Disrupted osteocyte distribution and morphology

(a-b and enlarged image) Safranin-O-stained images of rat tibia - 2 months post surgery, shows altered osteocyte distribution and proteoglycan depletion in the cartilage. (c-d)

Average osteocyte nucleus and average osteocyte lacunae was increased in MSX group compared to Sham.; (e-f) SEM images showing disrupted osteocytes in the

subchondral area of MSX compared to SHAM. S: SHAM / Control group; M: MSX / OA group * statistically significant compared to S; *p ≤ 0.05; n=5.



Altered micro-architectural and mineral properties of MSX subchondral bone

compared to SHAM controls

Equilibrium Partitioning of an Ionic Contrast agent via microcomputed

tomography (EPIC-microCT) was used to non-destructively assess cartilage

morphology and quantify the bone changes on the same sample. Figure 4-3, a&c

shows representative 3-D reconstructions of coronal section and Figure 4-3, b&d

shows axial view of sham and MSX tibia from EPICmicro-CT. SHAM group shows

preserved, smooth cartilage; subchondral bone has well-structured spaces and

trabaculae. The Medial compartment of the MSX group shows subchondral cysts,

fewer trabaculae with larger hollow spaces, osteophyte formation and increased bone

remodelling rate compared to SHAM controls. Quantitative data indicate that there is

a significant increase in the mineral content (Figure 4-3, e) and bone volume (Figure

4-3, f) of the MSX group compared to SHAM controls. These results indicate altered

subchondral bone remodelling and altered mineral metabolism.

Macroscopic analysis of MSX and SHAM control joint 8 weeks post surgery.

Figure4-4 (a&b) shows representative macroscopic, fluoro-stereomicroscope

images of SHAM control and MSX tibia at 10 weeks post surgery. All rats with

MSX surgery developed cartilage lesions and bone exposure in the medial

compartment of the tibia. Macroscopically the SHAM controls showed no cartilage

damage in the medial and lateral tibial plateau. Significant calcein and alizarin label

accumulation were detected along the margins and area of the medial compartment

of the tibial plateau. The intensity (mean grey value) of the fluorescence was

assessed in images captured using the same exposure time and magnification using

image J and MSX group shows, statistically significantly higher relative alizarin

(p=0.0011) (Figure 4-4, c) and calcein (p=0.0074) (Figure 4-4, d) expression

compared to SHAM controls that showed no such accumulation of fluorochrome

lables. Figure 4-4, e&f are representative coronal sections (Hard tissue embedded

and ground to 60μ thickness) showing progression of bone marker accumulation and

suggests increased bone remodelling with increased net bone formation at both time

points of injection and developing osteophyte.



Figure 4-3 : Altered micro-architectural and mineral properties in SHAM and MSX

subchondral bone

(a&b) shows representative 3-D reconstructions of coronal section and axial view of SHAM and

MSX tibia (c&d) from EPICmicro-CT scans after incubating with the contrasting agent, Hexabrix.

Quantitative shows mineral content (e) and bone volume (f). These results indicate significantly

increased bone volume fraction and mineral content quantitative data in MSX group compared to

SHAM group. S: SHAM / Control group; M: MSX / OA group * Statistically significant compared to

S; *p ≤ 0.05.



Figure4-4 Macroscopic images and mineral distribution of the MSX and SHAM joint 8 weeks

post surgery

(a) Whole joint flurochrome images of SHAM group shows smooth, full thickness cartilage on the

tibial join with no bone exposure. Whereas, (b) MSX/OA group shows cartilage lesions, bone

exposure on the medial compartment, accumulation of calcein (green, injected at week 6) and alizarin

(red, injected at week 8) along the margins of the tibial plateau. c&d shows progression of bone

marker accumulation in coronal sections and suggests increased bone remodelling with increased net

bone formation and developing osteophyte at both time points. When quantified, e&f shows MSX

group has significantly higher relative alizarin and calcein expression compared to SHAM. S: SHAM

/ Control group; M: MSX / OA group * Statistically significant compared to S; *p ≤ 0.05; n=9.



Dysregulated osteocyte markers in OA osteocytes

Osteocytes selectively express sclerostin/SOST, which is also characterised

as a WNT antagonist. Comparative quantitative immunohistochemical analysis of

SOST expression in the MSX group revealed that the percentage fraction of SOST-

positive osteocytes among total osteocytes in the subchondral bone is significantly

less compared to SHAM controls (p=0.0022) (Figure 4-5, a-c). Conversely, osteocyte

staining of Dentin Matrix Protein 1/ DMP1 characterised as a regulator of mineral

metabolism, had significantly higher percentage of DMP1 positive osteocytes in the

MSX group compared to SHAM controls (p=0.0078) (Figure 4-5, d-f).

E11/Podoplanin an early osteocyte marker was significantly increased in MSX group

compared to SHAM controls (p=0.001) (Figure 4-5, g-i). These results indicate

dysregulated osteocyte phenotype and a possible reason for subchondral bone

sclerosis and hampered mineral metabolism.

Increased TUNEL and TRAP positive staining in MSX osteocyte

Increased osteoclast activity accompanied by defective osteoclast is well

documented in the pathophysiology of OA. Interestingly, (Figure 4-6, a-c) TRAP

(indicates bone resorption) stained MSX tibia sections showed significantly

increased average number of TRAP positive osteocytes compared to SHAM controls

(p=0.0001). TUNEL (indicates apoptosis) stained section (Figure 4-6, d-e) reveals

that there are significantly more osteocytes undergoing apoptosis compared to

SHAM controls. The average TUNEL positive osteocyte between MSX and SHAM

control group are represented in a bar graph (p=0.0021) (Figure 4-6, f). These results

indicate that osteocytes could play a role in directing osteoclastogenesis in OA

subchondral bone.

Disrupted WNT β-catenin signalling proteins in MSX subchondral bone

osteocytes

Osteocyte WNT β-catenin signalling is required for normal bone

homeostasis. Quantitative immunohistochemical analysis revealed that MSX group

showed significantly increased average percentage of (Figure 4-7, a-c) β-catenin

(p=0.0075), and (Figure 4-7, d-f) AXIN 2 positive osteocytes (p=0.0089) in the MSX

group compared to SHAM controls. Conversely, DKK1 (WNT antagonist) was



significantly decreased in the osteocytes of the MSX group compared to SHAM

controls (p=0.001) (Figure 4-7, g-i).

Figure 4-5 Dysregulated osteocyte markers

Immunohistochemical analysis revealed that MSX group has a lower expression of (a-c) sclerostin

positive (SOST: a negative bone regulator/WNT antagonist) osteocytes compared to SHAM.

Conversely, the expression of (d-f) Dentin Matrix Protein 1 (DMP1: mineralization marker), (g-i) E11

(early osteocyte marker) was significantly higher in MSX group compared to SHAM. S: SHAM /

Control group; M: MSX / OA group * statistically significant compared to S; *p ≤ 0.05; n=4.



Figure 4-6 Defective osteoclast, osteocyte TRAP expression and increased apoptosis

TRAP (indicates bone resorption) stained sections shows increased number of defective osteoclast and

TRAP stained osteocytes in MSX group compared to SHAM (a-c) , A representative TUNEL stained

section (d&e) shows that a significantly higher number of osteocytes were undergoing apoptosis in

MSX group compared to SHAM. S: SHAM / Control group; M: MSX / OA group * Statistically

significant compared to S; *p ≤ 0.05; n=5.



Figure 4-7 Dysregulated WNT β-catenin signalling proteins

Immunohistochemical analysis revealed that the MSX group has higher expression of AXIN2 (a-c)

and, β-catenin (d-f) compared to SHAM. Conversely, a lower expression of (g-i) DKK1 positive

(WNT antagonist) osteocytes were found in the subchondral bone area of the MSX group compared to

SHAM. S: SHAM / Control group; M: MSX / OA group. * Statistically significant compared to S; *p

≤ 0.05; n=4.

4.5 DISCUSSION

The pathology of OA is well established. However, its etiopathogenesis is

widely debated and the subject of intense research. Bone and mineral changes have

been well documented in OA but it is unknown if they precede or follow cartilage

breakdown establishing a need for early intervention and better disease modifying

therapeutic drugs [19, 227]. However, the study of early pathophysiological changes

on human OA tissue is practically impossible as most tissues retrieved / collected

from replacement surgeries are at the end-stage of OA. Therefore animal models are



critical in the study of disease progression and onset (or a time-point). This study,

demonstrated that tibial subchondral architecture and remodelling closely mimics

changes observed in human OA subchondral bone and osteocyte in a MSX rat model

(8 weeks post surgery). This is the first study that characterises and associates the

dynamic changes of mineral metabolism, osteocyte molecular markers and the

involvement of WNT β-catenin signalling pathway in OA development.

Bone research has largely focused and targeted on the fuctions of osteoblasts

and osteoclasts and it is now evident that they are altered in OA [3]. Recent in vitro

and in vivo bone studies have emphasised various roles for osteocytes in physiology

and pathology; in OA subchondral bone sclerosis is a recognised manifestation. The

findings from this report support the data from previous in vivo minesectomy studies,

demonstrated that the subchondral plate thickness was significantly increased in the

MSX model compared to SHAM [216, 218]. Fluorochrome labelling at different

time points and EPICmicroCT data demonstrated that mineral content in the medial

compartment significantly increased compared to SHAM. When closely observed,

there is an uneven distribution of mineral content with very high or very low mineral

distribution compared with SHAM.

Osteocytes play an important functional role in regulation of mineralization

via the expression of Dentin Matrix Protein-1(DMP1). Disrupted expression of this

protein leads to defective osteocyte maturation [201, 228]. In our study, consistent

with the increased expression of DMP1 in OA human samples, we observed

significantly increased expression of DMP1. The subsequent increase in E11 (early

osteocyte marker [185]) was significantly increased indicating OA bone has

hampered mineral metabolism with woven bone like phenotype. Decreased osteocyte

expression of SOST (Negative bone regulator/ WNT inhibitor/ BMP inhibitor) in OA

human samples has been well established and associated with increased bone

formation [87, 180]. Results from the study conducted here infer that osteocytes are

not maturing to produce sufficient SOST to maintain bone homeostasis.

Roux in 1881 suggested that bone has the capacity to adapt to mechanical

loading by altering its architecture when bone cells regulate themselves as a result of

local regulation of osteocytes and influenced by mechanical stimuli [229]. Based on

this model, it can be confirmed that the increased osteocyte number per unit area,

observed in the studied MSX group, can be attributed to the increased subchondral



bone volume. Another study conducted by Hernandez et al on osteocyte density

suggests that woven bone has more osteocyte numbers and hence may undergo

remodelling at an accelerated rate compared to cortical bone [230]. Further,

considering that there is sufficient evidence supporting that osteocytes are local

initiators of bone formation/bone remodelling [13] and the MSX model has been

mechanically destabilised, to interpret that the increased subchondral bone with

hampered mineral content (osteoid phenotype) could be the result of an increased

osteocyte number per unit area.

Osteocyte apoptosis and the role of osteocyte in OA osteoclastogenesis or

bone resorption has been emphasised in independent studies [183, 231]. The findings

observed here makes it reasonable to suspect that osteocyte death (TUNEL positive

osteocyte) followed by increased bone remodelling (More bone formation and also

TRAP positive osteoclast and osteocytes indicate more bone resorption) as a

mechanism to heal the bone. Although TRAP positive osteocytes and their functions

have been debated, few studies have shown and evaluated TRAP positive osteocytes

close to the resorbing surface [232, 233]. Owing to the fact that human OA samples

had more TRAP positive osteocytes compared to the controls [225] and recapturing

this in our study reinstates that TRAP positive osteocytes could control the direction

of osteoclast resorption in OA. Together we can say that in OA there is a question of

balance in bone remodelling where there is increased focal bone remodelling with

net bone formation with hampered mineral metabolism.

There is a body of knowledge in WNT β-catenin signalling pathway and an

enormous evidence of the active role of this pathway in OA. However, no targeted

approach for therapy has been elucidated [176-178]. This led us to investigate the

role of this pathway in OA osteocyte to gain a novel mechanistic insight for the OA

osteocyte pathophysiobiology. It is now evident that osteocyte β-catenin signalling

specifically is required for normal bone homeostasis [29, 179]. Molecular response

of articular cartilage to mechanical injury down regulates β-cateninin joints [27,

181]. Previous studies have shown that WNT β-catenin signalling is activated as a

result of mechanical loading on osteocytes and that they are major signalling

pathway for mechanotransduction [29]. This pathway has also been implicated in

osteocyte survival and that osteocyte apoptosis correlates with the increased

osteoclast recruitment and bone resorption [182, 183].



Like SOST, DKK1 is a soluble inhibitor and a master regulator of WNT

signalling pathway playing a balancing role where increased expression is associated

with bone resorption and decreased expression is associated with bone formation. Its

role and levels of expression in OA has been debated [173]. Increased expression of

Plasma and synovial DKK1 was reported and their levels were inversely correlated

with the radiographic severity with knee OA patients [174]. The protective and

deleterious roles of DKK1 and its association with tissue expression is not

known[154]. Our study reveals that MSX rat model has a significantly decreased

expression of WNT inhibitors DKK1 and SOST that promotes WNTs and receptor-

ligand binding and stabilises the expression of phosphorylated β-cateninand further

translocated into the nucleus and increases the expression of target gene AXIN2.

Although activation or deactivation of signalling molecules controlling

osteocytes promise to hold great potential to be high priority targets for novel

therapies, exploration of the biological relevance of decreased osteocyte expression

of DKK1 and SOST in OA is needed before any definite putative conclusions are

drawn. Possibilities that WNT β-catenin pathway could interact with other major

pathways dependently or independently to maintain joint homeostasis.

Together with the current knowledge, this cascade of events in osteocytes and

osteocyte WNT β-catenin signalling pathway could play a major role in the

pathogenesis of OA and could be a possible reason for the focal increased bone

formation, which is followed by deposition of osteoid type of bone due to the

disturbed maturation of osteocytes.

4.6 CONCLUSION

OA MSX experimental rat model resembles the human situation closely

showing similar changes in subchondral bone and osteocyte phenotype.

Investigations in this model showed dynamic changes of mineral metabolism in

subchondral bone plate that may be related to the hampered osteocyte WNT β-

catenin signalling pathway. Osteocytes and their signalling molecules should,

therefore, be a high priority target to unveil the potential mechanism of OA

pathophysiology and for development of potential therapies for OA.




This study is supported by NHMRC project grant and the Prince Charles

Hospital Foundation (MS2010-02). We thank A/Prof Mia Woodruff and her team for

assisting with histology and imaging needs and Dr Indira Prasadam for the bone

volume fraction data.

Chapter 5 Role of osteocyte-WNT β-catenin pathway in long-term, low-dose inflammation and its potential

pathological role in osteoarthritis 107

Chapter 5: Role of osteocyte-WNT β-catenin

pathway in long-term, low-dose

inflammation and its potential

pathological role in

osteoarthritis




Nishant Chakravorty

Involved in the design of the project, assisted in laboratory experiments, data acquisition, analysis and critiquing the manuscript.

Ross Crawford Assisted in manuscript preparation and reviewing. Yin Xiao Involved in the conception and assisted in manuscript

preparation and reviewing.




108 Chapter 5 Role of osteocyte-WNT β-catenin pathway in long-term, low-dose inflammation and its potential

pathological role in osteoarthritis

5.1 ABSTRACT

Introduction: Proinflammatory cytokines are believed to play a pivotal role in the

initiation and development of osteoarthritis (OA) [22]. It has been proposed that OA

may be driven by low-grade inflammatory processes associated with subchondral

bone sclerosis [234]. Tumor Necrosis Factor α (TNFα) is implicated in the

pathophysiology of OA and is associated with bone loss and down regulation of the

WNT β-catenin pathway in osteoblasts [235]. However, effect of TNFα on

osteocytes, which constitute 90% of all bone cells, is unknown. The aim of this study

was to evaluate the molecular regulation of osteogenesis by osteocytes and evaluate

the synergistic effect of osteocytes with osteoblasts under the influence of low-dose

inflammation (TNFα). This study also tests the role of the osteocyte-WNT β-catenin

signalling pathway in these phenomena.

Methods: To test the effect of osteocytes on osteogenesis in an inflammatory

environment, MLOY4 cells (an osteocyte cell line) were cultured under the influence

of low (0.5ng/ml) and high (40ng/ml) doses of TNFα. Soluble factors from low-dose

and high-dose stimulated osteocyte groups were used to culture primary osteoblasts

for 7 days. ALP activity, calcium deposition, the gene expression of ALP, OPN,

COL1 and RUNX2 were used to determine the osteogenic potential in each of the

experimental groups. Gene and protein expression of the osteocyte-WNT β-catenin

signalling pathway (CTNNB1, AXIN2 and DKK1) was monitered in co-culture

experiments.

Results: MLOY4 cells treated with high-dose TNFα demonstrated decreased

osteogenic differentiation. In contrast, MLOY4 treated with low-dose TNFα

demonstrated increased proliferation and osteogenic potential. Further, when soluble

factors from MLOY4 cells after 3-day low-dose TNF treatment were used to culture

primary osteoblasts. Synergistic effect on osteogenesis was demonstrated in a dose

and time dependent manner, showing both increase in osteogenic differentiation

markers and an upregulation of the WNT β-catenin pathway along with a down

regulation of DKK1 compared to controls. The opposite was found in high dose.

Conclusion: These results indicated a differential regulation of osteocytes under the

influence of a low and high-dose of an inflammatory cytokine (TNFα). Low-dose,

long-term inflammation creates a pro-osteogenic niche that potentially modulates the



activities of osteocytes and osteoblasts leading to the activation of the WNT β-

catenin pathway and promoting bone formation. The results of this study indicate

that osteocytes could potentially play a role in subchondral bone sclerosis via the

WNT β-catenin pathway, preconditioned with low-dose long-term inflammatory

mediators.

5.2 INTRODUCTION

The pathogenesis and aetiology of OA is dynamic, complex and unclear with

currently no treatments that prevent or slow the progression of the disease. It is now

accepted that OA is a disease of the entire joint and changes observed in OA are due

to a combination of factors that range from mechanical to biochemical [19]. OA is

characterised pathologically by focal areas of cartilage damage and subchondral bone

changes and it has been proposed that the disease process is associated with low-

grade inflammation [4, 137, 236]. Although low-grade inflammation is detected in

OA, it is viewed as a secondary phenomenon related to the destruction of cartilage

[25].

An increased number of migratory inflammatory cells and the substances

secreted by these cells have been recognised in OA joint tissues [18], leading to

speculation that inflammation may play a major role in OA. Inflammation induced

pathologic bone loss in diseases like RA is well established. This is characterised by

the activation of bone resorption and the inhibition of bone formation associated with

alterations in the WNT signalling pathway, which is an anabolic pathway that

induces maturation and differentiation of osteoblasts [237].

TNFα is a major proinflammatory cytokine that has been shown to suppress

osteoblast maturation in vitro by inhibiting RUNX2 [238]. This in turn, suppresses

its target genes ALP and COL-1 resulting in impaired bone matrix deposition and

mineralization. Increasing evidence indicates that TNFα has an important role in not

only in inflammatory arthritis like RA, but also in degenerative joint diseases like

OA [4]. However, the subchondral bone changes between OA and RA are opposite

with increased bone volume in OA and bone resorption in RA. Even though anti-

TNFα therapy has shown some promising results in the treatment of OA; its

mechanisms of action and its specific role in OA treatment remains unexplored and

heavily debated [5, 239, 240]. Although stimulatory effects of TNFα on osteogenesis



have been well characterised, the dose and time dependent effects on osteocytes have

not been studied until now.

The aim of this study was to evaluate dose and time dependent effects of TNFα

on osteocytes and the synergistic effect of osteocytes and osteoblasts on osteogenesis

(potential to form bone) via the WNT β-catenin pathway.


MLOY4 is a well characterized and established osteocyte cell line derived from

mouse long bones (Kindly provided by Prof. Lynda F Bonewald, University of

Missouri, Kansas City, Texas). These cells were seeded at a density of 2 × 104

cells/well on collagen coated 24 well tissue culture plates (BD Falcon, North Ryde,

NSW, Australia) and cultured in α-minimum essential media (α-MEM),

supplemented with: 5% heat-inactivated fetal bovine serum (HI-FBS, Hyclone); 5%

heat-inactivated calf serum (HI-CS, Hyclone); 1.2 μg/ml Fungizone (Gibco); 60

μg/ml penicillin (Gibco); and Streptomycin (Gibco) at 37°C and 5% CO2 in air.

Osteoblasts were established from redundant tibial bone obtained following knee

replacement surgery (relatively healthy side was chosen to isolate cells) after

informed consent was given by the patients [225]. These cells were seeded at a

density of 2 × 104 cells/well on 24 well tissue culture plates (BD Falcon, North Ryde,

NSW, Australia) and cultured in α-minimum essential media (α-MEM)

supplemented with; 10% fetal bovine serum; 1.2 μg/ml Fungizone (Gibco); 60 μg/ml

penicillin (Gibco); and Streptomycin (Gibco) at 37°C and 5% CO2 in air.

Osteoblasts and MLOY4 cells were treated with pro-inflammatory cytokine,

recombinant human Tumor Necrosis Factor-α (TNFα, dilution range – 0.05ng/ml-

100ng/ml) purchased from Gibco® (Life Technologies - Applied Biosystems,

Mulgrave, VIC, Australia) for 14 days. Following initial dose dependance

experiments, 0.5 ng/ml was chosen as low-dose and 40 ng/ml as high-dose.

Osteocyte media without any cytokine supplementation was used as control.

Conditioned media experiments

On day 3, serum free osteocyte media with TNFα was added to MLOY4 cells. After

24 hours, this media was collected and mixed with fresh media (at a ratio of 2:1) to

make the conditioned media. This conditioned media was then used to culture



primary human osteoblasts. Osteoblast cultures without any cytokine

supplementation was used as ‘control’. ‘Normal’ was assigned to the conditioned

media made from control sample.

Alkaline phosphatase (ALP) activity

Intracellular ALP activity was determined with the Quantichrom™ Alkaline

Phosphatase Assay Kit (Gentaur Belgium BVBA, Kampenhout, Belgium), a p-

nitrophenyl phosphate (pNP-PO4) based assay. Osteoblastic cells were rinsed twice

with PBS, and lysed in 200µl of 0.2% Triton X-100 in MilliQ water, followed by 20

minutes agitation at room temperature. A 50µl sample was then mixed with a 100μl

working solution and absorbance was measured after 5 minutes at 405nm in a

microplate reader.

Calcium assay

Calcium was extracted by incubating the samples in 0.6N hydrochloric acid

overnight and subsequently quantified using the QuantichromeTM Calcium Assay kit

(Gentaur Belgium BVBA, Kampenhout, Belgium) according to the manufacturer’s

protocol [241]. The absorbance was measured at 612nm.

MTT assay

Metabolic activity was assessed by MTT assay using the methods as described

previously [242]. Briefly, 0.5 mg/ml of MTT solution (Sigma-Aldrich) was added to

each well and incubated 37°C to form formazan crystals. The culture media was

removed and the formazan was solubilised with dimethyl sulfoxide (DMSO) after 4

hours. The absorbance of the formazan-DMSO solution was read at 495 nm using a

plate reader. All results were demonstrated as the optical density values minus the

absorbance of blank wells.

RNA isolation

Cells were washed with PBS and lysed using QIAzol lysis reagent (Qiagen Pty Ltd,

Doncaster, VIC, Australia). Total RNA was isolated as described previously [225].

RNA concentrations were assessed using a Nanodrop spectrometer (Thermo

Scientific, Scoresby, Vic., Australia).



Quantitative real-time PCR

cDNA was prepared from 500ng RNA templates by reverse transcription using

DyNAmoTM cDNA Synthesis Kit (Finnzymes Oy., Vantaa, Finland) according to the

manufacturer’s protocol. The mRNA expression of ALP, RUNX2, DMP1, E11,

RANKL and COL1 was assessed. The mRNA expression of key genes of the WNT

β-catenin signalling pathway, β-catenin, AXIN2 and DKK1 was also assessed.

Primers were obtained from GeneWorks Pty Ltd (Hindmarsh, SA, Australia) and are

summarized in Table 5-1. Quantitative real time PCR (qPCR) reactions were

performed using the ABI Prism 7000 Sequence Detection System (Applied

Biosystems). The system enables direct detection of PCR products by measuring the

increase in fluorescence caused by the binding of SYBR Green dye to double-

stranded DNA. The reactions were incubated at 95°C for 10 minutes; and then 95°C

for 15 seconds and 60 °C for 1 minute for 40 cycles. PCR reactions were validated

by observing the presence of a single peak in the dissociation curve analysis. The

housekeeping gene glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) was used

as an endogenous reference gene for analysis using the Comparative Ct (Cycle of

threshold) value method.



Table 5-1 Human and mouse specific primer sequences used for real-time PCR analysis of gene

expression

Mouse specific primers used in this study

Gene name Forward primer (sequence 5’-3’) Reverse primer (sequence 5’-3’)

ALP ATCTTTGGTCTGGCTCCCATG TTTCCCGTTCACCGTCCAC

OPN CAATGAAAGCCATGACCACATGG CTCATCTGTGGCATCAGGATACTG

COL1 AGAACAGCGTGGCCTACATG TCCGGTGTGACTCGTGC

RUNX2 GACTGTGGTTACCGTCATGGC ACTTGGTTTTTCATAACAGCGGA

DMP1 AGATCCCTCTTCGAGAACTTCGCT TTCTGATGACTCACTGTTCGTGGGTG

DKK1 AATCTGCCTGGCTTGCCGAA GTGGAGCCTGGAAGAATTGC

β-catenin TGCTGAAGGTGCTGTCTGTC CATCCCTTCCTGCTTAGTCGC

Axin 2 TCAGGTCCTTCAAGAGAAGCG ACTGCGATGCATCTCTCTCTG

β actin CATACCCAAGAAGGAAGGCTGG TGAGATGGGTCAGGGTTTAGC-

Human specific primers used in this study

ALP ATCTTTGGTCTGGCCCCCATG AGTCCACCATGGAGACATTCTCTC

OPN TCACCAGTCTGATGAGTCTCACCATTC TAGCATCAGGGTACTGGATGTCAGGTC

COL1 AGAACAGCGTGGCCTACATG TCCGGTGTGACTCGTGC

RUNX2 GACGAGGCAAGAGTTTCACC ATGAAATGCTTGGGAACTGC

DKKI TCCGAGGAGAAATTGAGGAA CACAGTCTGATGACCGGAGA

β-catenin GGTGCTATCTGTCTGCTCTAGT GACGTTGACTTGGATCTGTCAGG

Axin 2 GCAGACGACGAAGCATGTC GCCTTTCCCATTGCGTTTGG

GAPDH TCAGCAATGCCTCCTGCAC TCTGGGTGGCAGTGATGGC

Western Blotting

To assess for the activation of the WNT pathways , cells were first washed with cold

PBS and then lysed with Hepes-Triton protein lysis buffer (20 mM Hepes, 2mM

EGTA, 1% Triton X-100, 10% Glycerol, pH=7.4). The lysis buffer was

supplemented with appropriate dilutions of protease inhibitor (cOmplete ULTRA



Tablets, Mini, EDTA-free, EASYpack - Roche Diagnostics Australia Pty Limited,

Castle Hill, NSW, Australia) and phosphatase inhibitors (PhosSTOP Phosphatase

Inhibitor Cocktail Tablets - Roche Diagnostics Australia Pty Limited, Castle Hill,

NSW, Australia). The total protein concentration was calculated by performing a

BCA Protein Assay Reagent (bicinchoninic acid) (Thermo Scientific Pierce Protein

Biology Products, Rockford, Illinois, USA). The protein samples were fractionated

by gel electrophoresis in 10% polyacrylamide gels under reducing conditions and

were transferred to nitrocellulose membranes. The membranes were blocked with 5%

bovine serum albumin (BSA) and probed with primary antibodies overnight at 4 °C.

The next day the blots were washed with Tris Buffered Saline-Tween (TBST) then

probed with their appropriate secondary antibodies. The blots were again washed

(three times) with TBST and then imaged using enhanced chemiluminescence

(ECL). Antibodies used for this technique are listed in Table 5-2.

Table 5-2 A list of antibodies, sources and working dilutions used for western blotting


DKK1 Ab109416

1:1000 Abcam

β-catenin #9581

1:1000 Cell Signaling

AXIN-2 Ab107613

1:3000 Abcam

GAPDH SC-32233

1:2000 Santa Cruz

Statistical analysis

The relative levels of expression of mRNAs were compared between control and the

treated groups using Student’s t test. The DCT value was obtained by subtracting the

average Ct value of the endogenous references selected from the test mRNA Ct value

of the same samples. The DDCT was determined by subtracting the DCT of the

control sample from the DCT of the target sample. The relative mRNA quantification

of the target gene was calculated by 2_DDCT. A value of p < 0.05 was considered

significant. Error Bars are SD.



5.4 RESULTS

Differential regulation of ALP activity on osteocytes and osteoblasts by TNFα.

Figure 5-1 shows ALP activity. Figure 5-1a shows that TNFα inhibit ALP

activity in osteoblasts in a dose dependent manner at all time points except day 1.

Figure 5-1b shows TNFα on osteocytes promoting ALP activity at lower doses of

0.25ng/ml and 0.5ng/ml at every time point compared to its control; at higher-doses

TNFα inhibited ALP activity. At every time point, 0.5ng/ml of TNFα on osteocytes

increased ALP activity significantly compared to 40ng/ml. Based on this differential

regulation on osteocytes, for further experiments, 0.5ng/ml of TNFα was chosen as

low-dose and 40ng/ml of TNFα as high-dose.

Figure 5-1 Effect of TNFα on ALP activity of osteocytes/MLOY4 and osteoblast

(a) Shows dose (range 0-100ng/ml) dependent effect on Day 1, 3, 7, 14 of TNFα on osteoblasts. (b)

Shows dose (range 0-100ng/ml) dependent effect on Day 1, 3, 7, 14 of TNFα on osteocytes. Y axis:

nmoles/min/μg protein represented as fold change to its own day control.* Statistically significant



compared to its control, p<0.05. o 40ng/ml dose is statistically significant compared to 0.5ng/ml dose

of TNF α, p<0.05.

Effects of TNFα on osteogenesis in osteocytes

ALP Activity, MTT proliferation assay and Gene expression

The osteogenic potential was tested at the following time points: day 1, day 3

and day 7. Figure 5-2a shows intracellular ALP activity significantly increasing with

low-dose stimulation of TNFα in osteocytes, whereas opposite effects were observed

with higher doses. MTT proliferation assay in Figure 5-2b shows that there was

increased proliferation of MLOY4 cells stimulated with high and low-dose TNFα at

day 3 with no statistical difference. At day7 with the low-dose of TNFα stimulation,

proliferation was significantly reduced compared to the high-dose and control. Gene

expression data was mixed and for details refer Figure 5-2 c&d. Briefly, at low-dose,

bone markers ALP, OPN, RUNX2, COL-1 was significantly increased or showed an

increasing trend at every time point compared to its controls. At high-dose these

bone marker genes were significantly decreased or showed a decreasing trend at

every time point. Osteocyte media without any cytokine supplementation was used

as control. This data implies that high and low dose of TNFα have the potential to

affect osteocytes differently and specifically, osteocytes have opposite effects on

osteogenesis/ potential to form bone to low and high doses of TNFα.

Chapter 5 Role of osteocyte-WNT β-catenin pathway in long-term, low-dose inflammation and its potential pathological role in osteoarthritis 117

Figure 5-2 Dose and time dependent effects

of TNFα on osteogenesis by osteocytes

(a) Effect of TNFα on intracellular ALP

activity of MLOY4/osteocyte cells

represented as relative expression of

nmoles/min/μg protein (b) MTT assay.

(Effect of TNFα on proliferation of

MLOY4/osteocyte cells) (c) Gene expression

data of (c, i-v) ALP, COL1, OPN, DMP1

and RUNX2 respectively on stimulation with

low-dose TNFα on MLOY4/osteocytes. (d)

Gene expression data of (d, i-v) ALP, COL1,

OPN, DMP1 and RUNX2 on stimulation

with high-dose TNFα on MLOY4/osteocytes

Y axis: relative gene expression normalised

to β-actin represented as fold change to its

controls; * Statistically significant compared

to its control, p<0.05.



Effect of preconditioned (TNFα) osteocytes on osteogenic differentiation of

osteoblasts

ALP Activity, Calcium assay, MTT proliferation assay and Gene expression

Figure 5-3a shows intracellular ALP activity significantly increased when

soluble factors from low-dose TNFα stimulated osteocytes were used to culture

osteoblasts compared to high, normal and control groups. The largest difference was

found when we compared day 7 low-dose group with Day 7 high-dose group.

Calcium deposition shown in Figure 5-3b followed a similar trend as seen in

intracellular ALP activity. MTT assay in Figure 5-3c showed increasing in

proliferation trend from day 1 to day 7 in all groups. Gene expression in Figure 5-3d

presenting data from low-dose TNFα stimulated osteocytes on osteoblasts reveals

that bone markers ALP, OPN, RUNX2 and COL-1 were significantly increased in a

time dependent manner compared to control and normal groups. At high-dose these

bone marker genes were significantly decreased or showed a decresing trend in a

dose and time dependent manner. Also, at every time point, gene expression was

significantly increased in low-dose group compared to high dose group. Osteoblast

media without any cytokine supplementation was used as ‘control’. ‘Normal’ was

assigned to the conditioned media made from control sample. This data implies a

functional relationship between osteocytes and osteoblasts suggesting a

synergistically stronger influence on osteogenesis.


Figure 5-3 Conditioned media experiments:

Effect of preconditioned (TNFα) osteocytes

on osteogenic differentiation of osteoblasts.

(a) Intracellular ALP activity relative

expression of nmoles/min/μg protein. (b)

Calcium assay represented as calcium in

mg/mg protein (c) MTT/proliferation assay (d)

Gene expression data of (d, i-iv) ALP,

RUNX2, COL1, OPN respectively.

Y axis: relative gene expression normalised to

GAPDH, represented as fold change to Day1

control group;

Control: Osteoblast media without any

cytokine supplementation.

Normal: conditioned media made from

control sample.

* Statistically significant compared to its

control within each time point (grey bars), p

<0.05.

o Statistically significant compared to low-

dose of TNF α, p<0.05.



TNFα dose and time dependent regulation of the WNT β-catenin signalling

pathway

Gene and protein expression

Gene expression data in Figure 5-4a reveals that at low-dose stimulation of

TNFα on osteocytes activated the osteocyte-WNT β-catenin signalling pathway with

significantly increased expression of β-catenin, AXIN 2 (target gene) and decreased

expression of the negative regulator of the WNT β-catenin signalling pathway

(DKK1), compared to its controls. However, in higher doses an inhibition of WNT β-

catenin signalling pathway was observed.

The synergistic effect of osteocytes and osteoblasts in the co-culture

experiments produced a stronger response to activate the WNT β-catenin signalling

pathway when low-dose TNFα stimulated osteocytes were used to culture

osteoblasts compared to high, normal and control groups. Figure 5-4b shows a

significantly increased expression of β-catenin, AXIN2 (target gene) and a decreased

expression of DKK1 (negative regulator of WNT β-signalling pathway). Inhibition of

the WNT β signalling pathway was observed in the higher dose group compared to

normal and control groups. Similar trend was observed at the protein level as shown

in figure 5-4d.


Figure 5-4 TNFα dose and time

dependent regulation of the WNT β

signalling pathway

(a) Effect of low-dose TNFα on

MLOY4/osteocytes (a, i-iii) Gene

expression of DKK1, β-catenin, AXIN2

respectively (b) Effect of high-dose

TNFα on MLOY4/osteocytes (b, i-iii)

Gene expression of DKK1, β-catenin,

AXIN2 respectively. For a & b, relative

gene expression normalised to β-actin

represented as fold change to its controls.

(c, i-iii) Gene expression data from

condition media experiments of DKK1,

β-catenin, AXIN2 respectively. Relative

gene expression normalised to GAPDH

represented as fold change to D1 control.

* Statistically significant compared to its

control, p <0.05. o Statistically

significant compared to low- dose of

TNF α, p<0.05. (d) Western blot

showing protein expression of DKK1, β-

catenin, AXIN2.



5.5 DISCUSSION

Pathologic bone loss or gain is characterised by an imbalance in the bone

(re)modelling process that is tightly regulated and highly complex. In contrast to

classical “inflammatory” joint diseases like Rheumatoid Arthritis (RA), that lead to

bone resorption/bone erosion [172], degenerative joint diseases like OA are

characterised by “low-grade” inflammation and new bone formation. However, both

of these diseases lead to a destruction of the joint architecture.

Synovial inflammation (synovitis) has been reflected in many of the signs and

symptoms of OA including joint swelling, effusion, stiffness and redness [243]. This

synovitis is cytokine-driven and there is evidence to suggest that OA chondrocytes

and synovial cells produce cytokines and have receptors to respond to cytokines

[134]. In OA, vascular penetration from the subchondral bone to the cartilage is

evident with an increased expression of inflammatory cytokines in the subchondral

bone [244]. These bone-derived cytokines are believed to diffuse into the cartilage

through fissures at the osteochondral junction [4]. Osteoblasts and osteoclasts are

proven to dysregulate bone (re)modelling in an inflammatory setting in OA [186,

245]. All these factors and tissues are closely linked with complex functional

interactions that impact the entire joint, perpetuating a vicious cycle.

Matzelle M et al demonstrated enhanced bone formation in a declining

inflammatory environment conducted in a serum transfer model of arthritis that led

to the repair of focal bone loss with the activation of the WNT β signalling pathway

[238]. This observation demonstrated that inflammation impairs the ability of

osteoblasts to form bone and that lowering the level of inflammation led to bone

formation. However, the role of osteocytes in inflammation is not elucidated.

Furthermore, Birmingham et al in their novel in vitro 3D co-culture and conditioned

media experiments demonstrated that factors from osteocytes and osteoblasts

produce a stronger response to MSCs to maintain bone homeostasis [246]. Our study

reports the impact (dose and duration) of proinflammatory cytokine (TNFα) on

osteocytes and its synergistic effect with osteoblasts on osteogenesis in vitro.

MLOY4 cells are a well characterised osteocyte cell line [84, 106] and have

been used in this study. Although cytokines (TNFα) are known to be osteoinhibitory



in large doses [143], immunological responses (low-dose inflammation) and

inflammatory modulators are known to be of prime importance in bone healing and

repair after a fracture, and their mechanisms have been implicated in bone

(re)modelling [247].Our study is consistent with this finding implying an anabolic

effect of TNFα.

Gerstenfeld, et. al, in two separate models of bone repair, demonstrated

impaired intramembranous bone formation during bone repair in the absence of

TNFα [248]. In our study, osteoblasts inhibited osteogenesis in a dose and time

dependent manner that is in agreement with previous reports [249]. We demonstrated

that osteocytes/MLOY4 cells exposed to low-dose long-term inflammation promoted

osteogenesis in vitro, whereas high-doses of TNFα inhibited the bone forming

potential of these cells. The bone forming potential of the cells (osteocytes and

osteoblasts) was confirmed by enhanced intracellular ALP activity and the

expression of a panel of genes (ALP, OPN, RUNX2) that have been implicated as

determinants of osteogenesis.

We also show that osteoblasts stimulated with conditioned media from low-

dose TNFα stimulated osteocytes promoted the osteogenic potential, whereas the

inverse (high-dose) promoted bone resorption potential, suggesting a synergistically

stronger influence. This is in line with Birmingham, et. al [246]. It is possible that

with lower and longer term doses of inflammation, osteocytes and osteoblasts may

promote osteogenesis. TNFα (at lower doses) and other proinflammatory molecules,

and their signaling networks, may prepare the niche through osteocytes for the

initiation of an osteogenic response leading to subchondral bone sclerosis as

observed in OA. Effects of TNFα are concentration, time and cell type dependent,

which dictates their metabolic (anabolic or catabolic) outcomes, making TNFα

therapy in OA patients a debatable clinical modality.

Osteocytes play an important functional role via Dentin Matrix Protein-1(DMP1) in

normal postnatal chondrogenesis and subsequent osteogenesis. Disrupted expression

of this protein leads to defective osteocyte maturation [201, 228, 250]. Consistent

with the increased expression of DMP1 in OA human samples (Chapter 3), this study

observed significantly increased expression of DMP1 in osteocytes with low-dose

TNFα, whereas higher doses of TNFα inhibited the expression of DMP1. With this in



mind, in OA perspective, hyperactivation of DMP1 may potentially hamper

osteocyte maturation and mineral deposition in the subchondral bone. This could

further have a role in chondrocyte hypertrophy resulting in cartilage degeneration

and increase the osteogenic activity of osteoblasts, causing OA subchondral bone

thickening or subchondral bone sclerosis.

Fully differentiated cells maintain their specialised character through signalling

pathways. Amongst these signalling factors, secreted proteins from WNT β-catenin

pathways are reported to regulate many critical fundamental biological factors [26].

The role of the WNTs in bone formation and (re)modelling has been reviewed over

the last half decade and its role in OA has been emphasised [27]. More recently, the

osteocyte-WNT β-catenin pathway has been shown to be a major signalling pathway

required for mechanotransduction in bone in vivo [28]. This pathway is also critical

for normal bone homeostasis [29]. Given the importance of the WNT β-catenin

pathway in cartilage and bone biology, specifically its importance in osteocyte

biology and inflammatory arthritis, this study investigated whether this pathway

would play a role in the osteocyte OA pathophysiology. DKK1 (an inhibitor and the

master regulator of the WNT β-catenin signalling pathway), is known to prevent

osteophyte formation by neutralising anabolic repair mechanisms and supporting

catabolic pathways of joint destruction [251]. Diarra et al [172] shows evidence that

the WNT β-catenin signalling pathway, through DKK1 can determine alternative

phenotypes of RA and/or OA-like bone remodelling in the joint repair of

inflammatory arthritis. DKK1 is known to play a key role in controlling not only

osteoblasts but also osteocytes [172]. In addition, TNFα could indirectly stimulate

DKK1 production via a mechanism that is to date unexplored [252]. This study has

shown that the WNT β-catenin signalling pathway was activated via DKK1 in low-

dose inflammation and in high doses of TNFα the expression of DKK1 was

inhibited. The activation of the WNT β-signalling pathway was demonstrated by the

increased gene expression of β-catenin (the read out for WNT signalling pathway),

AXIN2 (target gene in the WNT signalling pathway), and decreased expression of

DKK1.

This study suggests that inflammation, osteodifferentiation and

osteoproliferation are related, and that inflammation triggered by unknown stimuli



(e.g. mechanical stress or injury) drives a bone anabolic process in which the WNT

β-catenin pathway and down regulation of DKK1 play a prominent role. Moreover,

the changes seen in OA are site-specific without any clear explanation. Given that

osteocytes are dendritic, infers a potential to communicate with each other at

preferred distances. This could explain inflammation induced site-specific

(re)modelling.

This study is an important contribution towards elucidating a controversial

topic that inflammation and bone formation are interrelated and could lead to

subchondral bone sclerosis, which is the first insult to a healthy knee joint.

The control of (re)modelling requires not only osteoblasts but also osteoclasts.

This is discussed in the supplementary data, section 7.3.

5.6 CONCLUSION

This study shows that low-dose long-term stimulation of TNFα on osteocytes

could promote bone formation, whereas high-dose has opposing affects in vitro. The

results also show that there is a synergistic, stronger influence of the observed effect

when osteocytes and osteoblasts act together and activate the WNT β-catenin

pathway. The data confirms that a functional relationship exists in the osteocyte-

osteoblast network and that these can regulate differentially under different doses and

duration of inflammation. Site-specifically targeting the TNFα induced osteocyte-

WNT β-catenin pathway could potentially pave the way to reduce or retard the

progression of subchondral bone sclerosis in OA.


I would like to thank Dr.Thor Friis for helping with the primer design for this study.

Chapter 6 Discussion 127

Chapter 6: Discussion

128 Chapter 6 Discussion

OA, an accepted world health problem, is an organ level failure. From a

clinical perspective OA leads to joint pain and irreversible loss of function. This

disease is very heterogeneous and slow to develop but its pathophysiology is

undoubtedly much more complex than a simple “wear and tear” or aging

phenomenon. Moreover, many different processes may play a role in the process of

joint destruction in individual patients. Although there are a number of surgical and

non-surgical ways to deal with this disease, there is currently no cure or disease

modifying drugs. A more detailed understanding of cell and molecular factors

involved in disease progression is required to develop techniques that will identify

the disease process at an early stage and further develop therapies to prevent or slow

the progression of this debilitating disease.

Historically, OA was considered a disease of the cartilage as a result of the

apparent changes seen on and within the cartilage. However, our current

understanding highlights the importance of bone in disease progression. Although

there are chondro-centric and osteo-centric views about the initiation and progression

of OA in the research community, most researchers will now defend a global and

integrated view in which OA is viewed as a disease with an interactive role in

pathology of the whole joint or bone-cartilage unit. An ideal disease treatment should

target both these tissues.

Significant research has been conducted on most cells of the joint, however,

until now, osteocytes have been completely ignored. Therefore, to better understand

OA it is important to identify specific osteocyte factors responsible for structural

changes; view their significance in the progression of OA; it may then be possible to

identify new targets for disease treatment.

Discoveries in the recent years have changed the idea of osteocytes from

being passive, metabolically inactive cells to endocrine cells and orchestrators of

bone remodelling. This represents a paradigm shift in the bone field. Although there

has been speculation that osteocytes could play a role in OA, this thesis is the first

attempt to characterise osteocytes in OA and implicate their biological relevance for

better treatment options.

This project sought to advance the knowledge in understanding the consistent

OA clinical finding, subchondral bone sclerosis, with respect to osteocytes. The

objective being to further investigate and reveal a potential molecular mechanism


involved during this process at in vivo and cellular level in OA pathophysiology. The

ultimate aim of this project, irrespective of the initiating factor (cartilage or the

bone), is to draw a biological relevance with the dramatic changes observed in OA

osteocytes.

Section 2.6.3 and Chapter 3 highlight some of the discrepancies that exist in

the research community with respect to subchondral bone volume and

mineralization. Chapter 3 focuses on human samples. There exist some arguments

about the subchondral bone being hypo or hyper mineralised and whether there is

increased or decreased subchondral bone volume to total volume. To reconcile these

differences in the literature, we characterised the subchondral bone and mineral

changes using different methods and then characterised the osteocyte changes. We

used microCT, immunolocalization of bone markers, histology, gene expression and

western blotting in samples graded according to disease severity. Variables such as

age and gender were considered. The findings from this study indicate an increased

bone volume and hyper mineralization in the subchondral bone of OA patients. In a

finding not previously reported, in this project, dramatic osteocyte morphological

differences were observed. We also quantified the expression of disrupted osteocyte

markers and MMPs. Another interesting finding from this study is that osteocytes are

TRAP positive around the marrow space, implying that osteocytes could potentially

direct osteoclastogenisis or participate in bone resorption. Collectively, this data

shows that osteocytes do change in OA and could play a role in OA

pathophysiology/subchondral bone sclerosis.

Although Chapter 3 focuses on human samples and could be considered the

most biologically relevant results. But tissue was collected from end stage OA

patients requiring knee replacement surgery. Various factors could trigger the

complex detrimental cascades of damage seen in OA. As mentioned previously, it is

very important to identify the disease at the initial phase. The lack of an accurate

correlation between characteristic clinical features and pathobiological changes of

human joints has placed in vivo and in vitro studies as the corner stone to explore and

clarify the molecular pathogenic events that occur at onset and progression of OA

[116, 216]. Therefore Chapter 4 focused on establishing a suitable animal model, that

resembles the clinical situation and allows the investigation of progressive osteocyte

and mineral changes in OA pathophysiology.


Rats were chosen due to their similar histopathological features to humans and

their minimal spontaneous degeneration in knee joints. This is to allow any changes

in the knee joints to be directly associated to the surgical intervention [217]. OA was

initially induced by: (1) transecting the anterior cruciate ligament (ACLT group), (2)

removing the medial meniscus (MSX group); and (3) a single intra articular injection

of Mono-ido-acetate (MIA). The MIA and ACLT groups were excluded as they

showed decreased bone volume compared to the SHAM controls at 8 weeks that was

not consistent with our clinical data. The MSX group showed high subchondral bone

volume compared to the SHAM controls similar to the human clinical condition

shown in Chapter 3. The findings from this study correlate to the changes seen in our

clinical human samples and for the first time, mineral changes and the rate of bone

remodelling was assessed at 2 time points using flurochrome labels. These results

indicate that there is a question of balance in bone remodelling where site-specific

increased bone remodelling was observed with net bone formation and associated

osteophytes at both time points. Osteocyte changes observed at this time point were

similar to the changes observed in human samples.

The OA MSX experimental rat model was shown to resemble the human

situation more closely and is suitable for study of OA subchondral bone osteocyte

pathogenesis. The WNT β-catenin signalling pathway has been implicated in OA and

shown to play an important role in regulating osteocytes to maintain homeostasis.

Therefore, to gain a mechanistic insight, this signalling pathway was analysed in our

animal model. Interestingly, osteocytes from the medial compartment showed higher

WNT activity with a significant reduction in the expression of inhibitors of WNT

signalling, (DKK1 and SOST). These results are very exciting as activation or

deactivation of signalling molecules controlling osteocytes hold great potential to be

high priority targets for novel OA therapies. Supplementary data presented in Figure

7-2 shows preliminary microCT data and disrupted osteocyte morphology 6 months

post MSX surgery as opposed to 2 months post surgery that was investigated in

Chapter 4.

Chapter 4 and the supplementary data presents an enormous body of work

defining mineral changes seen in OA (in vitro, in vivo and clinically), addresses the

question of bone remodelling and indicates a potential regulatory role of osteocytes

in subchondral bone remodeling and mineral metabolism during OA pathogenesis.


For Chapter 5, in the pursuit to create an OA environment Initially, we used

conditioned media collected from human OA and control chondrocytes in 3D

culture, differentiated for 14 days and observed its effect on osteocytes. As expected,

it did show altered bone remodelling and mineral markers. However, defining this

OA environment is complex as soluble factors are patient specific. Inflammation,

considered an old player back in the game, is proposed as a primary driving force for

the progression of OA associated with subchondral bone sclerosis. On the other

hand, tumour necrosis factor (TNFα) has an important role not only in inflammatory

arthritis but also in degenerative joint disease [4]. Anti-TNFα has been shown as a

potential promising strategy for the treatment of OA [5], however, its mechanisms

are unexplored and debated. Therefore in Chapter 5 we hypothesised that osteocytes

could be a key player in this condition.

Based on literature and dose dependent changes observed in Figure 5-1, low

and high doses of TNFα on osteocytes were used. Although cytokines (TNFα) are

known to be osteoinhibitory in larger doses, interesting and unexpected outcomes

demonstrated that osteocytes exposed to low-dose long-term inflammation promoted

bone formation. Another fascinating finding was revealed when the condition media

from low and high-dose stimulated osteocytes were used to grow osteoblasts.

Osteoblasts stimulated with conditioned media (from low-dose TNFα stimulated

osteocytes) promoted bone formation, whereas the inverse promoted bone resorption.

This implies that different levels of inflammation affect osteocytes potential to create

a niche in promoting bone formation differently, this effect could potentially

distinguish OA (characterized by bone formation), from rheumatoid arthritis which is

characterized by bone resorption. WNT was analysed with results similar to the in

vivo results. Chapter 5 may support the theory of hormesis where toxins and other

stressors in low-doses generally promote favourable biological responses. The

question of whether TNFα promotes subchondral bone sclerosis in OA is difficult to

answer at this point given the limitations of this study. Whether or not this study

provides conclusive evidence that TNFα plays a role in subchondral bone sclerosis

via osteocyte-WNT β-catenin signalling pathway is dependent upon and to be

determined by the outcomes and findings of subsequent research on this topic. It may

be the case that inflammation in fact has a protective effect in OA and that bone

resorption simply cannot keep pace in a focal site-specific manner. This being said,


this study provides an important contribution to elucidating answers to a

controversial topic that inflammation and bone formation are interrelated and could

lead to subchondral bone sclerosis, which is the first insult to a healthy knee joint.

As shown in Chapter 3 and 4, osteocytes are dendritic and have the potential to

communicate with each other at preferred distances. This could explain inflammation

induced site specific remodelling. Chapter 5 shows for the first time the effect of

inflammation on osteocytes and their possible role in subchondral bone sclerosis.

The human body is the ultimate system, more advanced than any man-made in

vitro systems/animal models used to study disease progression. It is impossible to

recreate the dynamic complexities of a joint but it is believed that the experimental

work presented here provides strong evidence that osteocytes are altered in OA. This

provides some insight into the molecular mechanisms that control osteocyte induced

site-specific subchondral bone sclerosis in OA. This study also brings a new

perspective to the role of low-dose inflammation in this disease. As well as

answering a number of important questions, this thesis raises a number of further

questions, the answers to which are unclear. Conclusions are limited by a number of

factors that are common to investigations of complex biological processes.

6.1 LIMITATIONS

In Chapter 3 where subchondral bone characterisation studies were undertaken,

samples for these studies were collected from the tibial plateau of patients

undergoing knee replacement surgery. The sclerotic zone of the tibial medial

compartment was used as the OA sample and the lateral compartment of the same

patient used as controls. Although this method is well accepted (as OA is very site

specific), this comparison technique/method is debatable. It would be interesting to

directly compare the tibial medial compartment generated from normal patients to

the tibial medial compartment from OA patients. However, it is very difficult to find

normal samples that are age, gender and disease matched as it would require a very

large repository of human joint tissues.

Chapter 3 and 4, showed TRAP positive osteocytes. Although some studies

have shown the expression of TRAP in osteocytes close to the bone resorbing

surface, its validity and the role of osteocytes in osteoclastogenisis remains


controversial [232]. However the recent publication by Nakashima et al 2011 [92]

shows that osteocytes have a more potent ability to support osteoclastogenesis than

osteoblasts. We believe that the TRAP enzymes have diffused from the bone

resorbing surface through the osteocyte canalicular network under physiological

conditions and are a true representation of TRAP proteins in the respective

osteocytes [232]. This implies that osteocytes have the potential to control the

direction of osteoclastic resorption in OA subchondral bone.

OA normally takes many decades to develop and is multifactorial. Although

the MSX rat model is well characterised and widely used to study the detection and

progression of OA [218, 219], as well as test the efficacy of new therapeutic drugs

[42, 221], it is not an ideal animal model. For example, humans generally discontinue

using an affected limb whereas rats do not. Therefore the disease progression is very

rapid and less amenable to therapeutic intervention in rats. Having said this, there is

no gold standard model that can be truly defined to represent human aetiology and it

is important to consider distinct advantages, disadvantages and documented changes

before implicating it to disease progression and humans.

Studying osteocytes has been a challenging exercise as explained in section

2.5.6. The accrual of knowledge has been relatively slow but new technologies and

models are helping unlock their secrets. One of the major barriers to understanding

bone physiology at in vitro level is that we lack a methodology to study bone cells in

their native environment. In our study the differences seen between the two cell types

(osteoblasts and osteocytes) may be due to species differences. However, MLOY4 is

a well characterised osteocyte cell line. Although MLOY4 is a well characterised and

accepted osteocyte cell line, it is proliferating. In our study we have used it in a 2D

isolated system to mimic a terminally differentiated cell type that lives under the

influence of other types of cells in a 3D environment. Having said this, immortalised

cell lines take advantage of genetic instabilities in cells that have been cultured from

pathological sources; and cell culture methods have an advantage of defining culture

conditions in a controlled environment.

6.2 FUTURE DIRECTIONS

It is clear that this body of work leaves many questions unanswered. However

it is the first attempt to characterise osteocytes in OA, evaluate the osteocyte-WNT


signalling pathway and its involvement in OA and determine the role of low-dose

inflammation in this disease. Upon this background more detailed studies will be

established providing further insights into this subject. It would be of great interest to

test osteocyte site-specific inhibition of WNT activity in OA progression using

DMP1 cre-conditional knock-out animals. It would be exciting to understand TNFα

binding to its receptors and its role in the WNT signalling pathway because, binding

TNFα to TNFR1 is considered to be an irreversible mechanism. Conversely TNFα

binding to TNFR2 is considered both rapid on and off kinetics. However less is

known about the mechanisms of signal transduction and biological function of these

receptors. It is also tempting, based on the in vitro studies, to target low-dose

inflammation and its implications to treat OA. In the last decade, the discovery of

osteocyte potential to effect cells and tissues far beyond the bone suggests that the

research community has only scratched the surface of what the osteocyte is capable

of. Although osteocyte biology has represented a paradigm shift in the bone field,

there are a number of unanswered questions (See Chapter 7, page 148 and

interesting resin filled, acid etched SEM images from pages 149-154 suggesting a

number of possible roles for osteocytes) that could help researchers target osteocytes

in therapeutics for bone dysplasia and possibly have therapeutic potential in disorders

like sarcopenia and even chronic kidney failure.

6.3 CONCLUDING REMARKS

In conclusion, I believe that, although we have opened new doors to new

possibilities of targeting osteocytes as a therapeutic cure for OA, one sole approach

will not be a panacea for OA. Keeping in mind the medical economics and medical

ethics, the cure for OA would be at the crossroads of interdisciplinary medicine

ultimately leading to the better management of OA. Although the results presented in

this thesis are a collection of three years of research, in retrospect, significant work is

needed before the findings in this thesis can be applied clinically. Further

investigations will bring us a step closer towards improving the quality of life for

millions of OA patients worldwide.

Chapter 7 Supplementary data 135

Chapter 7: Supplementary data


7.1 SUBCHONDRAL BONE CHANGES IN RATS INDUCED WITH OA

FOR 6 MONTHS

Figure 7-1 Representative microCT reconstructions of SHAM controls and MSX rats, 2 and 6

months post medial minesectomy surgery

(a) Representative microCT reconstructions of SHAM and MSX rats, 2 months post surgery shows,

joint space narrowing, osteophyte formation at the margins of the joint.(red arrows) Subchondral bone

sclerosis in the medial side of MSX rats (yellow arrows) and well preserved corresponding

subchondral bone area in SHAM controls (b) Representative microCT reconstructions of SHAM and

MSX rats, 6 months post surgery. Apart from joint space narrowing and osteophyte formation (red

arrows), growth plate fusion was observed not only in MSX rats but also in SHAM controls (green

arrows) that was not observed 2 months post surgery. The sclerotic area (yellow arrows) was not only

localised to the medial compartment but had progressed to the lateral compartment.

(a)

(b) Coronal view of knee joint Tibial coronal view Tibial axial view

SHAM

SHAM

MSX

MSX


Figure 7-2 Acid etched tibial bone surface (coronal section) showing morphology of osteocytes in

SHAM controls and MSX rats 6 months post surgery

(a) Shows Representative SEM SHAM control image showing well preserved subchondral bone area.

(c) Shows the morphology of osteocytes in SHAM controls to be well aligned, spindle shaped and

preserved dendrites. (b) Shows subchondral bone thickening in MSX OA (d) represents altered

osteocyte morphology and broken dendrites.


7.2 ROLE OF OSTEOCYTE IN OSTEOCLASTOGENESIS IN A LOW-

DOSE INFLAMMATORY ENVIRONMENT

The control of (re)modelling requires not only osteoblasts but also osteoclasts.

Recent research demonstrates that osteocytes can orchestrate osteoclastic resorption

through the expression of RANK ligand (RANKL). It also demonstrates that the

influence of osteocytes is greater than that of osteoblasts - a role that has previously

been known to be played by osteoblasts to a larger extent [92]. This study (chapter

5) observed the expression of RANKL to be significantly higher in osteocytes

stimulated with low-dose TNFα compared to controls and high-dose TNFα with a

stronger effect in co-culture studies (Figure 7-3). The outcomes of this could

potentially provide justification for the increased bone (re)modelling and associated

net bone formation in OA patients compared to controls. However, this is debatable

given that osteocytes are conventionally considered to function down-stream to

osteoblasts, which subsequently fails to explain the coupling of bone formation and

bone resorption. To further support this, recent findings by Yeong et al presented at

the ANZBMS 2013 conference, demonstrated through highly purified osteocyte cells

via fluorescence activated cell sorting (FACS), that it is in fact osteoblasts that

produce more RANKL than osteocytes. Nonetheless, this study focuses on

osteogenesis and requires further mechanistic studies and validations before it is

applied to any in vitro or in vivo setting.


Figure 7-3 Effect of TNFα on MLOY4/osteocytes on RANKLgene expression

(a,i) Effect of low-dose TNFα on MLOY4/osteocytes on RANL gene expression. (a, ii) Effect of high-

dose TNFα on MLOY4/osteocytes on RANL gene expression. For i & ii, relative gene expression

normalised to β-actin represented as fold change to its control.(c) Gene expression of RANKL from

condition media experiments. Relative gene expression normalised to GAPDH represented as fold

change to day1 control. Refer Chapter 5 for experimental set up and methods.

References 140

References

1. Radin, EL and Rose, RM. Role of subchondral bone in the initiation and progression of cartilage damage. Clinical and Orthopaedic Related Research, 1986(213): 34-40.

2. Prasadam, I, Friis, T, Shi, W, van Gennip, S, Crawford, R, and Xiao, Y. Osteoarthritic cartilage chondrocytes alter subchondral bone osteoblast differentiation via mapk signalling pathway involving erk1/2. Bone, 2010. 46(1): 226-35.

3. Birchfield, PC. Osteoarthritis overview. Geriatric Nursing, 2001. 22(3): 124-30; .

4. Westacott, CI and Sharif, M. Cytokines in osteoarthritis: Mediators or markers of joint destruction? Seminars in Arthritis and Rheumatism, 1996. 25(4): 254-72.

5. Grunke, M and Schulze-Koops, H. Successful treatment of inflammatory knee osteoarthritis with tumour necrosis factor blockade. Annals of the Rheumatic Diseases, 2006. 65(4): 555-6.

6. Hissnauer, TN, Baranowsky, A, Pestka, JM, Streichert, T, Wiegandt, K, Goepfert, C, Beil, FT, Albers, J, Schulze, J, Ueblacker, P, Petersen, JP, Schinke, T, Meenen, NM, Portner, R, and Amling, M. Identification of molecular markers for articular cartilage. Osteoarthritis Cartilage, 2010.

7. Buckwalter, JA and Martin, JA. Osteoarthritis. Advanced Drug Delivery Reviews, 2006. 58(2): 150-167.

8. Ding, M, Odgaard, A, and Hvid, I. Changes in the three-dimensional microstructure of human tibial cancellous bone in early osteoarthritis. The Bone & Joint Journal, 2003. 85(6): 906-12.

9. Lajeunesse, D and Reboul, P. Subchondral bone in osteoarthritis: A biologic link with articular cartilage leading to abnormal remodeling. Current Opinion in Rheumatology, 2003. 15(5): 628-33.

10. Lajeunesse, D, Hilal, G, Pelletier, JP, and Martel-Pelletier, J. Subchondral bone morphological and biochemical alterations in osteoarthritis. Osteoarthritis Cartilage, 1999. 7(3): 321-2.

11. Hilal, G, Martel-Pelletier, J, Pelletier, JP, Ranger, P, and Lajeunesse, D. Osteoblast-like cells from human subchondral osteoarthritic bone demonstrate an altered phenotype in vitro: Possible role in subchondral bone sclerosis. Arthritis & Rheumatology, 1998. 41(5): 891-9.

References 141

12. Boyce, BF, Yao, Z, and Xing, L. Osteoclasts have multiple roles in bone in addition to bone resorption. Critical Reviews in Eukaryotic Gene Expression, 2009. 19(3): 171-80.

13. Schaffler, MB and Kennedy, OD. Osteocyte signaling in bone. Current Osteoporosis Reports, 2012. 10(2): 118-25.

14. Dallas, SL, Prideaux, M, and Bonewald, LF. The osteocyte: An endocrine cell and more. Endocrine reviews, 2013.

15. Rochefort, GY, Pallu, S, and Benhamou, CL. Osteocyte: The unrecognized side of bone tissue. Osteoporosis International, 2010. 21(9): 1457-69.

16. Bonewald, LF. The amazing osteocyte. Journal of Bone and Mineral Research, 2010.

17. Noble, BS and Reeve, J. Osteocyte function, osteocyte death and bone fracture resistance. Molecular and Cellular Endocrinology, 2000. 159(1-2): 7-13.

18. Buckland, J. Osteoarthritis: Complement-mediated inflammation in oa progression. Nature reviews. Rheumatology, 2012. 8(1): 2.

19. Lories, RJ and Luyten, FP. The bone-cartilage unit in osteoarthritis. Nature Reviews Rheumatology 2011. 7(1): 43-49.

20. Botter, SM, Glasson, SS, Hopkins, B, Clockaerts, S, Weinans, H, van Leeuwen, JP, and van Osch, GJ. Adamts5-/- mice have less subchondral bone changes after induction of osteoarthritis through surgical instability: Implications for a link between cartilage and subchondral bone changes. Osteoarthritis Cartilage, 2009. 17(5): 636-45.

21. Anderson-MacKenzie, JM, Quasnichka, HL, Starr, RL, Lewis, EJ, Billingham, MEJ, and Bailey, AJ. Fundamental subchondral bone changes in spontaneous knee osteoarthritis. The International Journal of Biochemistry & Cell Biology, 2005. 37(1): 224-236.

22. Kapoor, M, Martel-Pelletier, J, Lajeunesse, D, Pelletier, J-P, and Fahmi, H. Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nature Reviews Rheumatology, 2011. 7(1): 33-42.

23. Binder, NB, Puchner, A, Niederreiter, B, Hayer, S, Leiss, H, Bluml, S, Kreindl, R, Smolen, JS, and Redlich, K. Tumor necrosis factor-inhibiting therapy preferentially targets bone destruction but not synovial inflammation in a tumor necrosis factor-driven model of rheumatoid arthritis. Arthritis and Rheumatism, 2013. 65(3): 608-17.

24. Kammermann, JR, Kincaid, SA, Rumph, PF, Baird, DK, and Visco, DM. Tumor necrosis factor-alpha (tnf-alpha) in canine osteoarthritis: Immunolocalization of tnf-alpha, stromelysin and tnf receptors in canine osteoarthritic cartilage. Osteoarthritis and Cartilage, 1996. 4(1): 23-34.

142 References

25. Pelletier, J-P, Martel-Pelletier, J, and Abramson, SB. Osteoarthritis, an inflammatory disease: Potential implication for the selection of new therapeutic targets. Arthritis & Rheumatism, 2001. 44(6): 1237-1247.

26. Baron, R and Kneissel, M. Wnt signaling in bone homeostasis and disease: From human mutations to treatments. Nature Medicine, 2013. 19(2): 179-192.

27. Luyten, FP, Tylzanowski, P, and Lories, RJ. Wnt signaling and osteoarthritis. Bone, 2009. 44(4): 522-527.

28. Klein-Nulend, J, Bakker, AD, Bacabac, RG, Vatsa, A, and Weinbaum, S. Mechanosensation and transduction in osteocytes. Bone, 2013. 54(2): 182-190.

29. Kramer, I, Halleux, C, Keller, H, Pegurri, M, Gooi, JH, Weber, PB, Feng, JQ, Bonewald, LF, and Kneissel, M. Osteocyte wnt/beta-catenin signaling is required for normal bone homeostasis. Molecular and Cellular Biology, 2010. 30(12): 3071-85.

30. Buchanan, WW, Kean, WF, and Kean, R. History and current status of osteoarthritis in the population. Inflammopharmacology, 2003. 11(4): 301-316.

31. Braunstein, EM, White, SJ, Russell, W, and Harris, JE. Paleoradiologic evaluation of the egyptian royal mummies. Skeletal Radiology, 1988. 17(5): 348-52.

32. Dequeker, J and Luyten, FP. The history of osteoarthritis-osteoarthrosis. Annals of the Rheumatic Diseases, 2008. 67(1): 5-10.

33. Sarzi-Puttini, P, Cimmino, MA, Scarpa, R, Caporali, R, Parazzini, F, Zaninelli, A, Atzeni, F, and Canesi, B. Osteoarthritis: An overview of the disease and its treatment strategies. Seminars in Arthritis and Rheumatism, 2005. 35(1, Supplement 1): 1-10.

34. Goldring, MB and Goldring, SR. Articular cartilage and subchondral bone in the pathogenesis of osteoarthritis. Annals of the New York Academy of Sciences, 2010. 1192(1): 230-237.

35. Dougados, M. Why and how to use nsaids in osteoarthritis. Journal of Cardiovascular Pharmacology, 2006. 47: S49-S54.

36. Kneitz, C, Tony, H, and Krüger, K. Nsar und coxibe: Aktueller stand. Der Internist, 2006. 47(5): 533-540.

37. Sun, Y and Kandel, R. Deep zone articular chondrocytes in vitro express genes that show specific changes with mineralization. Journal of Bone and Mineral Research, 1999. 14(11): 1916-1925.

References 143

38. Arnold, EL and Arnold, WJ. Use of glucosamine and chondroitin sulfate in the management of osteoarthritis. Journal of the American Academy of Orthopaedic Surgeons, 2001. 9(5): 352-353.

39. Clegg, DO, Reda, DJ, Harris, CL, Klein, MA, O'Dell, JR, Hooper, MM, Bradley, JD, Bingham, CO, Weisman, MH, Jackson, CG, Lane, NE, Cush, JJ, Moreland, LW, Schumacher, HR, Oddis, CV, Wolfe, F, Molitor, JA, Yocum, DE, Schnitzer, TJ, Furst, DE, Sawitzke, AD, Shi, H, Brandt, KD, Moskowitz, RW, and Williams, HJ. Glucosamine, chondroitin sulfate, and the two in combination for painful knee osteoarthritis. New England Journal of Medicine, 2006. 354(8): 795-808.

40. Provenza, JR, Shinjo, SK, Silva, JM, Peron, CR, and Rocha, FA. Combined glucosamine and chondroitin sulfate, once or three times daily, provides clinically relevant analgesia in knee osteoarthritis. Clin Rheumatol, 2014.

41. Takemoto, JK, Reynolds, JK, Remsberg, CM, Vega-Villa, KR, and Davies, NM. Clinical pharmacokinetic and pharmacodynamic profile of etoricoxib. Clinical Pharmacokinetics, 2008. 47(11): 703-720.

42. Abramson, SB, Attur, M, and Yazici, Y. Prospects for disease modification in osteoarthritis. Nature Clinical Practice. Rheumatology, 2006. 2(6): 304-312.

43. Zhang, W, Moskowitz, RW, Nuki, G, Abramson, S, Altman, RD, Arden, N, Bierma-Zeinstra, S, Brandt, KD, Croft, P, Doherty, M, Dougados, M, Hochberg, M, Hunter, DJ, Kwoh, K, Lohmander, LS, and Tugwell, P. Oarsi recommendations for the management of hip and knee osteoarthritis, part ii: Oarsi evidence-based, expert consensus guidelines. Osteoarthritis and Cartilage, 2008. 16(2): 137-162.

44. Seeman, E. Bone modeling and remodeling. Crit Rev Eukaryot Gene Expr, 2009. 19(3): 219-33.

45. O'Hanlon-Nichols, T. Basic assessment series. A review of the adult musculoskeletal system. Am J Nurs, 1998. 98(6): 48-52.

46. Hidaka, C and Goldring, MB. Regulatory mechanisms of chondrogenesis and implications for understanding articular cartilage homeostasis. Current Rheumatology Reviews, 2008. 4(3): 136-147.

47. Pacifici, M, Koyama, E, Iwamoto, M, and Gentili, C. Development of articular cartilage: What do we know about it and how may it occur? Connective Tissue Research, 2000. 41(3): 175-84.

48. Koyama, E, Ochiai, T, Rountree, RB, Kingsley, DM, Enomoto-Iwamoto, M, Iwamoto, M, and Pacifici, M. Synovial joint formation during mouse limb skeletogenesis: Roles of indian hedgehog signaling. Annals of the New York Academy of Sciences, 2007. 1116: 100-12.

144 References

49. Sophia Fox, AJ, Bedi, A, and Rodeo, SA. The basic science of articular cartilage: Structure, composition, and function. Sports Health: A Multidisciplinary Approach, 2009. 1(6): 461-468.

50. Goldring, MB, Tsuchimochi, K, and Ijiri, K. The control of chondrogenesis. Journal of Cellular Biochemistry, 2006. 97(1): 33-44.

51. Staines, KA, MacRae, VE, and Farquharson, C. Cartilage development and degeneration: A wnt wnt situation. Cell Biochemistry and Function, 2012. 30(8): 633-642.

52. Yates, KE, Shortkroff, S, and Reish, RG. Wnt influence on chondrocyte differentiation and cartilage function. DNA and Cell Biology, 2005. 24(7): 446-57.

53. Poole, AR, Kojima, T, Yasuda, T, Mwale, F, Kobayashi, M, and Laverty, S. Composition and structure of articular cartilage: A template for tissue repair. Clinical Orthopaedics and Related Research, 2001(391 Suppl): S26-33.

54. Hollander, AP, Pidoux, I, Reiner, A, Rorabeck, C, Bourne, R, and Poole, AR. Damage to type ii collagen in aging and osteoarthritis starts at the articular surface, originates around chondrocytes, and extends into the cartilage with progressive degeneration. The Journal of Clinical Investigation, 1995. 96(6): 2859-2869.

55. Saarakkala, S, Julkunen, P, Kiviranta, P, Mäkitalo, J, Jurvelin, JS, and Korhonen, RK. Depth-wise progression of osteoarthritis in human articular cartilage: Investigation of composition, structure and biomechanics. Osteoarthritis and Cartilage, 2010. 18(1): 73-81.

56. Burr, DB and Radin, EL. Microfractures and microcracks in subchondral bone: Are they relevant to osteoarthrosis? Rheumatic Disease Clinics, 2003. 29(4): 675-85.

57. Li, B and Aspden, RM. Mechanical and material properties of the subchondral bone plate from the femoral head of patients with osteoarthritis or osteoporosis. Annals of the Rheumatic Diseases, 1997. 56(4): 247-54.

58. Iannone, F and Lapadula, G. Phenotype of chondrocytes in osteoarthritis. Journal of Biorheology, 2008. 45(3-4): 411-3.

59. Pullig, O, Weseloh, G, Ronneberger, D, Kakonen, S, and Swoboda, B. Chondrocyte differentiation in human osteoarthritis: Expression of osteocalcin in normal and osteoarthritic cartilage and bone. Calcified Tissue International 2000. 67(3): 230-40.

60. Sandell, LJ and Aigner, T. Articular cartilage and changes in arthritis. An introduction: Cell biology of osteoarthritis. Arthritis Research 2001. 3(2): 107-13.

61. Goldring, MB and Goldring, SR. Articular cartilage and subchondral bone in the pathogenesis of osteoarthritis. Ann N Y Acad Sci, 2010. 1192: 230-7.

References 145

62. Staines, KA, Macrae, VE, and Farquharson, C. Cartilage development and degeneration: A wnt wnt situation. Cell Biochemistry and Function, 2012. 30(8): 633-42.

63. Thorfve, A, Dehne, T, Lindahl, A, Brittberg, M, Pruss, A, Ringe, J, Sittinger, M, and Karlsson, C. Withdrawn: Characteristic markers of the wnt signalling pathway are differentially expressed in osteoarthritic cartilage. Osteoarthritis and Cartilage 2010.

64. Jeon, JE, Malda, J, Schrobback, K, Irawan, D, Masuda, K, Sah, RL, Hutmacher, DW, and Klein, TJ. Engineering cartilage tissue with zonal properties, in 3-d tissue engineering, F. Berthiaume, J. Morgan, and R. Langer, Editors. 2010, Artech House: Boston. p. 205-224.

65. Buckwalter, JA, Glimcher, MJ, Cooper, RR, and Recker, R. Bone biology. Ii: Formation, form, modeling, remodeling, and regulation of cell function. Instr Course Lect, 1996. 45: 387-99.

66. Buckwalter, JA, Glimcher, MJ, Cooper, RR, and Recker, R. Bone biology. I: Structure, blood supply, cells, matrix, and mineralization. Instr Course Lect, 1996. 45: 371-86.

67. Ng, KW, Romas, E, Donnan, L, and Findlay, DM. Bone biology. Baillieres Clin Endocrinol Metab, 1997. 11(1): 1-22.

68. Reichert, VMC. Application of a human bone engineering platform to an in vitro and in vivo breast cancer metastasis model, in Faculty of Built Environment and Engineering, School of Engineering Systems2011, Queensland University of Technology: Brisbane.

69. Mates, M. Atlas of anatomy: General anatomy and musculoskeletal system. Occup Ther Health Care, 2008. 22(4): 76-7.

70. Delaisse, J-M. The reversal phase of the bone-remodeling cycle: Cellular prerequisites for coupling resorption and formation. BoneKEy Rep, 2014. 3.

71. Franz-Odendaal, TA, Hall, BK, and Witten, PE. Buried alive: How osteoblasts become osteocytes. Developmental Dynamics, 2006. 235(1): 176-90.

72. Marotti, G. The structure of bone tissues and the cellular control of their deposition. Italian Journal of Anatomy and Embryology, 1996. 101(4): 25-79.

73. Mullender, MG, van der Meer, DD, Huiskes, R, and Lips, P. Osteocyte density changes in aging and osteoporosis. Bone, 1996. 18(2): 109-13.

74. Frost, HM. Bone dynamics in metabolic bone disease. The Journal of Bone & Joint Surgery

1966. 48(6): 1192-203.

146 References

75. Manolagas, SC. Birth and death of bone cells: Basic regulatory mechanisms and implications for the pathogenesis and treatment of osteoporosis. Endocrine Reviews, 2000. 21(2): 115-37.

76. McCulloch, CA and Heersche, JN. Lifetime of the osteoblast in mouse periodontium. Anatomical Record 1988. 222(2): 128-35.

77. Vatsa, A, Breuls, RG, Semeins, CM, Salmon, PL, Smit, TH, and Klein-Nulend, J. Osteocyte morphology in fibula and calvaria --- is there a role for mechanosensing? Bone, 2008. 43(3): 452-8.

78. Palumbo, C, Palazzini, S, Zaffe, D, and Marotti, G. Osteocyte differentiation in the tibia of newborn rabbit: An ultrastructural study of the formation of cytoplasmic processes. Acta Anatomica, 1990. 137(4): 350-8.

79. Dayong Guo and Bonewald, LF. Advancing our understanding of osteocyte cell biology. Therapeutic Advances in Musculoskeletal Disease, 2009. 1(2): 87-96.

80. Schneider, P, Meier, M, Wepf, R, and Muller, R. Towards quantitative 3d imaging of the osteocyte lacuno-canalicular network. Bone, 2010. 47(5): 848-58.

81. Busse, B, Djonic, D, Milovanovic, P, Hahn, M, Puschel, K, Ritchie, RO, Djuric, M, and Amling, M. Decrease in the osteocyte lacunar density accompanied by hypermineralized lacunar occlusion reveals failure and delay of remodeling in aged human bone. Aging Cell, 2010.

82. Noble, BS. The osteocyte lineage. Archives of Biochemistry and Biophysics, 2008. 473(2): 106-111.

83. Zhang, KQ, Barragan-Adjemian, C, Ye, L, Kotha, S, Dallas, M, Lu, YB, Zhao, SJ, Harris, M, Harris, SE, Feng, JQ, and Bonewald, LF. E11/gp38 selective expression in osteocytes: Regulation by mechanical strain and role in dendrite elongation. Molecular and Cellular Biology, 2006. 26(12): 4539-4552.

84. Kato, Y, Windle, JJ, Koop, BA, Mundy, GR, and Bonewald, LF. Establishment of an osteocyte-like cell line, mlo-y4. Journal of Bone and Mineral Research, 1997. 12(12): 2014-2023.

85. Liu, SG, Zhou, JP, Tang, W, Jiang, X, Rowe, DW, and Quarles, LD. Pathogenic role of fgf23 in hyp mice. American Journal of Physiology-Endocrinology and Metabolism, 2006. 291(1): E38-E49.

86. Feng, JQ, Ward, LM, Liu, S, Lu, Y, Xie, Y, Yuan, B, Yu, X, Rauch, F, Davis, SI, Zhang, S, Rios, H, Drezner, MK, Quarles, LD, Bonewald, LF, and White, KE. Loss of dmp1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nature Genetics, 2006. 38(11): 1310-5.

87. Poole, KE, van Bezooijen, RL, Loveridge, N, Hamersma, H, Papapoulos, SE, Lowik, CW, and Reeve, J. Sclerostin is a delayed secreted product of

References 147

osteocytes that inhibits bone formation. Federation of American Societies for Experimental Biology Journal, 2005. 19(13): 1842-4.

88. Bonewald, LF. Osteocytes as dynamic multifunctional cells. Annals of New York Academy of Sciences 2007. 1116: 281-90.

89. Wysolmerski, JJ. Osteocytes remove and replace perilacunar mineral during reproductive cycles. Bone, 2013. 54(2): 230-236.

90. Tatsumi, S, Amizuka, N, Li, M, Ishii, K, Kohno, K, Ito, M, Takeshita, S, and Ikeda, K. Targeted ablation of osteocytes in transgenic mice. Journal of Bone and Mineral Research, 2006. 21: S18-S18.

91. O'Brien, CA, Plotkin, LI, Galli, C, Goellner, JJ, Gortazar, AR, Allen, MR, Robling, AG, Bouxsein, M, Schipani, E, Turner, CH, Jilka, RL, Weinstein, RS, Manolagas, SC, and Bellido, T. Control of bone mass and remodeling by pth receptor signaling in osteocytes. PLoS ONE, 2008. 3(8): e2942.

92. Nakashima, T, Hayashi, M, Fukunaga, T, Kurata, K, Oh-hora, M, Feng, JQ, Bonewald, LF, Kodama, T, Wutz, A, Wagner, EF, Penninger, JM, and Takayanagi, H. Evidence for osteocyte regulation of bone homeostasis through rankl expression. Nature Medicine, 2011. 17(10): 1231-1234.

93. Qing, H, Ardeshirpour, L, Divieti Pajevic, P, Dusevich, V, Jähn, K, Kato, S, Wysolmerski, J, and Bonewald, LF. Demonstration of osteocytic perilacunar/canalicular remodeling in mice during lactation. Journal of Bone and Mineral Research, 2012. 27(5): 1018-1029.

94. Matsuo, K and Nango, N. Osteocytic osteolysis : Measurements of the volume of osteocytic lacunae. Clinical Calcium, 2012. 22(5): 677-83.

95. Brunkow, ME, Gardner, JC, Van Ness, J, Paeper, BW, Kovacevich, BR, Proll, S, Skonier, JE, Zhao, L, Sabo, PJ, Fu, Y, Alisch, RS, Gillett, L, Colbert, T, Tacconi, P, Galas, D, Hamersma, H, Beighton, P, and Mulligan, J. Bone dysplasia sclerosteosis results from loss of the sost gene product, a novel cystine knot-containing protein. Cell - The American Journal of Human Genetics, 2001. 68(3): 577-89.

96. van Bezooijen, RL, Roelen, BAJ, Visser, A, van der Wee-Pals, L, de Wilt, E, Karperien, M, Hamersma, H, Papapoulos, SE, ten Dijke, P, and Lowik, CWGM. Sclerostin is an osteocyte-expressed negative regulator of bone formation, but not a classical bmp antagonist. The Journal of Experimental Medicine, 2004. 199(6): 805-814.

97. Halleux, C, Kramer, I, Allard, C, and Kneissel, M. Isolation of mouse osteocytes using cell fractionation for gene expression analysis, in Bone research protocols, M.H. Helfrich and S.H. Ralston, Editors. 2012. p. 55-66.

98. Blaber, EA, Dvorochkin, N, Lee, C, Alwood, JS, Yousuf, R, Pianetta, P, Globus, RK, Burns, BP, and Almeida, EA. Microgravity induces pelvic bone loss through osteoclastic activity, osteocytic osteolysis, and osteoblastic cell cycle inhibition by cdkn1a/p21. PLoS ONE, 2013. 8(4): e61372.

148 References

99. Belanger, LF. Osteocytic osteolysis. Calcified Tissue Research, 1969. 4(1): 1-12.

100. Sabbagh, Y, Graciolli, FG, O'Brien, S, Tang, W, dos Reis, LM, Ryan, S, Phillips, L, Boulanger, J, Song, W, Bracken, C, Liu, S, Ledbetter, S, Dechow, P, Canziani, ME, Carvalho, AB, Jorgetti, V, Moyses, RM, and Schiavi, SC. Repression of osteocyte wnt/beta-catenin signaling is an early event in the progression of renal osteodystrophy. Journal of Bone and Mineral Research, 2012. 27(8): 1757-72.

101. Belanger, LF. Osteocytic osteolysis in a cretaceous reptile. Revue Canadienne de biologie / editee par l'Universite de Montreal, 1977. 36(1): 71-3.

102. Martin, RB. Toward a unifying theory of bone remodeling. Bone, 2000. 26(1): 1-6.

103. Noble, BS, Stevens, H, Loveridge, N, and Reeve, J. Identification of apoptotic changes in osteocytes in normal and pathological human bone. Bone, 1997. 20(3): 273-282.

104. Verborgt, O, Gibson, GJ, and Schaffler, MB. Loss of osteocyte integrity in association with microdamage and bone remodeling after fatigue in vivo. Journal of Bone and Mineral Research, 2000. 15(1): 60-67.

105. O'Brien, CA, Jia, D, Plotkin, LI, Bellido, T, Powers, CC, Stewart, SA, Manolagas, SC, and Weinstein, RS. Glucocorticoids act directly on osteoblasts and osteocytes to induce their apoptosis and reduce bone formation and strength. Endocrinology, 2004. 145(4): 1835-1841.

106. Bonewald, LF. Establishment and characterization of an osteocyte-like cell line, mlo-y4. Journal of Bone and Mineral Metabolism, 1999. 17(1): 61-65.

107. Cheng, B, Zhao, S, Luo, J, Sprague, E, Bonewald, LF, and Jiang, JX. Expression of functional gap junctions and regulation by fluid flow in osteocyte-like mlo-y4 cells. Journal of Bone and Mineral Research, 2001. 16(2): 249-59.

108. Tanabe, N, Maeno, M, Suzuki, N, Fujisaki, K, Tanaka, H, Ogiso, B, and Ito, K. Il-1 alpha stimulates the formation of osteoclast-like cells by increasing m-csf and pge2 production and decreasing opg production by osteoblasts. Life Science Journal, 2005. 77(6): 615-26.

109. Coetzee, M, Haag, M, and Kruger, MC. Effects of arachidonic acid, docosahexaenoic acid, prostaglandin e2 and parathyroid hormone on osteoprotegerin and rankl secretion by mc3t3-e1 osteoblast-like cells. The Journal of Nutritional Biochemistry, 2007. 18(1): 54-63.

110. Kalajzic, I, Matthews, BG, Torreggiani, E, Harris, MA, Divieti Pajevic, P, and Harris, SE. In vitro and in vivo approaches to study osteocyte biology. Bone, 2013. 54(2): 296-306.

References 149

111. Burr, DB. Anatomy and physiology of the mineralized tissues: Role in the pathogenesis of osteoarthrosis. Osteoarthritis Cartilage, 2004. 12 Suppl A: S20-30.

112. Clark, JM and Huber, JD. The structure of the human subchondral plate. The Bone & Joint Journal, 1990. 72(5): 866-73.

113. Duncan, H, Jundt, J, Riddle, JM, Pitchford, W, and Christopherson, T. The tibial subchondral plate. A scanning electron microscopic study. The Journal of Bone & Joint Surgery, 1987. 69(8): 1212-20.

114. Inoue, H. Alterations in the collagen framework of osteoarthritic cartilage and subchondral bone. International Orthopaedics, 1981. 5(1): 47-52.

115. Aspden, RM. Osteoarthritis: A problem of growth not decay? Rheumatology, 2008. 47(10): 1452-60.

116. Creamer, P and Hochberg, MC. Osteoarthritis. Lancet, 1997. 350(9076): 503-8.

117. Buckland-Wright, JC, Macfarlane, DG, Fogelman, I, Emery, P, and Lynch, JA. Techetium 99m methylene diphosphonate bone scanning in osteoarthritic hands. European Journal of Nuclear Medicine, 1991. 18(1): 12-6.

118. Hutton, CW, Higgs, ER, Jackson, PC, Watt, I, and Dieppe, PA. 99mtc hmdp bone scanning in generalised nodal osteoarthritis. Ii. The four hour bone scan image predicts radiographic change. Annals of the Rheumatic Diseases, 1986. 45(8): 622-6.

119. Dieppe, P, Cushnaghan, J, Young, P, and Kirwan, J. Prediction of the progression of joint space narrowing in osteoarthritis of the knee by bone scintigraphy. Annals of the Rheumatic Diseases, 1993. 52(8): 557-63.

120. Serink, MT, Nachemson, A, and Hansson, G. The effect of impact loading on rabbit knee joints. Acta orthopaedica Scandinavica, 1977. 48(3): 250-62.

121. Dequeker, J, Mokassa, L, Aerssens, J, and Boonen, S. Bone density and local growth factors in generalized osteoarthritis. Microscopy Research and Technique, 1997. 37(4): 358-71.

122. Dequeker, J, Aerssens, J, and Luyten, FP. Osteoarthritis and osteoporosis: Clinical and research evidence of inverse relationship. Aging Clinical and Experimental Research, 2003. 15(5): 426-39.

123. Sambrook, P and Naganathan, V. What is the relationship between osteoarthritis and osteoporosis? Baillière's Clinical Rheumatology, 1997. 11(4): 695-710.

124. Grynpas, MD, Alpert, B, Katz, I, Lieberman, I, and Pritzker, KP. Subchondral bone in osteoarthritis. Calcified Tissue International, 1991. 49(1): 20-6.

150 References

125. Martin, RB. Targeted bone remodeling involves bmu steering as well as activation. Bone, 2007. 40(6): 1574-80.

126. Findlay, DM. Vascular pathology and osteoarthritis. Rheumatology, 2007. 46(12): 1763-1768.

127. Jilka, RL, Noble, B, and Weinstein, RS. Osteocyte apoptosis. Bone, 2013. 54(2): 264-271.

128. Burr, DB and Gallant, MA. Bone remodelling in osteoarthritis. Nat Rev Rheumatol, 2012. 8(11): 665-73.

129. Benelli, R, Lorusso, G, Albini, A, and Noonan, DM. Cytokines and chemokines as regulators of angiogenesis in health and disease. Current Pharmaceutical Design, 2006. 12(24): 3101-15.

130. Baker-LePain, JC, Nakamura, MC, and Lane, NE. Effects of inflammation on bone: An update. Current Opinion in Rheumatology, 2011. 23(4): 389-95.

131. Charo, IF and Ransohoff, RM. The many roles of chemokines and chemokine receptors in inflammation. The New England Journal of Medicine, 2006. 354(6): 610-21.

132. Attur, MG, Dave, M, Akamatsu, M, Katoh, M, and Amin, AR. Osteoarthritis or osteoarthrosis: The definition of inflammation becomes a semantic issue in the genomic era of molecular medicine. Osteoarthritis and Cartilage, 2002. 10(1): 1-4.

133. McInnes, IB, Leung, BP, and Liew, FY. Cell-cell interactions in synovitis. Interactions between t lymphocytes and synovial cells. Arthritis Research, 2000. 2(5): 374-8.

134. Benito, MJ, Veale, DJ, FitzGerald, O, van den Berg, WB, and Bresnihan, B. Synovial tissue inflammation in early and late osteoarthritis. Annals of the Rheumatic Diseases, 2005. 64(9): 1263-7.

135. Goldring, SR and Goldring, MB. Eating bone or adding it: The wnt pathway decides. Nature Medicine, 2007. 13(2): 133-4.

136. Lewis, JS, Hembree, WC, Furman, BD, Tippets, L, Cattel, D, Huebner, JL, Little, D, DeFrate, LE, Kraus, VB, Guilak, F, and Olson, SA. Acute joint pathology and synovial inflammation is associated with increased intra-articular fracture severity in the mouse knee. Osteoarthritis Cartilage, 2011. 19(7): 864-73.

137. Abramson, SB. Inflammation in osteoarthritis. The Journal of Rheumatology, 2004. 70: 70-6.

138. Wang, Q, Rozelle, AL, Lepus, CM, Scanzello, CR, Song, JJ, Larsen, DM, Crish, JF, Bebek, G, Ritter, SY, Lindstrom, TM, Hwang, I, Wong, HH, Punzi, L, Encarnacion, A, Shamloo, M, Goodman, SB, Wyss-Coray, T, Goldring, SR, Banda, NK, Thurman, JM, Gobezie, R, Crow, MK, Holers, VM, Lee,

References 151

DM, and Robinson, WH. Identification of a central role for complement in osteoarthritis. Nat Med, 2011. 17(12): 1674-1679.

139. Carswell, EA, Old, LJ, Kassel, RL, Green, S, Fiore, N, and Williamson, B. An endotoxin-induced serum factor that causes necrosis of tumors. Proceedings of the National Academy of Sciences of the United States of America, 1975. 72(9): 3666-70.

140. Thomson, AW. Preface to the second edition, in The cytokine handbook (fourth edition), W.T. Angus and T.L. Michael, Editors. 2003, Academic Press: London. p. xv-xvi.

141. Evans, SW and Whicher, JT. The cytokines: Physiological and pathophysiological aspects. Advances in Clinical Chemistry, 1993. 30: 1-88.

142. Goldman, A, Rudloff, H, and Schmalstieg, F. Are cytokines in human milk?, in Immunology of milk and the neonate, J. Mestecky, C. Blair, and P. Ogra, Editors. 1991, Springer US. p. 93-97.

143. Beutler, B. Tumor necrosis factor (tnf), in Encyclopedia of hormones, L.H. Editors-in-Chief: Helen and W.N. Anthony, Editors. 2003, Academic Press: New York. p. 536-539.

144. Horiuchi, T, Mitoma, H, Harashima, S-i, Tsukamoto, H, and Shimoda, T. Transmembrane tnf-α: Structure, function and interaction with anti-tnf agents. Rheumatology, 2010. 49(7): 1215-1228.

145. Wallach, D. Tnf receptors, in Encyclopedia of immunology (second edition), J.D. Editor-in-Chief: Peter, Editor 1998, Elsevier: Oxford. p. 2345-2349.

146. Wang, H, Czura, CJ, and Tracey, KJ. Chapter 35 - tumor necrosis factor, in The cytokine handbook (fourth edition), W.T. Angus and T.L. Michael, Editors. 2003, Academic Press: London. p. 837-860.

147. Idriss, HT and Naismith, JH. Tnfα and the tnf receptor superfamily: Structure-function relationship(s). Microscopy Research and Technique, 2000. 50(3): 184-195.

148. Sieper, J. Spondyloarthropathies in 2010: New insights into therapy-tnf blockade and beyond. Nature reviews. Rheumatology, 2011. 7(2): 78-80.

149. Asaba, H and Sakai, J. [wnt signaling and bone metabolism]. Clinical Calcium, 2005. 15(5): 813-8.

150. Logan, CY and Nusse, R. The wnt signaling pathway in development and disease. Annual Review of Cell and Developmental Biology, 2004. 20: 781-810.

151. Moon, RT, Kohn, AD, Ferrari, GVD, and Kaykas, A. Wnt and [beta]-catenin signalling: Diseases and therapies. Nature Reviews Genetics, 2004. 5(9): 691-701.

152 References

152. Kobayashi, Y. Roles of wnt signaling in bone metabolism. Clinical calcium, 2012. 22(11): 1701-6.

153. Kubota, T, Michigami, T, and Ozono, K. Wnt signaling in bone metabolism. Journal of Bone and Mineral Metabolism, 2009. 27(3): 265-71.

154. Daoussis, D and Andonopoulos, AP. The emerging role of dickkopf-1 in bone biology: Is it the main switch controlling bone and joint remodeling? Seminars in Arthritis and Rheumatism, 2011. 41(2): 170-177.

155. Yuasa, T, Otani, T, Koike, T, Iwamoto, M, and Enomoto-Iwamoto, M. Wnt/beta-catenin signaling stimulates matrix catabolic genes and activity in articular chondrocytes: Its possible role in joint degeneration. Laboratory Investigation; Journal of Technical Methods and Pathology, 2008. 88(3): 264-74.

156. Hwang, SG, Ryu, JH, Kim, IC, Jho, EH, Jung, HC, Kim, K, Kim, SJ, and Chun, JS. Wnt-7a causes loss of differentiated phenotype and inhibits apoptosis of articular chondrocytes via different mechanisms. The Journal of Biological Chemistry, 2004. 279(25): 26597-604.

157. Nakaoka, R, Hsiong, SX, and Mooney, DJ. Regulation of chondrocyte differentiation level via co-culture with osteoblasts. Journal of Tissue Engineering and Regenerative Medicine, 2006. 12(9): 2425-33.

158. Kennell, JA and MacDougald, OA. Wnt signaling inhibits adipogenesis through beta-catenin-dependent and -independent mechanisms. The Journal of Biological Chemistry, 2005. 280(25): 24004-10.

159. Day, TF, Guo, X, Garrett-Beal, L, and Yang, Y. Wnt/beta-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Developmental Cell, 2005. 8(5): 739-50.

160. Joeng, KS, Schumacher, CA, Zylstra-Diegel, CR, Long, F, and Williams, BO. Lrp5 and lrp6 redundantly control skeletal development in the mouse embryo. Developmental Biology, 2011. 359(2): 222-9.

161. Leupin, O, Piters, E, Halleux, C, Hu, S, Kramer, I, Morvan, F, Bouwmeester, T, Schirle, M, Bueno-Lozano, M, Fuentes, FJ, Itin, PH, Boudin, E, de Freitas, F, Jennes, K, Brannetti, B, Charara, N, Ebersbach, H, Geisse, S, Lu, CX, Bauer, A, Van Hul, W, and Kneissel, M. Bone overgrowth-associated mutations in the lrp4 gene impair sclerostin facilitator function. The Journal of Biological Chemistry, 2011. 286(22): 19489-500.

162. Johnson, EB, Hammer, RE, and Herz, J. Abnormal development of the apical ectodermal ridge and polysyndactyly in megf7-deficient mice. Human Molecular Genetics, 2005. 14(22): 3523-38.

163. Loots, GG, Kneissel, M, Keller, H, Baptist, M, Chang, J, Collette, NM, Ovcharenko, D, Plajzer-Frick, I, and Rubin, EM. Genomic deletion of a long-

References 153

range bone enhancer misregulates sclerostin in van buchem disease. Genome Research, 2005. 15(7): 928-35.

164. Dell'Accio, F, De Bari, C, Eltawil, NM, Vanhummelen, P, and Pitzalis, C. Identification of the molecular response of articular cartilage to injury, by microarray screening: Wnt-16 expression and signaling after injury and in osteoarthritis. Arthritis & Rheumatism, 2008. 58(5): 1410-1421.

165. Ma, B, Landman, EB, Miclea, RL, Wit, JM, Robanus-Maandag, EC, Post, JN, and Karperien, M. Wnt signaling and cartilage: Of mice and men. Calcified Tissue International, 2013. 92(5): 399-411.

166. Loughlin, J, Dowling, B, Chapman, K, Marcelline, L, Mustafa, Z, Southam, L, Ferreira, A, Ciesielski, C, Carson, DA, and Corr, M. Functional variants within the secreted frizzled-related protein 3 gene are associated with hip osteoarthritis in females. Proceedings of the National Academy of Sciences of the United States of America, 2004. 101(26): 9757-62.

167. Killock, D. Osteoarthritis: Frzb knockout reveals the complexity of wnt signaling in joint homeostasis. Nat Rev Rheumatol, 2012. 8(3): 123.

168. Kato, M, Patel, MS, Levasseur, R, Lobov, I, Chang, BH, Glass, DA, 2nd, Hartmann, C, Li, L, Hwang, TH, Brayton, CF, Lang, RA, Karsenty, G, and Chan, L. Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in lrp5, a wnt coreceptor. The Journal of Cell Biology, 2002. 157(2): 303-14.

169. Yan, Y, Tang, D, Chen, M, Huang, J, Xie, R, Jonason, JH, Tan, X, Hou, W, Reynolds, D, Hsu, W, Harris, SE, Puzas, JE, Awad, H, O'Keefe, RJ, Boyce, BF, and Chen, D. Axin2 controls bone remodeling through the beta-catenin-bmp signaling pathway in adult mice. Journal of Cell Science, 2009. 122(19): 3566-78.

170. Mukhopadhyay, M, Shtrom, S, Rodriguez-Esteban, C, Chen, L, Tsukui, T, Gomer, L, Dorward, DW, Glinka, A, Grinberg, A, Huang, SP, Niehrs, C, Izpisua Belmonte, JC, and Westphal, H. Dickkopf1 is required for embryonic head induction and limb morphogenesis in the mouse. Developmental Cell, 2001. 1(3): 423-34.

171. Morvan, F, Boulukos, K, Clément‐Lacroix, P, Roman, SR, Suc‐Royer, I, Vayssière, B, Ammann, P, Martin, P, Pinho, S, and Pognonec, P. Deletion of a single allele of the dkk1 gene leads to an increase in bone formation and bone mass. Journal of Bone and Mineral Research, 2006. 21(6): 934-945.

172. Diarra, D, Stolina, M, Polzer, K, Zwerina, J, Ominsky, MS, Dwyer, D, Korb, A, Smolen, J, Hoffmann, M, Scheinecker, C, van der Heide, D, Landewe, R, Lacey, D, Richards, WG, and Schett, G. Dickkopf-1 is a master regulator of joint remodeling. Nature Medicine, 2007. 13(2): 156-63.

173. Weng, L-H, Wang, C-J, Ko, J-Y, Sun, Y-C, and Wang, F-S. Control of dkk-1 ameliorates chondrocyte apoptosis, cartilage destruction, and subchondral

154 References

bone deterioration in osteoarthritic knees. Arthritis and Rheumatism, 2010. 62(5): 1393-1402.

174. Honsawek, S, Tanavalee, A, Yuktanandana, P, Ngarmukos, S, Saetan, N, and Tantavisut, S. Dickkopf-1 (dkk-1) in plasma and synovial fluid is inversely correlated with radiographic severity of knee osteoarthritis patients. BMC Musculoskeletal Disorders, 2010. 11(1): 257.

175. Hopwood, B, Tsykin, A, Findlay, DM, and Fazzalari, NL. Microarray gene expression profiling of osteoarthritic bone suggests altered bone remodelling, wnt and transforming growth factor-β/bone morphogenic protein signalling. Arthritis Research & Therapy, 2007. 9(5): R100-R100.

176. Lohmander, LS. What can we do about osteoarthritis? Arthritis and Research Therapy, 2000. 2(2): 95 - 100.

177. Urano, T. Wnt-beta-catenin signaling in bone metabolism. Clinical Calcium, 2006. 16(1): 54-60.

178. Johnson, ML and Kamel, MA. The wnt signaling pathway and bone metabolism. Current Opinion in Rheumatology, 2007. 19(4): 376-82.

179. ten Dijke, P, Krause, C, de Gorter, DJ, Lowik, CW, and van Bezooijen, RL. Osteocyte-derived sclerostin inhibits bone formation: Its role in bone morphogenetic protein and wnt signaling. The Journal of Bone and Joint Surgery, 2008. 90 Suppl 1: 31-5.

180. Bezooijen, RLv, Dijke, Pt, Papapoulos, SE, and G.M. Löwik, CW. Sost/sclerostin, an osteocyte-derived negative regulator of bone formation. Cytokine & Growth Factor Reviews, 2005. 16(3): 319-327.

181. Dell'Accio, F, De Bari, C, Eltawil, NM, Vanhummelen, P, and Pitzalis, C. Identification of the molecular response of articular cartilage to injury, by microarray screening: Wnt-16 expression and signaling after injury and in osteoarthritis. Arthritis and Rheumatism, 2008. 58(5): 1410-1421.

182. Bellido, T. Osteocyte apoptosis induces bone resorption and impairs the skeletal response to weightlessness. IBMS BoneKEy, 2007. 4(9): 252-256.

183. Al-Dujaili, SA, Lau, E, Al-Dujaili, H, Tsang, K, Guenther, A, and You, L. Apoptotic osteocytes regulate osteoclast precursor recruitment and differentiation in vitro. Journal of Cellular Biochemistry, 2011. 112(9): 2412-23.

184. Brandt, KD, Radin, EL, Dieppe, PA, and van de Putte, L. Yet more evidence that osteoarthritis is not a cartilage disease. Annals of the Rheumatic Diseases 2006. 65(10): 1261-4.

185. Prideaux, M, Loveridge, N, Pitsillides, AA, and Farquharson, C. Extracellular matrix mineralization promotes e11/gp38 glycoprotein expression and drives osteocytic differentiation. PLoS ONE, 2012. 7(5): e36786.

References 155

186. Logar, DB, Komadina, R, Prezelj, J, Ostanek, B, Trost, Z, and Marc, J. Expression of bone resorption genes in osteoarthritis and in osteoporosis. Journal of Bone and Mineral Metabolism 2007. 25(4): 219-25.

187. Bonewald, LF. The amazing osteocyte. J Bone Miner Res. 26(2): 229-38.

188. Stains, JP and Civitelli, R. Cell-to-cell interactions in bone. Biochemical and Biophysical Research Communications, 2005. 328(3): 721-7.

189. Jacobs, CR, Temiyasathit, S, and Castillo, AB. Osteocyte mechanobiology and pericellular mechanics. Annual Review of Biomedical Engineering, 2010. 12: 369-400.

190. Herzog, W, Clark, A, and Longino, D. Joint mechanics in osteoarthritis. Novartis Foundation Symposium, 2004. 260: 79-95; Discussion 95-9, 100-4, 277-9.

191. Altman, R, Asch, E, Bloch, D, Bole, G, Borenstein, D, Brandt, K, Christy, W, Cooke, TD, Greenwald, R, Hochberg, M, and et al. Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and therapeutic criteria committee of the american rheumatism association. Arthritis and Rheumatology, 1986. 29(8): 1039-49.

192. Pacifici, M, Koyama, E, and Iwamoto, M. Mechanisms of synovial joint and articular cartilage formation: Recent advances, but many lingering mysteries. Birth Defects Research Part C: Embryo Today: Reviews, 2005. 75(3): 237-248.

193. Lu, Y, Xie, Y, Zhang, S, Dusevich, V, Bonewald, LF, and Feng, JQ. Dmp1-targeted cre expression in odontoblasts and osteocytes. The Journal of Bone & Joint Surgery, 2007. 86(4): 320-5.

194. Bonewald, LF and Johnson, ML. Osteocytes, mechanosensing and wnt signaling. Bone, 2008. 42(4): 606-15.

195. Prasadam, I, van Gennip, S, Friis, T, Shi, W, Crawford, R, and Xiao, Y. Erk-1/2 and p38 in the regulation of hypertrophic changes of normal articular cartilage chondrocytes induced by osteoarthritic subchondral osteoblasts. Arthritis and Rheumatology, 2010. 62(5): 1349-60.

196. Erlebacher, A and Derynck, R. Increased expression of tgf-beta 2 in osteoblasts results in an osteoporosis-like phenotype. The Journal of Cell Biology, 1996. 132(1): 195-210.

197. Taylor, AF, Saunders, MM, Shingle, DL, Cimbala, JM, Zhou, Z, and Donahue, HJ. Mechanically stimulated osteocytes regulate osteoblastic activity via gap junctions. Cell Physiology - American Journal of Physiology, 2007. 292(1): C545-52.

198. Li, X, Ominsky, MS, Niu, QT, Sun, N, Daugherty, B, D'Agostin, D, Kurahara, C, Gao, Y, Cao, J, Gong, J, Asuncion, F, Barrero, M, Warmington,

156 References

K, Dwyer, D, Stolina, M, Morony, S, Sarosi, I, Kostenuik, PJ, Lacey, DL, Simonet, WS, Ke, HZ, and Paszty, C. Targeted deletion of the sclerostin gene in mice results in increased bone formation and bone strength. Journal of Bone and Mineral Research, 2008. 23(6): 860-9.

199. Li, X, Zhang, Y, Kang, H, Liu, W, Liu, P, Zhang, J, Harris, SE, and Wu, D. Sclerostin binds to lrp5/6 and antagonizes canonical wnt signaling. The Journal of Biological Chemistry, 2005. 280(20): 19883-19887.

200. Sutherland, MK, Geoghegan, JC, Yu, C, Turcott, E, Skonier, JE, Winkler, DG, and Latham, JA. Sclerostin promotes the apoptosis of human osteoblastic cells: A novel regulation of bone formation. Bone, 2004. 35(4): 828-35.

201. George, A, Ramachandran, A, Albazzaz, M, and Ravindran, S. Dmp1--a key regulator in mineralized matrix formation. Journal of Musculoskeletal and Neuronal Interactions, 2007. 7(4): 308.

202. Turner, CH. Dentin matrix protein 1 (dmp1). Journal of Musculoskeletal and Neuronal Interactions, 2007. 7(4): 306-7.

203. Lu, Y, Yuan, B, Qin, C, Cao, Z, Xie, Y, Dallas, SL, McKee, MD, Drezner, MK, Bonewald, LF, and Feng, JQ. The biological function of dmp-1 in osteocyte maturation is mediated by its 57-kda c-terminal fragment. Journal of Bone and Mineral Research, 2011. 26(2): 331-40.

204. Gluhak-Heinrich, J, Ye, L, Bonewald, LF, Feng, JQ, MacDougall, M, Harris, SE, and Pavlin, D. Mechanical loading stimulates dentin matrix protein 1 (dmp1) expression in osteocytes in vivo. Journal of Bone and Mineral Research, 2003. 18(5): 807-817.

205. Feng, JQ, Huang, H, Lu, Y, Ye, L, Xie, Y, Tsutsui, TW, Kunieda, T, Castranio, T, Scott, G, Bonewald, LB, and Mishina, Y. The dentin matrix protein 1 (dmp1) is specifically expressed in mineralized, but not soft, tissues during development. Journal of Dental Research, 2003. 82(10): 776-80.

206. Burra, S, Nicolella, DP, Francis, WL, Freitas, CJ, Mueschke, NJ, Poole, K, and Jiang, JX. Dendritic processes of osteocytes are mechanotransducers that induce the opening of hemichannels. Proceedings of the National Academy of Sciences of the United States of America 2010. 107(31): 13648-53.

207. Qiu, S, Rao, DS, Fyhrie, DP, Palnitkar, S, and Parfitt, AM. The morphological association between microcracks and osteocyte lacunae in human cortical bone. Bone, 2005. 37(1): 10-5.

208. Rubin, C, Judex, S, and Hadjiargyrou, M. Skeletal adaptation to mechanical stimuli in the absence of formation or resorption of bone. Journal of Musculoskeletal and Neuronal Interactions, 2002. 2(3): 264-7.

209. Karsdal, MA, Andersen, TA, Bonewald, L, and Christiansen, C. Matrix metalloproteinases (mmps) safeguard osteoblasts from apoptosis during

References 157

transdifferentiation into osteocytes: Mt1-mmp maintains osteocyte viability. DNA and Cell Biology, 2004. 23(3): 155-65.

210. Kogianni, G and Noble, BS. The biology of osteocytes. Current Osteoporosis Reports, 2007. 5(2): 81-6.

211. Zhao, W, Byrne, MH, Wang, Y, and Krane, SM. Osteocyte and osteoblast apoptosis and excessive bone deposition accompany failure of collagenase cleavage of collagen. The Journal of Clinical Investigation, 2000. 106(8): 941-9.

212. Boabaid, F, Cerri, PS, and Katchburian, E. Apoptotic bone cells may be engulfed by osteoclasts during alveolar bone resorption in young rats. Tissue and Cell, 2001. 33(4): 318-325.

213. Bronckers, ALJJ, Sasaguri, K, and Engelse, MA. Transcription and immunolocalization of runx2/cbfa1/pebp2αa in developing rodent and human craniofacial tissues: Further evidence suggesting osteoclasts phagocytose osteocytes. Microscopy Research and Technique, 2003. 61(6): 540-548.

214. Zhao, S, Zhang, YK, Harris, S, Ahuja, SS, and Bonewald, LF. Mlo-y4 osteocyte-like cells support osteoclast formation and activation. Journal of Bone and Mineral Research, 2002. 17(11): 2068-79.

215. Little, CB and Zaki, S. What constitutes an “animal model of osteoarthritis” – the need for consensus? Osteoarthritis and Cartilage, 2012. 20(4): 261-267.

216. Little, CB and Smith, MM. Animal models of osteoarthritis. Current Rheumatology Reviews, 2008. 4(3): 175-182.

217. Bendele, AM. Animal models of osteoarthritis. Journal of Musculoskeletal & Neuronal Interactions, 2001. 1(4): 363-76.

218. Hayami, T, Pickarski, M, Zhuo, Y, Wesolowski, GA, Rodan, GA, and Duong, LT. Characterization of articular cartilage and subchondral bone changes in the rat anterior cruciate ligament transection and meniscectomized models of osteoarthritis. Bone, 2006. 38(2): 234-243.

219. Wancket, LM, Baragi, V, Bove, S, Kilgore, K, Korytko, PJ, and Guzman, RE. Anatomical localization of cartilage degradation markers in a surgically induced rat osteoarthritis model. Toxicologic Pathology, 2005. 33(4): 484-489.

220. Mohan, G, Perilli, E, Kuliwaba, J, Humphries, J, Parkinson, I, and Fazzalari, N. Application of in vivo micro-computed tomography in the temporal characterisation of subchondral bone architecture in a rat model of low-dose monosodium iodoacetate-induced osteoarthritis. Arthritis Research & Therapy, 2011. 13(6): R210.

221. Bendele, AM. Animal models of osteoarthritis in an era of molecular biology. Journal of Musculoskeletal & Neuronal Interactions, 2002. 2(6): 501-3.

158 References

222. Webster, DJ, Schneider, P, Dallas, SL, and Muller, R. Studying osteocytes within their environment. Bone, 2013.

223. Kalajzic, I, Matthews, BG, Torreggiani, E, Harris, MA, Divieti Pajevic, P, and Harris, SE. In vitro and in vivo approaches to study osteocyte biology. Bone, 2012.

224. Xiong, J and O'Brien, CA. Osteocyte rankl: New insights into the control of bone remodeling. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2012. 27(3): 499-505.

225. Jaiprakash, A, Prasadam, I, Feng, JQ, Liu, Y, Crawford, R, and Xiao, Y. Phenotypic characterization of osteoarthritic osteocytes from the sclerotic zones: A possible pathological role in subchondral bone sclerosis. International Journal of Biological Sciences, 2012. 8(3): 406-17.

226. Mankin, HJ, Dorfman, H, Lippiello, L, and Zarins, A. Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips. Ii. Correlation of morphology with biochemical and metabolic data. The Journal of Bone & Joint Surgery 1971. 53(3): 523-37.

227. Felson, DT and Neogi, T. Osteoarthritis: Is it a disease of cartilage or of bone? Arthritis & Rheumatism, 2004. 50(2): 341-344.

228. Rios, HF, Ye, L, Dusevich, V, Eick, D, Bonewald, LF, and Feng, JQ. Dmp1 is essential for osteocyte formation and function. Journal of Musculoskeletal and Neuronal Interactions, 2005. 5(4): 325-7.

229. Roux, W. Der kampf der theile im organismus. Ein beitrag zur vervollständigung der mechanischen zweckmässigkeitslehre, von wilhelm roux1881, Leipzig: W. Engelmann.

230. Hernandez, CJ, Majeska, RJ, and Schaffler, MB. Osteocyte density in woven bone. Bone, 2004. 35(5): 1095-1099.

231. O'Brien, CA, Nakashima, T, and Takayanagi, H. Osteocyte control of osteoclastogenesis. Bone, 2013. 54(2): 258-263.

232. Nakano, Y, Toyosawa, S, and Takano, Y. Eccentric localization of osteocytes expressing enzymatic activities, protein, and mrna signals for type 5 tartrate-resistant acid phosphatase (trap). Journal of Histochemistry & Cytochemistry, 2004. 52(11): 1475-1482.

233. Wysolmerski, JJ. Osteocytic osteolysis: Time for a second look. BoneKEy Reports, 2012. 1: 229.

234. Wang, Q, Rozelle, AL, Lepus, CM, Scanzello, CR, Song, JJ, Larsen, DM, Crish, JF, Bebek, G, Ritter, SY, Lindstrom, TM, Hwang, I, Wong, HH, Punzi, L, Encarnacion, A, Shamloo, M, Goodman, SB, Wyss-Coray, T, Goldring, SR, Banda, NK, Thurman, JM, Gobezie, R, Crow, MK, Holers, VM, Lee,

References 159

DM, and Robinson, WH. Identification of a central role for complement in osteoarthritis. Nature Medicine, 2011. 17(12): 1674-9.

235. Hardy, R and Cooper, MS. Bone loss in inflammatory disorders. The Journal of Endocrinology, 2009. 201(3): 309-20.

236. Rainbow, R, Ren, W, and Zeng, L. Inflammation and joint tissue interactions in oa: Implications for potential therapeutic approaches. Arthritis, 2012. 2012: 8.

237. Komatsu, N and Takayanagi, H. Inflammation and bone destruction in arthritis: Synergistic activity of immune and mesenchymal cells in joints. Frontiers in Immunology, 2012. 3: 77.

238. Matzelle, MM, Gallant, MA, Condon, KW, Walsh, NC, Manning, CA, Stein, GS, Lian, JB, Burr, DB, and Gravallese, EM. Resolution of inflammation induces osteoblast function and regulates the wnt signaling pathway. Arthritis & Rheumatism, 2012. 64(5): 1540-1550.

239. Grunke, M and Schulze-Koops, H. Successful treatment of inflammatory knee osteoarthritis with tumour necrosis factor blockade. Annals of the Rheumatic Diseases, 2006. 65(4): 555-556.

240. Calich, A, Domiciano, D, and Fuller, R. Osteoarthritis: Can anti-cytokine therapy play a role in treatment? Clinical Rheumatology, 2010. 29(5): 451-455.

241. Han, P, Wu, C, Chang, J, and Xiao, Y. The cementogenic differentiation of periodontal ligament cells via the activation of wnt/beta-catenin signalling pathway by li(+) ions released from bioactive scaffolds. Biomaterials, 2012. 33(27): 6370-9.

242. Wu, C, Zhou, Y, Fan, W, Han, P, Chang, J, Yuen, J, Zhang, M, and Xiao, Y. Hypoxia-mimicking mesoporous bioactive glass scaffolds with controllable cobalt ion release for bone tissue engineering. Biomaterials, 2012. 33(7): 2076-85.

243. Schett, G. Synovitis--an inflammation of joints destroying the bone. Swiss Medical Weekly, 2012. 142: w13692.

244. Loeser, RF, Goldring, SR, Scanzello, CR, and Goldring, MB. Osteoarthritis: A disease of the joint as an organ. Arthritis and rheumatism, 2012. 64(6): 1697-707.

245. Tanaka, Y, Nakayamada, S, and Okada, Y. Osteoblasts and osteoclasts in bone remodeling and inflammation. Current Drug Targets-Inflammation and Allergy, 2005. 4(3): 325-8.

246. Birmingham, E, Niebur, GL, McHugh, PE, Shaw, G, Barry, FP, and McNamara, LM. Osteogenic differentiation of mesenchymal stem cells is regulated by osteocyte and osteoblast cells in a simplified bone niche. European Cells & Materials, 2012. 23: 13-27.

160 References

247. Tnf-[alpha] accelerates bone fracture healing. BoneKEy Reports, 2012. 1(5).

248. Gerstenfeld, LC, Cho, TJ, Kon, T, Aizawa, T, Cruceta, J, Graves, BD, and Einhorn, TA. Impaired intramembranous bone formation during bone repair in the absence of tumor necrosis factor-alpha signaling. Cells, Tissues, Organs, 2001. 169(3): 285-94.

249. Gilbert, L, He, X, Farmer, P, Boden, S, Kozlowski, M, Rubin, J, and Nanes, MS. Inhibition of osteoblast differentiation by tumor necrosis factor-alpha. Endocrinology, 2000. 141(11): 3956-64.

250. Prasadam, I, Zhou, Y, Shi, W, Crawford, R, and Xiao, Y. Role of dentin matrix protein 1 in cartilage redifferentiation and osteoarthritis. Rheumatology (Oxford), 2014. 53(12): 2280-7.

251. Diarra, O, Ba, M, Ndiaye, A, Ciss, G, Dieng, PA, Sy, MH, Dieme, C, and Ndiaye, M. [traumatic manubriosternal joint dislocation in adult: About two surgical cases]. Dakar Medical, 2007. 52(3): 231-5.

252. Hardy, R, Juarez, M, Naylor, A, Tu, J, Rabbitt, EH, Filer, A, Stewart, PM, Buckley, CD, Raza, K, and Cooper, MS. Synovial dkk1 expression is regulated by local glucocorticoid metabolism in inflammatory arthritis. Arthritis Research & Therapy, 2012. 14(5): R226.

PHENOTYPICAL CHANGES OF OSTEOCYTES IN - QUT Jaiprakash_Thesis.pdf · vi Phenotypical Changes of...

Documents

Transcript of PHENOTYPICAL CHANGES OF OSTEOCYTES IN - QUT Jaiprakash_Thesis.pdf · vi Phenotypical Changes of...