Persistence of Algal Viruses and Cyanophages in Freshwater ... · Persistence of Algal Viruses and...
Transcript of Persistence of Algal Viruses and Cyanophages in Freshwater ... · Persistence of Algal Viruses and...
Persistence of Algal Viruses and Cyanophages in Freshwater Environments
by
Andrew Milam Long
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Ecology and Evolutionary Biology University of Toronto
© Copyright by Andrew Milam Long 2017
ii
Persistence of Algal Viruses and Cyanophages in Freshwater
Environments
Andrew Milam Long
Doctor of Philosophy
Ecology and Evolutionary Biology
University of Toronto
2017
Abstract
Algal viruses and cyanophages exert top-down population controls upon primary producers in
aquatic environments. Despite their clear importance, many ecological phenomena related to
viruses are poorly understood. For instance, several studies suggest that phytoplankton viruses
often exist at stable abundances, even when their hosts are absent. However, estimates of algal
virus and cyanophage decay suggest that they decay too swiftly for these stable abundance
patterns to occur. This paradox is the primary impetus for my research. In order to begin to
address this knowledge gap, the seasonality of algal virus decay was assessed using decay
incubation experiments across all four seasons using infectivity assays with cultivated viruses to
estimate decay rates, which found high decay rates in the summer and spring and low decay rates
in the winter. This seasonal study found that the low algal virus decay rates during winter
allowed for survival after 126 days under ice cover in a seasonally frozen freshwater pond. This
work was expanded upon by developing and validating molecular assays to estimate decay of
environmental viruses with either unknown or uncultivated hosts, which represent the majority
of viruses in nature. Upon validation of molecular assays for estimating decay rates,
environmental algal virus and cyanophage decay rates were found to vary seasonally in the same
way that cultivated algal virus decay rates did. Further, environmental algal viruses were found
iii
to have lower decay rates than cyanophages. In the molecular study, viruses were also found to
persist in the winter under/within the ice cover for 126 days. However, the spring and summer
decay rates estimated in both studies were often too high to permit virus population maintenance
for long periods without ongoing production, which would require the presence of host cells at
relatively high abundances. As such, the ability of freshwater sediment to serve as an
environmental refugium for phytoplankton viruses was assessed using molecular methods.
Freshwater sediments from Lake Erie were found to harbor diverse assemblages of both algal
viruses and cyanophages. Some algal virus and cyanophage genotypes were found at high
abundances in putatively 50 year old sediments, suggesting that sediments may aid in the
persistence of viruses. In conclusion, over-wintering of algal viruses in the water column appears
to be one mechanism that maintains a viral ‘seed-bank,’ and the sediments of aquatic
environments may be an environmental refugium for algal viruses and cyanophages alike.
iv
Acknowledgments
First, I would like to acknowledge my advisor, Dr. Steven Short, for his counsel and support
throughout my degree. Steve helped me through the twists and turns that my research took,
allowed me to take on interesting problems, and was always there to help find interesting
solutions to them. I would also like to acknowledge my committee members, Drs. George Espie
and Linda Kohn, for their advice during my research program and the guidance they both gave
me that allowed me to become a better scientist in general and helped to shape my research
specifically. I would also like to thank my fellow Short Squad members, Mike Staniewski, Robin
Rozon, Samia Mirza, Cindy Short, Ankita Virdi, Amna Alam, Yuri Chaban, Lyndsey Ogden,
Dylan Shea, Nikhil George, Alex Paquette, and Donglin Wang, all of whom made the lab a lot
more fun to be in and provided interesting topics of conversation.
In addition, I would to acknowledge my father-in-law, Dr. Jeff Velten, for providing feedback on
the introduction and discussion chapters and helping me improve the document.
I would also like to thank my wife, Dr. Brandy Velten, for not only helping me stay relatively
sane throughout this experience and helping proofread my thesis, but for providing me insight on
how to be a better student, a better scientist, and a better person in general. In addition, I must
acknowledge my dog, Rufus, for letting me know when to take him outside and forget about my
worries.
Last but definitely not least, I would like to thank my parents, James and Colleen Long, for their
emotional and financial support.
Without the help of those mentioned above, I would have surely not produced this document.
v
Table of Contents
ACKNOWLEDGMENTS IV
TABLE OF CONTENTS V
LIST OF TABLES IX
LIST OF FIGURES X
LIST OF ABBREVIATIONS XI
CHAPTER 1 GENERAL INTRODUCTION 1
AQUATIC VIRAL ECOLOGY 1
1.1 Biology of Phytoplankton Viruses 3
1.1.1 Diversity of Phytoplankton Viruses 3
1.1.2 Overview of Algal Virus Diversity 3
1.1.3 Overview of Cyanophage Diversity 6
1.2 Population Dynamics of Phytoplankton Viruses 9
1.2.1 Abundances of Algal Viruses and Cyanophages 9
1.2.2 Seasonal Variation in Phytoplankton Virus Abundances 13
1.2.3 Environmental Persistence of Phytoplankton Viruses 15
1.3 Thesis Focus and Objectives 21
CHAPTER 2 SEASONAL DETERMINATIONS OF ALGAL VIRUS DECAY RATES REVEAL OVERWINTERING
IN A TEMPERATE FRESHWATER POND 23
ABSTRACT 23
2.1 Introduction 24
2.2 Materials and Methods 27
vi
2.2.1 In situ Incubations to Estimate Virus Decay 27
2.2.2 Cell Culture Conditions and Estimating Virus Titres 28
2.2.3 Decay Rate Calculations and Statistical Analyses 29
2.3 Results 31
2.3.1 Environmental Parameters 31
2.3.2 Environmental Decay 31
2.3.3 Statistical Comparisons of Decay Rates 31
2.4 Discussion 40
2.4.1 Decay of Aquatic Viruses 40
2.4.2 Seasonality and Variability in Rates of Decay 42
2.4.3 Algal Virus Overwintering 44
2.4.4 Conclusions 45
2.4.5 Acknowledgements 46
CHAPTER 3 QUANTITATIVE PCR REVEALS ENVIRONMENTAL PHYTOPLANKTON VIRUS DECAY RATES
VARY SEASONALLY 47
ABSTRACT 47
3.1 Introduction 48
3.2 Materials and Methods 52
3.2.1 In situ decay incubation experiments 52
3.2.2 Algal cell culture conditions and viral infectious titre estimations 53
3.2.3 PCR conditions and sequence analysis 53
3.2.4 Quantitative PCR primer and probe design and conditions 55
3.2.5 Decay calculations and statistical analyses 57
3.3 Results 59
3.3.1 Environmental data 59
3.3.2 Algal virus and cyanomyovirus sequence analysis 59
3.3.3 Algal virus and cyanophage decay 63
3.3.4 Statistical comparisons of estimated algal virus and cyanophage decay rates 68
3.4 Discussion 73
3.4.1 Methodological considerations 73
vii
3.4.2 Diversity of algal viruses and cyanophages in a freshwater pond 74
3.4.3 Environmental decay of algal viruses and cyanophages 74
3.4.4 Treatment effects, seasonality and virus-to-virus variability 76
3.4.5 Conclusions 78
3.4.6 Acknowledgements 79
CHAPTER 4 DIVERSE AND ABUNDANT ALGAL VIRUSES AND CYANOPHAGES OBSERVED IN LAKE ERIE
SEDIMENTS 80
ABSTRACT 80
4.1 Introduction 81
4.2 Materials and Methods 85
4.2.1 Sample collection and DNA extraction 85
4.2.2 Analysis of algal virus and cyanophage communities 85
4.2.3 Quantitative PCR of viral genotypes in Lake Erie sediment 88
4.3 Results 91
4.3.1 Diversity of algal viruses and cyanophages in Lake Erie sediment 91
4.3.2 Abundance of algal virus and cyanophage genotypes in Lake Erie sediment 98
4.4 Discussion 104
4.4.1 Diversity of phytoplankton viruses in freshwater sediment 104
4.4.2 Phytoplankton virus gene abundance in Lake Erie sediment 106
4.4.3 Sediments as environmental refugia or geological record? 108
4.4.4 Conclusions 109
4.4.5 Acknowledgements 110
CHAPTER 5 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS 111
PHYTOPLANKTON VIRUS SURVIVAL 111
5.1 Seasonality of Algal Virus Decay Rates 112
5.2 Seasonality of Phytoplankton Virus Decay Rates Estimated with Molecular Methods 113
5.3 Diversity and Abundance of Phytoplankton Viruses in Sediment 115
viii
5.4 Potential Fates of Phytoplankton Viruses in Freshwater Environments 117
5.5 Future Directions 123
REFERENCES 125
APPENDICES 142
APPENDIX 1 142
APPENDIX 2 145
APPENDIX 3 157
COPYRIGHT ACKNOWLEDGEMENTS 161
ix
List of Tables
Table 2.1 Environmental parameters for seasonal decay experiments ..............32
Table 2.2 Linear regression analysis of decay curves ........................................34
Table 3.1 Algal virus and cyanophage targeting quantitative PCR primers and
probes designed for this study............................................................56
Table 3.2 Environmental parameters for autumn 2014 experiment ...................60
Table 4.1 Primer and probe sets of detected algal virus and cyanophage
genes in Lake Erie sediment ..............................................................90
Table 4.2 Species richness and diversity of polB and g20 genes in Lake Erie
sediment .............................................................................................95
Appendix Table 1.1 Pairwise statistical comparisons of the slopes from decay incubations
using the same viruses within the same treatment in different
seasons ...............................................................................................140
Appendix Table 1.2 Pairwise statistical comparisons of the slopes from decay incubations
using the same viruses within the in same season using different
treatments ...........................................................................................141
Appendix Table 1.3 Pairwise statistical comparisons of the slopes from decay incubations
using different viruses within the same season and treatment ...........142
Appendix Table 2.1 Linear regression analysis of decay curves ........................................143
Appendix Table 2.2 ANCOVA comparing slopes from qPCR assays versus infectivity
assays of the same viruses..................................................................146
Appendix Table 2.3 ANCOVA of regression slopes calculated in the same season from
the same viruses with different treatments.........................................148
Appendix Table 2.4 ANCOVA of regression slopes from the same virus and treatment
in different seasons ............................................................................149
Appendix Table 2.5 ANCOVA of regression slopes from the same treatment in the same
season with different viruses ..............................................................152
Appendix Table 3.1 Search results from blastp for polB OTU representative sequences ..155
Appendix Table 3.2 Search results from blastp for g20 OTU representative sequences ...156
x
List of Figures
Figure 2.1 Seasonal decay rates of algal viruses. ............................................................33
Figure 2.2 Percentage of statistically significant differences in the comparisons
between seasons, filtration treatment, or viruses ...........................................36
Figure 2.3 Over-wintering of algal viruses in a seasonally frozen freshwater pond .......37
Figure 3.1 Phylogenetic tree of inferred amino acid sequences of algal virus polB
fragments........................................................................................................61
Figure 3.2 Phylogenetic tree of inferred amino acid sequences of algal virus MCP
fragments........................................................................................................62
Figure 3.3 Phylogenetic tree of inferred amino acid sequences of cyanomyovirus g20
genes ..............................................................................................................64
Figure 3.4 Seasonal decay rates of (A) cultivated algal viruses, (B) environmental algal
viruses, and (C) environmental cyanophages estimated using qPCR ............66
Figure 3.5 Polynomial regression of infectious titre estimates against qPCR estimates
of ATCV-1, CVM-1, and CpV-BQ1 .............................................................69
Figure 4.1 Map of Lake Erie denoting sediment sampling sites. ....................................86
Figure 4.2 Maximum likelihood phylogenetic tree of putative algal virus polB gene
sequences from Lake Erie sediment ..............................................................93
Figure 4.3 Maximum likelihood phylogenetic tree of putative cyanomyovirus
g20 gene sequences from Lake Erie sediment ...............................................96
Figure 4.4 Abundances of individual algal virus genes at stations 1326 (A),
452 (B), 882 (C), and 973 (D)........................................................................100
Figure 4.5 Abundances of individual cyanophage genes at stations 1326 (A),
452 (B), 882 (C), and 973 (D)........................................................................101
Figure 5.1 Diagram of potential fates for phytoplankton viruses in aquatic
environments. .................................................................................................116
xi
List of Abbreviations
λ decay constant
% h-1 percent lost per hour
μm micrometer
ANCOVA analysis of covariance
ATCV-1 Acanthocystis turfacea Chlorella virus-1
AFC analytical flow-through cytometry
blastp basic local alignment search tool for proteins
C carbon
cm centimeter
CO2 carbon dioxide
CpV-BQ1 Chrysochromulina parva virus - Bay of Quinte 1
CVM-1 Chlorella virus Marburg-1
DNA deoxyribonucleic acid
DOM dissolved organic matter
DY-V Do it yourself media five
EhV-86 Emiliania huxleyi virus-86
EsV-1 Ectocarpus siliculosus virus-1
g20 portal protein encoding homolog gene 20
kb kilobase pairs
h hour
LPP Lyngbya, Plectonema, and Phormidium
MBBM modified Bold’s Basal Medium
MCP major capsid protein
mL milliliter
MPN most probably number
N nitrogen
NCBI National Center for Biotechnology Information
NCLDV nucleocytoplasmic large DNA viruses
MEGA molecular evolutionary genetics analysis
MpV-SP1 Micromonas pusilla virus-SP1
OTU operational taxonomic unit
PA plaque assay
PAR photosynthetically active radiation
PC polycarbonate
PCR polymerase chain reaction
PFU plaque forming units
polB DNA polymerase B gene
POM particulate organic matter
PVC polyvinyl chloride
qPCR quantitative PCR
dsDNA double-stranded DNA
dsRNA double-stranded RNA
ssDNA single-stranded DNA
ssRNA single-stranded RNA
RNA ribonucleic acid
TCAG The Center for Applied Genomics
xii
UTM University of Toronto Mississauga
UV ultraviolet
VLP virus-like particles
1
Chapter 1 General Introduction
Aquatic Viral Ecology
Viruses are important players in aquatic ecosystems. They can exert top-down control on specific
populations and, more generally, alter primary production and the cycling of nutrients through
ecosystems (Fuhrman, 1999; Wommack and Colwell, 2000; Suttle, 2007; Short, 2012; Breitbart,
2012). One example of how viruses may alter the population dynamics of their hosts is through
the mechanism proposed in the ‘killing the winner’ hypothesis (Thingstad, 2000; Winter et al.,
2010). In the simplest case of this theoretical model, two prokaryotes, one competition specialist
and one defense specialist, compete for the same resource. The competition specialist has a
higher growth rate and is typically more abundant than the defense specialist, which relies on
attributes that increase its survivability in the environment. Thus, because of its higher
abundance, the competition specialist is more likely to be infected by its specific virus or be
preyed upon by non-selective, predatory protozoans than the defense specialist. In the simplest
version of this model, as the competition specialist population crashes due to viral lysis and
predation, resources are then freed up for the defense specialist to utilize. In more complex
models, these newly freed resources are now available for other competition specialists and
defense specialists to utilize. The population dynamics presented by the ‘killing the winner’
hypothesis result in continual replacements of the most active or abundant member of a
community by other less abundant/active populations through the actions of both viruses and
predators. This continual replacement of the most abundant population may drive diversity in
host populations and requires at least one virus able to exploit each individual host.
While the ‘killing the winner’ hypothesis cannot be explicitly tested in natural systems due to
methodological limitations, a number of studies have clearly demonstrated that viruses occupy
key roles in the population control of cellular organisms within aquatic environments (reviewed
in: Winter et al., 2010). For example, viruses are linked to the cessation of algal blooms (e.g.,
Bratbak et al., 1993; Wilson et al., 2002a; Castberg et al., 2001; Brussaard et al., 2005), have
caused population crashes of heterotrophic flagellates (Massana et al., 2007), can account for up
to 70 % of the mortality of cyanobacteria (Proctor and Fuhrman, 1990), and 5 - 66 % of the
mortality of the marine algae Phaeocystis globosa during blooms (Baudoux et al., 2006).
2
The documented role of viruses as agents of mortality might indicate that viruses only have an
antagonistic relationship with bacteria and primary producers, however, recent evidence suggests
that viral lysis can also stimulate the production of a variety of organisms by altering the flow of
nutrients and energy through aquatic food webs. In what has been termed the ‘viral shunt,’ viral
lysis diverts nutrients away from primary producers and, thus, higher trophic levels into
dissolved and particulate organic matter (DOM and POM) pools (Fuhrman, 1999; Wilhelm and
Suttle, 1999). One of the key predictions of the ‘viral-shunt’ is that carbon that would otherwise
be utilized by higher trophic levels is lost from the system via CO2 production by heterotrophic
bacteria. However, carbon and nutrients taken up by bacteria can re-enter the DOM and POM
pools by further viral lysis of these organisms. After nutrients enter the DOM and POM pools,
bacteria or primary producers (Shelford et al., 2012) can consume the released nutrients, as
demonstrated experimentally for nutrients released by both lysed bacterial cells (Middelboe et
al., 2003) and algal cells (Haaber and Middelboe, 2009). Furthermore, the ‘viral shunt’ does not
always require complete lysis, as infected cells of the alga Phaeocystis globosa were documented
to leak nutrients even before the lysis event and these nutrients (C and N) were then utilized by
bacteria (Sheik et al., 2014). The consumption of nutrients released through viral lysis by
phytoplankton provides a mechanism that may explain the observed increase of primary
productivity due to the presence of viruses reported in marine (Weinbauer et al., 2011) and
freshwater systems (Staniewski and Short, 2014). Thus, through viral lysis and leakage of
nutrients during infection cycles, viruses have the ability to directly alter biogeochemical cycles.
Because many of the known mechanisms by which viruses alter biogeochemical cycles are in
relation to either causing the mortality of primary producers or by stimulating primary
production, the biology of viruses that infect phytoplankton requires special attention.
3
1.1 Biology of Phytoplankton Viruses
Diversity of Phytoplankton Viruses
The two major groupings of viruses that infect phytoplankton are algal viruses and cyanophages.
Algal viruses infect eukaryotic algae, while cyanophages infect prokaryotic algae (i.e.,
cyanobacteria). While single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), and
double-stranded RNA (dsRNA) viruses that infect algae have been observed, the majority of
isolated algal viruses have double-stranded DNA (dsDNA) genomes and belong to family
Phycodnaviridae. In contrast, all characterized cyanophages belong to order Caudovirales, an
order of tailed phages with dsDNA genomes (Ackermann and DuBow, 1987). Within
Caudovirales, the three families that contain cyanophages are Myoviridae, Podoviridae, and
Siphoviridae.
Overview of Algal Virus Diversity
Phycodnaviridae, which is one of the families of nucleocytoplasmic large DNA viruses
(NCLDV), contains six genera, Chlorovirus, Coccolithovirus, Phaeovirus, Prasinovirus,
Prymnesiovirus and Raphidovirus (International Committee on Taxonomy of Viruses, Viral
Taxonomy 2015 release). The genera are named for the types of algae members of each specific
genus generally infect: i.e., chloroviruses infect Chlorella and Chlorella-like green algae,
coccolithoviruses infect coccolithophores belonging to Prymnesiophycaea, phaeoviruses infect
brown algae belonging to Phaeophycaea, prasinoviruses infect green algae belonging to
Prasinophycaea, prymnesioviruses infect haptophyte algae belonging to Prymnesiophycaea, and
raphidoviruses infect raphidophytes belonging to Raphidophycaea (Nagasaki and Bratbak,
2010). Members of family Phycodnaviridae have large genomes (160 - 560 kb) encapsulated by
icosahedral capsids and almost all are obligate lytic viruses, such that infection leads to viral
lysis of the cell (Dunigan et al., 2006).
Remarkably, viruses that infect the brown alga Ectocarpus siliculosus are the only
phycodnaviruses known to date to be temperate, meaning that lysis and cell death does not
immediately follow infection. The genetic material of the temperate phaeoviruses can be
integrated into the hosts’ genomes and can even be inherited by gametophytes (Bräutigam et al.,
1995; Delaroque et al., 1999). Furthermore, these phaeoviruses, along with Chrysochromulina
4
brevifilum virus PW1, are also the only members of Phycodnaviridae currently known to infect
multiple hosts (Suttle and Chan, 1994; Müller et al., 1996). Additionally, Haptolina ericina virus
RF02 and Prymnesium kappa virus RF01, algal viruses that putatively belong to the NCLDV
family Mimiviridae, infect strains of both Haptolina ericina and Prymnesium kappa
(Johannessen et al., 2015). Observations of algal viruses belonging to either Phycodnaviridae or
Mimiviridae that infect multiple hosts challenge the previously held notion that most algal
viruses have a single host as more viruses are isolated and characterized.
As noted before, members of family Phycodnaviridae make up the majority of algal viruses
cultured to date. However, many other types of algal viruses are beginning to be isolated. Several
dsDNA algal viruses that are closely related to Mimiviridae have been isolated, including two
viruses that infect both Haptolina ericina and Prymnesium kappa (Johannessen et al., 2015).
Additionally, the same study isolated an additional algal virus, Prymnesium kappa virus RF02,
which infects two strains of Prymnesium kappa (Johannessen et al., 2015). Moreover, other
studies have isolated algal viruses related to Mimiviridae that infect green algae belonging to
Prasinophycaea (e.g., Pyramimonas orientalis virus-01B; Sandaa et al., 2001), and haptophyte
algae belonging to Prymnesiophycaea (e.g., Chrysochromulina ericina virus-01B; Sandaa et al.,
2001). In addition to other types of dsDNA viruses which infect eukaryotic algae, there are
several reports of viruses with ssDNA, ssRNA, and dsRNA genomes. For instance, there are
several types of ssRNA algal viruses which infect diatoms (e.g., Rhizosolenia setigera RNA
virus; Nagasaki et al., 2004; Chaetoceros tenuissimus RNA virus; Shirai et al., 2008;
Chaetoceros tenuissimus RNA virus type II; Kimura and Tomaru, 2015). Single-stranded RNA
viruses have also been isolated which infect raphidophyte algae (e.g., Heterosigma akashiwo
RNA virus; Tai et al., 2003) and dinoflagellates (e.g., Heterocapsa circularisquama RNA virus;
Tomaru et al., 2004a). Single-stranded DNA algal viruses which infect diatoms have also been
described (e.g., Chaetoceros salsugineum nuclear inclusion virus; Nagasaki et al., 2005;
Chaetoceros tenuissimus DNA virus type II; Tomaru et al., 2011; Chaetoceros tenuissimus DNA
virus type II; Kimura and Tomaru, 2015). Finally, a single dsRNA virus, Micromonas pusilla
RNA virus-01B, has been fully characterized that infects a green alga belonging to
Prasinophycaea (Brussaard et al., 2004). Even though several types of algal viruses have been
isolated, the diversity observed in environmental surveys using molecular tools far exceeds the
cultured diversity.
5
In addition to the algal viruses identified through isolation from environmental samples, various
molecular tools have been used to assess the diversity of uncultivated algal viruses in aquatic
environments. For instance, the use of DNA polymerase B (polB hereafter) as a signature gene
for algal viruses has been well established since the development of the universal algal virus
polB PCR primers AVS1 and AVS2 (Chen and Suttle, 1995). More recently, an additional
universal algal virus polB PCR primer set has been developed and successfully used to study the
diversity of environmental algal viruses (Clerissi et al., 2014a). Furthermore, major capsid
protein (MCP) gene sequences have been used to distinguish between strains of Emiliania
huxleyi viruses (Schroeder et al., 2002) and more recently, universal algal virus MCP PCR
primers have been developed (Larsen et al., 2008; Clerissi et al., 2014a). The majority of
diversity studies using these algal virus primer sets have been in marine systems and have
provided evidence that similar genotypes are widespread geographically and that many different
algal virus genotypes co-exist within the same environment (e.g., Chen et al., 1996; Short and
Suttle, 2002; Schroeder et al., 2002, 2003; Park et al., 2011; Clerissi et al., 2014b, 2015).
While the majority of algal virus diversity studies have been conducted in marine systems,
several studies using algal virus polB and/or MCP PCR primers have recently assessed the
diversity of these viruses in various freshwater systems, including rivers (Short and Short, 2008;
Gimenes et al., 2012), reservoirs (Short and Short, 2008), and several lakes (Short and Short,
2008; Clasen and Suttle, 2009; Gimenes et al., 2012; Short et al., 2011a, 2011b; Rozon and
Short, 2013; Zhong and Jacquet, 2014) One of the prevailing observations from the diversity
surveys using algal virus polB primers is that viruses related to Prasinovirus are the dominant
genotypes in aquatic systems (e.g., Short and Short, 2008; Clasen and Suttle, 2009; Gimenes et
al., 2012; Rozon and Short, 2013; Zhong and Jacquet, 2014; Wang et al., 2015). These
observations may be due to inherent primer biases within polB, however, metagenomic studies of
lakes often find Prasinovirus-like sequences to be the dominant algal virus sequences in
freshwater systems (e.g., López-Bueno et al., 2009; Zhang et al., 2015). While studies using
universal polB primers have also obtained sequences closely related to Prymnesiovirus and
Chlorovirus in freshwater environments (Short et al., 2011b; Wang et al., 2015), the
development of primers biased towards specific cultivated Chlorovirus species yielded more
Chlorovirus-like sequences than the universal algal virus polB PCR primers in Lake Ontario
(Short et al., 2011b). Furthermore, studies utilizing universal algal virus MCP PCR primers have
6
also yielded Prasinovirus-like sequences in freshwater environments, but the same studies also
obtained sequences related to Prymnesiovirus, Mimivirus-like prasinoviruses, and Mimivirus-like
prymnesioviruses (Rozon and Short, 2013; Zhong and Jacquet, 2014; Wang et al., 2015). In
addition to the putative algal virus sequences identified with polB and MCP PCR primers,
metagenomic studies have found Prasinovirus-like sequences in Antarctic lakes (López-Bueno et
al., 2009) and Yellowstone Lake, USA (Zhang et al., 2015), a Mimivirus-like prymnesiovirus in
Yellowstone Lake, USA (Zhang et al., 2015), and a Chlorovirus-like algal virus in Cayuga Lake
and Fayetteville Green Lake, USA (Hewson et al., 2012). The large diversity of putative algal
viruses in aquatic environments, which far exceeds the diversity of cultivated algal viruses,
suggests that the isolation of new algal viruses from aquatic environments is still a critical task in
aquatic viral ecology.
Overview of Cyanophage Diversity
Cyanophages that belong to the three families Myoviridae, Podoviridae, and Siphoviridae all
have dsDNA genomes ranging in size from 80 to 100 kb (McDaniel, 2011). Myoviridae,
Podoviridae, and Siphoviridae are morphologically distinct. While all three have icosahedral
capsids, Myoviridae have contractile tails separated by a neck protein, Podoviridae have non-
contractile tails that are much shorter than the tails of either Myoviridae or Siphoviridae, and
Siphoviridae have long non-contractile tails (Safferman et al., 1983). While these terms lack
taxonomic backing, cyanophages belonging to Myoviridae, Podoviridae, and Siphoviridae are
often referred to as cyanomyoviruses, cyanopodoviruses, and cyanosiphoviruses, respectively.
Cyanophages have been isolated that infect a wide range of cyanobacteria, including the coccoid
Synechococcus, which is widespread and ecologically important in both marine (Barsanti and
Gualtieri, 2006) and some freshwater systems (e.g., Wilhelm et al., 2006b). While all three
morphologies of cyanophages have been shown to infect Synechococcus species, the majority of
the isolated cyanophages that infect Synechococcus are cyanomyoviruses (Mann, 2003;
McDaniel, 2011). Additionally, many of the cyanophages that infect the freshwater toxin-
producing and bloom-forming Microcystis aeruginosa are myoviruses, though cyanopodoviruses
have been found that infect Microcystis species as well (e.g., Yoshida et al., 2006; Deng and
Hayes, 2008). Cyanophages have also been isolated that infect cyanobacteria of genera Lyngbya,
Plectonema, and Phormidium (the LPP group, Safferman and Morris, 1963), Prochlorococcus
7
(Sullivan et al., 2003), Anabaena (Khudyakov and Gromov, 1973; Hu et al., 1981; Franche,
1987), Nostoc (Hu et al., 1981), and Nodularia (Jenkins and Hayes, 2006).
Even though many earlier isolated cyanophages have been found to infect multiple hosts
(Safferman et al., 1983), it has been suggested that their multi-host status reflects the
dysfunctional state of cyanobacteria taxonomy rather than a true ability to infect vastly different
hosts (Suttle, 2000b). However, cyanophages have been shown to infect multiple types of
Synechococcus (e.g., Suttle and Chan, 1993) and some cyanophages even infect both
Synechococcus and Prochlorococcus species (Sullivan et al., 2003). Additionally, several
cyanophage isolates have been shown to infect cyanobacteria stains that are unambiguous
members of the genera Microcystis, Planktothrix, and Anabaena (Deng and Hayes, 2008). As
such, the ability to infect multiple hosts appears to be common among several types of
cyanophages. Surprisingly, some of the isolated cyanophages known to infect Microcystis,
Planktothrix, and Anabaena showed a novel filamentous morphology (Deng and Hayes, 2008).
These filamentous viruses suggest that some cyanophages may not belong to Myoviridae,
Podoviridae, or Siphoviridae.
As with algal viruses, molecular methods of detection have been used to assess the diversity of
cyanophages in aquatic environments. The environmental diversity of cyanomyoviruses has been
assessed through the use of PCR primers targeting the portal protein encoding homolog gene 20
(g20) of cyanomyoviruses infecting Synechococcus and Prochlorococcus (Fuller et al., 1998;
Zhong et al., 2002; Sullivan et al., 2008). Additionally, the diversity of cyanomyoviruses and
some cyanopodoviruses has been studied using PCR primers targeting the photosystem II protein
D1 gene psbA (Sullivan et al., 2006). This gene was likely acquired from host organisms and
models have suggested that viral photosynthetic genes may increase the fitness of host
organisms, especially during periods with intense light conditions (Bragg and Chisholm, 2008;
Hellweger, 2009). More recently, various PCR primers targeting the DNA polymerase gene,
polA, of cyanopodoviruses (Chen et al., 2009) and the ribonucleotide reductase, large terminase
subunit, and major capsid protein genes of cyanosiphoviruses (Wang et al., 2015) have been
developed and utilized to study the diversity of these cyanophage morphotypes in the
environment.
8
As was the case for algal viruses, the majority of cyanophage diversity studies were conducted in
marine systems (e.g., Zhong et al., 2002; Frederickson et al., 2003; Marston and Sallee, 2003;
Wang and Chen, 2004; Sandaa and Larsen, 2006; Sandaa et al., 2008; Huang et al., 2010;
Jameson et al., 2011). Nonetheless, the diversity of g20 of cyanomyoviruses and psbA genes of
cyanomyoviruses and cyanopodoviruses infecting Synechococcus have been studied in a number
of freshwater lakes (Dorigo et al., 2004; Short and Suttle, 2005; Wilhelm et al., 2006b; Chénard
and Suttle, 2008; Wilhelm and Matteson, 2008; Wang et al., 2009; Zhong and Jacquet, 2014;
Wang et al., 2015) and ponds (Short and Suttle, 2005), and the diversity of cyanosiphoviruses
infecting Synechococcus has been studied using multiple targeted genes in a single lake in China
(Wang et al., 2015). The most common observation from these studies is that, like algal viruses
and other microorganisms, the diversity of uncultivated environmental cyanophages far exceeds
the current diversity of cultured cyanophages. Furthermore, in the case of g20, several studies
have obtained sequences more closely related to other uncultured, environmental sequences than
sequences related to those from cultivated cyanophages (e.g., Short and Suttle, 2005; Wang et
al., 2009; Wang et al., 2015). This observation has led to the suggestion that the g20 primer sets
amplify other myoviruses that are not necessarily cyanomyoviruses (Short and Suttle, 2005).
However, when Sullivan and colleagues (2008) screened their redesigned g20 PCR primers with
a multitude of isolated phages, amplification was obtained for every Synechococcus and
Prochlorococcus cyanomyovirus tested, but none of the myoviruses that infect other types of
bacteria yielded PCR products. Therefore, the majority of sequences more closely related to
environmental sequences than cultivated cyanophages may be cyanomyoviruses.
In freshwater systems, additional PCR primers targeting cyanophages that infect the filamentous
cyanobacteria Anabaena and Nostoc (Baker et al., 2006), and for cyanophages that infect
Microcystis (Takashima et al., 2007; Kimura et al., 2013; Nakamura et al., 2014) have been
developed. The PCR primers developed by Takashima et al. (2007) to target Microcystis
cyanophage sheath proteins may be less suitable for diversity studies as only two genotypes were
obtained in an embayment of Lake Ontario in Canada (Rozon and Short, 2013), while many
genotypes were found in Hirosawanoike Pond and Lake Shinji in Japan using more recently
designed primers (Nakamura et al., 2014). Whether this discrepancy in observed genotypes
between these two locations is due to primer biases or differences in viral diversity at these sites
remains to be explored.
9
The isolation of diverse environmental viruses that infect phytoplankton suggests that numerous
viruses must be present in the environment. If the phytoplankton is able to be cultured, then
infectivity assays may be used to assess the abundance of its virus in environmental samples.
However, as stated above, the majority of phytoplankton viruses are only known from molecular
evidence. The molecular data for these phytoplankton viruses without known hosts has been used
to estimate the abundance of these viruses in nature. The use of infectivity and molecular assays
to estimate the abundance of phytoplankton viruses has begun to yield insights on the
distribution of these viruses in the environment and what factors might influence the observed
patterns.
1.2 Population Dynamics of Phytoplankton Viruses
Due to the wide ranging effects they have on food webs and biogeochemistry, the population
dynamics of algal viruses and cyanophages are of particular importance in viral ecology. The
abundance of phytoplankton viruses, their seasonality, their dependence upon host cell densities,
and their mechanisms for survival in the environment are all factors which directly influence
their population dynamics.
Abundances of Algal Viruses and Cyanophages
In order to give context to the abundances of individual phytoplankton viruses, the abundances
of total viruses in aquatic systems is summarized first. Total virus abundance is typically
measured with transmission electron microscopy or epifluorescence microscopy and is reported
as virus-like particles (VLP) per mL. As reviewed by Wilhelm and Matteson (2008), viruses in
water samples often have abundances between 106 and 108 VLP mL-1 in freshwater
environments and 104 and 108 VLP mL-1 in marine environments. While viral abundances are
typically higher in freshwater, they appear to be subject to greater seasonal variations in these
environments (Wilhelm and Matteson, 2008). Unsurprisingly, phytoplankton virus abundances
are estimated to be lower than the higher ranges of total virus abundance.
Before the abundance of phytoplankton viruses can be discussed, it is important to take note of
the limitations of the methods used to measure algal virus and cyanophage populations.
Individual phytoplankton virus populations have been enumerated through several methods.
10
Infectivity assays such as plaque assays and most probable number (MPN) assays rely on
cultured host organisms, while analytical flow-through cytometry (AFC) or quantitative PCR
(qPCR) do not. Quantifying algal viruses and cyanophages with measures of infectivity (i.e.,
plaque assays or MPN) is perhaps the most ecologically relevant method. However, it relies upon
the availability of host organisms capable of growth in culture, which represents a small minority
of single-celled organisms. Further, infectivity measures can only be used to deduce the total
community of viruses that infect specific algae or cyanobacteria. This can include several
different strains of viruses and/or even different viruses with varying genetic material. For
instance, both dsDNA and dsRNA viruses are known to infect the same host, Micromonas
pusilla (Brussaard et al., 2004). While AFC and qPCR can enumerate total viruses of specific
types, they likely represent overestimates of ecologically viable virus particles as only a portion
of algal virus progeny in culture are infectious (e.g., Van Etten et al., 1983b; Cottrell and Suttle,
1995; Bratbak et al., 1998). However, AFC and qPCR have a distinct advantage in their ability to
enumerate viruses of algae and cyanobacteria that are currently unable to be cultured. In
particular, qPCR has the advantage of being able to enumerate specific strains of environmental
phytoplankton viruses, as discussed above.
In marine systems, the abundances of several types of algal viruses have been estimated using
infectivity assays. The number of infectious units have been estimated for viruses that infect
Micromonas pusilla (Cottrell and Suttle, 1995; Sahlsten, 1998; Zingone et al., 1999),
Phaeocystis globosa (Baudoux et al., 2006), Heterosigma akashiwo (Tomaru et al., 2004b),
Heterocapsa circularsquama (Nagasaki et al., 2004), Ostreococcus tauri (Bellec et al., 2010),
and Chaetoceros spp. (Tomaru et al., 2011a) in several different marine environments. These
studies have found the range of abundances for these algal viruses to be 0.02 to 104 infectious
units mL-1. In addition to studies that estimated abundances with infectivity assays, several
studies have estimated the abundance of putative algal viruses using AFC. As these studies
typically estimated virus abundance during algal blooms, most of the large viruses estimated
with AFC were assumed to infect the prevailing algae during the bloom. AFC has been used to
estimate abundances of viruses that putatively infect Emiliania huxleyi (Wilson et al., 2002b;
Jacquet et al., 2002; Sorensen et al., 2009) and Phaeocystis globosa (Baudoux et al., 2006)
during algal blooms of these species. The maxima (up to 107 viruses mL-1) for abundance studies
using AFC were higher than those using infectivity assays. This may be due to the AFC studies
11
being conducted during blooms of host species, however, the abundance of viruses infecting
Phaeocystis globosa were simultaneously measured with AFC and MPNs, which found that
AFC-derived abundances were 20x that of the MPN-derived abundances (Baudoux et al., 2006).
It cannot be currently elucidated which method provides the more realistic measurement as AFC
likely overestimates the number of viruses due to its non-specific count of viruses of the same
size and MPN may underestimate the number of viruses if the strains present in the environment
do not infect the strain of algae used in the assay.
While the majority of phytoplankton virus abundance studies using infectivity assays have been
in marine systems, there have been several investigations of phytoplankton virus abundances
using these methods in freshwater environments. For example, the use of plaque assays to
enumerate viruses infecting Chlorella algae species have found abundances of up to 4.0 x 104
plaque-forming units (PFU) mL-1 in the Waccamaw River, NC, USA (Van Etten et al., 1985a),
3.2 x 103 PFU mL-1 in a drainage ditch in IL, USA (Van Etten et al., 1985b), 8.0 103 PFU mL-1 in
a pond in Seisei, Japan (Yamada et al., 1991), 1.4 x 103 PFU mL-1 in Holmes Lake, NE, USA
(Quispe et al., 2016), and up to 105 PFU mL-1 in an undescribed natural water sample (Kang et
al., 2005). However, for many of the environments tested in these studies, the PFU mL-1 of
Chlorella-infecting viruses appear to be lower than these maxima, ranging from below detection
in several sites in the surveys conducted in the USA, to less than one PFU mL-1 in other sites, up
to the maxima stated above (Van Etten et al., 1985a, 1985b). Additionally, plaque assays and
MPNs have been used to enumerate infectious units of cyanophages infecting Microcystis
aeruginosa in a hypereutrophic pond in Japan (Manage et al., 1999) and in Lake Baroon,
Australia (Tucker and Pollard, 2005). The abundances of Microcystis aeruginosa cyanophages
were estimated over time in a hypereutrophic pond in Japan using plaque assays, which found a
range of 2.0 x 102 to 4.2 x 104 PFU mL-1 (Manage et al., 1999). When estimated at a single time
point in Lake Baroon using MPNs, the abundance of Microcystis aeruginosa cyanophages were
found at a slightly higher abundance of 5.6 x 104 infectious units mL-1 (Tucker and Pollard,
2005). Like Chlorella-infecting algal viruses and Microcystis aeruginosa-infecting cyanophages,
cyanophage infecting the LPP group of cyanobacteria have also been shown to have a global
distribution (e.g., Safferman and Morris, 1963; Singh, 1973). However, these studies found the
LPP-infecting cyanophages to have infectious titres up to only a few thousand per mL. In
contrast, a group of cyanophage that infect Nostoc and Plectonema cyanobacteria were reported
12
to reach infectious titres of up to 104 mL-1 in fish farms and waste stabilization ponds throughout
Russia (Muradov et al., 1990). Overall, the abundance of infectious phytoplankton viruses varies
considerably, from below detection to less than 1 infectious particle mL-1 to 105 mL-1. Both
Chlorella-infecting viruses (105 mL-1) and cyanophages (104 mL-1) have similar maxima, with
the exception of LPP-infecting cyanophages, which are known to only reach 103 infectious units
mL-1. As only relatively few algae and cyanobacteria are in culture, several recent efforts have
looked at phytoplankton virus abundances using culture-free techniques.
Several recent studies have used qPCR to enumerate algal viruses and cyanophages in freshwater
environments. In order to enumerate specific types of algal viruses and cyanophages present
within freshwater systems, these studies have used sequences obtained using universal algal
virus or cyanophage PCR primers, as discussed above, to develop qPCR primers and probes. For
algal viruses, the abundances of Chlorovirus-like genotypes, Prasinovirus-like genotypes,
Mimivirus-like prasinovirus-like genotypes, and Mimivirus-like prymnesiovirus-like genotypes
have been enumerated in several locations in Lake Ontario, Canada across three studies (Short
and Short, 2009; Short et al., 2011a; Rozon and Short, 2013). Abundances of up to 104 gene
copies mL-1 were found for Chlorovirus-like genotypes, up to 105 gene copies mL-1 for
Prasinovirus-like genotypes, 103 gene copies mL-1 for Mimivirus-like prasinovirus-like
genotypes, and 104 gene copies mL-1 for Mimivirus-like prymnesiovirus-like genotypes (Short
and Short, 2009; Short et al., 2011a; Rozon and Short, 2013). Furthermore, the abundance of
Microcystis aeruginosa-infecting cyanophages related to the cyanomyovirus, Ma-LMM01, has
been studied using qPCR in several lakes ponds in Japan (Yoshida et al., 2008b, 2010; Kimura-
Sakai et al., 2015), in an embayment of Lake Ontario (Rozon and Short, 2013), and in East Lake,
China (Xia et al., 2013). These abundance surveys have often found cyanophage densities of up
to 105 gene copies mL-1. Finally, some studies have used universal cyanomyovirus PCR primers
in qPCR assays to enumerate the total cyanomyovirus community present in the environmental
samples, such as in the case of cyanomyovirus-like genotypes related to cyanomyoviruses that
infect Synechococcus in two lakes in France (Zhong et al., 2013) and in Lake Erie, USA
(Matteson et al., 2011). The abundance survey in the two French lakes found cyanomyovirus
genotype densities of up to 105 gene copies mL-1, while cyanomyovirus genotype densities had a
maximum of 106 gene copies mL-1 in Lake Erie. The overall range of phytoplankton virus
abundances estimated with qPCR is from below the detection limit for some viruses, to tens of
13
gene copies mL-1 to 106 gene copies mL-1. In addition to finding widespread and abundant algal
viruses and cyanophages in environments across the globe, many of these abundance surveys
have followed the abundance of phytoplankton viruses across seasons.
Seasonal Variation in Phytoplankton Virus Abundances
Upon estimating phytoplankton virus abundances across seasons and years, several studies have
found seasonal variations in both marine and freshwater systems (e.g., Van Etten et al., 1985b;
Yamada et al., 1991; Manage et al., 1999; Zingone et al., 1999; Tomaru et al., 2004b; Yoshida et
al., 2008a; Short and Short, 2009; Bellec et al., 2010; Short et al., 2011a; Rozon and Short,
2013; Zhong et al., 2013; Quispe et al., 2016). For instance, infectious titres of Chlorella
infecting viruses were monitored in several different ponds in Illinois, USA from April until
November. One pond had no infectious viruses over the sampling period. However, the overall
trend was peak abundances in May, followed by a drop in abundance by one or two orders of
magnitude, then relatively stable abundances at 5 - 90 PFU mL-1 throughout the rest of the time
points (Van Etten et al., 1985b). Similar patterns were observed in five ponds in Japan for
Chlorella-infecting viruses, sampled from June 1990 to March 1991 with peaks in abundance in
either April, May, or June, depending on the pond (Yamada et al., 1991). These peaks were then
routinely followed by a drop in abundance by one to two orders of magnitude to low, yet
relatively stable abundances throughout the rest of the year, except for two ponds, which both
had at least one month in which no viruses were detected. Furthermore, one pond in Japan had
stable, although very low abundances throughout the year with less than one PFU mL-1 for much
of the year, reaching a maximum of only 1 PFU mL-1. More recently, the seasonal abundance
patterns of algal viruses that infect four types of Chlorella-like algae were studied across three
years in Holmes Lake, NE, USA (Quispe et al., 2016). The strains used in this study were
Chlorella variabilis NC64A, Chlorella variabilis Syngen 2-3, Chlorella heliozoae SAG 3.83,
and Micractinium conductrix Pbi. There were no infectious viruses of M. conductrix Pbi detected
throughout the three year sampling period. In contrast, viruses were detected in every sampling
time for the other three types. The abundance patterns observed were unique for each virus, each
year, and even between the two sites sampled within Holmes Lake. ‘Boom-and-bust’ patterns, in
which periods of high abundance were followed by population crashes, were observed for all
14
three algal virus types. Typically, the periods of high abundance were in the summer, but there
were two peaks in autumn. Throughout the rest of the year, the most common pattern was a low,
stable abundance.
In addition to the three seasonal studies of Chlorella-infecting viruses, infectivity assays have
also been used to study the seasonal abundance of cyanophages infecting Microcystis aeruginosa
in a freshwater pond in Japan. This study found abundances in cyanophages peaked in the
summer and late autumn, after the peak of Microcystis aeruginosa, and was proceeded by a
sharp decline in both host and cyanophage abundances following their autumn maxima (Manage
et al., 1999). Like the Chlorella-infecting viruses, the Microcystis-infecting cyanophages were
present throughout the entire sampling period. The seasonality of cyanophages infecting the LPP
group of cyanobacteria have also been assessed with abundances ranging from single digits in
February and March to tens of infectious units mL-1 from May to June in waste stabilization
ponds in Arkansas, USA (Safferman and Morris, 1967). However, peak abundances of thousands
of infectious units mL-1 occurred during blooms of cyanobacteria in a fish pond in Israel (Padan
and Shilo, 1969).
Not only has the seasonality of algal viruses and cyanophages been studied using infectivity
assays, several studies have examined the seasonality of phytoplankton viruses using qPCR.
Using qPCR, the seasonality of putative of chloroviruses, prasinoviruses Mimivirus-like
prasinoviruses, and Mimivirus-like prymnesioviruses have been assessed in several sites in Lake
Ontario (Short and Short, 2009; Short et al., 2011a; Rozon and Short, 2013). Although some
genotypes had similar abundance patterns, there were complex population dynamics such that
many of the genotypes had unique patterns of abundances. Some genotypes even had different
patterns depending on the location. The two prevalent abundance patterns across the three studies
were that of ‘boom-and-bust’ and the pattern of low, but stable, abundances throughout the entire
sampling periods. Furthermore, the seasonality of Microcystis aeruginosa cyanophages related to
Ma-LMM01 were also estimated in ponds and lakes in Japan (Yoshida et al., 2008b, 2010;
Kimura-Sakai et al., 2015), in Lake Ontario (Rozon and Short, 2013), and in East Lake, China
(Xia et al., 2013). The abundance patterns of Microcystis aeruginosa cyanophages were similar
to those reported for the algal viruses in Lake Ontario, with all but one population of
cyanophages experiencing ‘boom-and-bust’ population dynamics. Only a single cyanophage
population maintained relatively stable abundances throughout the year in the Bay of Quinte in
15
Lake Ontario (Rozon and Short, 2013). Finally, the seasonal abundances of Synechococcus-
infecting cyanomyovirus genotypes have been estimated in Lake Bourget and Lake Annecy,
France (Zhong et al., 2013) and were enumerated in two seasons in Lake Erie, USA (Matteson et
al., 2011). In the two French lakes, there were large fluctuations between most time points, with
an overall maxima in Lake Bourget in September with 106 gene copies mL-1 and a minimum of
~104 gene copies mL-1 in March, while Lake Annecy had an overall maxima in September with
105 gene copies mL-1 and a minimum of ~103 gene copies mL-1 in January (Zhong et al., 2013).
The seasonality of phytoplankton viruses as estimated by both infectivity assays and qPCR raise
interesting questions on how these viruses persist from season-to-season and from year-to-year.
Many phytoplankton viruses, as mentioned above, have seasonal patterns of abundance in which
they exist in the water column in freshwater environments throughout the year. This year-long
persistence can be maintained at low levels following patterns of ‘boom-and-bust,’ at higher,
relatively stable densities, or even at stable low, but detectable, abundances. These patterns
suggest that either hosts remain at densities necessary for viral infection or that algal viruses and
cyanophages have low decay rates.
Environmental Persistence of Phytoplankton Viruses
The observations of stable phytoplankton virus populations in freshwater environments, coupled
with those reported for viruses in marine environments, such as Micromonas pusilla viruses
being present at detectable levels when their hosts were not (e.g., Zingone et al., 1999), provide
support for the ‘Bank’ model of viral ecology. The Bank model was first described by Breitbart
and Rohwer (2005) utilizing metagenomic data of viruses in a marine environment . It states that,
through a rank-abundance curve of viral genotypes, two fractions of viruses exist: one that is
highly abundant and active, but low in diversity, and one that contains the vast majority of
individual types of viruses that exist at low abundance. The viruses that survive in the
environment form a ‘seed-bank.’ Viruses within this ‘bank’ remain at low population levels until
their hosts reach an appropriate abundance such that contact between virus and host is likely to
occur. The threshold that host organisms must reach for phytoplankton viruses to infect and
produce new virions has been estimated to be 103 - 104 cells mL-1 for a number of algal viruses
and cyanophages (Suttle and Chan, 1994; Cottrell and Suttle, 1995; Jacquet et al., 2002).
However, the density of many types of algae drop below this threshold abundance at various
16
times throughout the year in many freshwater environments (e.g., Munawar and Munawar, 1986;
Reynolds, 2006). It would therefore be expected that phytoplankton virus decay rates would
allow for these viruses to persist during the times in which their hosts are below the threshold
necessary for viral infection and replication. However, in the few studies that have assessed the
environmental decay rates of phytoplankton viruses, this has not been the case. To illustrate this,
consider a population of viruses with an abundance equal to the highest reported for algal viruses
and cyanophages, 105 mL-1. Upon its host dropping below densities necessary for virus
production, the virus population will be subject to decay. The half-life for this virus population
will be ~5 days at the lowest decay of infectivity detailed below. This means only 1 virus particle
will remain from a starting population of 105 after 80 days with the lowest report decay rate of
infectivity. Even in this extreme case, the theoretical phytoplankton virus would require the
reoccurrence of its host 3 months after its initial drop below the threshold necessary for viral
production. However, most phytoplankton virus populations have not been observed to reach 105
mL-1 and the majority of phytoplankton viruses have been estimated to have lower half-lives than
5 days. This paradox of high viral decay rates for seemingly stable populations of algal viruses
and cyanophages in the absence of their hosts remains unresolved in aquatic environments.
Despite its clear importance in viral ecology and the necessity of phytoplankton virus particles to
survive outside host cells in order to reproduce, the number of studies that focus upon algal virus
and cyanophage decay rates is extremely limited. Only three studies provide estimates of algal
virus decay rates: two with infectivity measurements for marine algal viruses (Cottrell and Suttle,
1995; Frada et al., 2014) and one with qPCR for freshwater algal viruses (Hewson et al., 2012).
The decay rates of the marine Prasinovirus, Micromonas pusilla virus-SP1, was estimated to be
28 percent infectivity lost per hour (% h-1) in March in the Gulf of Mexico and 30 % h-1 in April,
which translate to half-lives of 2.5 and 2.3 hours (Cottrell and Suttle, 1995). The decay rate of
the marine Coccolithovirus, Emiliania huxleyi virus, was estimated to be 2 - 3 % h-1 in the North
Atlantic, with half-lives between 23 and 35 hours (Frada et al., 2014). Using qPCR, the decay
rate of an algal virus genotype related to the freshwater Chlorovirus, Acanthocystis turfacea
Chlorella virus-1 (ATCV-1), was estimated to be 0.13 % gene copies lost per hour (gene copy
half-life of 22 days) in a freshwater pond on the campus of Cornell University in Ithaca, NY,
USA (Hewson et al., 2012). To date, there have been no seasonal reports of algal virus decay
rates.
17
Likewise, estimates of cyanophage decay rates have been reported in five studies: four with
infectivity measures (Suttle and Chan, 1994; Garza and Suttle, 1998; Cheng et al., 2007; Liu et
al., 2011) and one with qPCR (Hewson et al., 2012). The decay rates of marine cyanophages
infecting Synechococcus have been estimated in two studies in the Gulf of Mexico using
infectivity assays, the first reporting a range of 0.5 - 17 % h-1 (half-lives between 4 hours and
5.75 days), depending on the location and depth in the water column (Suttle and Chan, 1994),
while the second study reported decay rates that ranged from ~ 5 to ~ 70 % h-1 (half-lives
between 1 and 13 hours), in both cultured isolates and naturally occurring cyanophages (Garza
and Suttle, 1998). Garza and Suttle (1998) also assessed the seasonality of Synechococcus
cyanophage decay, finding a maximum of ~ 40 - 70 % h-1 (half-lives between 1 and 1.7 hours) in
June and a minimum of ~ 5 - 20 % h-1 (half-lives between 3.5 and 13 hours) in November. Decay
rates have also been estimated for the freshwater cyanphage PP, which infect the filamentous
cyanobacterium Plectonema boryanum, in two studies in Donghu Lake, China. These studies
found a range of 60 - 230 % h-1 (half-lives between 0.3 and 1.2 hours; Cheng et al., 2007; Liu et
al., 2011). The decay rates of cyanophage PP had a clear seasonality, with a maximum of 230 %
h-1 (half-life of 0.3 hours) in summer and a minimum of 80 % h-1 (half-life of 0.9 hours) in
autumn (Cheng et al., 2007). Furthermore, the decay rate of a putative cyanomyovirus genotype
related to Prochlorococcus phage P-SSM-4 has been estimated to be 1.3 % h-1 (half-life of 2
days) in a freshwater pond on the campus of Cornell University in Ithaca, NY, USA (Hewson et
al., 2012). As such, the range of estimated decay rates varies across several environments from
approximately 0.13 - 30 % h-1 for algal viruses and 1.3 - 230 % h-1 for cyanophages. It is
important to note that the decay rates estimated with qPCR are, as the authors acknowledged,
likely to be underestimates of algal virus and cyanophage decay. This discrepancy is likely due,
in part, to only 20 - 60 % of algal virus progeny in culture being infectious (e.g., Van Etten et al.,
1983b; Cottrell and Suttle, 1995; Bratbak et al., 1998) as stated above. Additionally, many of the
decay processes that render a virus non-infective may not alter the amplifiability of the specific
regions of DNA necessary for enumeration via qPCR.
Virus particles in general can be removed from the system in a number of ways, including:
inactivation by solar radiation by either ultra-violet (UV) or photosynthetically active radiation
(PAR) (e.g., Wommack et al., 1996; Baudoux et al., 2012), heat-labile organic matter such as
nucleases and proteases (Gerba, 2005; Dell’Anno et al., 2015), consumption of viruses by
18
heterotrophic nanoflagellates (González and Suttle, 1993), attachment to non-host cells, and
adsorption to particles and subsequent sinking (Hewson and Fuhrman, 2003). These factors are
variable throughout aquatic environments. For example, cyanophages infecting Synechococcus
in the Gulf of Mexico were found to have lower decay rates at deeper depths, likely due to lower
levels of solar radiation, and lower enzyme activities stemming from lower temperatures at depth
(Garza and Suttle, 1998). It is easy to understand why some of these decay mechanisms would
destroy the infectivity of a virus, which requires a full complement of unaltered proteins and
genes in order replicate, before compromising the ability to amplify the DNA of a single gene
fragment necessary for qPCR enumeration. It is thus necessary for the relationship between the
loss of infectivity and the loss of amplifiable DNA to be established before further decay rates
can be estimated using qPCR.
Despite the harsh environment viruses experience outside of host cells and the sometimes rapid
turnover of viruses in the environment, algal viruses and cyanophages have several physiological
and life history traits that may aid in persistence outside of host cells. These characteristics
include thick capsids, UV-specific and other DNA repair mechanisms, host-mediated repair
mechanisms, lysogeny and pseudolysogeny. In bacteriophages that infect Escherichia coli,
survivability was found to be inversely proportional to the burst size (De Paepe and Taddei,
2006). Additionally, E. coli bacteriophages with small burst sizes have thick capsids and densely
packaged genomes, which may account for their increased survivability relative to the
bacteriophages with large burst sizes, which generally have thinner capsids and less densely
packed genomes (De Paepe and Taddei, 2006). Similar mechanisms may be involved in the
persistence of phytoplankton viruses as many algal viruses have burst sizes in line with the more
persistent bacteriophages (e.g., Chlorovirus burst sizes range from 200 to 350 PFU per cell,
Dunigan et al., 2006) and cyanophages are related to many of the persistent bacteriophage types,
such as Enterobacteria phage T4, studied by De Paepe and Taddei (2006).
Another mechanism in which algal viruses, in particular, may persist in the environment is
through the use of various DNA repair mechanisms. For instance, many algal viruses of the
family Phycodnaviridae, including many chloroviruses and at least one coccolithovirus, EhV-86,
possess genes for a UV-specific DNA glycosylase-pyrimidine lyase (Furuta et al., 1997;
Dunigan et al., 2006; Fitzgerald et al., 2007; Jeanniard et al., 2013). Other genes that algal
viruses possess include: DNA ligase, DNA polymerase δ, proliferating cell nuclear antigen, as
19
well genes involved in base incision repair and nucleotide incision repair (Dunigan et al., 2006;
Redrejo-Rodríguez and Salas, 2014). Although many algal viruses possess these genes, the
presence of several of the DNA repair genes are strain specific. For instance, some chlorovirus
strains such as KS1B, and the phaeovirus, EsV-1, lack the gene for UV-specific DNA
glycosylase-pyrimidine lyases (Dunigan et al., 2006; Jeanniard et al., 2013). This genetic
variation within algal viruses may partially explain the highly variable decay rates observed to
date.
Cyanophages have additional mechanisms that may aid in survival. For instance, host-mediated
photoreactivation has been shown to repair up to 59 % of the infectivity of cyanophage PP in
Donghu Lake, China (Cheng et al., 2007). Additionally, cyanophages are much more likely to
infect their hosts lysogenically (or temperately) than algal viruses, of which, as stated above,
only algal viruses that infect brown algae have been described to do. Studies have shown that
77.8 % of Synechococcus cyanophage in the Gulf of Mexico and Mississippi River plumes were
infecting their hosts lysogenically (Long et al., 2008). In addition to lysogeny, psuedolysogeny
has been exhibited by several cyanophages, including typically lytic cyanomyoviruses (e.g.,
Wilson et al., 1996; McDaniel and Paul, 2005). Pseudolysogeny occurs when a virus attaches to
the host, enters the host cell, but does not enter the lytic cycle and does not insert its genome into
that of the host cell. Lysogenic and pseudolysogenic infections tie their persistence with that of
their host cells until some environmental or chemical cue causes the virus to enter the lytic cycle
and produce more virions. Even though there are several mechanisms that may aid in the
persistence of phytoplankton viruses, their environmental decay rates can be quite high. Thus,
environmental refugia must also be considered in the maintenance of the viral ‘seed-bank.’
One potential environmental refugium for algal viruses and cyanophages in aquatic ecosystems
is the sediments of these environments; sediments may serve as a habitat that prolongs the
survival of viruses in general in aquatic systems. For example, estuarine sediments have shown
to increase the survival time of enteric viruses in laboratory decay experiments by up to 4 times
the survival time in water from the same sites (e.g., De Flora et al., 1975; Smith et al., 1978;
LaBelle and Gerba, 1980). Additionally, the abundance of viruses in the sediment often exceeds
the abundance of viruses in the overlaying water column (e.g., Paul et al., 1993; Maranger and
Bird, 1996). Furthermore, there is direct evidence that viable phytoplankton viruses can be found
in the sediments of several aquatic environments. In marine systems, sediments have been found
20
to harbor viruses that infect the raphidophyte Heterosigma akashiwo (Lawrence et al., 2002),
viruses that infect diatoms of Chaetoceros spp (e.g., Tomaru et al., 2011b; Kimura and Tomaru,
2015), viruses that infect the dinoflagellate Heterocapsa circularisquama (Nagasaki et al., 2004;
Tomaru et al., 2007), and cyanophages that infect the cyanobacterium Synechococcus strain DC2
(Suttle, 2000a). In the case of the Synechococcus cyanophages, these viruses remained viable
within sediments up to 100 years old (Suttle, 2000a). Further, qPCR has found algal virus
genotypes related to viruses that infect the coccolithophore Emiliania huxleyi in sediments up to
7000 years old in the Black Sea (Coolen, 2011). In freshwater systems, cyanophages infecting
Microcystis strains PPC 7820 and BC 84/1 have been recovered from lake sediments up to 50
years old (Hargreaves et al., 2013) and qPCR has been used to detect genotypes of a putative
chlorovirus and a putative cyanomyovirus in lake sediments (Hewson et al., 2012).
Although sediments may enhance the survivability of viruses, the hosts of phytoplankton viruses
are most active and abundant in the water column; therefore, phytoplankton must be capable of
re-entering the water column to successfully infect their hosts. One possible mechanism for re-
entry from sediment comes from natural disturbances due to storms, seasonal turnovers, and
even human activity such as dredging and high motorboat activity (Rao et al., 1984; Bosch et al.,
1988). These potential mechanisms for re-entry to the water column from the sediment are more
likely to occur in shallow areas and thus sinking of viruses into deep sediments may constitute an
irretrievable loss from the system. While there is clear evidence that sediments harbor
phytoplankton viruses, the diversity of algal viruses and cyanophages within aquatic sediments
has yet to be explored and the abundances of viruses within sediments have been estimated in
relatively few environments and for only some of the viral strains listed above.
The paradox of stable phytoplankton virus abundances in aquatic environments throughout the
year despite the estimations of decay rates that would not allow for this to occur drives my
research questions. In the following, I will discuss the overall and specific research questions of
my thesis and how the remaining chapters of my thesis seek to address these questions.
21
1.3 Thesis Focus and Objectives
Given the paradox of the constant abundances of many types of algal viruses and cyanophages in
freshwater systems, the variable abundances of their hosts, and the reported decay rates of
phytoplankton viruses that are sometimes too high to support long-term survival, the overall
research question of my thesis is: how do algal viruses persist throughout the year in freshwater
environments?
Chapter 2 seeks to answer the specific research question: does viral decay in the water column
proceed in a way that allows for environmental persistence? To do this, seasonal decay rates
were estimated via infectivity assays of three cultivated algal viruses, two chloroviruses and one
newly isolated virus that infects Chrysochromulina parva, in the water column of a freshwater
pond. The seasonal decay incubation experiments were designed in order to compare the
differences between seasons, viruses, and the two treatments: one which included a full
microbial community and one that contained particles less than 0.45 μm in diameter. Further, the
overwintering of these viruses under or within the ice that covered the pond for the entire winter
sampling period was assessed.
Chapter 3 seeks to answer the same specific research question as Chapter 2. Chapter 3 builds off
the framework of Chapter 2 by exploring the seasonal decay rates estimated via qPCR of not
only the three cultivated viruses in Chapter 2, but also for environmental algal viruses and
cyanomyoviruses detected via molecular methods. The viability of qPCR as a measure of
phytoplankton decay was addressed through comparing the environmental decay of the three
cultivated viruses estimated by infectivity assays and by qPCR. This allowed estimation of the
decay rates of uncultivated algal viruses and cyanophages, which represent the vast majority of
viruses in aquatic systems. Further, seasonal, virus, and treatment differences were examined as
in Chapter 2 as well as the overwintering of environmental, uncultivated phytoplankton viruses.
Chapter 4 examines the specific research question: do freshwater sediments provide an
environmental refugium that favors viral persistence? In order to accomplish this, the diversity
of algal viruses and cyanomyoviruses was examined in four discrete locations in Lake Erie in
four depth profiles ranging from the sediment surface to a depth of 8 cm. Further, the abundances
of 11 phytoplankton viral genotypes, 7 algal virus-like genotypes and 4 cyanophage-like
genotypes, were estimated at all four depths and at all four stations via qPCR. Whether the
22
results from this chapter hint at the potential for environmental refugia or provide historical
records of phytoplankton virus abundances in the water column through DNA preservation in the
sediment is discussed.
Chapter 5 will provide an explanation of how the results from Chapters 2 - 4 fit into the overall
research question of my thesis as well as highlight avenues for future research related to the
overall research question.
23
Chapter 2 Seasonal Determinations of Algal Virus Decay Rates Reveal
Overwintering in a Temperate Freshwater Pond
Abstract
To address questions about algal virus persistence (i.e. continued existence) in the environment,
rates of decay of infectivity for two viruses that infect Chlorella-like algae, ATCV-1 and CVM-
1, and a virus that infects the prymnesiophyte Chrysochromulina parva, CpV-BQ1, were
estimated from in situ incubations in a temperate, seasonally frozen pond. A series of
experiments were conducted to estimate rates of decay of infectivity in all four seasons with
incubations lasting 21 days in spring, summer, and autumn, and 126 days in winter. Decay rates
observed across this study were relatively low compared to previous estimates obtained for other
algal viruses, and ranged from 0.012 to 11 % h-1. Overall, the virus CpV-BQ1 decayed most
rapidly whereas ATCV-1 decayed most slowly, but for all viruses the highest decay rates were
observed during the summer and the lowest were observed during the winter. Furthermore, the
winter incubations revealed the ability of each virus to over-winter under ice as ATCV-1, CVM-
1, and CpV-BQ1 retained up to 48 %, 19 %, and 9 % of their infectivity after 126 days,
respectively. The observed resilience of algal viruses in a seasonally frozen freshwater pond
provides a mechanism that can support the maintenance of viral seed-banks in nature. However,
the high rates of decay observed in the summer demonstrates that virus survival and therefore
environmental persistence can be subject to seasonal bottlenecks.
A version of this chapter has been published in The ISME Journal
Long AM, Short SM. (2016). Seasonal determinations of algal virus decay rates reveal
overwintering in a temperate freshwater pond. ISME J 10: 1602–1612.
24
2.1 Introduction
Since the revelation that viruses are the numerically dominant component of aquatic
environments, the burgeoning field of viral ecology has begun to illuminate the roles that viruses
play in these ecosystems (Bergh et al., 1989; Wommack and Colwell, 2000; Brussaard et al.,
2004; Suttle, 2007; Short, 2012). Their high abundance and obligate parasitic lifestyle allow
viruses to exert top-down control of cellular organism populations, which is illustrated most
dramatically through the implication that viruses are involved in the termination of some algal
blooms (e.g., Bratbak et al., 1993; Tarutani et al., 2000; Wilson et al., 2002a; Brussaard et al.,
2005; Gobler et al., 2007; Tomaru et al., 2007). More subtly, viruses contribute to the mortality
of bacteria, phytoplankton, and higher trophic levels of the aquatic food web (Proctor and
Fuhrman, 1990; Suttle, 1994; Baudoux et al., 2006). Viral lysis of algae (Haaber and Middelboe,
2009) and bacteria (Middelboe et al., 2003) can cause the release of particulate and dissolved
organic matter (POM and DOM), and DOM can also be leaked from algal cells currently
infected with viruses (Sheik et al., 2014). Liberated POM and DOM due to viral lysis or leakage
from infected cells can be utilized by bacteria (Bratbak et al., 1998; Middelboe et al., 2003;
Haaber and Middelboe, 2009; Sheik et al., 2014) or by primary producers (Shelford et al., 2012).
Together, these observations demonstrate that viruses can have direct effects on ecosystems via
viral lysis of host cells and altered population dynamics, and indirect effects such as enhanced
nutrient recycling (Fuhrman, 1999). Further, by altering the flow of nutrients, viruses can even
stimulate primary production (Weinbauer et al., 2011; Staniewski and Short, 2014).
Historically, aquatic virus ecology has focused on marine environments, but high viral
abundances have been observed in both the water column and the sediments of freshwater
systems (Maranger and Bird, 1996; Filippini and Middelboe, 2007). The importance of viruses as
agents of freshwater phytoplankton mortality has also been established through a number of
modified dilution experiments, (Gobler et al., 2007; Tijdens et al., 2008; Staniewski et al., 2012),
and algal virus diversity surveys of various lakes and rivers have been conducted (e.g., Short and
Short, 2008; Clasen and Suttle, 2009; Gimenes et al., 2012; Zhong and Jacquet, 2014). Seasonal
studies of algal virus abundance in lakes (e.g., Short and Short, 2009; Short et al., 2011a;
Hewson et al., 2012; Rozon and Short, 2013) have revealed distinct seasonality with patterns of
25
‘boom or bust’ oscillations, or constant abundance depending on the particular virus examined.
Similar abundance patterns have been observed for VLPs (virus-like particles) and phages in
rivers (e.g., Mathias et al., 1995; Farnell-Jackson and Ward, 2003) and lakes (Hofer and
Sommaruga, 2001; Bettarel et al., 2004; Hewson et al., 2012; Zhong et al., 2015). Additionally,
observations of thousands of viral genomes in metagenomic studies of aquatic environments
(Breitbart et al., 2002), and of persistent viruses that exist at low but detectable abundances
throughout much of the year (Waterbury and Valois, 1993; Short and Short, 2009; Short et al.,
2011a; Zhong et al., 2013) have provided evidence for an environmental ‘seed-bank.’ In the
context of aquatic viruses, the concept of a seed bank is borrowed from terrestrial plant ecology
and implies that an inactive pool of viruses persist in the environment waiting for appropriate
conditions for ‘germination’, or replication (Short et al., 2011a). In turn, this idea is based on the
‘Bank model’ hypothesis of Breitbart & Rohwer (2005). Their metagenomics study
demonstrated that only a few virus genomes are highly abundant, and most are rare and part of a
‘bank’ fraction maintained at low abundances resisting destruction until their hosts reach
abundances high enough to promote their replication.
In contrast to observations of ‘seed-bank’ viruses, experimentally derived decay rates of aquatic
viruses are variable, but can be high, ranging from 0.13 - 54 % particles every hour (% h-1;
Heldal and Bratbak, 1991; Cottrell and Suttle, 1995; Noble and Fuhrman, 1997; Garza and
Suttle, 1998; Hewson et al., 2012; Frada et al., 2014). To date, there are few environmental
decay rate estimates for algal viruses. For marine algal viruses, decay rates of MpV-SP1 that
infects the prasinophyte Micromonas pusilla (Cottrell and Suttle, 1995) and the virus EhV that
infects the coccolithophore Emiliania huxleyi (Frada et al., 2014) have been determined via loss
of infectivity and were also variable, but suggested relatively high turnover (2 - 3 % h-1 and 28 -
30 % h-1 for EhV and MpV-SP1, respectively); a decay rate of 2 % h-1 is equal to a half-life of
only 34 h. Interestingly, decay rates of freshwater algal viruses most closely related to
Acanthocystis turfacea Chlorella virus 1 (ATCV-1) were estimated by tracking loss of viral
DNA in experimental incubations of water samples from a lake in New York, and were much
lower than previous reports of algal virus decay with an estimated half-life of 22 days (0.13 % h-
1; Hewson et al., 2012).
Since virus decay rates are potentially high, the seasonality of algal hosts of many viruses
presents an obstacle to the continued production, and thus the persistence (i.e., continued
26
existence), of virus particles throughout the year. It is well established that many freshwater
algae species drop below detectable levels throughout much of the year (e.g., Munawar and
Munawar, 1986; Reynolds, 2006). Because estimated host abundance thresholds for virus
transmission range from 103 - 104 host cells ml-1 for both cyanophages (e.g., Wiggins and
Alexander, 1985; Suttle and Chan, 1994) and algal viruses (e.g., Cottrell and Suttle, 1995;
Jacquet et al., 2002), it is clear that both viral infection and production is dependent upon host
availability. Given the apparently contradictory observations of viral ‘seed-banks’ and seemingly
high decay rates for the few virus taxa that have been studied, it is vital to further explore
viruses’ ability to persist in the environment when their hosts are absent.
The purpose of our study was three-fold: (1) to gain information about the environmental
persistence of algal viruses in freshwater, (2) to test if virus decay rates, and hence their ability to
survive outside of host cells, varies seasonally, and (3) to determine if algal viruses survive
during the winter months in a temperate freshwater habitat. With these goals in mind, decay rates
of three strains of freshwater algal viruses including two chloroviruses, ATCV-1 and Chlorella
virus Marburg-1 (CVM-1), and a newly isolated virus (CpV-BQ1; Mirza et al., 2015) which
infects the prymnesiophyte Chrysochromulina parva were estimated from seasonal in-situ
incubations. These particular viruses were used in this study because their hosts can be grown in
the laboratory and therefore, titres of infectious viruses can be estimated. Furthermore, close
relatives of each of these viruses are known in local freshwaters; CpV-BQ1 was isolated from
Ontario waters (Mirza et al., 2015), and DNA polymerase gene sequences closely related to
ATCV-1, CVM-1, and CpV-BQ1 have been amplified from the study site (Short et al., 2011b).
27
2.2 Materials and Methods
In situ Incubations to Estimate Virus Decay
To assess the seasonality of algal virus decay in a freshwater environment, decay rates of ATCV-
1, CVM-1, and CpV-BQ1 were estimated via experiments conducted throughout the year in a
storm water management pond on the University of Toronto Mississauga (UTM) campus.
Seasonal decay rates were estimated by incubating 500 mL natural water samples with known
concentrations of infectious viruses in situ during incubation experiments initiated within a few
days of the spring and fall equinoxes and the summer solstice, and within a month of the winter
solstice on May 23, 2013, June 21, 2013, October 3, 2013, and December 2, 2013. The infectious
titers in incubation bottles were determined before and after incubation to provide estimates of
loss of infectivity (i.e., decay). Additionally, to compare biotic and abiotic components of decay,
each incubation experiment involved two treatments; infectious viruses were incubated with
either unfiltered water, or water filtered to remove microorganisms larger than viruses.
At the beginning of each decay incubation, ~15 L water samples collected from the UTM pond
were passed through a 210 μm pore-size Nitex mesh to remove large particulates and floating
debris before being split for the two different treatments. The so-called unfiltered water (i.e.,
whole water) treatment used filtrate from the Nitex mesh as medium for in situ virus incubations
while the other treatment used water filtered through 142 mm dia., 0.45μm pore-size HVLP
membrane filter (EMD Millipore, Etobicoke, Canada). For each experiment and treatment
(whole water and filtered water), triplicate 500 mL polycarbonate (PC) bottles (VWR
International, Mississauga, Canada) were filled with the appropriate natural water to which final
concentrations of 1.40 - 4.31 x 106 infectious viruses mL-1 for ATCV-1, 7.02 x 105 - 2.96 x 106
for CVM-1, and 2.20 - 3.53 x 104 for CpV-BQ1 were added. CpV-BQ1 had not been isolated at
the time of the spring incubation and thus was not used in the May 2013 experiment. PC bottles,
although UV opaque, were used for this study because of their durability and because they are
not known to have deleterious effects on algal viruses. Given the lengthy incubations that were
conducted, using incubations bottles that could maintain sample integrity by withstanding
potential disturbances from local fauna as well as a wide range of environmental conditions was
deemed essential. For the spring, summer, and autumn decay experiments triplicate bottles for
each treatment were destructively sampled after incubating in situ for 1, 4, 7, and 21 days.
28
Winter incubations were sampled on days 1, 4, and 7, and again after 126 days to test the
survivability of algal viruses when frozen in the pond over the winter months. During
incubations, the bottles were secured in an arbitrary order to a PVC frame tethered to float
unshaded at the surface of the UTM pond. Ice thickness was monitored for the first 7 days of the
winter experiment.
Water temperatures were measured at each time point with a digital thermometer (VWR
International). Upon destructive sampling of triplicate incubation bottles at each time point and
for each treatment, 100 mL of H2O from each bottle was sequentially filtered through a 47 mm
dia., GC50 glass filter (0.5 μm nominal rating, Advantec AMD Manufacturing Inc. Mississauga,
Canada) followed by a 47 mm dia., 0.45 μm pore-size HVLP membrane filter (EMD Millipore).
The infectious titers of each virus in the resultant 0.45 μm filtrates were determined and used to
calculate environmental decay rates for each sample. Infectious titers were estimated within 2
weeks after destructive sampling at each time point; an earlier experiment demonstrated that 4 °C
storage of a 0.45 μm filtrated lysate of ATCV-1 retained 100 % of its infectivity even after 86
days.
Cell Culture Conditions and Estimating Virus Titres
Cell cultures of Micractinium conductrix strain Pbi (formerly Chlorella strain Pbi) were grown
in FES medium (Reisser et al., 1986), while cultures of Chlorella heliozoae strain SAG 3.83
were grown in modified Bold’s Basal Medium (MBBM) (Van Etten et al., 1983a), and
Chrysochromulina parva were grown in DY-V medium (Andersen et al., 2005). Viral lysates
were generated for ATCV-1, CVM-1, and CpV-BQ1 by inoculating 1 mL of infectious viruses
(i.e., 0.45 μm-filtered viral lysates) into 150 mL cultures of the appropriate host. After the cell
cultures cleared, the resulting viral lysates were filtered with a 47 mm dia. 0.45μm pore-size
HVLP membrane filter (Merck Millipore, Billerica, MA). Filtered viral lysates were stored at
4°C until utilization in environmental decay experiments. Infectious titers of the viral lysates
were estimated using plaque assays for ATCV-1 and CVM-1, and a most probable number assay
(MPN) for CpV-BQ1. Infectious titers remaining in each bottle after in situ incubation were
determined using the same methods.
Plaque assays for ATCV-1 used the host C. heliozoae grown on MBBM-agar medium (Van
Etten et al., 1983a), whereas plaque assays for CVM-1 were carried out using the same protocol,
29
but with M. conductrix grown on FES-agar medium. Plaque assays were performed in triplicate
for every sample. At the time of this study C. parva had not been successfully cultivated on solid
medium, so MPN assays were used to titer CpV-BQ1. MPNs were carried out in 96-well
microtiter plates with 100 μL of C. parva cells (107 cells mL-1) and 100 μL of the 0.45 μm
filtered samples from each incubation bottle diluted serially from 100 to 10-10; each column of 8
wells in the plates were replicates of a single dilution level. A column of wells with 100 μL of
cells and 100 μL of DY-V was used as a control in each plate. MPNs were calculated as
described in Jarvis et al., (2010).
Decay Rate Calculations and Statistical Analyses
Decay rates were estimated as previously described (Noble and Fuhrman, 1997). Briefly, linear
regressions were calculated for natural log transformed infectious titers plotted against time, as
decay of infectivity follows the exponential model 𝑁(𝑡) = 𝑁0𝑒−𝜆𝑡, where N0 is the infectious
titer at time zero, 𝑁(𝑡) is the infectious titer at time t, and λ is the decay constant. The slope of
the regressions represent the decay constants (units are h-1), the reciprocal of the decay constants
are turnover times, and decay rates expressed as percentage infectivity lost per hour were
calculated by multiplying λ by 100 and half-lives were calculated by dividing ln(2) by λ. In the
summer incubation, time points 7 and 21 days were excluded from the CpV-BQ1 calculations in
both treatments due to the absence of detectable infectious CpV-BQ1 viruses. Statistical
comparisons using summer CpV-BQ1 data also exclude these time points.
Linear regression analyses and analysis of covariance (ANCOVA) statistical tests were
conducted using GraphPad Prism 6 (GraphPad Software, La Jolla, CA). To be consistent with
the decay rate calculations, statistical tests were calculated using natural log transformed data. A
significance level of 0.05 was used for linear regression. To determine if decay rates of the three
viruses were significantly different, ANCOVA was used to compare the slopes of linear
regressions of different viruses incubated during the same season and in the same treatments.
Similarly, to determine if the two treatments (whole water incubation versus incubation in 0.45
μm filtrate) had a significant effect on viral decay rates, ANCOVA was used to compare slopes
of two treatments for the same viruses within the same season, while tests for the effect of
seasons on viral decay rates were based on comparisons of the same viruses in the same
treatment incubated during different times of the year. To account for the multiple pairwise
30
comparisons, Bonferroni corrections were applied to adjust the significance levels for seasonal (α
= 0.00167), treatment (α = 0.0045), and virus-to-virus (α = 0.0025) comparisons.
31
2.3 Results
Environmental Parameters
The average number of daylight hours over the course of the spring, summer, autumn, and winter
experiments were 15.25, 15.36, 11.05, and 10.22 h, respectively, with cumulative daylight hours
and irradiation greatest during the summer and lowest in winter (Table 2.1). The average water
temperature over the five time points was 21.85, 27.08, 17.36, and 3.18°C during the spring,
summer, autumn, and the first four time points of winter, respectively. The temperature at the
final time point of the winter experiment after the pond thawed was 5.9°C. During the winter
incubation, ice covered the pond for all 126 days with a thickness of at least 1.5 cm and
snowpack up to 25 cm according to data from Environment Canada for nearby Toronto
International Airport (approx. 14 km from the study site). During this winter incubation, snow
began to accumulate on the 7th day of the incubation and stayed until the 109th day of the 126 day
incubation. The daily average snow cover thickness was 5, 6, 15, and 5 cm, during the months of
December, January, February, and March, respectively.
Environmental Decay
All three algal viruses experienced lowest decay rates in the winter filtered water treatment and
the highest in the summer whole water treatment (Figure 2.1). ATCV-1 infectivity decayed at
rates ranging from 0.012 - 1.10 % h-1 with the lowest rates in the winter and the highest in the
summer (Figure 1). Half-lives for ATCV-1 ranged from 2.6 - 240 days. CVM-1 decay rates
ranged from 0.047 - 1.2 % h-1 with half-lives from 2.4 – 61 days, and for CpV-BQ1, decay rates
ranged from 0.077 - 11 % h-1, with half-lives from 0.26 - 38 days.
Statistical Comparisons of Decay Rates
Complete statistical comparisons of slopes from the regressions of the natural logarithm of virus
abundance versus time (i.e., decay rates) for each virus during every season and each treatment
are compiled in Table 2.2 and Appendices 1.1 - 1.3. Except for the regression slope for ATCV-1
during the winter decay incubation in the whole water treatment, the regression slopes for all
decay incubations were significantly non-zero, with p-values < 0.05 (Table 2.2). Pairwise
comparisons of the regression slopes were conducted to detect differences in decays rates
32
Table 2.1 Environmental Parameters for Seasonal Decay Experiments
Season Sampling
Times (hours) Water Temperature
(°C) Cumulative
Daylight Hours Ice Thickness
(cm)
Spring 0 20.6 0 -
24 15.3 15.03 -
96 20.7 60.31 -
168 27.1 105.78 -
504 25.6 320.05 -
Summer 0 25.1 0 -
24 26.7 15.45 -
96 29.4 61.78 -
168 27.1 108.07 -
504 27.1 322.63 -
Fall 0 21.2 0 -
24 18.5 11.07 -
96 18.1 45.45 -
168 18.3 79.38 -
504 10.8 232.13 -
Winter* 0 3.5 0 3
24 4.0 10.12 4.5
96 2.8 37.37 1.5
168 2.4 64.37 5.5
3072 5.9 1288.53 0
*Cumulative daylight hours do not necessarily reflect the exposure of viruses to daylight during this incubation due to persistent ice and snow cover.
33
Figure 2.1. Seasonal decay rates of algal viruses. Each data point is the average of three
calculated decay rates from triplicate incubations for each time point and treatment. Error bars
represent standard deviation. Note the split Y axis with different scaling above and below the
split.
4
5
6
7
8
9
10
11
12
ATCV-1
CVM-1
CpV-BQ1
0
0.5
1
1.5
2
Filt
ere
d
Wh
ole
wa
ter
Filt
ere
d
Wh
ole
wa
ter
Filt
ere
d
Wh
ole
wa
ter
Filt
ere
d
Wh
ole
wa
ter
Spring Summer Fall Winter
De
ca
y R
ate
(%
h-1)
34
Table 2.2. Linear Regression analysis of decay curves
Season Virus Treatment Slope 95% Confidence Interval Slope significantly
non-zero? F DFn, DFd p value
Spring ATCV-1 Filtered Water -0.0028 ± 0.00044 -0.0038 to -0.0019 Yes 41.03 1, 13 < 0.0001
Whole water -0.0093 ± 0.00043 -0.0102 to -0.0084 Yes 474.4 1, 13 < 0.0001
CVM-1 Filtered Water -0.0068 ± 0.00034 -0.0075 to -0.0061 Yes 410.4 1, 13 < 0.0001
Whole water -0.011 ± 0.00041 -0.012 to -0.0102 Yes 733.5 1, 13 < 0.0001
Summer ATCV-1 Filtered Water -0.0047 ± 0.00056 -0.0059 to -0.0035 Yes 70.8 1, 13 < 0.0001
Whole water -0.011 ± 0.00019 -0.011 to -0.0105 Yes 3144 1, 13 < 0.0001
CVM-1 Filtered Water -0.0072 ± 0.00063 -0.0086 to -0.0059 Yes 132.3 1, 13 < 0.0001
Whole water -0.012 ± 0.00062 -0.013 to -0.0103 Yes 351.5 1, 13 < 0.0001
CpV-BQ1 Filtered Water -0.096 ± 0.0042 -0.11 to -0.087 Yes 530.5 1, 7 < 0.0001
Whole water -0.11 ± 0.0041 -0.12 to -0.102 Yes 761.8 1, 7 < 0.0001
Fall ATCV-1 Filtered Water -0.0029 ± 0.00022 -0.0034 to -0.0025 Yes 178 1, 13 < 0.0001
Whole water -0.0041 ± 0.00028 -0.0047 to -0.0034 Yes 206.9 1, 13 < 0.0001
CVM-1 Filtered Water -0.0076 ± 0.00024 -0.0081 to -0.00702 Yes 956.3 1, 13 < 0.0001
Whole water -0.0088 ± 0.00047 -0.0098 to -0.0078 Yes 348.3 1, 13 < 0.0001
CpV-BQ1 Filtered Water -0.016 ± 0.0029 -0.023 to -0.0101 Yes 31.8 1, 13 < 0.0001
Whole water -0.016 ± 0.0035 -0.024 to -0.0083 Yes 20.6 1, 13 0.00061
Winter ATCV-1 Filtered Water -0.00014 ± 4.8e-005 -0.00025 to -3.7e-005 Yes 8.5 1, 13 0.012
Whole water -0.00012 ± 6.8e-005 -0.00027 to 2.7e-005 No 3.1 1, 13 0.10
CVM-1 Filtered Water -0.00047 ± 6.1e-005 -0.00059 to -0.00034 Yes 61.04 1, 13 < 0.0001
Whole water -0.00086 ± 6.5e-005 -0.001001 to -0.00072 Yes 178.4 1, 13 < 0.0001
CpV-BQ1 Filtered Water -0.00077 ± 0.00013 -0.0011 to -0.00048 Yes 34.1 1, 13 < 0.0001
Whole water -0.0018 ± 0.00017 -0.0021 to -0.0014 Yes 103.8 1, 13 < 0.0001
35
between seasons, between filtered or whole water treatments, and between the different viruses
themselves, and significant differences were observed among all three sets of comparisons.
As noted above, for each of the three algal viruses studied slopes were most negative in the summer
and least negative in the winter; i.e., decay rates were highest in the summer and lowest in the winter
(Table 2.2). In general, regression slopes in different seasons were significantly different from each
other (p-value < 0.00167, Appendix 1.1) but there were some exceptions. For both ATCV-1 and
CVM-1, certain comparisons of spring and summer, spring and autumn, and summer and autumn
slopes were not significantly different. On the other hand, for CpV-BQ1 all seasonal comparisons
produced significant differences. Overall, seasonal comparisons were statistically significant for
73% of all slopes compared (Figure 2.2).
During all seasons and for every virus, regression slopes were more negative in the whole water
treatments compared to filtered water. The regression slopes of the two treatments were significantly
different (p-value < 0.0045, Appendix 1.2) except for viruses in the autumn incubation experiment,
as well as ACTV-1 in the winter, and CpV-BQ1 in the summer. For both treatments in every
seasonal incubation experiment, ATCV-1 decayed most slowly (least negative regression slopes),
while CpV-BQ1 decayed most rapidly (most negative slope). Treatment effects were significant in
55% of the statistical comparisons (Figure 2.2). The differences of the decay rates between the three
algal viruses were generally statistically significant, with p-values < 0.0025 (Appendix 1.3). Notable
exceptions include comparisons of the regression slopes of CVM-1 and ATCV-1 in the summer and
spring whole water treatments, and the spring filtered treatment, and CVM-1 and CpV-BQ1
comparisons during the autumn and in the winter filtered water treatment. Overall, virus-to-virus
comparisons were statistically significant for 70% of the time (Figure 2.2).
After 126 days in a frozen freshwater pond, infectious viruses were detected for all three of the algal
viruses and in both treatments. ATCV-1 retained 47.82 % of its original infectivity in the filtered
water treatment and 45.58 % in the whole water treatment (Figure 2.3A), while CVM-1 retained
18.82 % in filtered water and 5 % in whole water (Figure 2.3B), and CpV-BQ1 retained 9.22 % in
filtered water and 0.79 % in whole water (Figure 2.3C). Statistical comparisons demonstrated that
36
Figure 2.2. Percentage of statistically significant differences in the comparisons between seasons,
filtration treatment, or viruses. Values were derived from the season to season, whole water to
filtered water, and virus to virus comparisons using the statistical tests from Supplemental Tables 1,
2, and 3, respectively. The numbers above each bar show the number of significantly different
comparisons and the total number of comparisons.
22/30
6/11
14/20
0
25
50
75
100
Season to Season Filtered to Whole water Virus to Virus
Pe
rce
nt
Sig
nific
an
t D
iffe
recnces
Statisical Comparisons
37
38
Figure 2.3. Over-wintering of algal viruses in a seasonally frozen freshwater pond. Mean percent
infectivity remaining in triplicate bottles incubated through the winter months was plotted against
time in days for the viruses ACTV-1 (A), CVM-1 (B), and CpV-BQ1 (C). Filled circles are data
points from the filtered-water treatment while open triangles are data points from the whole water
treatment. Error bars represent standard deviation. The inset figure in panel C shows a close-up view
of the percent infectivity remaining for CpV-BQ1 at the final time point.
39
there was no difference in decay rates for the filtered versus whole water treatments for ATCV-1 in
the winter, but rates for these treatments were significantly different in the winter for CVM-1 and
CpV-BQ1 (Appendix 1.2).
40
2.4 Discussion
Decay of Aquatic Viruses
Viruses can be destroyed, inactivated, or removed from aquatic environments by exposure to
sunlight (both UV and PAR), extreme temperatures, heat-labile organic matter such as nucleases,
consumption by heterotrophic nanoflagellates, attachment to non-host cells, and adsorption to
detritus and subsequent sinking (reviewed in: Wommack and Colwell, 2000). The role of other
microbes in virus destruction has also been demonstrated in several studies showing increased
survival of viruses when other microbes were inactivated through antibiotics, autoclaving, or
filtration, and many microorganisms are known to produce enzymes with antiviral properties
(reviewed in: Gerba, 2005). These observations, together with the knowledge of threshold
abundances for virus production and succession in phytoplankton assemblages, have led to questions
about the survival and environmental persistence of aquatic viruses. In general, the results of our
study corroborate past work on aquatic virus decay since rates were variable among different
viruses, and the highest decay rates were observed during summer incubations, which received the
greatest irradiation, and whole water incubations, which included microbes < 210 μm in size. Most
significantly, the results of our study also demonstrate the ability of freshwater algal viruses to
overwinter and remain viable after freezing, supporting the hypothesis that some viruses, even in the
absence of ongoing production, can form a persistent seed-bank in aquatic environments.
Using cultivation-based techniques to estimate numbers of infectious viruses, environmental decay
rates of the algal viruses ATCV-1, CpV-BQ1, and CVM-1 were estimated from in-situ incubations.
The ranges of decay rates estimated in this study for ATCV-1 (0.012 - 1.10 % h-1), CVM-1 (0.047 -
1.12 % h-1), and CpV-BQ1 (0.077 - 11.26 % h-1) were relatively low compared to decay rates
determined using a similar experimental approach, but for bacteriophages incubated in direct
sunlight using water from Santa Monica Bay, USA (4.1 - 11 % h-1; Noble and Fuhrman, 1997).
Given the inclusion of seasonal estimates of decay for the study reported here, and structural
differences between different types of viruses, and the fact that the Santa Monica study included UV
exposure, it is not surprising that decay rates estimated for bacteriophages and algal viruses are not
directly comparable. However, even when compared to other algal viruses, ATCV-1 and CVM-1
41
decay rates were relatively low compared to rates reported in other studies (Cottrell and Suttle, 1995;
Hewson et al., 2012; Frada et al., 2014). On the other hand, the decay rates estimated for CpV-BQ1
were the highest of the three algal viruses used in this study and, at least for the summer
experiments, were within the range of previously reported values for algal viruses. That the rates
estimated in this study were generally low compared to previous studies of algal viruses is likely due
to the different experimental approaches that were used, and more importantly because previous
studies estimated decay in only a single season. It is important to note that the decay rates estimated
in this study likely represent underestimates, especially for the summer incubations, due to the use of
polycarbonate bottles which are essentially UV opaque. UV radiation, and UV-B in particular, is an
important factor for bacteriophage decay, and decay rates estimated in the absence of UV-B can be
much lower (e.g., 20 %) than the values estimated from incubations in full sunlight (Suttle and Chen,
1992). However, in some cases, PAR, or photosynthetically active radiation, can be responsible for
more viral decay than UV radiation (e.g., Wommack et al., 1996; Baudoux et al., 2012). Since the
PC bottles used in this study are PAR transparent it is certain that the algal viruses in this study were
subjected to some photochemical, or sunlight-mediated decay, but relative contributions of UV and
PAR to algal virus decay cannot be resolved. Additionally, as is the case with any microcosm study
conducted using closed incubation bottles, attachment to detritus and sinking is not a mechanism of
decay that can be estimated in this study. Therefore, true environmental decay rates are likely higher
than the estimates presented in this, or indeed any, study of viral decay.
The decay rate of 0.13 % h-1 for the ATCV-1-like environmental virus reported in Hewson et al.,
(2012) was, as the authors acknowledged, not an estimate of decay of infectivity but rather an
estimate of decay of genomic DNA based on qPCR. Infectivity decays more rapidly than virus
particles or genomes because virion damage can compromise attachment to host cells, or other
critical steps such as cell entry and unpackaging despite the fact that the virus particle and even
genome can remain intact (Suttle and Chen, 1992; Wommack et al., 1996; Noble and Fuhrman,
1997). MpV-SP1 infectivity was estimated to decay at a rate of 28 - 30 % h-1 during incubations
carried out in March and April in unattenuated sunlight using water from the Gulf of Mexico
(Cottrell and Suttle, 1995). Overall, decay rates determined during our study were often low
compared to the few literature values available for algal viruses, but the rates we observed during the
42
spring, summer, and autumn were similar to estimates determined for Emiliania huxleyi viruses in
the North Atlantic (i.e., 2 - 3 % h-1; Frada et al., 2014). Furthermore, as expected, the lowest rates
estimated during this study came from the winter incubation, and for ATCV-1 were 10 times lower
than the lowest estimate previously reported for any algal virus. However, if the algal viruses in this
study followed the pattern observed for marine bacteriophage where the decay rate in the absence of
UV-B is only 20% of the decay rate in the presence of UV-B (Suttle and Chen, 1992), the decay
estimates obtained in this study can be normalized to account for UV-B –mediated decay by
multiplying the rates by a factor of 5. This yields decay estimates ranging from 0.06 – 5.5 % h-1 for
ACTV-1, 0.235 – 5.6 % h-1 for CVM-1, and 0.385 – 56.3 % h-1 for CpV-BQ1. As noted above, this
normalization may be conservative for the summer incubations and exaggerated for the winter
incubations, but the highest corrected decay rate observed in this study actually exceeds the decay
estimate obtained from the Gulf of Mexico for the algal virus MpV-SP1 (Cottrell and Suttle, 1995).
Seasonality and Variability in Rates of Decay
Although other more general studies of aquatic virus decay have noted the lowest rates in the winter
(Thomas et al., 2011), the winter incubation experiment with the freshwater algal viruses ATCV-1,
CVM-1, and CpV-BQ1 produced the lowest estimated decay rates observed for any algal viruses in
nature. It is likely that these unprecedented low rates of decay were due to the fact that the
freshwater pond was frozen over during the winter incubation, which would dramatically reduce
exposure to sunlight, especially when ice is covered by snow (Perovich et al., 1993; Bertilsson et al.,
2013). As expected, for all three algal viruses decay rates were highest in the summer and
intermediate for the spring and autumn. Similarly, decay rates of cyanophage in the Gulf of Mexico,
Texas (Garza and Suttle, 1998) and Lake Donghu, China (Cheng et al., 2007) were also shown to be
highest during the summer. Seasonality in virus decay is likely due to seasonal fluctuations in
temperature and sunlight (both UV and PAR), which have both been implicated in virus inactivation
(Lo et al., 1976; Suttle and Chen, 1992; Garza and Suttle, 1998; Baudoux et al., 2012). Sunlight
exposure can cause photochemical damage of viruses directly, while increased temperatures may act
indirectly through anti-viral increased microbial and enzymatic activity (e.g., Yates et al., 1985;
Gersberg et al., 1987; Garza and Suttle, 1998).
43
Exposure to UV radiation and PAR can deactivate viruses (Cottrell and Suttle, 1995; Furuta et al.,
1997; Jacquet and Bratbak, 2003; Baudoux et al., 2012), yet some algal viruses encode genetic
machinery to repair light-induced DNA damage. Many, but not all, genomes of chloroviruses,
including ATCV-1 and CVM-1, contain homologs of a UV repair gene, denV, which encodes a UV-
specific DNA glycosylase-pyrimidine lyase (Fitzgerald et al., 2007; Jeanniard et al., 2013) known to
be functional in the strain PBCV-1 (Furuta et al., 1997). Moreover, other nucleic acid metabolism
genes encoded by algal viruses that could aid in environmental persistence include DNA ligase,
DNA polymerase δ, proliferating cell nuclear antigen, as well genes involved in base incision repair
and nucleotide incision repair (Dunigan et al., 2006; Redrejo-Rodríguez and Salas, 2014). The
absence of denV homologues in some chlorovirus strains such as KS1B, and other DNA repair genes
in other algal virus genomes demonstrates that these capabilities are not universally present among
algal viruses (Jeanniard et al., 2013). Furthermore, the genome of EhV-86, a coccolithovirus,
contains a pyrimidine dimer-specific glycosylase, while the genome of EsV-1, a phaeovirus, does
not (Dunigan et al., 2006). While photo-induced pyrimidine dimers were likely not a major source of
DNA damage in this study, the variability of denV is illustrative of the variability in the genetic
potential of specific algal virus strains to repair DNA damage.
Even though UV-B and much of UV-A were attenuated in this study, the fact that ATCV-1 and
CVM-1 encode pyrimidine dimer-specific glycosylases as well as other DNA repair genes and had
10 fold lower decay rates than CpV-BQ1 in summer months suggest that CpV-BQ1 might not
encode similar DNA repair machinery. Genome sequence information from CpV-BQ1 could resolve
this hypothesis and generate other interesting questions about the genetic basis for the environmental
stability of aquatic viruses. Furthermore, the results presented here reveal both intra- and inter-genus
variability as the chloroviruses ATCV-1 and CVM-1, and the newly isolated, putative
prymnesiovirus CpV-BQ1 all decayed at different rates. Differential rates of decay could drive
differences in virus-host dynamics among different algal viruses supporting the notion that
individual virus-host pairs are ecologically unique (Rozon and Short, 2013). It is worth noting that
decay rates of CVM-1 were estimated via MPNs versus PAs to compare these different approaches
but were not significantly different when compared with ANCOVA (F = 0.392, DFn, DFd = 1, 11,
44
p-value = 0.54), suggesting that differences in decay rates between the chloroviruses and
prymnesiovirus were not due to experimental methods alone.
Differences in decay rates between the filtered and whole water treatments implicate the anti-viral
effect of microbes as the filtered water treatment produced decay rates that were often lower than did
the whole water treatment. An active microbial community is known to accelerate rates of viral
decay through adsorption to non-host cells, consumption of viruses by nanoflagellates, or the activity
of extracellular nucleases and other enzymes (Gerba, 2005). This effect was most significant in the
spring and summer incubations for ATCV-1 and CVM-1 when temperatures, and presumably
microbial activity, were highest. On the other hand, at least one study has demonstrated that
particulate material that was presumably removed during our filtration could actually reduce algal
virus decay rates. The viruses ATCV-1 and CVM-1 can dynamically attach and detach to host cells
and host cell debris, and remain infectious, and this process has been implicated in increased virus
survival (Agarkova et al., 2014). As such, depending on the particular samples there may have been
particulate material filtered out of the whole water that could have enhanced virus decay, or
enhanced virus survival. These contrasting effects of different particulate materials on virus decay
may explain why only a little more than half of the filtered water treatments yielded decay rates that
were significantly different than rates from the corresponding whole water treatment. The highest
estimated decay rates observed in this study coincided with the maxima for water temperature,
sunlight, and daylight hours, providing further evidence that temperature and sunlight are major
factors in the inactivation of virus particles in aquatic environments and drove the seasonality
observed in the decay of ATCV-1, CVM-1, and CpV-BQ1.
Algal Virus Overwintering
This study presents the first experimental evidence that algal viruses can persist in ice-covered,
freshwater environments. For the winter incubation, samples bottles were initially placed underneath
the existing thin ice cover and remained in the water column, unfrozen, for the first 7 days of the
experiment. After 7 days, the ice was too thick to break and the bottles were left in situ for the rest of
the season. During this time, the exact date that the samples froze is unknown, but before the ice
became covered in snow the bottles were clearly stuck in the thick ice cover and the liquid in the
45
bottles was visibly frozen. Following their winter-long incubation, samples were recovered after the
ice on the pond had thawed and every incubation bottle contained infectious viruses. Furthermore, in
a lab study conducted to simulate freezing in the environment, ATCV-1, CVM-1, and CpV-BQ1
retained approximately 92, 85, and 89 % of their infectivity after they were chilled in ice water for 3
h, stored at -20 °C for 15 h, and were subsequent thawed in ice water. Thus it is apparent that some
algal viruses can survive overwinter in the ice of seasonally frozen ponds and lakes. The survival of
ATCV-1 and CVM-1 after freezing is perhaps surprising as PBCV-1, a close relative, can be
inactivated by freezing (Van Etten et al., 1991). Although we have provided the first direct evidence
that some algal viruses can survive in frozen environments, other viruses have been previously
shown to tolerate similar conditions. For example, human enteric viruses persisted for several
months when incubated in situ in dialysis bags filled with autoclaved marine water, and were most
stable during winter months (Lo et al., 1976). Also, viruses have been shown to exist in high
abundances in frozen Antarctic lakes (Foreman et al., 2011), viral genomes have been detected in
~700 year old frozen caribou feces (Ng et al., 2014), and even more incredible, a putatively 30,000
year old giant virus of amoebas has been recovered from Siberian permafrost (Legendre et al.,
2014). Hence, it is plausible, even likely, that reduced decay rates experienced during winter months
may constitute a major mechanism for algal virus survival and the establishment of viral seed-banks
in many aquatic environments.
Conclusions
Over the year, algal virus decay rates were highly variable, but the winter decay rates observed here
are among the lowest reported for aquatic viruses. The winter half-life of the least resilient virus
examined, CpV-BQ1, was 38 days, long enough for a substantial fraction of the virus population to
survive as a seed-bank for the subsequent ice-free growing season. The observation that decay rates
were greatly reduced in the winter and viruses maintained infectivity after freezing provides direct
evidence that algal viruses can persist in the environment for many months. However, during the
summer when decay rates peaked the half-life of even the most resilient virus, ATCV-1, was only 2
days suggesting that even this population would be rapidly destroyed; hypothetically, starting with
105 viruses mL-1 only 6 viruses mL-1 would remain after 30 days. This suggests that the summer
46
represents a seasonal bottleneck for virus survival, and ongoing virus production or some other
means of escaping destruction such as mixing into deeper waters is necessary to maintain virus
populations through these months; the decay experiments described here were conducted at the
surface of the pond where sunlight was maximal, and it is known that algal virus decay rates
attenuate rapidly with depth (Cottrell and Suttle, 1995). Although virus survival when experiencing
high decay rates necessitates constant production, environmental refugia, or non-lytic infections,
viruses that withstand the summer in temperate aquatic environments should be able to overwinter
until the subsequent growing season of their hosts. Therefore, the results of this study clearly
demonstrate the importance of seasonality in the environmental persistence of algal viruses.
In future studies, qPCR methods that were established to monitor the abundance of diverse,
uncultivated phycodnaviruses (Short and Short, 2009; Short et al., 2011a) could be combined with
cultivation approaches to determine relationships between decay of infectivity and decay of viral
nucleic acids. In turn, these relationships could be used to infer decay rates for viruses that have not
yet been cultivated, which constitutes the vast majority of environmental viruses. Knowing true,
functional rates of decay for a range of algal viruses is essential to establish boundaries related to
their resilience and environmental persistence. Constraining estimates of virus environmental
persistence is a vital step towards realistic models of virus-host dynamics in aquatic environments.
Acknowledgements
Special thanks to Dr. James Van Etten and colleagues at University of Nebraska, Lincoln for
providing cell cultures of M. conductrix and C. heliozoae as well as isolates of ATCV-1 and CVM-1.
We are also grateful to Cindy Short and Samia Mirza for their support in maintaining cell culture
lines. This research was supported in part by the Canadian Foundation for Innovation Leaders
Opportunity Fund and NSERC Discovery grants awarded to S.M.S.
47
Chapter 3 Quantitative PCR reveals environmental phytoplankton virus
decay rates vary seasonally
Abstract
Algal viruses and cyanophages are implicated in the top-down control of eukaryotic algae and
cyanobacteria. Despite this clear importance, many questions about how viral populations are
maintained when host cells drop below abundances necessary for viral infection. In order to
answer questions on the persistence of naturally occurring algal viruses and cyanophages,
seasonal decay incubations were conducted and molecular assays were developed to monitor the
decay of uncultivated viruses, which constitute the majority of viruses. Assays for estimating
viral decay rates were validated by comparing loss of infectivity and loss of amplifiable DNA in
field incubation experiments with the cultivated algal viruses ATCV-1, CVM-1, and CpV-BQ1.
The range of decay rates for cultivated viruses based on molecular assays of seasonal incubations
was 0.0056 to 1.23 % h-1, while decay rates for uncultivated algal viruses and cyanophages
ranged from 0.007 to 1.30 % h-1 and 0.27 to 14.81 % h-1, respectively. For every virus, the lowest
decay rates were observed in the winter, while the highest decay rates were typically recorded in
the spring and summer. The winter decay incubation experiment, which lasted 126 days,
demonstrated that all viruses remained detectable throughout the season, with 20 - 62 % of the
amplifiable DNA remaining for cultivated algal viruses, 19 % for an uncultivated algal virus, and
0.008 % for an uncultivated cyanophage in the whole water treatment. These results demonstrate
that environmental algal viruses can successfully over-winter in temperate, seasonally frozen
aquatic environments. However, the low percentage of amplifiable DNA remaining for
cyanophages in winter suggests that other mechanisms may be necessary for the maintenance of
the viral ‘seed-bank’ for these virus types.
48
3.1 Introduction
Algal viruses and cyanophages infect aquatic primary producers, exert top-down controls on the
population dynamics of algae and cyanobacteria, and by extension, alter biogeochemical cycles
(Wommack and Colwell, 2000; Brussaard, 2004; Suttle, 2007; Wilhelm and Matteson, 2008).
Algal viruses and cyanophages have both been implicated in algal bloom termination and more
generally, are involved in algal population turnover via viral lysis (e.g., Bratbak et al., 1993;
Wilson et al., 2002a; Brussaard et al., 2005; Deng and Hayes, 2008). Furthermore, the mortality
of algae and cyanobacteria by algal viruses and cyanophages can alter the flow of nutrients to
higher trophic levels by ‘shunting’ organic material to the particulate and dissolved fractions
where they can be utilized by both bacteria and other algae (Wilhelm and Suttle, 1999; Suttle,
2007; Shelford et al., 2012). Being a direct source of mortality intuitively implies that viruses
can decrease primary productivity in aquatic systems, yet there is mounting evidence that in
some cases viral lysis may actually stimulate primary productivity, perhaps by enhancing rates of
nutrient recycling (Weinbauer et al., 2011; Shelford et al., 2012; Staniewski and Short, 2014).
Though it is clear that algal viruses and cyanophages play an important role in the population
dynamics of their hosts, basic questions on the ecology of algal viruses and cyanophages remain.
The majority of ecological studies of algal viruses and cyanophages have been in marine
environments and only relatively recently have viruses in freshwater environments been studied
in detail. Studies using molecular markers and metagenomics have found diverse communities of
algal viruses and cyanophages with widespread distributions in various freshwater environments,
and some genotypes that exist in marine environments have also been observed in freshwater
systems (e.g., Dorigo et al., 2004; Short and Suttle, 2005; Wilhelm et al., 2006b; Chénard and
Suttle, 2008; Short and Short, 2008; Short et al., 2011b; Hewson et al., 2012). Additionally,
sequence information obtained through molecular studies of aquatic viruses has been recently
used to develop tools such as quantitative PCR (qPCR) primers and probes to monitor seasonal
changes in the abundance of specific virus genes in freshwater environments (e.g., Short and
Short, 2009; Zhong et al., 2013). Increasingly, viral abundance studies based on molecular tools
have revealed a variety of population patterns, including ‘boom and bust’ ecologies where
populations oscillate between periods of high abundance followed by rapid decline, or
conversely, where populations are maintained at relatively constant levels, but low abundance
(Short et al., 2011a; Rozon and Short, 2013; Zhong et al., 2013).
49
Observations of viral populations persisting at constant, low abundances stemming from qPCR-
based studies, metagenomics, microscopy counts of virus-like particles, or counts of infectious
viruses all support the ‘Bank model’ of viral ecology (Waterbury and Valois, 1993; Breitbart et
al., 2002; Short and Short, 2009; Short et al., 2011a; Quispe et al., 2016). The Bank model, as
proposed by Breitbart and Rohwer (2005), suggests that there exists a community of highly
abundant viruses that actively infect their hosts, as well as a diverse community of viruses with
low abundances that remain viable in a ‘seed-bank’ while their hosts are below abundance levels
that could support ongoing viral reproduction. The population dynamics of many eukaryotic
algae and cyanobacteria in the environment are such that they are either below threshold
abundance levels necessary for viral infection (103 - 104 host cells mL-1; Wiggins and Alexander,
1985; Suttle and Chan, 1994; Cottrell and Suttle, 1995; Jacquet et al., 2002), or remain at
undetectable levels for many months of the year (Munawar and Munawar, 1986; Reynolds,
2006). Observations of constant, low abundances for some viruses even when their hosts may
fall below population thresholds needed for virus replication suggest that viruses have the ability
to survive long periods without replication, supporting the Bank model. However, many of the
reported viral decay rates in both marine and freshwater systems are too high to permit
sustainable viral populations without ongoing production. This paradox drives many of the
research questions in this study.
Contrary to a widespread, general phenomenon of viral seed-banks, estimated rates of decay for
algal viruses are variable and can be quite high, ranging from 0.012 to 30 % lost per hour (% h-1)
in some aquatic environments (Cottrell and Suttle, 1995; Hewson et al., 2012; Frada et al., 2014;
Long and Short, 2016). Furthermore, the decay rates of cyanophages can be even higher, ranging
from 1.50 to 230 % h-1 (Suttle and Chan, 1994; Garza and Suttle, 1998; Cheng et al., 2007; Liu
et al., 2011; Hewson et al., 2012). However it should be noted that for some bacteriophages and
cyanophages photoreactivation may counteract high decay rates through host-mediated virus
repair (Weinbauer et al., 1997; Wilhelm et al., 1998; Cheng et al., 2007). The variability in
decay rates between algal viruses and cyanophages may be due to differences in the structure and
physiology of the two viral groups, or it may be, in part, due the different physical environments
in which the viruses were studied. Differences in genetic content, such as the presence of genes
that code for UV repair mechanisms, and/or differences in the thickness of the virus capsid have
been suggested to change the ability of individual virus strains to withstand the environment
50
outside their hosts (Furuta et al., 1997; De Paepe and Taddei, 2006; Dunigan et al., 2006).
Additionally, seasonal decay rates of algal viruses and cyanophages described in aquatic
environments highlight marked seasonal differences in the environmental conditions experienced
by viruses, especially between winter and all other seasons (Garza and Suttle, 1998; Cheng et al.,
2007; Long and Short, 2016). The especially low decay rates observed in the winter in a
seasonally frozen freshwater pond could provide a potential mechanism through which the viral
‘seed-bank’ might be maintained (Long and Short, 2016). However, the much higher decay rates
observed in the spring and summer months in that same study suggest that unanswered questions
on how a viral ‘seed-bank’ could be maintained year-round yet remain.
In particular, estimating decay rates for individual viruses with hosts that have not been cultured
is not possible using common approaches for estimating viral decay, such as microscopy or
infectivity-based assays. Recently, qPCR has been used to assess the decay rates of uncultured
viruses, including algal viruses and a specific group of cyanophages commonly referred to as
cyanomyoviruses (Hewson et al., 2012). However, the presence of amplifiable DNA does not
confirm the presence of viable, infectious viruses, especially as known algal viruses produce
many non-viable virions upon replication. For example, only 25 - 50 % of the particles produced
by the algal virus Paramecium bursaria Chlorella virus 1 are infectious (Van Etten et al.,
1983b). Additionally, decay of infectivity is likely much faster than decay of amplifiable DNA
due to the relatively fragile nature of infectivity, which requires an intact virion in its native
conformation with a suite of intact genes. In contrast, amplification of a gene fragment requires
only the specific fragment to be intact across the targeted region. As such, any molecular
methods for estimating viral decay for must be compared and validated against infectivity-based
estimates of decay to obtain a biologically-relevant picture of viral decay. Thus, development of
qPCR methods for estimating viral decay remains an important task in viral ecology.
The goals of this study are threefold: 1) to determine if qPCR can successfully be used to track
the decay of uncultured viruses, 2) to estimate the decay of several algal viruses and
cyanophages across all four seasons and from year to year, and 3) to determine the over-
wintering ability of uncultured algal viruses and cyanophages. In order to accomplish these
goals, five in situ incubation experiments, including a 126 day long winter incubation, were
employed with two cultivated chloroviruses, Acanthocystis turfacea Chlorella virus 1 (ATCV-1)
and Chlorella virus Marburg-1 (CVM-1), as well as a cultivated algal virus that infects the
51
prymnesiophyte Chrysochromulina parva (CpV-BQ1). The decay rates of these viruses were
estimated via both infectivity and molecular assays. Molecular markers for algal viruses and
cyanomyoviruses were used to design qPCR primer and probe sets, which were subsequently
utilized to estimate the decay of several naturally-occurring, uncultivated algal virus and
cyanomyoviruses during five incubation experiments, spanning all four seasons.
52
3.2 Materials and Methods
In order to test questions on the persistence of uncultivated algal viruses and cyanophages, the
following experiments were conducted. First, cultivated viruses were used in seasonal decay
experiments in a freshwater pond where both the loss of infectivity and the loss of amplifiable
DNA were measured. Then, molecular probes were developed for several uncultivated algal
viruses and cyanophages and were utilized to estimate the loss rates of their amplifiable DNA.
In situ decay incubation experiments
Complete details for the first four seasonal decay incubation experiments are presented in Long
and Short (2016). Briefly, the decay incubation experiments were conducted in a freshwater
pond on the University of Toronto Mississauga (UTM) campus in Mississauga, Ontario, Canada
and were initiated May 23, 2013, June 21, 2013, October 3, 2013, and December 2, 2013. 500
mL polycarbonate incubation bottles were destructively sampled at five time points, starting at
time zero and ending at 21 days for the spring, summer, and autumn incubation experiments, or
ending at 126 days for the winter incubation. Additionally, two treatments were conducted for
every incubation: unfiltered natural water was used as the medium in one set of bottles (whole
water hereafter), while the other treatment used natural water filtered through 47 mm dia. 0.45
μm pore-size HVLP membrane filters (Merck Millipore, Billerica, MA) in order to remove
microorganisms and other particulates (filtered water hereafter). For both treatments, ATCV-1
and CVM-1 were added to the spring decay incubation experiment while ATCV-1, CVM-1, and
CpV-BQ1 were added to the summer, autumn, and winter decay incubation experiments.
Immediately after sampling, 100 mL of subsamples were filtered with 0.45 μm filters, 50 mL of
which was stored at 4 °C for infectivity assays, and 1 mL was stored at -20 °C for molecular
assays.
A fifth decay incubation was conducted in autumn 2014 using the same procedure. However,
during time zero of the 21 day time series, which commenced on October 16, 2014, an additional
100 mL water sample was taken from the pond for molecular analysis of the naturally occurring
algal virus community. This 100 mL sample was filtered through a 0.45 μm filter and then
concentrated via centrifugation at 118,000 x g for 3.5 h using a SW32-Ti rotor (Beckham
Coulter, Inc., Indianapolis, IN). Concentrated samples were stored at -20 °C. For the other
sampling periods, bottles were destructively sampled at each time point, filtered, and stored at 4
53
°C for infectivity assays, while 36 mL was concentrated via centrifugation and stored at -20 °C
for molecular assays as before. To release encapsidated nucleic acids, all samples for molecular
analysis from every decay incubation experiment were subjected to three freeze-thaw cycles as
per Short and Short (2008). Water and air temperature were measured at each time point with a
digital thermometer (VWR International) and daylight hours were obtained from Environment
Canada for the closest monitoring station (Toronto, Canada).
Algal cell culture conditions and viral infectious titre estimations
Cell cultures of Chlorella heliozoae strain SAG 3.83, Micractinium conductrix strain Pbi and
Chrysochromulina parva were used to generate viral lysates of ATCV-1, CVM-1, and CpV-
BQ1, respectively, which were then filtered through 0.45 μm filters and stored at 4°C as
described in Long and Short (2016). For the first four seasonal decay incubations, infectious
titres were published in Long and Short (2016). The infectious titre of ATCV-1, CVM-1, and
CpV-BQ1 in the samples from the autumn 2014 decay incubation experiment were estimated
using a most probable number assay (MPN) designed for CpV-BQ1, which is fully described in
Long and Short (2016). The protocol was modified for ATCV-1 and CVM-1 by replacing C.
parva and its growth medium (DY-V; Andersen et al., 2005) with the hosts for ATCV-1 (C.
heliozoae) and CVM-1 (M. conductrix) and their respective growth media, modified Bold’s basal
medium (Van Etten et al., 1983a) and FES medium (Reisser et al., 1986). MPNs were calculated
using the methods of Jarvis and colleagues (2010).
PCR conditions and sequence analysis
Previously published primer sets for the major capsid protein gene (MCP; mcp Fwd and mcp
Rev; Larsen et al., 2008) and for the DNA polymerase gene of algal viruses (polB; VpolAS4 and
VpolAAS1; Clerissi et al., 2014a) were used to create clone libraries of PCR-amplified, naturally
occurring algal viruses from the autumn 2014 decay incubation experiment. No samples from the
first four decay incubations were taken without the addition of the three cultivated algal viruses,
which prevented the generation of clone libraries of environmental algal virus genes for those
incubations. For cyanophages, a previously described marker for the cyanophage portal-protein-
encoding gene 20 (g20; CPS1.1 and CPS8.1; Sullivan et al., 2008) was used to create clone
libraries of naturally occurring cyanophages in each of the 5 decay incubation experiments.
54
For algal virus MCP and polB, only one round of PCR was required for amplification, while for
cyanophage g20 genes, two rounds of PCR were required. The PCRs for polB were as follows:
50 μL total volume with 25 μL of GoTaq G2 Green Master Mix (Promega Corporation,
Madison, WI), 200 nM of VpolAS4, 800 nM of VpolAAS1, and 5 μL of the template, while the
PCRs for MCP used the same reaction and GoTaq G2 Green Master Mix volumes, but 400 nM
of each primer was used with 2 μL of template. The PCR cycling conditions for MCP genes used
the methods of Larsen et al., (2008). The PCR cycling conditions for polB used an initial 180 s
denaturation step at 95 °C, followed by 40 cycles of 95 °C for 30 s, 50 °C for 50 s, and 72 °C for
90 s, and terminating with an elongation step of 72 °C for 240 s. For g20 genes, the following
PCR cycling conditions were used: a 95 °C step for 180 s, then 35 cycles for round 1 and 25
cycles for round 2 of 95 °C for 30 s, 45 °C for 60 s, and 72 °C for 60 s, and a final step of 72 °C
for 300 s. The PCR product from the initial g20 PCR was purified using a BioBasic PCR
purification kit following the manufacturer’s protocol (BioBasic, Toronto, Canada). The purified
PCR product (2 μL) was then used as the template for the second round of PCR. First round PCR
of g20 gene fragments used 50 μL total reaction volumes consisting of: 5 μL of 10x PCR Buffer,
1.5 mM of MgCl2, 0.2 mM of each dNTP, 400 nM of each primer, 1 unit of Platinum Taq DNA
Polymerase (Life Technologies Corporation, Carlsbad, CA), and 5 μL of template, while the
second round used the same reagent concentrations with 2 μL of template.
All final PCR products were visualized using gel electrophoresis. Appropriately sized DNA
bands were excised from the gels for each marker gene and purified using a BioBasic Gel
purification kit using the manufacturer’s protocol (BioBasic, Toronto, Canada). Purified PCR
products were cloned using a pGem-T Vector System II kit using the manufacturer’s protocol
(Promega Corporation, Madison, WI). A PCR using T7/SP6 primers was used on white colonies
to confirm the presence of an appropriately sized insert fragment, and appropriate amplification
products were purified with the BioBasic PCR clean-up kit and were sequenced at the Center for
Applied Genomics (TCAG) in Toronto, Canada. Only full-length sequences were used in further
analyses (~500 bp for MCP, ~350 bp for polB, and ~592 bp for g20).
For all three genes, DNA sequences were separated into OTUs at a 97% cut-off level using the
computer program mothur (Schloss et al., 2009). Amino acid sequences were inferred from the
sequences of the OTUs, and representative sequences from each OTU were aligned with selected
sequences from NCBI Genbank using MUSCLE with default parameters in MEGA 6.0 (Tamura
55
et al., 2013). After alignment, maximum likelihood phylogenies were constructed using the
Jones-Taylor-Thornton amino acid substitution model in MEGA. All sequences used for
phylogenetic analysis were submitted to NCBI Genbank (accession numbers: KY082068 -
KY082085 for g20, KY082086 - KY082088 for polB, KY082089 for MCP).
Quantitative PCR primer and probe design and conditions
Using the approach described by Short and Short (2009), TaqMan® primers and probes were
designed for putative polB sequences from the cultivated algal viruses ACTV-1 and CVM-1, a
putative algal virus MCP gene sequence related to viruses that infect prymnesiophytes
(F2MCP1), a putative algal virus polB gene sequence related to viruses that infect prasinophytes
(F2VPOL1), and two putative cyanophage g20 gene sequences, one related to cyanophage P-
TIM40 (IZCPS1) and one related to Synechococcus phage S-SM1 (WZCPS8). Previously
described primers and probes were used for the cultivated algal virus CVM-1 (Short et al.,
2011a), CpV-BQ1 (Mirza et al., 2015) and for a putative algal virus polB gene fragment related
to viruses that infect chlorophytes (LO.20May09.33; Short et al., 2011a). The newly designed
primer and probe sequences are detailed in Table 3.1. All TaqMan ® probes used in this study
were 5’ labeled with FAM (6-carboxyfluorescein) and were 3’ labeled with a Zen Internal
Quencher (Integrated DNA Technologies, Coralville, IA), except for LO.20May09.33.
The conditions for quantitative PCR for every primer and probe set in this study are as follows:
20 μL reactions with 0.5 units of Platinum Taq DNA polymerase (Life Technologies
Corporation, Carlsbad, CA), 1X Platinum Taq PCR Buffer, 5 mM MgCl2, 200 μM each dNTP,
250 nM forward and reverse primers each, 100 nM TaqMan probe, 30 nM ROX reference dye,
and 2 μL of template. For every primer and probe set, the thermal cycling conditions used a
denaturation step at 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1
min, during which, the fluorescence was measured using an Mx3000P QPCR System
(Stratagene, La Jolla, CA). Quantitative PCR standards for each primer and probe set were
generated from clones as previously described in Short and Short (2009), and ranged from 1.0 x
56
Table 3.1. Algal virus and cyanophage targeting quantitative PCR primers and probes designed for this study
Target Closest cultivated blastp match to target* Probe (5' - 3') Primers (5' - 3')
ATCV-1 Acanthocystis turfacea chlorella virus 1(100%) CGA GCC ACT TCG CAA CTT CAA Fwd: GTC TGT AGT GTA TGG TG
Rev: GAG CTT TGT ACT CCT TTG TG
F2VPOL1 Bathycoccus virus BpV178 (78%) CGC ACA ATC TCT GTT ATT CAA CCC T Fwd: GTC TGT ACC CAT CGA TCA
Rev: CGC TTT GAG TTC TCT GAG
F2MCP1 Chrysochromulina parva virus CpV-BQ1 (89%) TCT TGC TCT TCC TCT CAT TGC TCT T Fwd: TCT CAA TTT CTG GTT CTG
Rev: GCC GTA AAT CAA TGT TAA TAC
IZCPS1 Cyanophage P-TIM40 (64%) TTC TGG ATG CCT CGC CGT GA Fwd: CGC CAT CTA TCA ATG ATG
Rev: CGG CTA ATT GGT ACA TTC
WZCPS8 Synechococcus phage S-SM1 (72%) AGT TCT CAC CAC CTG GCA ATG Fwd: GTG ACA TTA TGG CAC GTT A
Rev: GGA AGT AGA GAA TGT CTT CAA
*Parenthetical percentage denotes the percent identity to the top blastp search match using inferred amino acid sequences
57
100 to 1.0 x 107 molecules per reaction. Every standard curve had an efficiency between 91.1 and
104.5 % with R-squared values above 0.99. All standards were run in duplicate and all samples
and negative controls were run in triplicate.
Decay calculations and statistical analyses
Decay rates were estimated as described in Noble and Fuhrman (1997) and Long and Short
(2016). Briefly, linear regressions were calculated for the natural log of infectious titers, or of
gene abundances, against incubation time points. Regression slopes were used as decay constants
(units are h-1), and the percent infectivity or genotype abundance lost per hour was calculated by
multiplying the decay constant by 100. Time points that did not have detectable viruses or had
detectable but unquantifiable viruses (i.e. one or two, but not all, triplicate qPCRs amplified in a
sample) were excluded from decay calculations as well as the subsequent statistical analyses,
resulting in several decay rates being estimated with less than the total five time points.
Additionally, the final time points during the summer incubation for both treatments were
excluded due to the presence of PCR inhibitors that reduced the observed gene copies of known
standards by 40 %, indicating that reliable gene quantification was not possible in these samples.
A second-order polynomial regression was used to assess the relationship between the loss of
infectivity and the loss of amplifiable DNA and calculated in Excel (Microsoft, Redmond, WA).
The quantity obtained via infectivity estimated either in Long and Short, (2016), or in this study
for the autumn 2014 incubations, was plotted against the quantity obtained via qPCR in the same
time point for all cultivated viruses, treatments, and seasons. Spearman correlation analysis was
conducted on these same values. Linear regression analyses and analysis of covariance
(ANCOVA) statistical tests were conducted for decay constants as described in Long and Short
(2016). The Spearman correlation, linear regressions, and ANCOVAs were calculated in
GraphPad Prism 7 (GraphPad Software, La Jolla, CA, USA) using natural log transformed data,
which is consistent with decay rate calculations. To determine if decay rates of the three
cultivated viruses were significantly different when estimated via infectivity assays versus
molecular assays, ANCOVA was used to compare the slopes of linear regressions of the
cultivated viruses incubated during the same season and in the same treatments but with these
different enumeration techniques. Additionally, ANCOVA was used to compare treatments,
seasonal, and virus-to-virus differences as previously described (Long and Short, 2016).
58
Bonferroni corrections were applied to account for the multiple pairwise comparisons. Thus,
significance levels were adjusted for comparisons of enumeration technique (α = 0.0018),
treatment (α = 0.002), seasons (α = 0.0025 for ATCV-1, α = 0.0025 for CVM-1, α = 0.0042 for
CpV-BQ1, α = 0.0083 for F2VPOL1, α = 0.013 for WZCPS8), and viruses (α = 0.0031 for
spring 2013, α = 0.00031 for summer 2013, α = 0.0083 for autumn 2013, α = 0.0025 for winter
2013-2014, and α = 0.0025 for autumn 2014).
59
3.3 Results
Environmental data
The environmental data from the four 2013 seasonal decay incubation experiments was
published and fully discussed in Long and Short (2016). For autumn 2014, the average water
temperature was 13.8 °C, while the average daylight hours per day were 10.5 h. The autumn
2014 decay incubation experiment started later in the year than in autumn 2013 and had lower
overall temperatures and shorter day lengths (Table 3.2). Overall, the highest temperatures and
longest day lengths were in the summer and spring incubations while the lowest temperatures
and shortest day lengths were in the winter incubation (Long and Short, 2016). Ice cover existed
over the winter incubation for the entirety of the experiment (Long and Short, 2016).
Algal virus and cyanomyovirus sequence analysis
Environmental sequences of algal virus polB and MCP genes were obtained from the autumn
2014 samples. Samples from the previous four incubations were not taken before the addition of
cultivated algal viruses, which prevented sequences from environmental algal viruses to be
obtained. For polB, three OTUs were obtained from 70 total sequences using a 97 % nucleotide
identity cut-off, two of which were 95 % identical to each other with respect to nucleotides
(F2VPOL1 & F2VPOL2), while the third OTU shared only 79 % identity with the other OTUs
(F2VPOL43). All three OTUs were most closely related to uncultivated algal viruses (Figure
3.1), and had the prasinovirus BpV178 as their closest cultivated relative according to blastp (78
%, 77 %, and 77 % amino acid sequence identity). A primer and probe set (F2VPOL1) was
designed to amplify two of these OTUs, which accounted for all but one of the sequences
obtained. For MCP, one OTU was obtained from 61 total sequences using a 97 % cut-off. The
MCP OTU was most closely related to the cultured prymnesiovirus CpV-BQ1 (Figure 3.2; 87 %
amino acid sequence identity). A qPCR primer and probe set (F2MCP1) was designed for this
OTU.
Environmental sequences of cyanomyovirus g20 genes were obtained from all five decay
incubation experiments. Overall, 18 OTUs were obtained from 78 sequences across the five
sampling periods. Autumn 2014 contained the most OTUs while autumn 2013 contained the
least. The OTUs used for qPCR primer and probe design, IZCPS1 and WZCPS8, were both most
60
Table 3.2. Environmental Parameters for Autumn 2014 Experiment
Season Time point (hours) Water Temperature (°C) Daylight Hours
Autumn 0 17.9 0
2014 24 16.3 11.07
96 12.3 43.73
168 13.4 75.65
504 9.1 220.5
61
Figure 3.1. Maximum likelihood phylogenetic tree of inferred amino acid sequences of algal
virus polB fragments using the Jones-Taylor-Thornton amino acid substitution model with 1000
bootstrap iterations. Bolded sequence names indicate OTUs obtained in this study, and asterisks
indicate sequences targeted by qPCR primers and probes designed for this study. Sequences from
cultivated viruses or from other environmental studies are shown with their Genbank accession
number in parentheses. The names of the sequences obtained in this study indicate autumn 2014
(F2), the primers used (Vpol for VpolAAS4/VpolAS1) and the clone number of the
representative OTU sequence.
62
Figure 3.2. Maximum likelihood phylogenetic tree of inferred amino acid sequences of algal
virus MCP fragments using a Jones-Taylor-Thornton amino acid substitution model with 1000
bootstrap iterations. Bolded sequences indicate OTUs obtained in this study, and asterisks
indicate sequences targeted by qPCR primers and probes designed for this study. Sequences from
cultivated viruses or from other environmental studies are shown with their Genbank accession
number in parentheses. The names of the sequences from this study indicates autumn 2014 (F2),
the primers used (MCP for mcp Fwd/mcp Rev) and the clone number of the representative OTU
sequence.
63
closely related to putative cyanophage sequences obtained from environmental samples (Figure
3.3). Additionally, IZCPS1 had Cyanophage P-TIM40 (64 % amino acid sequence identity) and
WZCPS8 had Synechococcus phage S-SM1 (72 % amino acid sequence identity) as their closest
cultivated relatives according to blastp. Sequences belonging to the IZCPS1 and WZCPS8 OTUs
were obtained from samples in multiple seasons: spring and summer for IZCPS1 and spring and
winter for WZCPS8. The occurrence in multiple seasons provided the impetus for designing
probes for these two targets.
Algal virus and cyanophage decay
The decay of infectivity for ATCV-1, CVM-1, and CpV-BQ1 in the spring, summer, autumn,
and winter 2013 was previously reported in Long and Short (2016). In autumn 2014, ATCV-1
had infectivity decay rates of 0.59 ± 0.12 % h-1 for the filtered water treatment and 0.85 ± 0.24 %
h-1 for the whole water treatment, while CVM-1 had infectivity decay rates of 0.81 ± 0.15 % h-1
and 1.42 ± 0.47 % h-1, and CpV-BQ1 had infectivity decay rates of 0.75 ± 0.04 % h-1 and 1.01 ±
0.05 % h-1 for these same treatments, respectively.
For each incubation experiment, qPCR was used to estimate decay rates for the three cultivated
viruses as well as naturally occurring, uncultivated algal viruses and cyanophages (Figure 3.4).
When estimated via qPCR assays, ATCV-1 had decay rates that ranged from 0.0056 to 0.75 % h-
1, CVM-1 had decay rates that ranged from 0.034 to 0.84 % h-1, and CpV-BQ1 had decay rates
that ranged from 0.047 to 1.25 % h-1. Overall, the highest decay rates were during the spring and
summer, while the lowest decay rates were in the winter. ATCV-1 exhibited the lowest decay
rates, while CpV-BQ1 had the highest decay rates. Generally, filtered water treatments had lower
estimated rates of decay than whole water treatments.
Estimates for the decay rates of uncultivated algal viruses and cyanophages were not obtained for
each season simply because some viral genes were not detected or quantifiable (i.e. amplified in
one or two but not all triplicate qPCRs) in all seasons (Figure 3.4). F2VPOL1, a sequence related
to prasinoviruses, was detected in summer 2013, winter 2013-2014, and autumn 2014. F2MCP1,
related to viruses that infect prymnesiophyte algae, was detected in autumn 2013 and 2014, but
was only quantifiable in autumn 2014. IZCPS1, related to cyanomyoviruses, was detected in
spring 2013 and summer 2013, but decayed so rapidly that it was no longer detectable after 24
hours rendering a decay rate estimate unreliable, except in the spring filtered
64
65
Figure 3.3. Maximum likelihood phylogenetic tree of inferred amino acid sequences of
cyanomyovirus g20 genes using a Jones-Taylor-Thornton amino acid substitution model with
1000 bootstrap iterations. Bolded sequence names indicate OTUs obtained in this study, and
asterisks indicate sequences targeted by qPCR primers and probes designed for this study.
Sequences from cultivated viruses or from other environmental studies are shown with their
Genbank accession number in parentheses. The names of the sequences from this study indicates
spring 2013 (IZ), summer 2013 (SZ), autumn 2013 (FZ), winter 2013-14 (WZ), and autumn
2014 (F2), the primers used (CPS for CPS1.1/8.1) and the clone number of the representative
OTU sequence.
66
0
0.5
1
1.5
2
FW WW FW WW FW WW FW WW FW WW
Spring Summer Autumn 2013 Winter Autumn 2014
ATCV-1
CVM-1
CpV-BQ1
0
0.5
1
1.5
2
FW WW FW WW FW WW FW WW FW WW
Spring Summer Autumn 2013 Winter Autumn 2014
LO.20May09.33
F2VPOL1
F2MCP1
0
5
10
15
20
FW WW FW WW FW WW FW WW FW WW
Spring Summer Autumn 2013 Winter Autumn 2014
IZCPS1
WZCPS8
B
A
C
% G
en
e c
opie
s lost p
er
ho
ur
% G
en
e c
op
ies lost p
er
hour
% G
ene c
op
ies lo
st p
er
hou
r
t.f.
t.e.
t.f.
t.e.
t.f.
t.e
.
t.f.
t.e.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.n
.d.
n.d
.n
.d.
n.d
.
n.d
.
n.d
.
n.a
.
n.d
.n.d
.n.d
.
n.d
.n.d
.n
.d.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.d
.
n.a
.
67
Figure 3.4. Seasonal decay rates of (A) cultivated algal viruses, (B) environmental algal viruses,
and (C) environmental cyanophages estimated using qPCR. Each data point is the average of
triplicate incubations of decay and the error bars represent standard deviation. Note that
cyanophages have different scaling on the Y-axis. FW indicates the filtered water treatment and
WW indicates the whole water treatment. The abbreviation n.a. indicates the virus was not added
to the incubation during that season, n.d. indicates the decay rate was not determined because it
was not detected during that season, and t.f.t.e. indicates the virus decayed too fast to be
estimated for that treatment (see text for further details).
68
water treatment. WZCPS8, also related to cyanomyoviruses, was detected in spring and summer
of 2013, and winter 2013-2014. As with IZCPS1, WZCPS8 decayed too rapidly in the summer
whole water treatment for reliable decay rate estimation. Finally, LO.20May09.33, a previously
described sequence related to chloroviruses, was detected only in spring 2013.
Like the cultivated algal viruses, decay rate estimates for the uncultivated virus genes were
highest in the summer incubations and lowest in the winter, and were higher in the whole water
treatments compared to the filtered water treatments. Algal virus genes had lower decay rates
than cyanomyovirus genes in the seasonal incubations in which they were both detected. Decay
rate estimates for the prasinovirus-like gene, F2VPOL1, ranged from 0.007 to 1.30 % h-1; the
prymnesiovirus-like gene, F2MCP1, ranged from 0.048 to 0.99 % h-1; the chlorovirus-like gene,
LO.20May09.33, ranged from 0.44 to 0.76 % h-1; the cyanomyovirus-like gene, WZCPS8,
ranged from 0.27 to 14.81 % h-1. A decay rate was only able to be estimated for the IZCPS1
cyanomyovirus-like gene in the spring filtered incubation (2.60 % h-1).
Statistical comparisons of estimated algal virus and cyanophage decay rates
A second-order polynomial regression between natural log transformed infectivity measurements
and natural log transformed qPCR measurements at every time point used for the decay rate
calculations found a close relationship between the loss of infectivity and the loss of amplifiable
DNA (R-squared = 0.648; Figure 3.5). Spearman correlation was strong and highly significant (ρ
= 0.79, n = 375, p-value < 0.0001).
Linear regression analyses of the natural-log transformed qPCR abundances revealed that the
slopes (i.e., decay constants) for the whole water treatments were statistically significant (i.e.,
non-zero) at α = 0.05, except for ATCV-1 in the autumn 2013 (Appendix 2.1). The slopes of the
filtered treatments were non-significant for 61 % of the slopes tested. The patterns for the decay
constants were inverse from the patterns for the estimated decay rates above as more negative
decay constants produce higher decay rates.
ANCOVA was used to test if the decay constants based on infectivity assays were significantly
different than the decay constants based on molecular assays for the same virus. In every
69
Figure 3.5. Polynomial regression of infectious titre estimates from either Long and Short, 2016
or this study in the case of autumn 2014, against qPCR estimates of ATCV-1, CVM-1, and CpV-
BQ1 in all time points used for qPCR decay rate calculations in both treatments and every
season.
y = 0.0801x2 - 0.5275x + 9.4036R² = 0.648
0
5
10
15
20
25
0 5 10 15 20
ln G
ene
co
pie
s p
er
mL
ln Infectious units per mL
70
case, the decay constants estimated from infectivity assays were more negative (i.e., higher
decay) than decay constants derived from qPCR. Overall, 13 of 28 of the comparisons between
infectivity and qPCR measures were significantly different (Appendix 2.2). For ATCV-1, CVM-
1, and CpV-BQ1, 4 of 10, 5 of 10, and 4 of 8 of the decay constants were significantly different,
respectively. For filtered water treatments, 6 of 14 were significantly different, while 7 of 14
differed significantly for the whole water treatments. For spring, 2 of 4 comparisons were
significantly different, while 2 of 6 were significantly different in the summer, 7 of 12 were
significantly different in the autumn, and 2 of 6 were significantly different in the winter. In
summation, the number of significant differences between decay constants estimated with
infectivity assays and those estimated with qPCR did not vary much between the three viruses,
the two treatments, or seasonally, although over half of the decay constants were significantly
different in the two autumn incubations.
Similarly, ANCOVA was also used to compare the decay constants from the two different
treatments for each virus tested within the same season. Generally, decay constants from the
filtered water treatments were less negative than decay constants from the whole water
treatments. However, only 5 of 21 of the decay constants from the filtered treatments were
significantly different than those estimated from the whole water treatments (Appendix 2.3). In
spring, most (3 of 4) of the decay constants from the two treatments were significantly different
than each other, while no statistical differences were found in the summer, and only 1 of 7 and 1
of 5 comparisons were significantly different in autumn and winter, respectively. There was a
clear seasonality in the number of significant differences between treatments as over half were
significantly different in spring and no other season had more than one significant difference.
Additionally, comparisons were made between the decay constants from different seasons for the
same virus and treatment using ANCOVA, where overall, decay constants were more negative in
summer than the other seasons and less negative in winter than the other seasons. While these
patterns were observed, only 18 of the 62 decay constant comparisons were significantly
different (Appendix 2.4). Significant seasonal differences were found for 12 of 52 of the decay
constant comparisons for the cultivated viruses and in 3 of 10 comparisons for the uncultivated
viruses (2 of 4 for cyanophage genotypes, 1 of 6 for algal virus genotypes). For spring, 7 of 19
decay constant comparisons were significantly different from the other seasons (1 of 10 in
filtered, 6 of 9 in whole water), while 4 of 27 comparisons (1 of 14 in filtered, 3 of 13 in whole
71
water) in summer, 3 of 22 comparisons (0 of 11 in filtered, 3 of 11 in whole water) in autumn
2013, 13 of 29 comparisons (3 of 15 in filtered, 10 of 14 in whole water) in winter, and 7 of 26
comparisons (1 of 13 in filtered, 6 of 13 in whole water) autumn 2014 were significantly
different from other seasons. For all viruses, significant seasonal differences in decay rate
estimates were exhibited in 3 of 32 comparisons for the filtered water treatments and 15 of 30
comparisons for the whole water treatments. Additionally, decay constants from autumn 2013
were significantly different than the decay constants from autumn 2014 for 1 of 6 comparisons.
Overall, decay constants from the whole water treatments were much more likely to have
significant seasonal differences than decay constants from the filtered treatments and the spring
and winter experiments were more significantly different from other seasons than either summer
or autumn experiments.
Further, ANCOVA was used to test for significant differences between the decay constants
estimated for different viruses in the same season and treatment. Generally, in these
comparisons, cultivated algal viruses had less negative decay constants than uncultivated algal
viruses, and cyanomyoviruses had the most negative decay constants. Despite these observed
differences, only 29 of 78 decay constant comparisons between viruses were significantly
different from each other within the same season and treatment type (Appendix 2.5). The most
striking differences observed were between cyanophages, which had the highest decay rates, and
all other viruses. When the cyanophage decay constants were compared to all other viruses, 15 of
21 of the comparisons were significantly different. Of the two cyanophages, IZCPS1 was only
significantly different in 1 of 3 comparisons with algal viruses and WZCPS8 was significantly
different in 14 of 18. Due to the high decay observed in cyanophages, only one statistical
comparison between IZCPS1 and WZCPS8 could be made, which found WZCPS8 to have a
significantly different and more negative decay constant in the spring filtered treatment. While
WZCPS8 had a higher decay rate in this instance, IZCPS1 was more likely to decay too quickly
to be quantified and thus was likely to be the less stable cyanophage.
For the algal viruses, which had similar rates of decay, only 20 of the 80 comparisons between
viruses in the same treatment and season were significantly different, with 14 of 52 significantly
different between cultivated algal viruses, 5 of 26 significantly different between cultivated and
uncultivated algal viruses, and 1 of 2 significantly different between cultivated algal viruses.
Throughout most of the seasons, ATCV-1 had the lowest rate of decay, but only 9 of 28 of
72
comparisons between ATCV-1 and other algal viruses were significantly different. Similarly,
while CpV-BQ1 had the highest rate of decay for algal viruses for most seasons, only 7 of 22
comparisons were significantly different.
73
3.4 Discussion
Methodological considerations
Most phytoplankton viruses have not been cultivated and have unknown environmental hosts.
Therefore, cultivation-free techniques are vital to study viruses in their natural environments.
Molecular tools have been used to measure the diversity, abundance, and population dynamics of
algal viruses and cyanophages (e.g., Dorigo et al., 2004; Short and Suttle, 2005; Wilhelm et al.,
2006b; Chénard and Suttle, 2008; Short et al., 2011a; Hewson et al., 2012; Zhong and Jacquet,
2014). While one other study has estimated decay rates of uncultivated viruses via qPCR
(Hewson et al., 2012), the technique requires further validation to make inferences about the
decay of virus infectivity. The decay of infectivity is ecologically important because once a virus
is rendered non-infectious, it can no longer influence the mortality of its host populations. Since
decay rates of uncultivated viruses can only be assessed using culture-free methods, development
and validation of molecular techniques to estimate the decay of viruses is vital in viral ecology.
Validation of qPCR as a means of estimating virus decay is necessary as only some virions are
infectious (e.g., Van Etten et al., 1983b) and some mechanisms of decay may affect infectivity
without altering PCR amplification of viral genes. For instance, photochemical, chemical, and
enzymatic damage can render a virion non-infectious by compromising proteins involved in host
cell attachment and entry without damaging the small stretch of DNA required for qPCR
amplification. However, several mechanisms of decay will eliminate both infectivity and the
presence of amplifiable DNA at the same rate in filtered water samples, such as adsorption to
non-host cells and detritus or consumption by nanoflagellates (reviewed in: Gerba, 2005). It is
thus vital to resolve the relationship between the loss of infectivity and the loss of amplifiable
DNA in order to ascertain the usefulness of qPCR enumeration to estimate viral decay rates. In
order to establish the relationship between the loss of infectivity and the loss of amplifiable DNA
due to environmental factors in this study, the remaining infectious titre at each time point for
each treatment in each season was estimated with plaque assays or most probable number assays
and the remaining amplifiable DNA in the same samples was estimated with qPCR. The close
relationship between the loss of infectivity and the loss of amplifiable DNA, as evidenced by the
R-squared value in the polynomial regression (Figure 3.5) and high and significant Spearman
correlation values, suggests that qPCR measurements can be used as an effective proxy for
74
infectivity assays in decay experiments. Despite this, as the decay rates estimated with qPCR
were universally lower than those estimated with infectivity assays, molecular-based estimations
of virus decay should be interpreted cautiously.
Diversity of algal viruses and cyanophages in a freshwater pond
While the main focus of this study is the persistence of algal viruses and cyanophages, the
sequence data obtained revealed interesting patterns of diversity. Both polB and MCP sequences
obtained in autumn 2014 were dominated by either a single OTU or a few closely related OTUs,
suggesting the algal virus community during this season was not diverse. For both polB and
MCP, the sequences from autumn 2014 had fewer OTUs than previous studies in the same
environment (Short et al., 2011b) or in nearby Lake Ontario (Short and Short, 2008) and the Bay
of Quinte (Rozon and Short, 2013). Primer biases or shallow sequencing depth may have
influenced these results, however high host abundances may have contributed to the high relative
abundances of the observed genotypes. For instance, the dominance of the MCP prymnesiovirus-
like genotype may be explained by the population dynamics of the locally present
Chrysochromulina parva, which occurs in high abundances during autumn in nearby waters and
is infected by this OTU’s closest cultivated relative, CpV-BQ1 (Munawar and Munawar, 1982;
Mirza et al., 2015).
Though putative cyanophage g20 gene fragment sequences were obtained from every season, the
sequencing depth varied between the seasons, and thus, definitive statements cannot be made.
However, cyanophage OTU richness was highest in autumn 2014 and lowest in autumn 2013.
This study suggests highly similar cyanomyovirus-like genotypes have a global distribution as 16
of the 18 OTUs in this study were most closely related to sequences (65 - 95 % amino acid
sequence identity, with the majority over 85 %) obtained from freshwater environments in Asia
(Wang et al., 2011; Wang et al., 2015).
Environmental decay of algal viruses and cyanophages
Infectivity assays were used to estimate decay rates in autumn 2014. As in the previous four
incubations, ATCV-1 was the most resilient virus (Long and Short, 2016). Contrary to the
previous incubations, which found CpV-BQ1 to the most fragile virus (Long and Short, 2016),
CVM-1 had the highest decay rate in autumn 2014. However, CVM-1 and CpV-BQ1 did not
75
have statistically different decay rates when compared with ANCOVA (F = 0.0541, DFn, DFd =
1, 26, p-value = 0.817 for the filtered treatment; F = 1.802, DFn, DFd = 1, 26, p-value = 0.197
for the whole water treatment).
Molecular assays were utilized to enumerate specific genes throughout in situ decay incubation
experiments. These abundance estimates were then used to estimate the decay rates of ATCV-1,
CVM-1, CpV-BQ1, a chlorovirus-like gene, a prymnesiovirus-like gene, a prasinovirus-like
gene, and two cyanomyovirus-like genes. Overall, the decay rate estimates (0.0056 - 14.81 % h-
1) varied considerably, but the lower ranges are comparable to the decay rates estimated via
infectivity in these same incubations (0.012 - 11.26 % h-1; Long and Short, 2016). To our
knowledge, the only other decay incubation experiments which utilized qPCR to estimate decay
rates focused on a freshwater pond in Ithaca, NY, USA (Hewson et al., 2012) and presented rates
for a chlorovirus-like gene (0.13 % h-1) and a cyanomyovirus-like gene (1.50 % h-1) that were
within the range we obtained for uncultivated algal viruses (0.007 - 1.30 % h-1) and
cyanomyoviruses (0.27 - 14.81 % h-1). In the spring and summer incubations, two of the
cyanophage genes experienced decay that was too fast to be estimated with our experimental set-
up as they were no longer detectable after 24 hours (IZCPS1 in the spring whole water and both
summer treatments; WZCPS8 in the summer whole water treatment). If the final abundance at 24
hours is assumed to be one copy per mL, minimum decay rates can be estimated. The decay rate
estimates using this assumption range from 44 to 58 % h-1, which is near the range of
cyanophage PP decay as estimated with infectivity assays in Wuhan Lake, China (60 – 90 % h-1;
Liu et al., 2011).
The decay rates of ATCV-1, CVM-1, and CpV-BQ1 were estimated with both qPCR and
infectivity assays. In every case, the decay rate estimated with infectivity assays exceeded the
decay rate estimated with qPCR. While significant statistical differences were not always found,
this means that decay rates determined with qPCR should be treated as minimum estimates. It
should also be noted that ultraviolet (UV) irradiation was largely excluded from these
experiments and therefore these decay rates may have been underestimated by either
enumeration method. However, as some viruses are more damaged by photosynthetically active
radiation (PAR) than UV (e.g., Baudoux et al., 2012), further experiments utilizing UV-
transparent and UV-opaque vessels may be necessary to resolve whether the estimates of decay
in this study were underestimated.
76
Treatment effects, seasonality and virus-to-virus variability
The decay rates in the whole water treatments were higher than the filtered treatments but, less
than half of these differences were significant statistically. Interestingly, most of the treatment
differences were significantly different in the spring, while few were significantly different in
any other season, which suggests a clear seasonality in treatment effects. Additionally, while no
statistical inferences can be made, the decay was so high in the spring whole water for IZCPS1
and the summer whole water for WZCPS8 that they were no longer detected after 24 hours, but
the same viruses remained quantifiable in the filtered treatments, further suggesting a treatment
effect in the spring and summer incubations. The treatment effects were also greater in the spring
and summer when decay rates were estimated via infectivity during the same incubations (Long
and Short, 2016). Greater concentrations of non-host cells and other large particles, as expected
in whole water treatments, could increase the rate of absorption of viruses to these cell and
particles resulting in these viruses being filtered out during the sample preparation for qPCR.
Further, biomass is generally greater in the late spring and summer than in the autumn and winter
and, thus, viral absorption to non-host cells, the enzymatic breakdown of viruses, and the
presence of oxidizing and reducing agents of bacterial origin are more likely to occur in spring
and summer. These biological factors have been implicated in the decay of viruses in previous
studies (reviewed in: Gerba, 2005). It should also be noted that potential host cells were likely
present in the whole water treatment and thus whole water decay rates may have been lessened
by some amount of viral production during the incubations.
Seasonality in general was observed, viruses decayed fastest in spring and summer and lowest in
winter. The low decay rates in the winter were likely due to the ice cover that remained over the
incubation bottles throughout the experiment, which reduced the level of sunlight capable of
reaching the incubation bottles (Bertilsson et al., 2013). To our knowledge, this study constitutes
only the second reported experimental evidence that algal viruses persist over-winter within the
ice column of temperate aquatic systems and is the first study to provide evidence that
cyanomyoviruses may also persist in these conditions. The cultivated algal viruses, ATCV-1,
CVM-1, and CpV-BQ1, were shown to persist via infectivity assays previously (Long and Short,
2016). In this study, qPCR found ACTV-1 retained up to 62 % of its initial gene copies, CVM-1
up to 44 %, and CpV-BQ1 up to 20 %. In every case, a higher percentage of gene copies
remained than a percentage of infectivity. Despite this, the decay rates estimated with infectivity
77
assays were significantly different than the decay rates estimated with qPCR for only 2 of 6
comparisons in the winter.
In addition, both uncultivated viruses tested were found to retain gene copies throughout the
winter. F2VPOL1, the prasinovirus-like genotype, retained 19 % of its original gene copies in
the whole water treatment while WZCPS8, a cyanomyovirus-like genotype, retained only 0.0077
%. As less infectivity remained for each of the three cultivated viruses than gene copies, it is
reasonable to assume that F2VPOL1 will have remained infectious, but as only a very low
percentage of WZCPS8 gene copies remained, it is less likely that an appreciable amount of the
virus with this gene remained infectious at the end of winter. This marked contrast between algal
viruses and cyanophages suggest that they may employ different life histories in temperate
aquatic systems. However, high abundances of cyanomyoviruses have been reported during the
winter in Lake Erie, USA during which ice cover was present (Matteson et al., 2011). Therefore,
while the much lower decay rates of algal viruses in winter compared to the other seasons may
constitute a vital mechanism for the maintenance of viral ‘seed-banks’ in aquatic systems, further
questions on the stability of cyanophages during winter remain.
Estimated decay rates also had distinct differences between individual viral types. Overall,
cultivated algal viruses had the lowest decay rates and uncultivated cyanomyovirus-like genes
had the highest decay rates, which parallels a study that found lower decay rates for uncultivated
algal viruses than for uncultivated cyanomyoviruses (Hewson et al., 2012). Similarly, decay
patterns for the cultivated algal viruses monitored in this study using qPCR mirrored those from
the previous study of infectivity decay (Long and Short, 2016).
The generally high decay rates of cyanomyoviruses throughout the year compared to algal
viruses may be explained by differences in life history. For instance, several cyanomyoviruses
that infect Synechococcus infect multiple strains of Synechococcus, and even some strains of
Prochlorococcus (Sullivan et al., 2003), which may allow for more opportunities for infection of
different hosts throughout the year and continued production to counteract rapid rates of decay.
The differences in decay rate between algal viruses and cyanomyoviruses may also be due to
differences in genetic potential and physical structures. For instance, cyanophages and other
bacteriophages can exhibit extraordinary rates of photoreactivation (up to 78 %), whereby host
cell machinery repairs the phage, enabling it to regain infectivity (e.g., Weinbauer et al., 1997;
78
Wilhelm et al., 1998; Cheng et al., 2007). Similarly, many algal viruses contain the genetic
potential for DNA repair that, while independent of host genes, relies upon host cell machinery
(e.g., Dunigan et al., 2006). Furthermore, a strong relationship between capsid thickness
(represented by surfacic mass) and the mortality of phage has been reported in bacteriophages,
including myoviruses, whereby a greater capsid surfacic mass increased the survival of the
individual phage strain (De Paepe and Taddei, 2006).
Conclusions
The application of qPCR to enumerate specific viral genotypes allows estimates of decay for
viruses, whereas previous methods only allowed for the estimation of decay rates for total virus-
like particles in the case of microscopy (e.g., Heldal and Bratbak, 1991), or for infectious
particles with known and cultivated hosts (e.g., Noble and Fuhrman, 1997). The application of
qPCR, which was first validated in this study, is particularly important, as the vast majority of
viruses are uncultivated. While the decay rates of the majority of viruses can be estimated using
qPCR, it is important to note that the qPCR decay estimates represent minimum estimates of
decay and, as viruses are most ecologically important when infectious, infectivity decay
estimates remain the preferred method when host-virus pairs are in culture. Additionally,
metagenomics and deep-amplicon sequencing may offer more potential gene targets, which
would allow for future studies to estimate the decay rates of many more types of viruses than
were estimates in the current study.
The results of this study show clear seasonality in the decay rates of both algal viruses and
cyanophages. The high decay rates in the summer and spring suggest that other mechanisms,
such as environmental refugia, may be necessary to maintain the viral ‘seed-bank’ during these
periods of rapid decay. One such refugium may be in sediments as decay rates in the sediments
of aquatic systems are generally lower than decay rates in the water column and are less likely to
show extreme seasonal differences (Middelboe et al., 2011). While seasonal bottlenecks in virus
survival seem to occur in the spring and summer, the exceptionally low decay rates of
uncultivated algal viruses and cyanophages in winter suggest these viruses may overwinter
frozen within the ice cover of a freshwater pond. However, the decay rates estimated for an
uncultivated cyanophage genotype during winter suggests that the survival of cyanophages
throughout winter still remains unresolved.
79
Acknowledgements
I am appreciative of the constructive comments on data analysis by Michael Staniewski and on
analysis in general by Brandy Velten. This research was supported in part by the Canadian
Foundation for Innovation Leaders Opportunity Fund and NSERC Discovery grants awarded to
S.M.S.
80
Chapter 4 Diverse and abundant algal viruses and cyanophages observed in
Lake Erie sediments
.
Abstract Algal viruses and cyanophages infect important primary producers in aquatic systems and have
wide-ranging effects upon the food web and biogeochemical cycles. However, little is known
about these obligate pathogens within aquatic sediments. To address this information gap,
sediment core samples were taken from Lake Erie at four distinct sites: two in the western basin,
one in the central basin, and one in the eastern basin. Molecular probes targeting the polB gene
of algal viruses and the viral capsid assembly gene (g20) of cyanophages were used to examine
the diversity of environmental phytoplankton virus sequences. Additionally, quantitative PCR
primers and probes were utilized to estimate the abundances of select algal virus and cyanophage
genes in Lake Erie sediment. PCR and sequencing of polB and g20 genes revealed diverse
assemblages of putative algal viruses and cyanomyoviruses, uncovering many viral gene
sequences that had previously only been described from water column samples. Wide abundance
ranges of certain algal virus (below detection to 2.97 x 106 gene copies per gram of wet
sediment) and cyanophage (below detection to 9.42 x 104 gene copies per gram of wet sediment)
genes were found using qPCR. Abundance patterns were variable between viruses and were
often specific to the virus gene and sampling site. The diversity of viruses coupled with the high
abundances of several virus genes, suggest that aquatic sediments are an important
environmental refugia for phytoplankton viruses
A version of this chapter has been submitted to Applied and Environmental Microbiology
81
4.1 Introduction
Viruses have high abundances relative to cellular life in both the water column (Bergh et al.,
1989) and sediments (Maranger and Bird, 1996) of aquatic ecosystems. These highly abundant
particles are thought to exert top-down population control upon cellular organisms, a process
which has widespread implications for aquatic food webs and biogeochemical cycles (Brussaard,
2004; Wilhelm and Suttle, 1999; Suttle, 2007; Short, 2012). Additionally, evidence suggests
viruses can drive succession in both eukaryotic and prokaryotic algal communities, and that they
are responsible for cessation of certain algal blooms (e.g., Bratbak et al., 1993; Tarutani et al.,
2000; Wilson et al., 2002a; Brussaard et al., 2005; Gobler et al., 2007; Tomaru et al., 2007). Not
only do viruses actively decrease populations via lytic mortality, their activity has increasingly
been linked to increased productivity of both heterotrophic bacteria and primary producers via
liberation of nutrients following cell lysis (Haaber and Middelboe, 2009; Weinbauer et al., 2011;
Shelford et al., 2012; Staniewski and Short, 2014). Furthermore, it has been suggested that the
destruction of virus particles themselves contribute to the productivity of certain environments,
such as anoxic sediments (Dell’Anno et al., 2015). While viruses that infect eukaryotic or
prokaryotic algae are assumed to have important roles in aquatic ecosystems, the population
dynamics of these viruses and their effects upon hosts are only just beginning to be understood.
In addition to reports of high viral abundance in aquatic environments at discrete time points,
many studies have sought to analyze the diversity and seasonal patterns of viruses in aquatic
environments. The use of PCR targeting of hallmark genes for specific groups of viruses (e.g.,
Dorigo et al., 2004; Short and Suttle, 2005; Wilhelm et al., 2006b; Chénard and Suttle, 2008;
Short and Short, 2008; Clasen and Suttle, 2009) and metagenomics (Mohiuddin and Schellhorn,
2015) has allowed the diversity of uncultivated viruses to be studied in a number of freshwater
environments. The use of these molecular tools for algal viruses and cyanophages have often
revealed closely related gene sequences with widespread occurrences in marine and freshwater
environments (Short and Suttle, 2005; Wilhelm et al., 2006b; Short and Short, 2008). Despite
this, many diversity studies based on marker gene analysis have pointed to the existence of
sequences unique to specific environmental samples (Short et al., 2011b; Rozon and Short,
2013).
82
Moreover, sequence information obtained via PCR or metagenomics have recently been
extended to develop quantitative PCR (qPCR) assays that can assess the abundance of putative
algal virus and cyanophage genes in aquatic environments (e.g., Short and Short, 2009; Short et
al., 2011a; Matteson et al., 2011; Hewson et al., 2012; Zhong et al., 2013). Studies using qPCR
or infectivity assays to monitor the abundance of algal viruses or cyanophages have
demonstrated that some populations of algal viruses and cyanophages exhibit ‘boom and bust’
patterns, whereas other populations can be maintained at lower, but stable, abundances
throughout several seasons (e.g., Short and Short, 2009; Short et al., 2011a; Hewson et al., 2012;
Rozon and Short, 2013; Quispe et al., 2016). Indeed, observations of stable virus abundances
throughout the year, coupled with metagenomic studies, have revealed aquatic virus
communities with a few dominant virus genotypes but many more less abundant, yet detectable
genotypes (Breitbart et al., 2002; Breitbart and Rohwer, 2005). These findings provide evidence
for a ‘bank model’ of viral ecology, which proposes the presence of two pools of viruses: one of
highly abundant, less diverse viruses that actively produce more viruses while their hosts are
present, and another pool of highly diverse viruses that exist at relatively low abundances
(Breitbart and Rohwer, 2005; Waterbury and Valois, 1993). This pool of highly diverse, low
abundance viruses constitutes a ‘seed-bank’ that persists in the environment until hosts reach
‘threshold’ abundances necessary to promote viral production. The host-cell ‘threshold’
abundance for algal viruses and cyanophages typically ranges from 103 - 104 host cells per mL
(Suttle and Chan, 1994; Cottrell and Suttle, 1995; Jacquet et al., 2002), concentrations that both
eukaryotic and prokaryotic algae generally drop below during certain times of the year (e.g.,
Munawar and Munawar, 1986). After decreases in Synechococcus populations in the South
Pacific Ocean, total virus populations decreased in the 2 days immediately after, further
suggesting that phytoplankton virus populations are dependent on the availability of their hosts
(Matteson et al., 2012).
Despite this clear pressure on the continued existence of algal viruses and cyanophages in
aquatic environments, water column decay rates for these viruses are often highly variable (0.012
- 230 % lost per hour) and subject to seasonal variations (e.g., Heldal and Bratbak, 1991; Cottrell
and Suttle, 1995; Noble and Fuhrman, 1997; Garza and Suttle, 1998; Cheng et al., 2007; Hewson
et al., 2012; Frada et al., 2014; Long and Short, 2016). Recently, three different cultivated algal
viruses were shown to retain much of their infectivity after in situ incubation for 126 days under
83
ice in a freshwater pond (Long and Short, 2016). These observations provide evidence for one
mechanism of persistence within the water column that may maintain the viral ‘seed-bank.’
However, in other seasons, as well as in other studies examining the rate of decay of algal
viruses or cyanophages, the reported rates of decay were high enough to prevent continued
persistence of viruses in the absence of their hosts (e.g., 11 - 230 % lost per hour; Cottrell and
Suttle, 1995; Cheng et al., 2007; Long and Short, 2016).
To this end, other mechanisms must aid in the maintenance of algal virus and cyanophage ‘seed-
banks.’ These may include the DNA repair mechanisms encoded in several algal virus genomes
(e.g., Jeanniard et al., 2013), host- or virus-mediated photo-reactivation (e.g., Cheng et al., 2007;
Moniruzzaman et al., 2014), and even temperate life cycles for cyanophages (e.g., Sode et al.,
1994; Long et al., 2008). Further, environmental refugia may play a vital role in the maintenance
of the viral ‘seed-bank.’ One obvious potential refugium for algal viruses and cyanophages is the
sediment of aquatic environments, especially considering that early studies on sediment viruses
suggested that they experience reduced decay rates relative to viruses in the water column (Smith
et al., 1978; LaBelle and Gerba, 1980). Additionally, viable cyanophages have been recovered
from marine sediments up to 100 years old (Suttle, 2000a) and from freshwater sediments up to
50 years old (Hargreaves et al., 2013). Infectious algal viruses of the raphidophyte Heterosigma
akashiwo have also been recovered from sediment depths of up to 40 cm in coastal British
Colombia, Canada (Lawrence et al., 2002). The single stranded DNA (ssDNA) algal viruses of
Chaetoceros spp. and single stranded RNA (ssRNA) viruses of Heterocapsa circularisquama
have also been found in Japanese coastal sediments (Nagasaki et al., 2004; Tomaru et al., 2007,
2011b; Kimura and Tomaru, 2015). Furthermore, algal virus (Coolen, 2011; Hewson et al.,
2012), cyanomyovirus (Hewson et al., 2012), and potential host (Coolen, 2011; Rinta-Kanto et
al., 2009b) genes have been detected in sediments using qPCR. As such, marine and freshwater
sediments alike may harbor viable viruses that could be reintroduced into the water column,
acting as a source of viruses for the overlying waters.
Even though sediments are a likely refuge for aquatic viruses, viral ecology in aquatic sediments
remains poorly understood relative to the overlying waters. Studies of reef environments (Paul et
al., 1993), freshwater lakes (Maranger and Bird, 1996), and estuaries (Hewson et al., 2001) have
all found that viruses, enumerated via infectivity assays with specific hosts or via microscopy of
virus-like particles, can be up to 1,000 times more numerous in sediments than in the overlying
84
waters. Similarly, infectious algal viruses were found to be several times more abundant in the
coastal sediments of British Columbia compared with the overlying water column (Lawrence et
al., 2002). These observations have stimulated studies of virus diversity within aquatic sediment
using different experimental approaches, including metagenomics (Breitbart et al., 2004), pulsed
field gel electrophoresis (Filippini and Middelboe, 2007), and random amplification of
polymorphic DNA (Helton and Wommack, 2009; Borrell et al., 2012). Virus diversity in both
marine and freshwater sediments have been found to be quite high when compared to the water
column, but with large variations between sampling sites (Helton and Wommack, 2009). Despite
the clear importance of algal viruses and cyanophages in freshwater ecosystems and the presence
of specific algal viruses and cyanophages in sediments, the diversity of these viruses in aquatic
sediments has not been fully explored, and the abundances of only one algal virus and one
cyanophage have been estimated from freshwater sediments (Hewson et al., 2012).
Lake Erie is an important socioeconomic resource that is experiencing harmful algal blooms,
particularly of the toxic cyanobacterium Microcystis, at an increased rate and intensity (Rinta-
Kanto et al., 2009a; Michalak et al., 2013; Harke et al., 2016). As such, understanding
phytoplankton viral ecology in Lake Erie is of particular importance, including an examination
of sediments as a viral refugium. Therefore, the goals of this study were two-fold: 1) to assess
the potential for the freshwater sediments of Lake Erie to harbor diverse assemblages of algal
viruses and cyanophages and 2) to quantify the abundance of specific algal virus and cyanophage
genes across multiple depths in these same sediments. In order to accomplish these goals,
sediment samples were collected from four different locations and PCR of specific algal virus
and cyanophage hallmark genes was used to obtain gene sequences to assess the diversity of
these groups. Subsequently, qPCR was used to estimate the abundance of specific algal virus and
cyanophage genes at discrete depth profiles within the sediment samples.
85
4.2 Materials and Methods
Sample collection and DNA extraction
Lake Erie sediment sampling was conducted during a research cruise aboard CCGS Limnos
during the summer of 2013. Three sediment cores were taken at stations 452, 882, and 973 and
two were taken at station 1326 using clean, graduated acrylic coring tubes with a 2.5 cm
diameter (Figure 4.1). Sediment cores were immediately subsampled on board into 0 - 2 cm, 2 -
4 cm, 4 - 6 cm, and 6 - 8 cm depth profiles. Samples from each depth profile were placed in 4
ounce Whirl-Pak bags (Nasco, Fort Atkinson, WI) and stored at -20 °C until further processing.
Sediment samples were thawed in the lab, wet weight was measured, and DNA was extracted
with a PowerSoil DNA isolation kit (MO BIO Laboratories, Carlsbad, CA) using the
manufacturers’ protocol. The starting wet weight of sediment averaged 0.5 grams (standard
deviation = 0.1, n = 44). Triplicate (or duplicate in the case of station 1326) DNA extracts were
analyzed with a NanoDrop 1000 (Thermo Scientific, Wilmington, DE) for quantity and purity,
and were pooled to reduce sample variability creating composite samples for each depth at each
station, and then were stored at -20 °C.
Analysis of algal virus and cyanophage communities
PCR of DNA polymerase B genes (polB) was conducted to examine the community composition
of algal viruses in Lake Erie sediment using the primer set VpolAS4/VpolAAS1 (Clerissi et al.,
2014a), while the primers CPS1.1/CPS8.1 (Sullivan et al., 2008) were used for PCR of the
portal-protein-encoding gene 20 (g20) of cyanomyoviruses. PCR amplification of algal virus
polB gene fragments required one round of PCR using 50 μL reactions with 25 μL of GoTaq G2
Green Master Mix (Promega Corporation, Madison, WI), 200 nM of VpolAS4, 800 nM of
VpolAAS1, and 5 μL of template. Cycling conditions for polB PCR reactions were: 180 s at 95
°C, 40 cycles of 95 °C for 30 s, 50 °C for 50 s, and 72 °C for 90 s, and 240 s at 72 °C. PCR of
cyanophage g20 gene fragments required two rounds of PCR where products from the first round
of g20 PCR (180 s at 95 °C, 35 cycles of 95 °C for 30 s, 44 °C for 60 s, and 72 °C for 60 s, and
300 s at 72 °C) were purified with a Biobasic PCR clean-up kit (Biobasic, Markham, Canada)
and were used as templates for a second round of PCR (180 s at 95 °C, 25 cycles of 95 °C for 30
s, 45 °C for 60 s, and 72 °C for 60 s, and 300 s at 72 °C). The first round PCR of g20 used 50 μL
reactions with 5 μL of 10x PCR Buffer, 1.5 mM of MgCl2, 0.2 mM of each dNTP, 400 nM of
86
Figure 4.1. Map of Lake Erie denoting sediment sampling sites.
87
CPS1.1, 400 nM of CPS8.1, 1 unit of Platinum Taq DNA Polymerase (Life Technologies
Corporation, Carlsbad, CA), and 5 μL of template, while the second round of g20 PCR used the
same reagent concentrations, but only 1 μL of template. Final PCR products for both polB and
g20 gene fragments were visualized via gel electrophoresis and DNA bands of approximately the
correct size for each primer set were excised. Excised DNA bands were purified with a BioBasic
Gel Purification kit (Biobasic, Toronto, Canada) using the manufacturers’ protocol. Purified PCR
products were cloned using a pGem-T Vector System II kit (Promega Corporation, Madison,
WI). PCR was then conducted on portions of individual bacterial colonies using SP6/T7 primers
to verify the presence of the correct inserts, and PCR products of appropriately sized inserts were
purified using a Biobasic PCR clean-up kit as before. These purified PCR products were Sanger
sequenced at the Center for Applied Genomics at Sick Kids Hospital in Toronto, Canada. Only
sequences of the correct length were used for subsequent analysis, i.e., ~350 bp for polB and
~592 bp for g20.
For both polB and g20 gene fragment sequences, NCBI BLAST was utilized to verify that
amplicons were related to sequences from cultivated algal viruses and cyanophages. Sequences
that did not match the targeted genes were removed from the data set and not used in further
analysis. Nucleotide sequences of polB or g20 gene fragments were aligned using MUSCLE in
MEGA 6 (Tamura et al., 2013) and mothur was used to check for chimeric sequences using the
bellerophon approach (Schloss et al., 2009). Operational Taxonomic Units (OTUs), chao1, and
inverse Simpson indices were calculated in mothur with a 97 % identity cut-off for OTUs
(Schloss et al., 2009). Amino acid sequences were inferred from representative sequences of
each OTU, aligned with MUSCLE along with closely related sequences obtained using NCBI
blastp, and were used to construct maximum likelihood phylogenetic trees based on the Jones-
Taylor-Thornton amino acid substitution model (JTT) with 1000 bootstrap iterations in MEGA
6. All alignments, blastp searches, and phylogenetic reconstructions were conducted using
default parameters. Representative nucleotide sequences from each polB and g20 OTU were
submitted to NCBI Genbank (accession numbers: KY082090 - KY082166 for g20 and
KY082167 - KY082185 for polB).
88
Quantitative PCR of viral genotypes in Lake Erie sediment
To estimate the abundance of various algal virus and cyanophage genes, qPCR was used.
Numerous extant qPCR primer and probe sets for algal virus and cyanophage genes were tested
on DNA extracted from the sediment core samples. Eleven qPCR primer and probe sets, seven
targeting algal virus genes and four targeting cyanophage genes, reliably produced amplification
signals from sediment DNA and thus were used to estimate the abundance of these genes at all
stations and depths. The primer and probe sets used in this study and their targets are detailed in
Table 4.1.
For qPCR with all primer and probe sets, 20 μL reaction mixtures were used with 1x Platinum
Taq PCR Buffer, 0.5 units of Platinum Taq DNA polymerase (Life Technologies Corporation,
Carlsbad, CA), 5 mM of MgCl2, 200 μM of each dNTP, 250 nM of the respective forward
primers, 250 nM of the respective reverse primers, 100 nM of the respective TaqMan probe, 30
nM of ROX reference dye, and 2 μL of template. All reactions had an initial denaturation step for
300 s at 95 °C which was followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. The qPCRs
were conducted and fluorescence was measured on an Mx3000P QPCR System (Stratagene, La
Jolla, CA). The efficiencies for the standard curves ranged from 93.7 to 104.2 %, and for all
primer and probe sets, the R-squared values of Ct vs. gene copies for the standards were above
0.99. As per Short et al., (2004), when only one or two of the three triplicate qPCRs amplified,
the gene was considered detectable but not quantifiable. Final gene abundances were estimated
as gene copies per gram of wet sediment.
In order to account for variability in DNA extraction efficiency, known quantities of plasmid
DNA (pGem®-T vector, Promega Corporation, Madison, WI) containing a synthetic gene
fragment (gBlocks®, Integrated DNA Technologies, Coralville, IA) insert were added to the
sediment samples before DNA extraction was conducted. The insert sequence, a fragment of the
Suricata suricatta (meerkat) mitochondrial gene for cytochrome b (accession number D28906;
Masuda et al., 1994), was selected based on the improbability of its existence in the
environmental samples examined in this study. A qPCR primer and probe set amplifying a 109
bp region of a 209 bp gBlocks® synthetic meerkat cytochrome b gene fragment was designed
using Beacon Designer 7 (Premier Biosoft International, Palo Alto, CA) under default
parameters for TaqMan® probe design. Nucleotide sequences for the primers and probe (5’-3’)
89
are as follows: forward primer GCCTTTTCATCAGTAACTC, reverse primer
CGTGTATGAATAAGCAGATAA, and probe CAACTATGGCTGAATCATCCGATATGC.
The probe was 5’ labelled with FAM (6-carboxyfluorescein), 3’ labelled with Iowa Black® FQ,
and incorporated an internal ZEN™ quencher. The meerkat gene insert was cloned using an A-
tailing procedure as described in Kobs (1997), and ligation, transformation, overnight
incubations, plasmid harvesting, and DNA quantification were performed as previously
described (Short and Short, 2008). Plasmids containing the desired insert DNA sequence
(verified by Sanger sequencing performed by the Centre for Applied Genomics, at the Hospital
for Sick Children, Toronto, ON, Canada) were linearized using the ApaI restriction endonuclease
(New England Biolabs, Ipswich, MA) and were purified using a QIAquick PCR purification kit
(Qiagen, Hilden, Germany). Eight, 10-fold serial dilutions of the linearized cloned fragments
were used to create qPCR standard curves. Quantitative PCRs utilizing the Suricata suricatta
primers and probe set, following the same reaction conditions as described above, were
conducted to quantify the number of meerkat gene copies in the stock solution that was added to
each sediment samples as well as in extracted the DNA samples. Percent recovery of amplifiable
meerkat cytochrome b gene copies was then determined (range: 31 - 53 %), and was used to
correct environmental gene copy estimates for DNA extraction efficiencies.
.
90
Table 4.1. Primer and probe sets of detected algal virus and cyanophage genotypes in Lake Erie sediment
Group Target name Targeted gene Closest cultivated relative to target* Primer design study
Algal Viruses 356-M5.3 MCP gene Pyramimonas orientalis virus isolate M05-01 (56%) Rozon and Short, 2013
356-M5.14 MCP gene Chrysochromulina parva virus-Bay of Quinte 1 (81%) Rozon and Short, 2013
F2MCP1 MCP gene Chrysochromulina parva virus-Bay of Quinte 1 (89%) Chapter 3
CpV-BQ1 polB gene Chrysochromulina parva virus-Bay of Quinte 1 (100%) Mirza et al., 2015
LO.08may08.08 polB gene Chlorella Marburg virus-1 (99%) Short et al., 2011a
F2VPOL1 polB gene Bathycoccus virus BpV178 (78%) Chapter 3
LO1b-49 polB gene Ostreococcus virus isolate OtV343 (26%) Short et al., 2011a
Cyanophages IZCPS1 g20 gene Cyanophage P-TIM40 (64%) Chapter 3
WZCPS8 g20 gene Synechococcus phage S-SM1 (72%) Chapter 3
252.SH Sheath protein gene Microcystis phage Ma-LMM01 (95%) Rozon and Short, 2013
282.SH Sheath protein gene Microcystis phage Ma-LMM01 (93%) Rozon and Short, 2013
*Percent sequence identity to closest cultivated nucleotide BLAST match in parentheses
91
4.3 Results
Diversity of algal viruses and cyanophages in Lake Erie sediment
178 putative polB sequences were obtained from the four stations in Lake Erie, representing 20
OTUs (Table 4.2). Putative polB sequences were obtained from all four depths at station 882 in
the western basin of Lake Erie and station 1326 in the central basin, the 2 - 4 cm sample from
station 452 (eastern basin), and the 4 - 6 cm sample from station 973 (western basin). The
highest number of OTUs were in the 0 - 2 cm depth profile of station 1326, while the lowest
number of OTUs were in the 6 - 8 cm depth profile of station 1326. The 6 - 8 cm depth profile of
station 1326 had both the lowest chao1 and inverse Simpson index scores, while the station 1326
0 - 2 cm and the 2 - 4 cm depth profiles had the highest inverse Simpson and chao1 index scores,
respectively. For station 1326, the offshore station near Cleveland, OH in the central basin, the
general trend was more OTUs and higher index scores in the shallower depth profiles and fewer
OTUS and lower index scores in the deeper depth profiles. For station 882, the station near the
mouth of the Maumee River in the western basin, the trend was the opposite, with more OTUs
and higher index scores in the deeper sediment depth profiles.
A maximum likelihood JTT amino acid phylogenetic tree comparing representative sequences
from each polB OTU to reference sequences of cultivated algal viruses and other environments
was used to provide a crude identity of sediment sequences (Figure 4.2). The majority of polB
OTUs (75 %) clustered within a clade of cultivated prasinoviruses (Figure 4.2), and according to
NCBI blastp, had at least 76 % identity with cultivated prasinoviruses (Appendix Table 3.1).
These prasinovirus-like OTUs contain sequences obtained from every station and every depth
sampled. In addition to prasinovirus-like OTUs, one polB OTU (88268VPOLCC1) clustered
with mimivirus-like prymnesioviruses and had 99 % amino acid sequence identity with the polB
sequence from the recently isolated freshwater algal virus Chrysochromulina parva virus BQ1
(Mirza et al., 2015). This prymnesiovirus-like polB gene was only amplified from the 6 - 8 cm
depth sample from station 882 and the 0 - 2 cm and 4 - 6 cm depths at station 1326. Another
polB OTU (132624VPOLCC19) clustered with Yellowstone Phycodnavirus 1 and 2 and had 86
% identity with these putative phycodnavirus polB sequences. This OTU was a singleton, and
was only observed in the 2 - 4 cm depth at station 1326. The remaining three OTUs were in a
92
clade by themselves (Figure 4.2), and shared either 51 % identity to Yellowstone Phycodnavirus
1 in the case of 88202VPOLCC1 and 88246VPOLCC5, or 49 % identity with Phaeocystis
globosa virus PgV-03T in the case of 45224VPOLCC1. Other OTU sequences
(88202VPOLCC1 and 88246VPOLCC5) were found in all sediment depths at station 882, while
sequences in the 45224VPOLCC1 OTU were only found in the 2 - 4 cm depth profile of station
452.
From the four stations in Lake Erie, 143 putative g20 sequences were obtained, which
represented 76 OTUs based on a 97 % nucleotide identity cut-off (Table 4.2). Putative g20
sequences were obtained for all depths in station 882 in the western basin, the top three depths in
station 1326 in the central basin, and the 0 - 2 cm depths for station 452 in the eastern basin and
station 973 in the western basin. The highest number of OTUs was observed in the 6 - 8 cm
depth profile of station 882, while the fewest number of OTUs was observed in the 0 - 2 cm
depth profile of station 1326. The 6 - 8 cm depth of station 882 also had the highest chao1 and
inverse Simpson index values, while the 0 - 2 cm depth of station 1326 had the lowest chao1 and
inverse Simpson index values. The general trend observed in both station 882 and station 1326
showed higher numbers of OTUs and higher diversity and richness values in the deeper sediment
depth profiles as compared to the more shallow sediment depth profiles.
A total of 20 of the 76 g20 OTUs obtained when using a 97 % cut-off clustered with g20
sequences from cultivated cyanomyoviruses (Figure 4.3). These 20 OTUs shared 81 - 94 %
amino acid sequence identity with cultivated Synechococcus-infecting and Prochlorococcus-
infecting cyanomyoviruses and were present in all the stations and depths analyzed (Appendix
Table 3.2). The majority of the g20 OTUs (~72 %) obtained in this study were more closely
related to sequences obtained from previous environmental studies than to cultivated
cyanomyoviruses. These OTUs shared between 72 - 100 % sequence identities with g20
sequences obtained from environmental sequences and had only 59 - 72 % sequence identities
with cultivated cyanomyoviruses (Figure 4.3). One OTU obtained in this study
(88246CPSCC11) was in a clade with only itself and shared 52 % sequence identity with
Synechococcus phage S-CBM2 and 58 % sequence identity with an environmental sequence
from East Lake, China (Figure 4.3). This OTU was only present in the 4 - 6 cm depth profile of
station 882.
93
94
Figure 4.2. Maximum likelihood phylogenetic tree of amino acid sequences inferred from
putative algal virus polB gene sequences using a Jones-Taylor-Thornton amino acid substitution
model with 1000 bootstrap iterations. Bolded sequences are OTUs obtained from Lake Erie
sediment in this study. The first three or four numbers denote station (first three for 452, 882, and
973; first four for 1326), the next two numbers indicated depth (02 for 0 - 2 cm, etc.), Vpol
indicates primer used (VpolAAS4/VpolAS1) and CC and number after indicate clone number.
Sequences obtained in this study were compared to polB gene sequences from cultivated algal
viruses and environmental sequences from previous studies to provide phylogenetic and
environmental context. The environmental reference sequences are color-coded based on their
isolation source.
95
Table 4.2. Species richness and diversity of polB and g20 genes in Lake Erie sediment
Gene Station Depth profile Total number of sequences OTUs* chao1* Inverse Simpson*
polB 452 2 - 4 cm 20 5 5.5 2.88
882 0 - 2 cm 18 3 4 1.28
2 - 4 cm 18 3 2 1.13
4 - 6 cm 20 4 4.5 1.88
6 - 8 cm 17 6 9.5 5.67
all 73 13 17.5 2.33
973 4 - 6 cm 19 3 3 1.8
1326 0 - 2 cm 14 9 11 9.23
2 - 4 cm 16 7 12 2.96
4 - 6 cm 15 4 4.5 1.88
6 - 8 cm 21 2 2 1.11
all 66 13 20.5 3.35
all all 178 20 41 6.84
g20 452 0 - 2 cm 16 7 12 3.24
882 0 - 2 cm 15 13 31.33 52.5
2 - 4 cm 18 13 46.33 76.5
4 - 6 cm 15 13 21 35
6 - 8 cm 19 17 86 171
all 67 55 235.17 130.06
973 0 - 2 cm 15 8 9.5 8.08
1326 0 - 2 cm 15 4 4 3.39
2 - 4 cm 11 6 7 6.88
4 - 6 cm 3 3 6 1
all 29 9 10.5 4.72
all all 143 76 241.3 30.04
*All OTU, chao1, and inverse Simpson indices were calculated with a 97% cut-off
96
97
Figure 4.3. Maximum likelihood phylogenetic tree of putative cyanophage g20 gene sequences
using a Jones-Taylor-Thornton amino acid substitution model with 1000 bootstrap iterations.
Bolded sequences are OTUs obtained from Lake Erie sediment in this study. The first three or
four numbers denote station (first three for 452, 882, and 973; first four for 1326), the next two
numbers indicated depth (02 for 0 - 2 cm, etc.), CPS indicates primer used (CPS1.1/CPS8.1) and
CC and number after indicate clone number. Sequences obtained in this study were compared to
g20 gene sequences from cultivated algal viruses and environmental sequences from previous
studies to provide phylogenetic and environmental context. The environmental cyanomyovirus
group are putatively cyanophage sequences and are color-coded according to isolation source.
98
Abundance of algal virus and cyanophage genotypes in Lake Erie sediment
The abundances of the seven algal virus genes ranged from below detection or detectable but not
quantifiable (i.e., only one or two of the triplicate qPCRs amplified) to 3.78 x 102 - 2.97 x 106
gene copies per gram of wet sediment in the samples (Figure 4.4). The limit of detection varied
from sample to sample and from virus to virus (5.40 x 101 - 3.76 x 103 gene copies per gram of
sediment) due to small differences in the lowest detectable dilution of the standards used for each
qPCR assay, the total weights of sediment used for each DNA extraction, and the efficiencies of
the DNA extractions as inferred from meerkat gene amplification. Overall, the most abundant
algal virus gene at every station and depth was 356-M5.14, a putative mimivirus-like
prymnesiovirus major capsid protein gene first identified in the Bay of Quinte in Lake Ontario
(Rozon and Short, 2013). The least abundant genes all had at least one depth profile in which
they were below the limit of detection, and included the putative polB gene from CpV-BQ1,
F2VPOL1, a putative Prasinovirus-like polB gene first observed in a storm-water pond in
Mississauga, Ontario, and LO1b-49, another putative Prasinovirus-like polB gene from Lake
Ontario. Overall, the least abundant algal virus was likely Chlorella Marburg virus 1 (CVM-1),
as it was present in detectable but unquantifiable levels in only one depth profile from every
station.
The abundances of the four cyanophage genes ranged from below detection to detectable but not
quantifiable to 7.32 x 102 - 9.42 x 104 gene copies per gram of wet sediment (Figure 4.5).
IZCPS1, a putative cyanomyovirus-like g20 gene, first found in a storm-water pond in
Mississauga, Ontario, had the highest maxima of the four cyanophage-like genes. While each of
the four genes had depths at various stations in which they were below the limit of detection,
252.SH, an M. aeruginosa phage-like sheath protein gene first found in the Bay of Quinte, Lake
Ontario, was the least abundant overall, as it was not quantifiable at any of the depth profiles in
which it was detectable.
As Figures 4.4 and 4.5 illustrate, there are a number of abundance patterns for both algal virus
and cyanophage genes with depth. For instance, some algal virus genes were generally most
abundant in the more shallow depth profiles and were less abundant in the deeper sediments
(e.g., 356-M5.14 at stations 452 and 1326), whereas other algal viruses and cyanophages were
more abundant in the deeper sediment than in the more shallow depth profiles (e.g., LO1b-49 at
99
station 1326). Further, several phytoplankton virus genes had relatively similar abundances from
depth profile to depth profile (e.g., 356-M5.14 at stations 882 and 973), while others had no
discernable pattern with varying degrees of abundance from depth to depth. Abundance patterns
differed between sampling stations, with the same virus gene having different abundance
patterns at different stations. For example, 356-M5.14 had higher abundances in the shallower
depth profile at stations 1326 and 452, in the central and eastern basins of Lake Erie, respectively
while exhibiting relatively constant abundances at each depth profile in the two western basin
stations, 882 and 973. Additionally, all four cyanophage genes tested were either detectable but
not quantifiable, or not detectable at most of the depths in both central and eastern basin stations,
but were either quantifiable, with abundances of up to 9.42 x 104 gene copies per gram of wet
sediment, or detectable but not quantifiable at most depths in the two western basin stations.
100
101
Figure 4.4. Abundances of individual algal virus genotypes at stations 1326 (A), 452 (B), 882 (C), and 973 (D). Each individual bar
represents the average of triplicate quantitative PCRs and the error bars represent standard deviation. A filled circle represents a genotype
that was detectable but not quantifiable at that depth profile. Shades of blue represent putative algal virus MCP gene abundances while
shades of green represent putative algal virus polB gene abundances.
102
103
Figure 4.5. Abundances of individual cyanophage genotypes at stations 1326 (A), 452 (B), 882 (C), and 973 (D). Each individual point
represents the average of triplicate quantitative PCRs and the error bars represent standard deviation. A filled circle represents a genotype
that was detectable but not quantifiable at that depth profile. Shades of blue represent putative Microcystis phage sheath protein gene
abundances while shades of green represent putative cyanomyovirus g20 gene abundances.
104
4.4 Discussion
The presence of diverse algal virus and cyanomyovirus communities in sediment from Lake Erie
was confirmed through the use of molecular techniques targeting hallmark genes distinguishing
these virus groups. To our knowledge, this was the first attempt to examine the diversity of algal
viruses and cyanomyoviruses in freshwater sediments using these techniques. To ensure
amplification of the most abundant taxa at each station, and to reduce within site heterogeneity
(Goyer and Dandie, 2012), composite sediment samples were analyzed. Additionally, qPCR was
used to assess the abundance patterns of specific algal virus and cyanophage genes, which
revealed distinct patterns of abundance over the four discrete depth profiles sampled and at the
four sampling sites. The qPCR results also demonstrated the presence of Microcystis phage-like
genes in Lake Erie sediment. This finding suggests that sediments may be a reservoir for phages
that infect Microcystis aeruginosa, a harmful algal bloom-forming species that has caused
serious water quality issues in Lake Erie in recent years (e.g., Rinta-Kanto et al., 2009a;
Michalak et al., 2013; Harke et al., 2016).
Diversity of phytoplankton viruses in freshwater sediment
The majority of algal virus-like polB OTUs from Lake Erie sediments were closely related to
Prasinovirus sequences. While prasinophyte algae have never been reported in the Laurentian
Great Lakes (Munawar and Munawar, 1986), algal virus diversity surveys have often found
Prasinovirus-like sequences to be the dominant algal virus in the Great Lakes. It has been
suggested that these viruses could have hosts other than prasinophytes, such as other closely
related chlorophyte algae (Short and Short, 2008; Rozon and Short, 2013). While the polB
primers used in this study were designed to target Prasinovirus genes (Clerissi et al., 2014a),
other observations have suggested that Prasinovirus is the most abundant algal virus type in
environmental samples (Clasen and Suttle, 2009).
Even though the majority of algal virus polB OTUs were most closely related to Prasinovirus
sequences, there was also an OTU obtained that was closely related to CpV-BQ1, which infects
the haptophyte alga Chrysochromulina parva (Mirza et al., 2015). Additionally, three OTUs
(45224VPOLCC1, 88202VPOLCC1 and 88246VPOLCC5) formed their own clade within
Phycodnaviridae. These OTUs were only distantly related to their closest blastp matches
(Appendix Table 3.1). Additionally, all three of the OTU sequences were checked for chimeras
105
using the bellerophon approach, and none were detected as chimeric sequences. The finding of
algal virus polB that branch with only environmental sequences is not unprecedented as similar
results have been reported for a group of algal virus polB sequences from Lake Ontario (Short
and Short, 2008).
While algal viruses have been largely unexplored in Lake Erie, a previous study using water
samples from Lake Erie found several cyanomyoviruses via screening cyanobacterial isolates
and PCR of g20 genes (Wilhelm et al., 2006b). Several cyanobacterial isolates were used in that
study but only Synechococcus sp. strain WH 7803, a marine isolate, was found to be infected by
the isolated viruses. Additionally, several of the OTUs obtained from the water column study
were more closely related to marine cyanomyovirus isolates than to freshwater isolates. Even
though a different primer set was used in the previous study (CPS1/CPS8; Zhong et al., 2002),
several sequences from that study, including those related to both marine and freshwater isolates,
were closely related to sequences obtained from the sediments during the current study. The
presence of similar sequences in both the water column and the sediments suggests that
cyanomyoviruses from the water column may be deposited into the sediment of Lake Erie.
Furthermore, the majority of cyanophage-like g20 OTUs obtained from Lake Erie sediments
were closely related to environmental sequences obtained from East Lake, China (Wang et al.,
2015). The presence of freshwater and marine cyanophage OTUs, as well as the presence of
OTUs closely related to those found on multiple continents, underpins the idea that cyanophages
may have global distributions of closely related OTUs (Short and Suttle, 2005).
The clade of cyanophage-like g20 OTUs most closely related to cultivated phytoplankton viruses
are likely to infect the cyanobacterium Synechococcus, which have been found to exist in high
abundances in Lake Erie (e.g., Wilhelm et al., 2006a). While many of the closely related
cultivated OTUs are from cyanophages that infect Prochlorococcus species, reports of several
cyanomyoviruses being able to infect both Prochlorococcus and Synechococcus species
(Sullivan et al., 2003), coupled with the absence of Prochlorococcus in Lake Erie (Loar, 2009),
suggests that the natural hosts of these cyanophage-like OTUs in Lake Erie are Synechococcus
species. However, the majority of g20 OTUs obtained from Lake Erie sediment were more
closely related to sequences of environmental origin than of sequences generated from cultivated
cyanophages. These OTUs may be from currently undescribed cyanophages or, despite the
recent redesign of the CPS1.1/CPS8.1 primer set to exclude myoviruses that do not infect
106
cyanobacteria (Sullivan et al., 2008), may be amplified from myoviruses that infect other
bacteria. It is impossible to know the true hosts of these virus OTUs until the virus-host pairings
are known in culture. It is thus still a primary goal in viral ecology to isolate and characterize
viruses that infecting novel host organisms.
Phytoplankton virus gene abundance in Lake Erie sediment
In order to obtain qPCR-derived gene abundances more representative of nature, sample to
sample variability in DNA extraction efficiency must be taken into account. In this study, known
quantities of exogenous DNA (a fragment of the Suricata suricatta mitochondrial cytochrome b
gene ligated into a plasmid) were added to the sediment samples prior to DNA extraction and
were used to assess percent recovery of DNA. The main assumption of this approach is that both
exogenous and environmental DNA will be affected equally by the DNA extraction procedure
and so, the proportion of exogenous DNA lost during extraction will mirror the proportion of
environmental DNA lost. The application of this technique permits absolute quantification of
gene copies, a more ecologically relevant estimate compared to relative quantification. Species
abundances derived from gene copies per gram of sediment (either wet or dry weight) would
underestimate natural abundances if they were not corrected for variable DNA extraction
efficiencies and the resulting DNA losses.
Using qPCR with corrections for DNA extraction efficiency, the abundance of 11 different
phytoplankton virus genes were quantified in two western basin stations, 882 and 973, one
central basin station, 1326, and one eastern basin station, 452. The overall range of algal virus
gene abundance fell within the reported ranges of coccolithovirus gene abundance in western
Black Sea sediments (from below detection to over 106 gene copies per gram of total organic
carbon; Coolen, 2011), while the upper range was higher than the range of abundance of a
chlorovirus-like gene in Fayetteville Green Lake, NY sediments (~1.0 x 101 - 50 x 101 gene
copies per gram of sediment; Hewson et al., 2012).
While algal virus genes have been detected in metagenomic studies (Mohiuddin and Schellhorn,
2015) and the effect of viral lysis has been studied on eukaryotic algae in Lake Erie (Gobler et
al., 2008), algal viruses have not been quantified using qPCR or indeed, any method of
numeration, in the water column of Lake Erie and thus, the overlaying abundances of algal
viruses cannot be compared to those in the sediment. However, several studies have quantified
107
algal virus genes in nearby Lake Ontario (e.g., Short and Short, 2009; Rozon and Short, 2013;
Mirza et al., 2015), some of which included the same genes quantified in Lake Erie sediment in
this study. Overall, the most abundant algal virus in Lake Erie sediment, the putative mimivirus-
like prymnesiovirus 356-M5.14, was present at greater abundances in the sediment of station
1326 in the central basin of Lake Erie than any of the reported abundances for any viral gene in
the water column of Lake Ontario. While this comparison must be interpreted carefully due to
the differences between quantifying gene copies per mL of water and gene copies per gram of
sediment (wet weight), many of the other algal virus gene abundances in Lake Erie sediment
exceeded the range of abundances reported for the same genes in Lake Ontario water samples. It
may be that Lake Erie has higher abundances of these algal virus genes than Lake Ontario.
However, the water samples from Lake Ontario were discrete time points, while the sediment
samples were from 2 cm depth profiles that likely contained viruses sedimented throughout
entire growing seasons, or even over multiple years, thereby reflecting an accumulation of
viruses rather than viruses present at a discrete time point.
Similarly, the upper range of cyanophage gene abundances in Lake Erie sediment exceeds the
range of abundance of a cyanomyovirus gene Fayetteville Green Lake, NY sediments (~5.0 x 101
- 4.0 x 102 gene copies per gram of sediment; Hewson et al., 2012). Unlike algal viruses, total
cyanomyovirus abundances using qPCR of g20 genes have been estimated in Lake Erie
(Matteson et al., 2011). In that study of Lake Erie water column cyanomyoviruses the
CPS1/CPS2 qPCR primers, which amplify many different cyanomyoviruses g20 genes (Fuller et
al., 1998), were used so it is not surprising that most gene-specific g20 abundances were much
lower in this current study of Lake Erie sediments. In addition to the two cyanomyovirus g20
genes, two putative Microcystis aeruginosa phage sheath protein genes were quantified in Lake
Erie sediments via qPCR. The putative Microcystis aeruginosa phage sheath protein genes were
both detected at station 882, which is located at the outflow of Maumee River, the putative
starting point of many Microcystis aeruginosa blooms (e.g., Rinta-Kanto et al., 2005) and 973,
which is in the western basin and is much closer to the Maumee River than the other two
stations. One of the two putative Microcystis aeruginosa phage sheath protein genes was also
detected at stations 1326, in the central basin, and 452, in the eastern basin. The presence of
these two genes in the stations where Microcystis aeruginosa blooms are known to initiate
compliments the recent discovery of Microcystis-specific cyanophage sequences found in the
108
water column at these same stations (Steffen et al., 2015) and further suggests that these harmful
algal bloom species may be subject to top-down population control in Lake Erie.
Sediments as environmental refugia or geological record?
The presence of diverse and abundant phytoplankton viruses in Lake Erie sediments from all
three basins of the lake suggests two complementary hypotheses: sediments serve as an
environmental refugium for phytoplankton viruses, and sediments can preserve molecular signals
of phytoplankton virus infections on decadal and longer timescales. For this refugium to be
ecological important, phytoplankton viruses must be able to re-enter the water column. A
possible mechanism for the re-entry of viruses to the water column from the sediment could be
that the virus attaches to its host in the sediment. The host itself may re-enter the water column,
infection may then occur and then new virus particles may be produced. In the case of
Microcystis aeruginosa, cells are known to overwinter in benthic environments (Reynolds et al.,
1981) and up to 20 % of these benthic colonies can re-enter the water column (Xie et al., 2003)
aided by gas vesicle buoyancy. More generally, viruses attached to sediment particles may be re-
suspended into the water column upon a disturbance, such as storms, seasonal turnovers, and
human activity like dredging and motorboat activity, as has been suggested for human
enteroviruses in marine sediment (Bosch et al., 1988). While certain mechanisms may exist to
aid in the re-entry of phytoplankton to the water column from the sediment, it is certainly
possible that many of the viruses that enter sediments do not return to the water column and their
infectivity is irreversibly lost.
One of the phytoplankton viral abundance patterns found in this study was decreasing abundance
with increasing sediment depth. If it is assumed that the year-to-year production and subsequent
sedimentation of these viruses is constant, genes that decrease in abundance with sediment depth
could be used to provide a rough estimate of virus decay in sediments based on previous
estimates of sedimentation rates. For instance, the most abundant virus observed, the putative
mimivirus-like prymnesiovirus 356-M5.14, had its peak gene abundance in the surface sediments
of station 1326, and nearby sedimentation rates have been estimated at be 1.5 mm yr-1 (Kemp et
al., 1977). If this sedimentation rate is constant and compaction is minimal, then the 6 - 8 cm
depth profile at station 1326 can be estimated to be 40 to 53 years old. Using the qPCR
abundances of 356-M5.14, the sediment age estimates and the decay calculations of Noble and
109
Fuhrman (Noble and Fuhrman, 1997), the decay rate of the most abundant viral gene can be
estimated to be 4.59 % gene copies lost per year with a half-life of 15 years. It is important to
note that even if these assumptions are met in nature, this decay rate is representative of
amplifiable viral DNA persisting and not necessarily infectious particles. While this estimate and
the recovery of viable algal viruses and cyanophages from potentially decade- (Suttle, 2000a;
Lawrence et al., 2002) and century-old sediments (Hargreaves et al., 2013) hints at long-term
persistence of phytoplankton viruses in both marine and freshwater sediments, qPCR abundances
in sediments can also be useful in paleoecological studies.
As sedimentation rate data estimates place the potential ages of the deepest sediments in this
study anywhere from 12 to 53 years old, several of the abundance patterns found in this study
may point to historical abundance patterns of phytoplankton viruses in the water column. For
instance, several of the viral genes had peak abundances below the surface sediments, which
suggests that they had higher abundances several years before the present. Others showed
differences in abundance from depth profile to depth profile within the same sample site, which
may be indicative of year-to-year variations in phytoplankton virus abundances. Variations in
virus abundance may also suggest differences in host population levels. For instance, fluctuations
in coccolithophore virus and potential host populations have been observed throughout 7000
years of sediments in the Black Sea (Coolen, 2011). Additionally, Microcystis abundances using
qPCR have been estimated in Lake Erie sediment (Rinta-Kanto et al., 2009b). However, the
Microcystis phage genes quantified in this study cannot be directly compared to the previously
reported Microcystis abundances because sediment samples were collected from different cores
in a different part of the lake. The results from qPCR quantification in Lake Erie sediment
suggest that historical phytoplankton virus population dynamics may be accessed through the use
of molecular enumeration techniques.
Conclusions
In summary, this study presents a glimpse into the diversity and abundance of several types of
phytoplankton viruses in freshwater sediments. The results suggest that the sediments of Lake
Erie harbor diverse types of algal viruses and cyanophages that could re-enter the water column
and reinitiate infection of their hosts. Additionally, this study presents further evidence for the
presence of Microcystis aeruginosa phages in Lake Erie, where blooms of Microcystis
110
aeruginosa are known to occur, suggesting that these harmful algae are subject to top-down
population control via viral lysis. Finally, while the sediments may be an environmental
refugium for algal viruses and cyanophages, the qPCR abundances show patterns that may also
reflect historical abundance patterns of phytoplankton viruses in the water column.
This study provides evidence supporting the hypothesis that sediments are an important
environmental refugium for algal viruses and cyanophages, but vital questions remain about the
persistence of phytoplankton viruses in the environment. For example, future studies should
address, through the use of decay incubation experiments with cultivated algal viruses and/or
cyanophages, whether phytoplankton virus decay rates are lower in sediments than the water
column. Additionally, this and previous studies have found qPCR to be a valuable tool to
observe historical algal virus and cyanophage populations across both freshwater and marine
sediments, opening up the possibility to study the paleoecology of phytoplankton viruses with a
wide variety of hosts and in very different ecosystems.
Acknowledgements
I am very grateful to the captain, crew, and scientific staff on the CCGS Limnos. This research
was supported in part by the Canadian Foundation for Innovation Leaders Opportunity Fund and
NSERC Discovery grants awarded to S.M.S.
111
Chapter 5 General Conclusions and Future Directions
Phytoplankton Virus Survival
My research results relate directly to how algal viruses and cyanophages survive in the
environment. My thesis provides the first reports of in situ algal virus decay using infectivity in
freshwater environments. In addition, the first reports of the seasonal differences throughout the
entire year for algal virus decay rates in any system are described in my thesis. Furthermore, the
use of qPCR to estimate virus decay rates was validated, but estimates using this technique must
be cautiously interpreted. Using this method, the decay rates of viruses that were previously
intractable (i.e., viruses that infect either currently unknown hosts or hosts that cannot presently
be cultured, which represent the vast majority of viruses in nature) were estimated. Additionally,
qPCR estimated decay rates were used to further describe the seasonality of viral decay in both
cultivated viruses and environmental algal virus and cyanomyovirus populations. The seasonality
of decay was such that algal viruses have the ability to survive under or within the ice cover of
temperate freshwater ponds over the entirety of the winter season. This observation of algal virus
overwintering provides a possible mechanism for maintaining the viral ‘seed-bank.’ While
extremely low decay rates were estimated during over-wintering of cultivated algal viruses, the
higher decay rates observed in the spring and summer incubation experiments and for
cyanomyoviruses in every incubation suggest alternative mechanisms are involved in
maintaining the viral ‘seed-bank’ at these times of the year.
One mechanism that may help to sustain the viral ‘seed-bank’ in aquatic systems are
environmental refugia, such as the sediment. My thesis contains the first glimpse of the diversity
of algal viruses and cyanophages within the sediment of any aquatic environment. Additionally,
the abundance of eleven distinct algal virus and cyanophage genes in Lake Erie sediments were
estimated for the first time. The findings of diverse algal viruses and cyanophages, along with
sometimes high abundances of these viruses in sediments up to 53 years old, suggest that when
disturbed, freshwater sediments may be a source of many types of phytoplankton viruses that can
be re-introduced into the water column. What follows will provide further detail on the key
findings of my thesis, how they fit into hypothetical framework of viral persistence in freshwater
environments, and how future research directions on this topic should proceed.
112
5.1 Seasonality of Algal Virus Decay Rates
Chapter 2 addresses the specific research question, does viral decay in the water column proceed
in a way that allows for environmental persistence? In order to accomplish this, the decay rates
of three cultivated algal viruses were estimated across four seasonal incubation experiments. The
algal virus decay rates were found to be highest in spring or summer and lowest in winter.
Furthermore, all three algal virus types remained infectious after the 126 day winter incubation.
In multiple studies of algal virus abundance in freshwater systems, several of the viruses
examined have been found to occur at relatively constant numbers, representing a viral ‘seed-
bank’ (e.g., Van Etten et al., 1985b; Yamada et al., 1991; Zingone et al., 1999; Short and Short,
2009; Short et al., 2011a; Rozon and Short, 2013). The observed seasonal variations in virus
decay rates and over-wintering of cultivated algal viruses described in Chapter 2 provides one
possible mechanism likely to contribute to sustaining the viral ‘seed-bank.’
In addition to finding a mechanism that may aid in the maintenance of the viral ‘seed-bank,’
other findings in Chapter 2 show that there were clear differences in the decay rates of the two
chloroviruses and of a newly isolated algal virus which infects C. parva. Specifically, the C.
parva-infecting virus had higher decay rates than the two chloroviruses and these differences
were often statistically significant. While this needs to be further explored to find the root cause
of the differences in decay rates, it can be speculated that it may be due to differences in genetic
potential. For instance, there is precedence for specific algal virus strains possessing genes for
several DNA repair mechanisms (e.g., Redrejo-Rodríguez and Salas, 2014). Further, other algal
virus strains, sometimes even closely algal viruses within the same genus, do not possess some
of these DNA repair genes (e.g., Dunigan et al., 2006; Jeanniard et al., 2013; Redrejo-Rodríguez
and Salas, 2014). When the genome of the C. parva-infecting algal virus, CpV-BQ1, is
sequenced and annotated, it will be possible to directly assess the differences in its genetic
potential and how those differences relate to the decay of this virus in the environment.
Expression studies of algal viruses with varying decay rates may also help to find the underlying
cause of the observed decay rate differences.
Furthermore, there were decay rate differences between the two treatments. Without exception,
the whole water treatment had higher decay rates than the filtered treatment. One possible
explanation for the observed differences is that the microbial flora present in the whole water
113
produced heat-labile substances, such as nucleases and proteases, which are known to inactivate
viruses (reviewed in: Gerba, 2005).
While the methods used allowed for observations of over-wintering and the differences in decay
rates across different types of algal viruses and treatments, the limitations of these results should
be discussed. One such limitation stems from the use of polycarbonate bottles. Polycarbonate
greatly attenuated UV radiation, which is often found to be the most damaging wavelength of
light to viruses (e.g., Suttle and Chen, 1992). However, other studies estimating the decay rates
of specific viruses found the PAR range to be more damaging to the viruses than UV (e.g.:
Baudoux et al., 2012). Thus, the decay rates from this study may be underestimated in the spring
and summer incubation experiments, when the day lengths were longer and samples were
subjected to more solar radiation. However, for the winter decay incubation experiments, the
decay rates are less likely to be underestimates as the persistent ice cover and intermittent snow
pack greatly reduced the amount of solar radiation, both UV and PAR, experienced by the
viruses. Further, polycarbonate bottles are more sturdy than UV-penetrable alternates and over-
wintering may not have been observed if another vessel was used that might have been destroyed
during the 126 incubation. Another limitation is that, while the cultivated algal viruses chosen
were either isolated from nearby waters or were chosen based upon evidence of close relatives
being present within local ecosystems, the decay rates in Chapter 2 were estimated from
cultivated algal viruses, and may not necessarily have the same characteristics of the endogenous
algal virus community. This limitation was addressed in Chapter 3 through the use of qPCR of
environmental algal virus and cyanophage genotypes.
5.2 Seasonality of Phytoplankton Virus Decay Rates Estimated with Molecular Methods
Chapter 3 further addresses the specific research question first explored by Chapter 2 by
assessing the seasonality of environmental algal viruses and cyanophage decay rates with qPCR.
Before this could be accomplished, the relationship between the loss of infectivity and the loss of
gene copies estimated by qPCR had to be established. In order to achieve this, the cultivated
virus abundance estimates from infectivity assays were compared to the abundance estimates of
these same viruses using qPCR. The two measures were found to have a close relationship that
114
could be described by a second-order polynomial equation and had a strong and significant
Spearman correlation. In addition, the decay rates estimated using the two methods were
compared using ANCOVA. In the majority of cases, the decay rates estimated using infectivity
measurements were not significantly different from the decay rates of the same virus (in the
same season and treatment) estimated with qPCR. The close and significant relationship between
the loss of infectivity and the loss of gene copies, coupled with the results from the ANCOVA
comparisons, suggests that qPCR can be used as an effective proxy for infectivity assays for
estimating the decay of environmental viruses. Thus, the first key finding of Chapter 3 was that
the decay rates of uncultivated environmental phytoplankton viruses may be estimated with
qPCR. It should be noted that these qPCR derived decay rates represent minimum estimates and
might exaggerate survival, necessitating cautious interpretation. The primary limitation of this
study was therefore the likely underestimated decay rates of environmental viruses.
One of the key findings in Chapter 3 that compliments the findings of Chapter 2 was the distinct
seasonality of environmental phytoplankton virus decay rates. As seen for the cultivated algal
viruses, both the environmental algal viruses and cyanophages had their highest decay rates in
the spring and the summer and their lowest decay rates in the winter. The seasonality of decay as
estimated by both infectivity and qPCR is likely due to the seasonal differences in the causes of
viral decay, including: solar radiation, temperature, non-host cell abundance and the activity of
extracellular enzymes such as nucleases. In addition, there was a clear seasonality of treatment
effects. While whole water treatments again had higher rates of decay than the filtered treatment,
these differences were statistically different more often in spring than in any other season. For
cyanophages, decay rates were too high to estimate accurately for some whole water treatments
and yet, the filtered treatment for the same virus and season were able to be calculated. One
reason for the seasonality observed in treatment effects may be that microbial biomass has a
clear seasonality. In addition to the reasons stated above, an increased biomass in the whole
water treatment is likely to increase the adsorption of viruses to non-host cells. Viruses attached
to non-hosts would then be removed by the subsequent sample processing (0.45 μm filtration)
before qPCR.
Another key finding of Chapter 3 was that cyanomyovirus-like genotypes had much higher
decay rates than algal viruses, further complimenting the previous findings that cyanophages
often have higher decay rates than algal viruses (e.g., Cottrell and Suttle, 1995; Cheng et al.,
115
2007; Hewson et al., 2012). Previous studies exploring the decay of cyanophage PP in Donghu
Lake, China, found similarly high decay rates, but photoreactivation of this population reached
up to 59 %, mitigating the high decay rates of these cyanophages (Cheng et al., 2007). While this
was not directly tested, it is reasonable to speculate that at least some of the decay experienced
by the cyanomyovirus-like genotypes would be repaired via host-mediated photoreactivation.
Further, like the cultivated algal viruses, algal virus and cyanophage genotypes were observed
with qPCR to over-winter under, or within, the ice cover across a 126 day period. However, very
few of the initial gene copies for the cyanomyovirus (0.0077 % remained in the whole water
treatment), there was likely little to no infectivity remaining for these viruses. While the low
decay rates in the winter decay incubation experiments may propagate the viral ‘seed-bank’ for
algal viruses, other mechanisms may be needed to explain how some cyanophages could persist
in these same conditions. One such mechanism may be through the persistence of phytoplankton
viruses in environmental refugia, which was explored in Chapter 4.
5.3 Diversity and Abundance of Phytoplankton Viruses in Sediment
Chapter 4 sought to address the specific research question: does viral decay in the water column
proceed in a way that allows for environmental persistence? In order to accomplish this, PCR
primers targeting signature genes of algal viruses and cyanomyoviruses were used to assess the
diversity of phytoplankton viruses in four distinct sites in Lake Erie and across four sediment
depth profiles. Additionally, previously designed qPCR primer and probe sets were utilized to
quantify the abundance of specific algal virus and cyanophage genotypes in Lake Erie sediments.
This work is, to my knowledge, the first study that utilized phytoplankton virus signature gene
PCR primers on samples from the benthic environment of any aquatic system. While several
previous studies have found algal viruses or cyanophages in sediments using either infectivity
assays (Suttle, 2000a; Lawrence et al., 2002; Hargreaves et al., 2013) or qPCR (Coolen, 2011;
Hewson et al., 2012), the observations of diversity of algal viruses and cyanophages in Lake Erie
sediment are the first attempt at assessing the diversity of phytoplankton viruses present within
any aquatic sediment.
116
For algal viruses, the polB gene diversity observed was limited to putative prasinoviruses, a
prymnesiovirus, and three Operational Taxonomic Units (OTUs) more closely related to putative
algal virus polB gene sequences, known only from environmental sequences as opposed to
sequences from previously cultivated algal viruses. While the polB primer set used in Chapter 4
was designed to target prasinoviruses (Clerissi et al., 2014a), previous studies have suggest that
Prasinovirus-like genotypes are the dominant algal virus type in freshwater systems (e.g., Clasen
and Suttle, 2009). This is perhaps surprising for samples from Lake Erie as prasinophyte algae
have never been identified in samples from the Laurentian Great Lakes (Munawar and Munawar,
1986). However, several studies in Lake Ontario have found Prasinovirus-like genotypes to be
the dominant algal virus present and have suggested that the host for these viruses might be a
green alga related to prasinophyte algae (e.g., Short and Short, 2008; Rozon and Short, 2013).
The putative cyanomyovirus sequences in Lake Erie sediment were far more diverse than the
putative algal virus polB sequences from the same samples. While many different putative
cyanomyovirus g20 sequences were obtained, the g20 PCR primer set was designed to amplify
only genotypes that infect Prochlorococcus and Synechococcus species of cyanobacteria
(Sullivan et al., 2008). The OTUs obtained from Lake Erie sediment samples closely related to
cultivated cyanomyoviruses are more likely to infect Synechococcus cyanobacteria, which have
been found to exist at high abundances in Lake Erie (Wilhelm et al., 2006a). In addition to the
sequences closely related to cultivated cyanomyoviruses, the majority of putative cyanomyovirus
g20 sequences obtained from Lake Eire sediment samples were more closely related to
sequences only known from environmental samples. This observation is not without precedent as
many studies using samples from the water column have had similar results (e.g., Short and
Suttle, 2005; Zhong and Jacquet, 2014). While previous versions of the cyanomyovirus g20
primers have been suggested to amplify g20 genes from bacteriophages that do not infect
cyanobacteria (Short and Suttle, 2005), the redesigned CPS1.1/CPS8.1 primers amplify g20
sequences from cyanomyovirus isolates but fail to amplify the g20 sequences present in non-
cyanophage myovirus isolates (Sullivan et al., 2008). However, the possibility that the
CPS1.1/CPS8.1 PCR primer set may amplify sequences from non-cyanobacteria-infecting
myoviruses cannot be excluded and thus more data is required before the hosts can be identified.
Ascertaining the hosts for the observed cyanomyoviruses can best be accomplished by the
isolation and identification of more freshwater cyanomyoviruses and myoviruses in general.
117
Overall, the diversity of phytoplankton viruses obtained from Lake Erie sediments suggest that
freshwater sediments can harbor many different types of phytoplankton viruses including both
cyanophages and virus of eukaryotic algae.
The other key observation of Chapter 4 was that specific algal virus and cyanophage genotypes
can exist at high abundances in freshwater sediments. Algal viruses had abundances up to 2.97 x
106 gene copies per gram of wet sediment and cyanophages had abundances up to 9.42 x 104
gene copies per gram of wet sediment. These high abundances observed for several distinct algal
viruses and cyanophage genes suggest that freshwater sediment may be an important
environmental refugium for phytoplankton viruses. Furthermore, the observed changes in
abundances through the sediment depth profile may reflect historical infection events in the
water column as suggested by Coolen when estimating the abundances of coccolithoviruses in
the Black Sea in sediments up to 7000 years old (2011).
It is also important to discuss the limitations of the study in Chapter 4. The primary limitation is
that molecular evidence cannot provide concrete information on the hosts of the diverse
phytoplankton viruses observed. However, as limited phytoplankton hosts are currently available
in culture, surveys of phytoplankton virus diversity using only culture-based methods will likely
miss most of the phytoplankton viruses in the environment. Furthermore, the abundances
observed may constitute over-estimates of the ecological importance as molecular measures can
enumerate viruses that may not be infectious (as shown in Chapter 3). Nevertheless, as several
previous studies have identified infectious algal viruses and cyanophages in sediments up to 100
years old (Suttle, 2000a; Lawrence et al., 2002; Hargreaves et al., 2013), it is likely that there are
infectious viruses within the populations that were estimated using qPCR.
5.4 Potential Fates of Phytoplankton Viruses in Freshwater Environments
Using the findings in Chapters 2 - 4 that provide new insights on the persistence of algal viruses
and cyanophages in aquatic environment as a framework, it is possible to speculate on the
potential fates of phytoplankton in freshwater systems (Figure 5.1). Starting at infection,
118
Figure 5.1. Diagram of potential fates for phytoplankton viruses in aquatic environments.
119
phytoplankton viruses can either enter the lytic cycle, rapidly producing more viruses and
ultimately resulting in cell lysis, or the virus can proceed through the lysogenic cycle (or
temperate infection in algal viruses) in which the viral genome inserts into the host genome,
directly tying the fate of the virus to its host's vigor. A third viral infection pathway is
pseudolysogeny, in which the virus genome enters the host cells but does not enter either the
lytic or lysogenic cycles. It is important to note that lysogeny and pseudolysogeny are thus far
only known for cyanophages (e.g., Wilson et al., 1996; McDaniel and Paul, 2005; Long et al.,
2008) and phaeoviruses that infect macrophytic brown algae are the only known temperate algal
viruses (Bräutigam et al., 1995; Delaroque et al., 1999). Furthermore, unless the hosts have
mechanisms to resist virus production, temperate, lysogenic, and pseudolysogenic viruses will
eventually, after some environmental stimuli, enter the lytic cycle and lyse the host cell. After
cell lysis, the newly produced virions may or may not be infectious as up to 20 - 60% of algal
viruses produced are not infectious (e.g., Van Etten et al., 1983b; Cottrell and Suttle, 1995;
Bratbak et al., 1998). Infectious virions will then be subject to a number of decay inducing
mechanisms, including: solar radiation (both UV and PAR; Suttle and Chen, 1992; Baudoux et
al., 2012), high temperatures (Garza and Suttle, 1998), consumption by heterotrophic
nanoflagellates (González and Suttle, 1993), adsorption to non-host cells and detritus (Hewson
and Fuhrman, 2003), and inactivation by heat-labile substances such as nucleases (Noble and
Fuhrman, 1997). The magnitude of these mechanisms vary seasonally. As reported in Chapters 2
and 3, the decay rates of phytoplankton viruses vary seasonally as well, with high decay rates in
the summer and low decay rates in the winter.
Consider a population of phytoplankton viruses with a peak abundance in the summer. Using the
lowest decay rate observed in the summer (ATCV-1, Chapter 2), a viral population would drop
from 105 mL-1 to 6 mL-1 within 30 days. In order to counter-act this high decay rate, virus
production must either match or exceed the decay rate, or the viruses must employ additional
mechanism(s) to insure the survival of sufficient phytoplankton viruses for continued viability.
Mechanisms such as host-mediated photoreactivation for cyanophages (e.g., Cheng et al., 2007)
or DNA repair in algal viruses may aid in viral persistence (e.g., Redrejo-Rodríguez and Salas,
2014). However, based on the high estimated decay rates, the decay processes are likely to
exceed repair mechanisms in summer. It may then be necessary for phytoplankton viruses to rely
upon environmental refugia. In the case of the raphidophyte algae, Heterosigma akashiwo, viral
120
infection enhances algae sinking rates (Lawrence and Suttle, 2004), which may lead to viruses
being deposited into the sediment during times in which algae are above the threshold necessary
for viral production. As sediments have shown to decrease the decay rates of viruses (e.g.,
LaBelle and Gerba, 1980), sediments may serve as an environmental refugium for phytoplankton
viruses. In Chapter 4, many types of phytoplankton viruses were observed in Lake Erie sediment,
some of which had abundances estimated up to 106 gene copies per gram of wet sediment. Given
this, the ultimate fate of algal viruses in the summer seems likely to be destruction or
sedimentation if the population of host cells drops below the threshold for viral infection.
Virus particles may remain in the sediment for years, as evidenced by the recovery of infectious
algal viruses and cyanophages from sediments with ages as old as 100 years (e.g., Suttle, 2000a;
Lawrence et al., 2002; Hargreaves et al., 2013). Despite this, viruses are still subject to decay in
the sediment, largely from the action of proteases (Dell’Anno et al., 2015). The active
phytoplankton viruses that remain in the sediment must re-enter the water column in order to be
ecologically relevant. While sediments may be disturbed by benthic organisms throughout the
year, phytoplankton viruses that re-enter the water column during periods of lake stratification
are unlikely to return to the surface waters. During thermal stratification, which often occurs in
the summer and winter, currents are unlikely to reach the bottom waters of the pelagic zone
(hypolimnon) due to the differences in water density. However, if the sediment is in the littoral
zone, currents may still reach the benthos and viruses deposited in littoral sediment may re-enter
the water column, even in times of stratification. If re-entry occurs in the summer, the virus will
most likely decay in the water column unless its host is present.
During times of stratification, a possible mechanism to return to the upper layers of the water
from pelagic sediment may lay in the vertical migration of host cells, which can occur for algae
that alter their buoyancy or actively swim. Additionally, zooplankton that feed on phytoplankton
and migrate throughout the water column may aid in the transport of viruses from deeper waters
to the surface where hosts are most abundant. Recent studies in marine environments have
reported that 80 % of copepods in the North Atlantic contained traces of algal virus DNA (Frada
and Vardi, 2015) and that decay rates of algal viruses are lower in the gut of large zooplankton
than they are in free water (Frada et al., 2014). This finding suggests that zooplankton may act as
transmission vectors for phytoplankton viruses in aquatic systems.
121
In the autumn of dimictic lakes, the water column has a relatively constant temperature from top
to bottom. This constant temperature allows wind to mix the entirety of the water column.
During such times, the diverse and abundant community of phytoplankton viruses found in the
sediments in Chapter 4 may be constantly replenished from the sediments into the water column.
If the host abundance is above the threshold needed for virus production, the individual virus
population that infects this abundant host may increase, however, if the host is below this
threshold, virus concentration will decay. During times of mixing, the viruses may only be
subjected to the peak decay forces of the surface waters for only part of the day, which may
decrease the decay of phytoplankton viruses in a fully mixed aquatic environment. However, the
highest decay rates in autumn reported in either Chapter 2 or 3 (CpV-BQ1 in whole water) had
an equivalent half-life as the lowest decay rate in summer and thus a population of 105 viruses
mL-1 may still drop to 6 viruses mL-1 in 30 days. This suggests that the least stable viruses in
autumn still rely upon high abundances or other mechanisms of persistence such as
sedimentation and subsequent re-entry into the water column via the previous described
mechanisms. However, viruses with lower decay rates in the autumn, such as ACTV-1 (Chapters
2 and 3) or F2MCP1 (Chapter 3), have half-lives between 3 and 7 days, which means a starting
population of 105 viruses mL-1 is reduced to 6 viruses mL-1 in 42 to 98 days. While viruses are
likely to survive longer in the water column in autumn, it is still reasonable to speculate that the
other mechanisms of survival discussed above are important during this season.
As the temperature cools and winter begins, lakes will once again stratify. As mentioned above,
this makes re-entry from the sediment less likely. However, if the water column develops ice
cover, the decay rates of phytoplankton viruses can be reduced dramatically, as seen in Chapters
2 and 3. The survival of both cultivated and uncultivated phytoplankton viruses over a 126 day
period (Chapters 2 and 3), suggest that algal viruses in general may be able to persist in the
winter, even if the abundances of their hosts are below the threshold necessary for virus
production. For instance, even the highest algal virus decay rate in the winter (CpV-BQ1 in
Chapter 2), has a half-life of 16 days. This half-life would the delay drop from 105 viruses mL-1
to 6 viruses mL-1 until 224 days had passed. As such, algal viruses that are abundant in winter are
likely to survive at least until the ice thaws. However, cyanophage may require further
environmental refugia during this same time. For the cyanophage decay rate estimated in the
winter whole water treatment (Chapter 3), the half-life is 10 days, meaning 105 viruses mL-1
122
would be reduced to 6 viruses mL-1 after 140 days. As the ice cover only lasted for 126 days and
that this rate is a likely underestimate as it was estimated with qPCR, only highly abundant
cyanophages would be able to persist in the water column. As such, cyanophages are likely to
rely upon other environmental refugia unless their hosts are present.
During spring in a dimictic lake, the water temperature of the water column will eventually
become relatively constant and mixing will occur. As in the autumn, the act of mixing may
protect the viruses by limiting the time at the surface and may recharge aqueous virus
populations from those that were in the sediment. However, decay rates were estimated to be
high in the spring, with the lowest decay rates (LO.20May09.33, Chapter 3) equating to half-
lives on the order of 3 to 4 days. Again, these half-lives would reduce a population of 105 viruses
mL-1 to 6 viruses mL-1 after 42 to 56 days. Further, as stated above, this qPCR-derived estimate
of decay is likely an underestimate. As such, spring virus populations are likely to be reliant
upon viral production and the re-entry of viruses from the sediment if the environment is
completely mixed.
Given this framework, it seems reasonable that phytoplankton viruses persist throughout the year
in freshwater ecosystems. The mechanisms in which viruses rely upon to persist vary seasonally.
During times in which their hosts are present, the most likely mechanism is continual production
of viruses that either equals or overcomes decay rates. However, once host populations drop
below the threshold for viral production, phytoplankton viruses are likely to either have infected
their host lysogenically/temperately, sedimented into the benthos, or are subject to decay forces.
During such times, one likely source of new viruses that maintained populations in the water
column is the sediment. The only time of the year in which survival of phytoplankton viruses in
the water column is likely sufficient to maintain virus populations is during the winter, under the
ice. Despite this, as reported in Chapter 3, cyanophages are not as likely to persist in the water
column in the winter without some source of exogenous viruses, which, if the ice covers the
entire environment, can only be the sediment. Even with this framework, many questions remain
on the persistence of phytoplankton viruses in aquatic environments.
123
5.5 Future Directions
Even though the key findings of Chapters 2 and 3 indicate that algal viruses are likely to survive
during the winter in temperate freshwater environments with seasonal ice cover and the results
reported in Chapter 4 found that the sediments of freshwater environments can contain diverse
and abundant phytoplankton viruses, several questions remain about the persistence of algal
viruses and cyanophages in freshwater environments. For instance, the effect of UV radiation on
algal viruses in the environment has yet to be fully explored, as was done for cyanophages
infecting Synechococcus in the Gulf of Mexico (Garza and Suttle, 1998). While long-term
incubations may not be feasible due to the nature of the required UV-permeable experimental
vessels, short-term decay incubation experiments incorporating reaction vessels composed of
materials that pass specific wavelengths, such as polycarbonate and polyethylene, could be
undertaken and the decay rate estimates between vessel type could be compared. These short-
term incubation experiments may allow the major wavelengths causing algal virus decay to be
deduced. Furthermore, while it seems intuitive that deeper depths with lower temperatures and
greater light attenuation would be protective, the effect of depth in the water column on the
decay rates of freshwater algal viruses has not been fully explored.
In addition, as the use of qPCR to estimate decay rates was validated (Chapter 3), the decay rates
of many more virus types in different aquatic environments may be explored, providing vital
information regarding the persistence of viruses in the environment. One of the limitations of
Chapter 3 was that decay rates were estimated for only a few, five total, environmental
phytoplankton virus genes. While time zero samples without added algal viruses for all five
incubations may have provided more potential targets for qPCR assays, the one incubation that
clone libraries could be made had algal virus communities that were not very diverse. To obtain
a more diverse set of sequences, several methods could be undertaken. First, metagenomic
sequencing of environmental samples could provide targets for qPCR assays, as used by Hewson
and colleagues (2012). Second, deep-amplicon sequencing may also provide more targets for
qPCR, which may necessitate the development of new primers for high-throughput sequencing
as the only currently available algal virus primers for this are purposefully biased to amplify
Prasinovirus sequences (Clerissi et al., 2014a). Finally, as cyanophages appear to be more
diverse in the tested environments, the relationship between the loss of infectivity and the loss of
amplifiable DNA should be established for these virus types.
124
For phytoplankton viruses found in the sediment of freshwater systems, further studies should be
undertaken to confirm their viability, and thus further confirm the findings that sediments can act
as a refugium for diverse and abundant algal viruses and cyanophages. Additionally, even though
studies have found that sediments can enhance the survival of some viruses (e.g., LaBelle and
Gerba, 1980), the decay rates of algal viruses and cyanophages, using either infectivity assays,
qPCR, or both, in the sediment should be explored and compared to the decay rates of these
same viruses in the water column. Furthermore, as viruses in the sediment require some
disturbance in order to re-enter the water column, possible mechanisms for dispersal of
phytoplankton viruses should be examined, a research topic that has been explored very sparsely
to date. Research on these matters will allow for a more thorough understanding of the
mechanisms that allow for the maintenance of the viral ‘seed-bank’ in aquatic systems.
125
References
Ackermann H-W, DuBow MS. (1987). Viruses of Prokaryotes: General properties of
bacteriophages. CRC Press: Boca Raton, FL.
Agarkova I, Hertel B, Zhang X, Lane L, Tchourbanov A, Dunigan DD, et al. (2014). Dynamic
attachment of Chlorovirus PBCV-1 to Chlorella variabilis. Virology 466: 95–102.
Andersen RA, Berges JA, Harrison PJ, Watanabe MM. (2005). Recipes for Freshwater and
Seawater Media. In: Algal Culturing Techniques. Elsevier, pp 429–538.
Baker AC, Goddard VJ, Davy J, Schroeder DC, Adams DG, Wilson WH. (2006). Identification
of a diagnostic marker to detect freshwater cyanophages of filamentous cyanobacteria. Appl
Environ Microbiol 72: 5713–5719.
Barsanti L, Gualtieri P. (2006). Algae: Anatomy, Biochemistry, and Biotechnology, Second
Edition. CRC Press: Boca Raton, FL.
Baudoux A, Noordeloos A, Veldhuis M, Brussaard C. (2006). Virally induced mortality of
Phaeocystis globosa during two spring blooms in temperate coastal waters. Aquat Microb Ecol
44: 207–217.
Baudoux A-C, Hendrix RW, Lander GC, Bailly X, Podell S, Paillard C, et al. (2012). Genomic
and functional analysis of Vibrio phage SIO-2 reveals novel insights into ecology and evolution
of marine siphoviruses. Environ Microbiol 14: 2071–2086.
Bellec L, Grimsley N, Derelle E, Moreau H, Desdevises Y. (2010). Abundance, spatial
distribution and genetic diversity of Ostreococcus tauri viruses in two different environments.
Environ Microbiol Rep 2: 313–321.
Bergh O, Borsheim K, Bratbak G, Heldal M. (1989). High abundance of viruses found in aquatic
environments. Nature 340: 467–468.
Bertilsson S, Burgin A, Carey CC, Fey SB, Grossart H-P, Grubisic LM, et al. (2013). The under-
ice microbiome of seasonally frozen lakes. Limnol Oceanogr 58: 1998–2012.
Bettarel Y, Sime-Ngando T, Amblard C, Dolan J. (2004). Viral activity in two contrasting lake
ecosystems. Appl Environ Microbiol 70: 2941–2951.
Borrell G, Colombet J, Robin A, Lehours A, Prangishvili D, Sime-Ngando T. (2012).
Unexpected and novel putative viruses in the sediments of a deep-dark permanently anoxic
freshwater habitat. ISME J 6: 2119–2127.
Bosch A, Lucena F, Girones R, Jofre J. (1988). Occurrence of enteroviruses in marine sediment
along the coast of Barcelona, Spain. Can J Microbiol 34: 921–924.
Bragg JG, Chisholm SW. (2008). Modeling the fitness consequences of a cyanophage-encoded
photosynthesis gene. PLOS ONE 3: e3550.
126
Bratbak G, Egge J, Heldal M. (1993). Viral mortality of the marine alga Emiliania huxleyi
(Haptophyceae) and termination of algal blooms. Mar Ecol Prog Ser 93: 39–48.
Bratbak G, Jacobsen A, Heldal M, Nagasaki K, Thingstad F. (1998). Virus production in
Phaeocystis pouchetii and its relation to host cell growth and nutrition. Aquat Microb Ecol 16: 1–
9.
Bräutigam M, Klein M, Knippers R, Müller DG. (1995). Inheritance and meiotic elimination of a
virus genome in the host Ectocarpus szlzculosus (Phaeophyceae). J Phycol 31: 823–827.
Breitbart M. (2012). Marine viruses: Truth or dare. Annu Rev Mar Sci 4: 425–448.
Breitbart M, Felts B, Kelley S, Mahaffy J, Nulton J, Salamon P, et al. (2004). Diversity and
population structure of a near-shore marine-sediment viral community. Proc Lond Sci 271: 565–
574.
Breitbart M, Rohwer F. (2005). Here a virus, there a virus, everywhere the same virus? Trends
Microbiol 13: 278–284.
Breitbart M, Salamon P, Andresen B, Mahaffy JM, Segall AM, Mead D, et al. (2002). Genomic
analysis of uncultured marine viral communities. Proc Natl Acad Sci U S A 99: 14250–14255.
Brussaard CPD. (2004). Viral control of phytoplankton populations - a review. J Eukaryot
Microbiol 51: 125–138.
Brussaard CPD, Kuipers B, Veldhuis MJW. (2005). A mesocosm study of Phaeocystis globosa
population dynamics: I. Regulatory role of viruses in bloom control. Harmful Algae 4: 859–874.
Brussaard CPD, Noordeloos A a. M, Sandaa R-A, Heldal M, Bratbak G. (2004). Discovery of a
dsRNA virus infecting the marine photosynthetic protist Micromonas pusilla. Virology 319:
280–291.
Castberg T, Larsen A, Sandaa RA, Brussaard CPD, Egge JK, Heldal M, et al. (2001). Microbial
population dynamics and diversity during a bloom of the marine coccolithophorid Emiliania
huxleyi (Haptophyta). Mar Ecol Prog Ser 221: 39–46.
Chen F, Suttle CA. (1995). Amplification of DNA polymerase gene fragments from viruses
infecting microalgae. Appl Environ Microbiol 61: 1274–1278.
Chen F, Suttle CA, Short SM. (1996). Genetic diversity in marine algal virus communities as
revealed by sequence analysis of DNA polymerase genes. Appl Environ Microbiol 62: 2869–
2874.
Chen F, Wang K, Huang S, Cai H, Zhao M, Jiao N, et al. (2009). Diverse and dynamic
populations of cyanobacterial podoviruses in the Chesapeake Bay unveiled through DNA
polymerase gene sequences. Environ Microbiol 11: 2884–2892.
Chénard C, Suttle CA. (2008). Phylogenetic diversity of sequences of cyanophage
photosynthetic gene psbA in marine and freshwaters. Appl Environ Microbiol 74: 5317–5324.
127
Cheng K, Zhao Y, Du X, Zhang Y, Lan S, Zhengli S. (2007). Solar radiation-driven decay of
cyanophage infectivity, and photoreactivation of the cyanophage by host cyanobacteria. Aquat
Microb Ecol 48: 13–18.
Clasen JL, Suttle CA. (2009). Identification of freshwater Phycodnaviridae and their potential
phytoplankton hosts, using DNA pol sequence fragments and a genetic-distance analysis. Appl
Environ Microbiol 75: 991–997.
Clerissi C, Desdevises Y, Romac S, Audic S, de Vargas C, Acinas SG, et al. (2015). Deep
sequencing of amplified Prasinovirus and host green algal genes from an Indian Ocean transect
reveals interacting trophic dependencies and new genotypes. Environ Microbiol Rep 7: 979–989.
Clerissi C, Grimsley N, Ogata H, Hingamp P, Poulain J, Desdevises Y. (2014a). Unveiling of the
diversity of prasinoviruses (Phycodnaviridae) in marine samples by using high-throughput
sequencing analyses of PCR-amplified DNA polymerase and major capsid protein genes. Appl
Environ Microbiol 80: 3150–3160.
Clerissi C, Grimsley N, Subirana L, Maria E, Oriol L, Ogata H, et al. (2014b). Prasinovirus
distribution in the Northwest Mediterranean Sea is affected by the environment and particularly
by phosphate availability. Virology 466–467: 146–157.
Coolen M. (2011). 7000 years of Emiliania huxleyi viruses in the Black Sea. Science 333: 451–
452.
Cottrell MT, Suttle CA. (1995). Dynamics of lytic virus infecting the photosynthetic marine
picoflagellate Micromonas pusilla. Limnol Oceanogr 40: 730–739.
De Flora S, De Renzi GP, Badolati G. (1975). Detection of animal viruses in coastal seawater
and sediments. Appl Microbiol 30: 472–475.
De Paepe M, Taddei F. (2006). Viruses’ life history: Towards a mechanistic basis of a trade-off
between survival and reproduction among phages. PLOS Biol 4: e193.
Delaroque N, Maier I, Knippers R, Müller DG. (1999). Persistent virus integration into the
genome of its algal host, Ectocarpus siliculosus (Phaeophyceae). J Gen Virol 80 ( Pt 6): 1367–
1370.
Dell’Anno A, Corinaldesi C, Danovaro R. (2015). Virus decomposition provides an important
contribution to benthic deep-sea ecosystem functioning. Proc Natl Acad Sci U S A 112: E2014–
E2019.
Deng L, Hayes PK. (2008). Evidence for cyanophages active against bloom-forming freshwater
cyanobacteria. Freshw Biol 53: 1240–1252.
Dorigo U, Jacquet S, Humbert J-F. (2004). Cyanophage diversity, inferred from g20 gene
analyses, in the largest natural lake in France, Lake Bourget. Appl Environ Microbiol 70: 1017–
1022.
128
Dunigan DD, Fitzgerald LA, Van Etten JL. (2006). Phycodnaviruses: a peek at genetic diversity.
Virus Res 117: 119–132.
Farnell-Jackson EA, Ward AK. (2003). Seasonal patterns of viruses, bacteria and dissolved
organic carbon in a riverine wetland. Freshw Biol 48: 841–851.
Filippini M, Middelboe M. (2007). Viral abundance and genome size distribution in the sediment
and water column of marine and freshwater ecosystems. FEMS Microbiol Ecol 60: 397–410.
Fitzgerald LA, Graves MV, Li X, Hartigan J, Pfitzner AJP, Hoffart E, et al. (2007). Sequence
and annotation of the 288-kb ATCV-1 virus that infects an endosymbiotic Chlorella strain of the
heliozoon Acanthocystis turfacea. Virology 362: 350–361.
Foreman CM, Dieser M, Greenwood M, Cory RM, Laybourn-Parry J, Lisle JT, et al. (2011).
When a habitat freezes solid: microorganisms over-winter within the ice column of a coastal
Antarctic lake. FEMS Microbiol Ecol 76: 401–412.
Frada MJ, Schatz D, Farstey V, Ossolinski JE, Sabanay H, Ben-Dor S, et al. (2014).
Zooplankton may serve as transmission vectors for viruses infecting algal blooms in the ocean.
Curr Biol 24: 2592–2597.
Frada MJ, Vardi A. (2015). Algal viruses hitchhiking on zooplankton across phytoplankton
blooms. Commun Integr Biol 8. e-pub ahead of print, doi: 10.1080/19420889.2015.1029210.
Franche C. (1987). Isolation and characterization of a temperate cyanophage for a tropical
Anabaena strain. Arch Microbiol 148: 172–177.
Frederickson CM, Short SM, Suttle CA. (2003). The physical environment affects cyanophage
communities in British Columbia inlets. Microb Ecol 46: 348–357.
Fuhrman JA. (1999). Marine viruses and their biogeochemical and ecological effects. Nature
399: 541–548.
Fuller NJ, Wilson WH, Joint IR, Mann NH. (1998). Occurrence of a sequence in marine
cyanophages similar to that of T4 g20 and its application to PCR-based detection and
quantification techniques. Appl Environ Microbiol 64: 2051–2060.
Furuta M, Schrader JO, Schrader HS, Kokjohn TA, Nyaga S, McCullough AK, et al. (1997).
Chlorella virus PBCV-1 encodes a homolog of the bacteriophage T4 UV damage repair gene
denV. Appl Environ Microbiol 63: 1551–1556.
Garza DR, Suttle CA. (1998). The effect of cyanophages on the mortality of Synechococcus spp.
and selection for UV resistant viral communities. Microb Ecol 36: 281–292.
Gerba CP. (2005). Survival of Viruses in the Marine Environment. In: Belkin S, Colwell RR
(eds). Oceans and Health: Pathogens in the Marine Environment. Springer US, pp 133–142.
Gersberg R, Lyon S, Brenner R, Elkins B. (1987). Fate of viruses in artificial wetlands. Appl
Environ Microbiol 53: 731–736.
129
Gimenes MV, Zanotto PM de A, Suttle CA, da Cunha HB, Mehnert DU. (2012). Phylodynamics
and movement of phycodnaviruses among aquatic environments. ISME J 6: 237–247.
Gobler CJ, Anderson OR, Gastrich MD, Wilhelm SW. (2007). Ecological aspects of viral
infection and lysis in the harmful brown tide alga Aureococcus anophagefferens. Aquat Microb
Ecol 47: 25–36.
Gobler CJ, Davis TW, Deonarine SN, Saxton MA, Lavrentyev PJ, Jochem FJ, et al. (2008).
Grazing and virus-induced mortality of microbial populations before and during the onset of
annual hypoxia in Lake Erie. Aquat Microb Ecol 51: 117–128.
González J, Suttle C. (1993). Grazing by marine nanofiagellates on viruses and virus-sized
particles: ingestion and digestion. Mar Ecol Prog Ser 94: 1–10.
Goyer C, Dandie C. (2012). Quantification of microorganisms targeting conserved genes in
complex environmental samples using qPCR. In: Filion M (ed). Quantitative Real-time PCR in
Applied Microbiology. Caister Academic Press, pp 87–106.
Haaber J, Middelboe M. (2009). Viral lysis of Phaeocystis pouchetii: implications for algal
population dynamics and heterotrophic C, N and P cycling. ISME J 3: 430–441.
Hargreaves KR, Anderson NJ, Clokie MRJ. (2013). Recovery of viable cyanophages from the
sediments of a eutrophic lake at decadal timescales. FEMS Microbiol Ecol 83: 450–456.
Harke MJ, Steffen MM, Gobler CJ, Otten TG, Wilhelm SW, Wood SA, et al. (2016). A review
of the global ecology, genomics, and biogeography of the toxic cyanobacterium, Microcystis spp.
Harmful Algae 54: 4–20.
Heldal M, Bratbak G. (1991). Production and decay of viruses in aquatic environments. Mar
Ecol Prog Ser 72: 205–212.
Hellweger FL. (2009). Carrying photosynthesis genes increases ecological fitness of cyanophage
in silico. Environ Microbiol 11: 1386–1394.
Helton R, Wommack K. (2009). Seasonal dynamics and metagenomic characterization of
estuarine viriobenthos assemblages by randomly amplified polymorphic DNA PCR. Appl Env
Microbiol 75: 2259–2265.
Hewson I, Barbosa JG, Brown JM, Donelan RP, Eaglesham JB, Eggleston EM, et al. (2012).
Temporal dynamics and decay of putatively allochthonous and autochthonous viral genotypes in
contrasting freshwater lakes. Appl Environ Microbiol 78: 6583–6591.
Hewson I, Fuhrman JA. (2003). Viriobenthos production and virioplankton sorptive scavenging
by suspended sediment particles in coastal and pelagic waters. Microb Ecol 46: 337–347.
Hewson I, Neil J, Fuhrman J, Dennison W. (2001). Virus-like particle distribution and
abundance in sediments and overlying waters along eutrophication gradients in two subtropical
estuaries. Limnol Ocean 46: 1734–1746.
130
Hofer JS, Sommaruga R. (2001). Seasonal dynamics of viruses in an alpine lake: importance of
filamentous forms. Aquat Microb Ecol 26: 1–11.
Hu N-T, Thiel T, Giddings TH, Wolk CP. (1981). New Anabaena and Nostoc cyanophages from
sewage settling ponds. Virology 114: 236–246.
Huang S, Wilhelm SW, Jiao N, Chen F. (2010). Ubiquitous cyanobacterial podoviruses in the
global oceans unveiled through viral DNA polymerase gene sequences. ISME J 4: 1243–1251.
Jacquet S, Bratbak G. (2003). Effects of ultraviolet radiation on marine virus-phytoplankton
interactions. FEMS Microbiol Ecol 44: 279–289.
Jacquet S, Heldal M, IglesiasRodriguez D, Larsen A, Wilson W, Bratbak G. (2002). Flow
cytometric analysis of an Emiliana huxleyi bloom terminated by viral infection. Aquat Microb
Ecol 27: 111–124.
Jameson E, Mann NH, Joint I, Sambles C, Mühling M. (2011). The diversity of cyanomyovirus
populations along a North–South Atlantic Ocean transect. ISME J 5: 1713–1721.
Jarvis B, Wilrich C, Wilrich P-T. (2010). Reconsideration of the derivation of Most Probable
Numbers, their standard deviations, confidence bounds and rarity values. J Appl Microbiol 109:
1660–1667.
Jeanniard A, Dunigan DD, Gurnon JR, Agarkova IV, Kang M, Vitek J, et al. (2013). Towards
defining the chloroviruses: a genomic journey through a genus of large DNA viruses. BMC
Genomics 14: 158.
Jenkins CA, Hayes PK. (2006). Diversity of cyanophages infecting the heterocystous
filamentous cyanobacterium Nodularia isolated from the brackish Baltic Sea. J Mar Biol Assoc
U K 86: 529–536.
Johannessen TV, Bratbak G, Larsen A, Ogata H, Egge ES, Edvardsen B, et al. (2015).
Characterisation of three novel giant viruses reveals huge diversity among viruses infecting
Prymnesiales (Haptophyta). Virology 476: 180–188.
Kang M, Dunigan DD, VAN Etten JL. (2005). Chlorovirus: a genus of Phycodnaviridae that
infects certain chlorella-like green algae. Mol Plant Pathol 6: 213–224.
Kemp ALW, MacInnis GA, Harper NS. (1977). Sedimentation rates and a revised sediment
budget for Lake Erie. J Gt Lakes Res 3: 221–233.
Khudyakov IY, Gromov BV. (1973). Temperate cyanophage A-4(L) of the blue-green alga
Anabaena variabilis. Mikrobiologiia. 42:904-907.
Kimura K, Tomaru Y. (2015). Discovery of two novel viruses expands the diversity of single-
stranded DNA and single-stranded RNA viruses infecting a cosmopolitan marine diatom. Appl
Environ Microbiol 81: 1120–1131.
131
Kimura S, Sako Y, Yoshida T. (2013). Rapid gene diversification of Microcystis cyanophages
revealed by long- and short-term genetic analysis of the tail sheath gene in a natural pond. Appl
Environ Microbiol AEM.03751-12.
Kimura-Sakai S, Sako Y, Yoshida T. (2015). Development of a real-time PCR assay for the
quantification of Ma-LMM01-type Microcystis cyanophages in a natural pond. Lett Appl
Microbiol 60: 400–408.
Kobs G. (1997). Cloning blunt-end DNA fragments into the pGem-T Vector systems. Promega
Notes Magazine.
LaBelle RL, Gerba CP. (1980). Influence of estuarine sediment on virus survival under field
conditions. Appl Environ Microbiol 39: 749–755.
Larsen JB, Larsen A, Bratbak G, Sandaa R-A. (2008). Phylogenetic analysis of members of the
Phycodnaviridae virus family, using amplified fragments of the major capsid protein gene. Appl
Environ Microbiol 74: 3048–3057.
Lawrence J, Suttle C. (2004). Effect of viral infection on sinking rates of Heterosigma akashiwo
and its implications for bloom termination. Aquat Microb Ecol 37: 1–7.
Lawrence JE, Chan AM, Suttle CA. (2002). Viruses causing lysis of the toxic bloom-forming
alga Heterosigma akashiwo (Raphidophyceae) are widespread in coastal sediments of British
Columbia, Canada. Limnol Oceanogr 47: 545–550.
Legendre M, Bartoli J, Shmakova L, Jeudy S, Labadie K, Adrait A, et al. (2014). Thirty-
thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus
morphology. Proc Natl Acad Sci U S A 111: 4274–4279.
Liu W, Cheng K, Zhao Y, Wu Y, Cai C, Shaoyong L, et al. (2011). Cyanophage decay and its
causes in eutrophic freshwater. Food Agric Environ 9: 963–966.
Lo S, Gilbert J, Hetrick F. (1976). Stability of human enteroviruses in estuarine and marine
waters. Appl Environ Microbiol 32: 245–249.
Loar S. (2009). Seasonal variation in Lake Erie picoplankton. Master's Thesis. University of
Tennessee-Knoxville. 2009. http://trace.tennessee.edu/utk_gradthes/48
Long A, McDaniel LD, Mobberley J, Paul JH. (2008). Comparison of lysogeny (prophage
induction) in heterotrophic bacterial and Synechococcus populations in the Gulf of Mexico and
Mississippi river plume. ISME J 2: 132–144.
Long AM, Short SM. (2016). Seasonal determinations of algal virus decay rates reveal
overwintering in a temperate freshwater pond. ISME J 10: 1602–1612.
López-Bueno A, Tamames J, Velázquez D, Moya A, Quesada A, Alcamí A. (2009). High
diversity of the viral community from an Antarctic lake. Science 326: 858–861.
132
Manage PM, Kawabata Z ’ichiro, Nakano S. (1999). Seasonal changes in densities of
cyanophage infectious to Microcystis aeruginosa in a hypereutrophic pond. Hydrobiologia 411:
211–216.
Mann NH. (2003). Phages of the marine cyanobacterial picophytoplankton. FEMS Microbiol Rev
27: 17–34.
Maranger R, Bird DF. (1996). High concentrations of viruses in the sediments of Lac Gilbert,
Québec. Microb Ecol 31: 141–151.
Marston MF, Sallee JL. (2003). Genetic diversity and temporal variation in the cyanophage
community infecting marine Synechococcus species in Rhode Island’s coastal waters. Appl
Environ Microbiol 69: 4639–4647.
Massana R, Del Campo J, Dinter C, Sommaruga R. (2007). Crash of a population of the marine
heterotrophic flagellate Cafeteria roenbergensis by viral infection. Environ Microbiol 9: 2660–
2669.
Masuda R, Yoshida MC, Shinyashiki F, Bando G. (1994). Molecular phylogenetic status of the
iriomote cat Felis iriomotensis, inferred from mitochondrial DNA sequence analysis. Zoolog Sci
11: 597–604.
Mathias C, Kirschner A, Velimirov B. (1995). Seasonal-variations of virus abundance and viral
control of the bacterial production in a backwater system of the Danube River. Appl Environ
Microbiol 61: 3734–3740.
Matteson AR, Loar SN, Bourbonniere RA, Wilhelm SW. (2011). Molecular enumeration of an
ecologically important cyanophage in a Laurentian Great Lake. Appl Environ Microbiol 77:
6772–6779.
Matteson AR, Loar SN, Pickmere S, DeBruyn JM, Ellwood MJ, Boyd PW, et al. (2012).
Production of viruses during a spring phytoplankton bloom in the South Pacific Ocean near of
New Zealand. FEMS Microbiol Ecol 79: 709–719.
McDaniel L, Paul JH. (2005). Effect of nutrient addition and environmental factors on prophage
induction in natural populations of marine Synechococcus species. Appl Environ Microbiol 71:
842–850.
McDaniel LD. (2011). Viruses of Cyanobacteria. In: Hurst CJ (ed). Studies in Viral Ecology.
John Wiley & Sons, Inc., pp 169–187.
Michalak AM, Anderson EJ, Beletsky D, Boland S, Bosch NS, Bridgeman TB, et al. (2013).
Record-setting algal bloom in Lake Erie caused by agricultural and meteorological trends
consistent with expected future conditions. Proc Natl Acad Sci U S A 110: 6448–6452.
Middelboe M, Riemann L, Steward GF, Hansen V, Nybroe O. (2003). Virus-induced transfer of
organic carbon between marine bacteria in a model community. Aquat Microb Ecol 33: 1–10.
133
Mirza SF, Staniewski MA, Short CM, Long AM, Chaban YV, Short SM. (2015). Isolation and
characterization of a virus infecting the freshwater algae Chrysochromulina parva. Virology 486:
105–115.
Mohiuddin M, Schellhorn HE. (2015). Spatial and temporal dynamics of virus occurrence in two
freshwater lakes captured through metagenomic analysis. Front Microbiol 6. e-pub ahead of
print, doi: 10.3389/fmicb.2015.00960.
Moniruzzaman M, LeCleir GR, Brown CM, Gobler CJ, Bidle KD, Wilson WH, et al. (2014).
Genome of brown tide virus (AaV), the little giant of the Megaviridae, elucidates NCLDV
genome expansion and host–virus coevolution. Virology 466–467: 60–70.
Müller DG, Sengco M, Wolf S, Bräutigam M, Schmid CE, Kapp M, et al. (1996). Comparison of
two DNA viruses infecting the marine brown algae Ectocarpus siliculosus and E. fasciculatus. J
Gen Virol 77: 2329–2333.
Munawar M, Munawar IF. (1982). Phycological studies in lakes Ontario, Erie, Huron, and
Superior. Can J Bot 60: 1837–1858.
Munawar M, Munawar IF. (1986). The seasonality of phytoplankton in the North American
Great Lakes, a comparative synthesis. Hydrobiologia 138: 85–115.
Muradov M, Cherkasova G, Akhmedova D, Kamilova F, Mukhamedov R, Abdukarimov A, et
al. (1990). Comparative study of NP-1T cyanophages, which lysogenize nitrogen-fixing bacteria
of the genera Nostoc and Plectonema. Microbiology 59: 558–563.
Nagasaki K, Bratbak G. (2010). Isolation of viruses infecting photosynthetic and
nonphotosynthetic protists. In: Wilhelm SW, Weinbauer MG, Suttle CA (eds). Manual of
Aquatic Viral Ecology. ASLO, pp 92–101.
Nagasaki K, Tomaru Y, Nakanishi K, Hata N, Katanozaka N, Yamaguchi M. (2004). Dynamics
of Heterocapsa circularisquama (Dinophyceae) and its viruses in Ago Bay, Japan. Aquat Microb
Ecol 34: 219–226.
Nagasaki K, Tomaru Y, Takao Y, Nishida K, Shirai Y, Suzuki H, et al. (2005). Previously
unknown virus infects marine diatom. Appl Environ Microbiol 71: 3528–3535.
Nakamura G, Kimura S, Sako Y, Yoshida T. (2014). Genetic diversity of Microcystis
cyanophages in two different freshwater environments. Arch Microbiol 196: 401–409.
Ng TFF, Chen L-F, Zhou Y, Shapiro B, Stiller M, Heintzman PD, et al. (2014). Preservation of
viral genomes in 700-y-old caribou feces from a subarctic ice patch. Proc Natl Acad Sci U S A
111: 16842–16847.
Noble RT, Fuhrman JA. (1997). Virus decay and its causes in coastal waters. Appl Environ
Microbiol 63: 77–83.
Padan E, Shilo M. (1969). Distribution of cyanophages in natural habitats. Verhandlungen Int
Vereingung Theor Angew Limnol 17: 747–751.
134
Park Y, Lee K, Lee YS, Kim SW, Choi T-J. (2011). Detection of diverse marine algal viruses in
the South Sea regions of Korea by PCR amplification of the DNA polymerase and major capsid
protein genes. Virus Res 159: 43–50.
Paul JH, Rose JB, Jiang SC, Kellogg CA, Dickson L. (1993). Distribution of viral abundance in
the reef environment of Key Largo, Florida. Appl Environ Microbiol 59: 718–724.
Perovich D, Cota G, Maykut G, Grenfell T. (1993). Biooptical observations of 1st-Year arctic
sea-ice. Geophys Res Lett 20: 1059–1062.
Proctor LM, Fuhrman JA. (1990). Viral mortality of marine bacteria and cyanobacteria. Nature
343: 60–62.
Quispe CF, Sonderman O, Seng A, Rasmussen B, Weber G, Mueller C, et al. (2016). Three-year
survey of abundance, prevalence and genetic diversity of Chlorovirus populations in a small
urban lake. Arch Virol 161: 1839–1847.
Rao VC, Seidel KM, Goyal SM, Metcalf TG, Melnick JL. (1984). Isolation of enteroviruses
from water, suspended solids, and sediments from Galveston Bay: survival of poliovirus and
rotavirus adsorbed to sediments. Appl Environ Microbiol 48: 404–409.
Redrejo-Rodríguez M, Salas ML. (2014). Repair of base damage and genome maintenance in the
nucleo-cytoplasmic large DNA viruses. Virus Res 179: 12–25.
Reisser W, Becker B, Klein T. (1986). Studies on ultrastructure and host range of a Chlorella
attacking virus. Protoplasma 135: 162–165.
Reynolds C. (2006). The Ecology of Phytoplankton. Cambridge University Press: Cambridge.
Reynolds CS, Jaworski GHM, Cmiech HA, Leedale GF. (1981). On the annual cycle of the blue-
green alga Microcystis aeruginosa Kutz. Emend. Elenkin. Philos Trans R Soc Lond B Biol Sci
293: 419–477.
Rinta-Kanto JM, Konopko EA, DeBruyn JM, Bourbonniere RA, Boyer GL, Wilhelm SW.
(2009a). Lake Erie Microcystis: Relationship between microcystin production, dynamics of
genotypes and environmental parameters in a large lake. Harmful Algae 8: 665–673.
Rinta-Kanto JM, Ouellette AJA, Boyer GL, Twiss MR, Bridgeman TB, Wilhelm SW. (2005).
Quantification of toxic Microcystis spp. during the 2003 and 2004 blooms in western Lake Erie
using quantitative real-time PCR. Environ Sci Technol 39: 4198–4205.
Rinta-Kanto JM, Saxton MA, DeBruyn JM, Smith JL, Marvin CH, Krieger KA, et al. (2009b).
The diversity and distribution of toxigenic Microcystis spp. in present day and archived pelagic
and sediment samples from Lake Erie. Harmful Algae 8: 385–394.
Rozon RM, Short SM. (2013). Complex seasonality observed amongst diverse phytoplankton
viruses in the Bay of Quinte, an embayment of Lake Ontario. Freshw Biol 58: 2648–2663.
135
Safferman RS, Cannon RE, Desjardins PR, Gromov BV, Haselkorn R, Sherman LA, et al.
(1983). Classification and nomenclature of viruses of cyanobacteria. Intervirology 19: 61–66.
Safferman RS, Morris ME. (1963). Algal virus: isolation. Science 140: 679–680.
Safferman RS, Morris ME. (1967). Observations on the occurrence, distribution, and seasonal
incidence of blue-green algal viruses. Appl Microbiol 15: 1219–1222.
Sahlsten E. (1998). Seasonal abundance in Skagerrak-Kattegat coastal waters and host specificity
of viruses infecting the marine photosynthetic flagellate Micromonas pusilla. Aquat Microb Ecol
16: 103–108.
Sandaa R-A, Clokie M, Mann NH. (2008). Photosynthetic genes in viral populations with a large
genomic size range from Norwegian coastal waters. FEMS Microbiol Ecol 63: 2–11.
Sandaa R-A, Heldal M, Castberg T, Thyrhaug R, Bratbak G. (2001). Isolation and
characterization of two viruses with large genome size infecting Chrysochromulina ericina
(Prymnesiophyceae) and Pyramimonas orientalis (Prasinophyceae). Virology 290: 272–280.
Sandaa R-A, Larsen A. (2006). Seasonal variations in virus-host populations in Norwegian
coastal waters: focusing on the cyanophage community infecting marine Synechococcus spp.
Appl Environ Microbiol 72: 4610–4618.
Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. (2009).
Introducing mothur: open-source, platform-independent, community-supported software for
describing and comparing microbial communities. Appl Environ Microbiol 75: 7537–7541.
Schroeder DC, Oke J, Hall M, Malin G, Wilson WH. (2003). Virus succession observed during
an Emiliania huxleyi bloom. Appl Environ Microbiol 69: 2484–2490.
Schroeder DC, Oke J, Malin G, Wilson WH. (2002). Coccolithovirus (Phycodnaviridae):
characterisation of a new large dsDNA algal virus that infects Emiliana huxleyi. Arch Virol 147:
1685–1698.
Sheik AR, Brussaard CPD, Lavik G, Lam P, Musat N, Krupke A, et al. (2014). Responses of the
coastal bacterial community to viral infection of the algae Phaeocystis globosa. ISME J 8: 212–
225.
Shelford EJ, Middelboe M, Mller EF, Suttle CA. (2012). Virus-driven nitrogen cycling enhances
phytoplankton growth. Aquat Microb Ecol 66: 41–46.
Shirai Y, Tomaru Y, Takao Y, Suzuki H, Nagumo T, Nagasaki K. (2008). Isolation and
characterization of a single-stranded RNA virus infecting the marine planktonic diatom
Chaetoceros tenuissimus Meunier. Appl Environ Microbiol 74: 4022–4027.
Short CM, Rusanova O, Short SM. (2011a). Quantification of virus genes provides evidence for
seed-bank populations of phycodnaviruses in Lake Ontario, Canada. ISME J 5: 810–821.
136
Short CM, Suttle CA. (2005). Nearly identical bacteriophage structural gene sequences are
widely distributed in both marine and freshwater environments. Appl Environ Microbiol 71:
480–486.
Short SM. (2012). The ecology of viruses that infect eukaryotic algae. Environ Microbiol 14:
2253–2271.
Short SM, Jenkins BD, Zehr JP. (2004). Spatial and temporal distribution of two diazotrophic
bacteria in the Chesapeake Bay. Appl Environ Microbiol 70: 2186–2192.
Short SM, Rusanova O, Staniewski MA. (2011b). Novel phycodnavirus genes amplified from
Canadian freshwater environments. Aquat Microb Ecol 63: 61–67.
Short SM, Short CM. (2008). Diversity of algal viruses in various North American freshwater
environments. Aquat Microb Ecol 51: 13–21.
Short SM, Short CM. (2009). Quantitative PCR reveals transient and persistent algal viruses in
Lake Ontario, Canada. Environ Microbiol 11: 2639–2648.
Short SM, Suttle CA. (2002). Sequence analysis of marine virus communities reveals that groups
of related algal viruses are widely distributed in nature. Appl Environ Microbiol 68: 1290–1296.
Singh PK. (1973). Occurrence and distribution of cyanophages in ponds, sewage and rice fields.
Arch Für Mikrobiol 89: 169–172.
Smith EM, Gerba CP, Melnick JL. (1978). Role of sediment in the persistence of enteroviruses
in the estuarine environment. Appl Environ Microbiol 35: 685–689.
Sode K, Oozeki M, Asakawa K, Burgess J, Matsunaga T, J. (1994). Isolation of a marine
cyanophage infecting the marine unicellular cyanobacterium, Synechococcus so NKBG 042902.
Biotech 1: 189–192.
Sorensen G, Baker AC, Hall MJ, Munn CB, Schroeder DC. (2009). Novel virus dynamics in an
Emiliania huxleyi bloom. J Plankton Res 31: 787–791.
Staniewski MA, Short CM, Short SM. (2012). Contrasting community versus population-based
estimates of grazing and virus-induced mortality of phytoplankton. Microb Ecol 64: 25–38.
Staniewski MA, Short SM. (2014). Potential viral stimulation of primary production observed
during experimental determinations of phytoplankton mortality. Aquat Microb Ecol 71: 239–256.
Steffen M, Belisle B, Watson S, Boyer G, Bourbonniere R, Wilhelm S. (2015).
Metatranscriptomic evidence for co-occurring top-down and bottom-up controls on toxic
cyanobacterial communities. Appl Envrion Microbiol 81: 3268–3276.
Sullivan M, Waterbury J, Chisholm S. (2003). Cyanophages infecting the oceanic
cyanobacterium Prochlorococcus. Nature 424: 1047–1051.
137
Sullivan MB, Coleman ML, Quinlivan V, Rosenkrantz JE, DeFrancesco AS, Tan G, et al.
(2008). Portal protein diversity and phage ecology. Environ Microbiol 10: 2810–2823.
Sullivan MB, Lindell D, Lee JA, Thompson LR, Bielawski JP, Chisholm SW. (2006).
Prevalence and evolution of core photosystem II genes in marine cyanobacterial viruses and their
hosts. PLOS Biol 4: e234.
Suttle C. (1994). The significance of viruses to mortality in aquatic microbial communities.
Microb Ecol 28: 237–243.
Suttle CA. (2000a). Cyanophages and Their Role in the Ecology of Cyanobacteria. In: Whitton
BA, Potts M (eds). The Ecology of Cyanobacteria. Springer Netherlands, pp 563–589.
Suttle CA. (2000b). Ecological, Evolutionary, and Geochemical Consequences of Viral Infection
of Cyanobacteria and Eukaryotic Algae. In: Viral Ecology. Elsevier, pp 247–296.
Suttle CA. (2007). Marine viruses — major players in the global ecosystem. Nat Rev Microbiol
5: 801–812.
Suttle CA, Chen F. (1992). Mechanisms and rates of decay of marine viruses in seawater. Appl
Environ Microbiol 58: 3721–3729.
Suttle C, Chan A. (1994). Dynamics and distribution of cyanophages and their effect on marine
Synechococcus Spp. Appl Environ Microbiol 60: 3167–3174.
Suttle C, Chan A. (1993). Marine cyanophages infecting oceanic and coastal strains of
Synechococcus: abundance, morphology, cross-infectivity and growth characteristics. Mar Ecol
Prog Ser 92: 99–109.
Tai V, Lawrence JE, Lang AS, Chan AM, Culley AI, Suttle CA. (2003). Characterization of
HaRNAV, a single-stranded RNA virus causing lysis of Heterosigma akashiwo
(Raphidophyceae). J Phycol 39: 343–352.
Takashima Y, Yoshida T, Yoshida M, Shirai Y, Tomaru Y, Takao Y, et al. (2007). Development
and application of quantitative detection of cyanophages phylogenetically related to cyanophage
Ma-LMM01 infecting Microcystis aeruginosa in freshwater. Microbes Environ 22: 207–213.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013). MEGA6: Molecular
evolutionary genetics analysis version 6.0. Mol Biol Evol mst197.
Tarutani K, Nagasaki K, Yamaguchi M. (2000). Viral impacts on total abundance and clonal
composition of the harmful bloom-forming phytoplankton Heterosigma akashiwo. Appl Environ
Microbiol 66: 4916–4920.
Thingstad TF. (2000). Elements of a theory for the mechanisms controlling abundance, diversity,
and biogeochemical role of lytic bacterial viruses in aquatic systems. Limnol Oceanogr 45:
1320–1328.
138
Thomas R, Berdjeb L, Sime-Ngando T, Jacquet S. (2011). Viral abundance, production, decay
rates and life strategies (lysogeny versus lysis) in Lake Bourget (France). Environ Microbiol 13:
616–630.
Tijdens M, van de Waal DB, Slovackova H, Hoogveld HL, Gons HJ. (2008). Estimates of
bacterial and phytoplankton mortality caused by viral lysis and microzooplankton grazing in a
shallow eutrophic lake. Freshw Biol 53: 1126–1141.
Tomaru Y, Fujii N, Oda S, Toyoda K, Nagasaki K. (2011a). Dynamics of diatom viruses on the
western coast of Japan. Aquat Microb Ecol 63: 223–230.
Tomaru Y, Hata N, Masuda T, Tsuji M, Igata K, Masuda Y, et al. (2007). Ecological dynamics
of the bivalve-killing dinoflagellate Heterocapsa circularisquama and its infectious viruses in
different locations of western Japan. Environ Microbiol 9: 1376–1383.
Tomaru Y, Katanozaka N, Nishida K, Shirai Y, Tarutani K, Yamaguchi M, et al. (2004a).
Isolation and characterization of two distinct types of HcRNAV, a single-stranded RNA virus
infecting the bivalve-killing microalga Heterocapsa circularisquama. Aquat Microb Ecol 34:
207–218.
Tomaru Y, Takao Y, Suzuki H, Nagumo T, Koike K, Nagasaki K. (2011b). Isolation and
Characterization of a single-stranded DNA virus infecting Chaetoceros lorenzianus Grunow.
Appl Environ Microbiol 77: 5285–5293.
Tomaru Y, Tarutani K, Yamaguchi M, Nagasaki K. (2004b). Quantitative and qualitative
impacts of viral infection on a Heterosigma akashiwo (Raphidophyceae) bloom in Hiroshima
Bay, Japan. Aquat Microb Ecol 34: 227–238.
Tucker S, Pollard P. (2005). Identification of cyanophage Ma-LBP and infection of the
cyanobacterium Microcystis aeruginosa from an Australian subtropical lake by the virus. Appl
Environ Microbiol 71: 629–635.
Van Etten J, Lane L, Meints R. (1991). Viruses and virus-like particles of eukaryotic algae.
Microbiol Rev 55: 586–620.
Van Etten JL, Burbank DE, Kuczmarski D, Meints RH. (1983a). Virus infection of culturable
Chlorella-like algae and dlevelopment of a plaque assay. Science 219: 994–996.
Van Etten JL, Burbank DE, Schuster AM, Meints RH. (1985a). Lytic viruses infecting a
Chlorella-like alga. Virology 140: 135–143.
Van Etten JL, Burbank DE, Xia Y, Meints RH. (1983b). Growth cycle of a virus, PBCV-1, that
infects Chlorella-like algae. Virology 126: 117–125.
Van Etten JL, Van Etten CH, Johnson JK, Burbank DE. (1985b). A survey for viruses from fresh
water that infect a eucaryotic Chlorella-like green alga. Appl Environ Microbiol 49: 1326–1328.
139
Wang G, Asakawa S, Kimura M. (2011). Spatial and temporal changes of cyanophage
communities in paddy field soils as revealed by the capsid assembly protein gene g20. FEMS
Microbiol Ecol 76: 352–359.
Wang G, Murase J, Asakawa S, Kimura M. (2009). Novel cyanophage photosynthetic gene psbA
in the floodwater of a Japanese rice field. FEMS Microbiol Ecol 70: 79–86.
Wang K, Chen F. (2004). Genetic diversity and population dynamics of cyanophage
communities in the Chesapeake Bay. Aquat Microb Ecol 34: 105–116.
Wang M-N, Ge X-Y, Wu Y-Q, Yang X-L, Tan B, Zhang Y-J, et al. (2015). Genetic diversity
and temporal dynamics of phytoplankton viruses in East Lake, China. Virol Sin 30: 290–300.
Waterbury J, Valois F. (1993). Resistance to cooccurring phages enables marine Synechococcus
communities to coexist with cyanophages abundant in seawater. Appl Environ Microbiol 59:
3393–3399.
Weinbauer MG, Bonilla-Findji O, Chan AM, Dolan JR, Short SM, Simek K, et al. (2011).
Synechococcus growth in the ocean may depend on the lysis of heterotrophic bacteria. J
Plankton Res 33: 1465–1476.
Weinbauer MG, Wilhelm SW, Suttle CA, Garza DR. (1997). Photoreactivation compensates for
UV damage and restores infectivity to natural marine virus communities. Appl Environ
Microbiol 63: 2200–2205.
Wiggins B, Alexander M. (1985). Minimum bacterial density for bacteriophage replication -
implications for significance of bacteriophages in natural ecosystems. Appl Environ Microbiol
49: 19–23.
Wilhelm SW, Bullerjahn GS, Eldridge ML, Rinta-Kanto JM, Poorvin L, Bourbonniere RA.
(2006a). Seasonal hypoxia and the genetic diversity of prokaryote populations in the central
basin hypolimnion of Lake Erie: evidence for abundant cyanobacteria and photosynthesis. J Gt
Lakes Res 32: 657–671.
Wilhelm SW, Carberry MJ, Eldridge ML, Poorvin L, Saxton MA, Doblin MA. (2006b). Marine
and freshwater cyanophages in a Laurentian Great Lake: Evidence from infectivity assays and
molecular analyses of g20 genes. Appl Environ Microbiol 72: 4957–4963.
Wilhelm SW, Matteson AR. (2008). Freshwater and marine virioplankton: a brief overview of
commonalities and differences. Freshw Biol 53: 1076–1089.
Wilhelm SW, Suttle CA. (1999). Viruses and nutrient cycles in the sea: Viruses play critical
roles in the structure and function of aquatic food webs. BioScience 49: 781–788.
Wilhelm SW, Weinbauer MG, Suttle CA, Jeffrey WH. (1998). The role of sunlight in the
removal and repair of viruses in the sea. Limnol Oceanogr 43: 586–592.
140
Wilson WH, Carr NG, Mann NH. (1996). The effect of phosphate status on the kinetics of
cyanophage infection in the oceanic cyanobacterium Synechococcus sp. Wh78031. J Phycol 32:
506–516.
Wilson WH, Tarran GA, Schroeder D, Cox M, Oke J, Malin G. (2002a). Isolation of viruses
responsible for the demise of an Emiliania huxleyi bloom in the English Channel. J Mar Biol
Assoc U K 82: 369–377.
Wilson WH, Tarran G, Zubkov MV. (2002b). Virus dynamics in a coccolithophore-dominated
bloom in the North Sea. Deep Sea Res Part II Top Stud Oceanogr 49: 2951–2963.
Winter C, Bouvier T, Weinbauer MG, Thingstad TF. (2010). Trade-offs between competition
and defense specialists among unicellular planktonic organisms: the ‘killing the winner’
hypothesis revisited. Microbiol Mol Biol Rev 74: 42–57.
Wommack KE, Colwell RR. (2000). Virioplankton: Viruses in aquatic ecosystems. Microbiol
Mol Biol Rev 64: 69–114.
Wommack KE, Hill RT, Muller TA, Colwell RR. (1996). Effects of sunlight on bacteriophage
viability and structure. Appl Environ Microbiol 62: 1336–1341.
Xia H, Wang M, Ge X, Wu Y, Yang X, Zhang Y, et al. (2013). Study of the dynamics of
Microcystis aeruginosa and its cyanophage in East Lake using quantitative PCR. Virol Sin 28:
309–311.
Xie L, Xie P, Tang H. (2003). Enhancement of dissolved phosphorus release from sediment to
lake water by Microcystis blooms-an enclosure experiment in a hyper-eutrophic, subtropical
Chinese lake. Env Pollut 122: 391–399.
Yamada T, Higashiyama T, Fukuda T. (1991). Screening of natural waters for viruses which
infect Chlorella cells. Appl Environ Microbiol 57: 3433–3437.
Yates M, Gerba C, Kelley L. (1985). Virus persistence in groundwater. Appl Environ Microbiol
49: 778–781.
Yoshida M, Yoshida T, Kashima A, Takashima Y, Hosoda N, Nagasaki K, et al. (2008a).
Ecological dynamics of the toxic bloom-forming cyanobacterium Microcystis aeruginosa and its
cyanophages in freshwater. Appl Environ Microbiol 74: 3269–3273.
Yoshida M, Yoshida T, Yoshida-Takashima Y, Kashima A, Hiroishi S. (2010). Real-time PCR
detection of host-mediated cyanophage gene transcripts during infection of a natural Microcystis
aeruginosa population. Microbes Environ JSME 25: 211–215.
Yoshida T, Nagasaki K, Takashima Y, Shirai Y, Tomaru Y, Takao Y, et al. (2008b). Ma-
LMM01 infecting toxic Microcystis aeruginosa illuminates diverse cyanophage genome
strategies. J Bacteriol 190: 1762–1772.
141
Yoshida T, Takashima Y, Tomaru Y, Shirai Y, Takao Y, Hiroishi S, et al. (2006). Isolation and
characterization of a cyanophage infecting the toxic cyanobacterium Microcystis aeruginosa.
Appl Environ Microbiol 72: 1239–1247.
Zhang W, Zhou J, Liu T, Yu Y, Pan Y, Yan S, et al. (2015). Four novel algal virus genomes
discovered from Yellowstone Lake metagenomes. Sci Rep 5: 15131.
Zhong X, Berdjeb L, Jacquet S. (2013). Temporal dynamics and structure of picocyanobacteria
and cyanomyoviruses in two large and deep peri-alpine lakes. FEMS Microbiol Ecol 86: 312–
326.
Zhong X, Guidoni B, Jacas L, Jacquet S. (2015). Structure and diversity of ssDNA Microviridae
viruses in two peri-alpine lakes (Annecy and Bourget, France). Res Microbiol 166: 644–654.
Zhong X, Jacquet S. (2014). Contrasting diversity of phycodnavirus signature genes in two large
and deep western European lakes. Environ Microbiol 16: 759–773.
Zhong Y, Chen F, Wilhelm SW, Poorvin L, Hodson RE. (2002). Phylogenetic diversity of
marine cyanophage isolates and natural virus communities as revealed by sequences of viral
capsid assembly protein gene g20. Appl Environ Microbiol 68: 1576–1584.
Zingone A, Sarno D, Forlani G. (1999). Seasonal dynamics in the abundance of Micromonas
pusilla (Prasinophyceae) and its viruses in the Gulf of Naples (Mediterranean Sea). J Plankton
Res 21: 2143–2159.
142
Appendices
Appendix 1
Appendix Table 1.1. Pairwise statistical comparisons of the slopes from decay incubations using the same viruses within the same treatment in different seasons
Virus Slope 1† Slope 2†
Slopes Significantly Different?* F
DFn, DFd p-value
ACTV-1 Spring Filtered Summer Filtered No 7.07 1, 26 0.013
Spring Filtered Fall Filtered No 0.063 1, 26 0.804
Spring Filtered Winter Filtered Yes 48.098 1, 26 <0.0001
Spring Wholewater Summer Wholewater No 12.43 1, 26 0.0016
Spring Wholewater Fall Wholewater Yes 106.59 1, 26 <0.0001
Spring Wholewater Winter Wholewater Yes 441.18 1, 26 <0.0001
Summer Filtered Fall Filtered No 8.65 1, 26 0.0068
Summer Filtered Winter Filtered Yes 99.23 1, 26 <0.0001
Summer Wholewater Fall Wholewater Yes 441.51 1, 26 <0.0001
Summer Wholewater Winter Wholewater Yes 1001.29 1, 26 <0.0001
Fall Filtered Winter Filtered Yes 104.8 1, 26 <0.0001
Fall Wholewater Winter Wholewater Yes 110.85 1, 26 <0.0001
CVM-1 Spring Filtered Summer Filtered No 0.301 1, 26 0.501
Spring Filtered Fall Filtered No 3.096 1, 26 0.0902
Spring Filtered Winter Filtered Yes 297.78 1, 26 <0.0001
Spring Wholewater Summer Wholewater No 0.51 1, 26 0.48
Spring Wholewater Fall Wholewater Yes 14.53 1, 26 0.00076
Spring Wholewater Winter Wholewater Yes 601.11 1, 26 <0.0001
Summer Filtered Fall Filtered No 0.26 1, 26 0.62
Summer Filtered Winter Filtered Yes 163.15 1, 26 <0.0001
Summer Wholewater Fall Wholewater Yes 13.95 1, 26 0.00093
Summer Wholewater Winter Wholewater Yes 406.47 1, 26 <0.0001
Fall Filtered Winter Filtered Yes 464.69 1, 26 <0.0001
Fall Wholewater Winter Wholewater Yes 309.018 1, 26 <0.0001
CpV-BQ1 Summer Filtered Fall Filtered Yes 32.804 1, 20 <0.0001
Summer Filtered Winter Filtered Yes 417.88 1, 20 <0.0001
Summer Wholewater Fall Wholewater Yes 33.61 1, 20 <0.0001
Summer Wholewater Winter Wholewater Yes 368.98 1, 20 <0.0001
Fall Filtered Winter Filtered Yes 51.94 1, 20 <0.0001
Fall Wholewater Winter Wholewater Yes 28.79 1, 20 <0.0001
*α level = 0.00167 with Bonferroni correction †Slopes in bold and italics are more negative and have higher rate of decay, but bolds fonts indicate statistically significant differences.
143
Appendix Table 1.2. Pairwise statistical comparisons of the slopes from decay incubations using the same viruses within the in same season using different treatments
Virus Slope 1† Slope 2†
Slopes Significantly Different?* F
DFn, DFd p-value
ATCV-1 Spring Filtered Spring Wholewater Yes 111.73 1, 26 <0.0001
Summer Filtered Summer Wholewater Yes 110.72 1, 26 <0.0001
Fall Filtered Fall Wholewater No 9.29 1, 26 0.0052
Winter Filtered Winter Wholewater No 0.066 1, 26 0.79
CVM-1 Spring Filtered Spring Wholewater Yes 66.45 1, 26 <0.0001
Summer Filtered Summer Wholewater Yes 25.65 1, 26 <0.0001
Fall Filtered Fall Wholewater No 5.31 1, 26 0.029
Winter Filtered Winter Wholewater Yes 19.85 1, 26 0.00014
CpV-BQ1 Summer Filtered Summer Wholewater No 7.602 1, 14 0.015
Fall Filtered Fall Wholewater No 0.015 1, 26 0.91
Winter Filtered Winter Wholewater Yes 21.091 1, 26 <0.0001
*α level = 0.0045 with Bonferroni correction †Slopes in bold and italics are more negative and have higher rate of decay, but bolds fonts indicate statistically significant differences.
144
Appendix Table 1.3. Pairwise statistical comparisons of the slopes from decay incubations using different viruses within the same season and treatment
Season Slope 1 Slope 2
Slopes Significantly Different?* F
DFn, DFd p-value
Spring ACTV-1 Filtered CVM-1 Filtered Yes 51.53 1, 26 <0.0001
ACTV-1 Wholewater CVM-1 Wholewater No 9.31 1, 26 0.0052
Summer ACTV-1 Filtered CVM-1 Filtered No 8.65 1, 26 0.0068
ACTV-1 Wholewater CVM-1 Wholewater No 1.09 1, 26 0.31
ACTV-1 Filtered CpV-BQ1 Filtered Yes 627.82 1, 20 <0.0001
ACTV-1 Wholewater CpV-BQ1 Wholewater Yes 1504.26 1, 20 <0.0001
CVM-1 Filtered CpV-BQ1 Filtered Yes 527.22 1, 20 <0.0001
CVM-1 Wholewater CpV-BQ1 Wholewater Yes 693.08 1, 20 <0.0001
Fall ACTV-1 Filtered CVM-1 Filtered Yes 194.41 1, 26 <0.0001
ACTV-1 Wholewater CVM-1 Wholewater Yes 74.45 1, 26 <0.0001
ACTV-1 Filtered CpV-BQ1 Filtered Yes 21.23 1, 26 <0.0001
ACTV-1 Wholewater CpV-BQ1 Wholewater Yes 11.35 1, 26 0.0024
CVM-1 Filtered CpV-BQ1 Filtered No 9.18 1, 26 0.0056
CVM-1 Wholewater CpV-BQ1 Wholewater No 4.03 1, 26 0.055
Winter ACTV-1 Filtered CVM-1 Filtered Yes 18.06 1, 26 0.00024
ACTV-1 Wholewater CVM-1 Wholewater Yes 62.89 1, 26 <0.0001
ACTV-1 Filtered CpV-BQ1 Filtered Yes 19.98 1, 26 0.0014
ACTV-1 Wholewater CpV-BQ1 Wholewater Yes 78.25 1, 26 <0.0001
CVM-1 Filtered CpV-BQ1 Filtered No 4.27 1, 26 0.049
CVM-1 Wholewater CpV-BQ1 Wholewater Yes 23.95 1, 26 <0.0001
*α level = 0.0025 with Bonferroni correction †Bolded slope is more negative and thus has higher rate of decay
145
Appendix 2
Appendix Table 2.1. Linear Regression analysis of decay curves
Season Virus Treatment Slope ± Standard Error* Slope significantly
non-zero? F DFn, DFd p value
Spring ATCV-1 Filtered -0.00066 ± 0.00070 No 0.897 1, 13 0.36
2013 Wholewater -0.0071 ± 0.00090 Yes 61.29 1, 13 < 0.0001
CVM-1 Filtered -0.00046 ± 0.010 No 0.197 1, 13 0.67
Wholewater -0.0062 ± 0.00083 Yes 55.68 1, 13 < 0.0001
CpV-BQ1 Filtered n.a. - - - -
Wholewater n.a. - - - -
LO.20May09.33 Filtered -0.0044 ± 0.00074 Yes 35.27 1, 13 < 0.0001
Wholewater -0.0076 ± 0.0013 Yes 35.47 1, 10 0.0001
F2Vpol1 Filtered n.d. - - - -
Wholewater n.d. - - - -
F2MCP1 Filtered n.d. - - - -
Wholewater n.d. - - - -
IZCPS1 Filtered -0.026 ± 0.0049 Yes 10.72 1, 7 0.014
Wholewater t.h.t.e. - - - -
WZCPS8 Filtered -0.043 ± 0.0049 Yes 76.36 1, 7 < 0.0001
Wholewater -0.15 ± 0.025 Yes 34.22 1, 2 0.028
Summer ATCV-1 Filtered -0.0046 ± 0.0062 No 0.57 1, 9 0.47
2013 Wholewater -0.0075 ± 0.0023 Yes 10.52 1, 7 0.014
CVM-1 Filtered -0.0047 ± 0.0019 Yes 6.171 1, 10 0.032
Wholewater -0.0071 ± 0.0027 Yes 6.817 1, 7 0.034
CpV-BQ1 Filtered -0.0037 ± 0.0045 No 0.658 1, 10 0.44
Wholewater -0.012 ± 0.0024 Yes 13.59 1, 10 0.0042
LO.20May09.33 Filtered n.d. - - - -
Wholewater n.d. - - - -
146
F2Vpol1 Filtered -0.00091 ± 0.0026 No 0.126 1, 9 0.73
Wholewater -0.0074 ± 0.0015 Yes 23.73 1, 10 < 0.0001
F2MCP1 Filtered n.d. - - - -
Wholewater n.d. - - - -
IZCPS1 Filtered t.h.t.e. - - - -
Wholewater t.h.t.e. - - - -
WZCPS8 Filtered -0.029 ± 0.022 No 1.641 1, 4 0.27
Wholewater t.h.t.e. - - - -
Autumn ATCV-1 Filtered -0.00089 ± 0.00042 No 4.495 1, 13 0.054
2013 Wholewater -0.0010 ± 0.00047 No 4.606 1, 13 0.051
CVM-1 Filtered -0.00050 ± 0.00046 No 1.189 1, 13 0.30
Wholewater -0.0013 ± 0.00046 Yes 7.918 1, 13 0.015
CpV-BQ1 Filtered -0.0065 ± 0.0023 Yes 7.946 1, 13 0.018
Wholewater -0.0074 ± 0.0011 Yes 43.55 1, 13 0.022
LO.20May09.33 Filtered n.d. - - - -
Wholewater n.d. - - - -
F2Vpol1 Filtered n.d. - - - -
Wholewater n.d. - - - -
F2MCP1 Filtered n.d. - - - -
Wholewater n.d. - - - -
IZCPS1 Filtered n.d. - - - -
Wholewater n.d. - - - -
WZCPS8 Filtered n.d. - - - -
Wholewater n.d. - - - -
Winter ATCV-1 Filtered -0.00012 ± 0.000047 Yes 5.933 1, 13 0.03
2013-14 Wholewater -0.000056 ± 0.000061 No 0.824 1, 13 0.38
CVM-1 Filtered -0.00034 ± 0.000049 Yes 47.83 1, 13 < 0.0001
Wholewater -0.00042 ± 0.000060 Yes 50.23 1, 13 < 0.0001
CpV-BQ1 Filtered -0.00047 ± 0.000038 Yes 157.6 1, 13 < 0.0001
Wholewater -0.00053 ± 0.000049 Yes 116.6 1, 13 < 0.0001
LO.20May09.33 Filtered n.d. - - - -
147
Wholewater n.d. - - - -
F2Vpol1 Filtered -0.000069 ± 0.000054 No 1.654 1, 13 0.22
Wholewater -0.00065 ± 0.00014 Yes 21.57 1, 13 0.0005
IZCPS1 Filtered n.d. - - - -
Wholewater n.d. - - - -
WZCPS8 Filtered -0.0027 ± 0.00025 Yes 121.2 1, 13 < 0.0001
Wholewater -0.0029 ± 0.00029 Yes 98.92 1, 13 < 0.0001
IZCPS1 Filtered n.d. - - - -
Wholewater n.d. - - - -
Autumn ATCV-1 Filtered -0.00085 ± 0.00085 No 1.002 1, 13 0.34
2014 Wholewater 0.0034 ± 0.00060 Yes 32.32 1, 13 < 0.0001
CVM-1 Filtered -0.00068 ± 0.0022 No 0.092 1, 13 0.76
Wholewater -0.0084 ± 0.0011 Yes 58.36 1, 13 < 0.0001
CpV-BQ1 Filtered -0.00099 ± 0.0024 No 0.169 1, 13 0.69
Wholewater -0.0096 ± 0.0011 Yes 74.9 1, 13 < 0.0001
LO.20May09.33 Filtered n.d. - - - -
Wholewater n.d. - - - -
F2Vpol1 Filtered -0.0080 ± 0.0012 Yes 43.23 1, 13 < 0.0001
Wholewater -0.013 ± 0.0028 Yes 22.39 1, 13 0.0004
F2MCP1 Filtered -0.00048 ± 0.00090 No 0.292 1, 13 0.60
Wholewater -0.0099 ± 0.0020 Yes 23.85 1, 13 0.0003
WZCPS8 Filtered n.d. - - - -
Wholewater n.d. - - - -
IZCPS1 Filtered n.d. - - - -
Wholewater n.d. - - - -
*n.a. = not added, n.d. = not detected, t.h.t.e. = too high to estimate
148
Appendix Table 2.2. ANCOVA comparing slopes from qPCR assays versus infectivity assays of the same viruses
Virus qPCR Slope† Infectivity Slope† Slopes Significantly
Different?* F DFn, DFd p-value
ATCV-1 Spring Filtered Spring Filtered No 6.855 1, 26 0.015
Spring Wholewater Spring Wholewater No 5.261 1, 26 0.030
Summer Filtered Summer Filtered No 0.850 1, 18 0.37
Summer Wholewater Summer Wholewater No 7.357 1, 14 0.017
Autumn 2013 Filtered Autumn 2013 Filtered Yes 19.04 1, 26 0.0002
Autumn 2013 Wholewater Autumn 2013 Wholewater Yes 31.07 1, 26 <0.0001
Winter Filtered Winter Filtered No 1.344 1, 26 0.26
Winter Wholewater Winter Wholewater No 0.007 1, 26 0.94
Autumn 2014 Filtered Autumn 2014 Filtered Yes 19.94 1, 26 0.0001
Autumn 2014 Wholewater Autumn 2014 Wholewater Yes 21.34 1, 26 <0.0001
CVM-1 Spring Filtered Spring Filtered Yes 40.79 1, 23 <0.0001
Spring Wholewater Spring Wholewater Yes 29.06 1, 26 <0.0001
Summer Filtered Summer Filtered No 11.87 1, 20 0.0026
Summer Wholewater Summer Wholewater No 4.654 1, 20 0.049
Autumn 2013 Filtered Autumn 2013 Filtered Yes 183.1 1, 26 <0.0001
Autumn 2013 Wholewater Autumn 2013 Wholewater Yes 129.1 1, 26 <0.0001
Winter Filtered Winter Filtered No 2.911 1, 26 0.099
Winter Wholewater Winter Wholewater Yes 26.34 1, 26 <0.0001
Autumn 2014 Filtered Autumn 2014 Filtered No 8.107 1, 26 0.0085
Autumn 2014 Wholewater Autumn 2014 Wholewater No 6.771 1, 26 0.015
CpV-BQ1 Summer Filtered Summer Filtered Yes 179.5 1, 17 <0.0001
Summer Wholewater Summer Wholewater Yes 192.5 1, 17 <0.0001
Autumn 2013 Filtered Autumn 2013 Filtered Yes 39.21 1, 26 <0.0001
Autumn 2013 Wholewater Autumn 2013 Wholewater No 0.010 1, 15 0.92
Winter Filtered Winter Filtered No 5.089 1, 26 0.033
Winter Wholewater Winter Wholewater Yes 48.35 1, 26 <0.0001
149
Autumn 2014 Filtered Autumn 2014 Filtered No 4.917 1, 26 0.036
Autumn 2014 Wholewater Autumn 2014 Wholewater No 0.035 1, 26 0.85
*α level = 0.0018 with Bonferroni correction †Bolded slope is significantly more negative and thus has higher rate of decay while italicized slope is more negative, but not significantly different
150
Appendix Table 2.3. ANCOVA of regression slopes calculated in the same season from the same viruses with different treatments
Virus Slope 1† Slope 2† Slopes Significantly
Different?* F DFn, DFd p-value
ATCV-1 Spring Filtered Spring Wholewater Yes 31.36 1, 26 <0.0001
Summer Filtered Summer Wholewater No 0.099 1, 16 0.76
Autumn 2013 Filtered Autumn 2013 Wholewater No 0.034 1, 26 0.85
Winter Filtered Winter Wholewater No 0.578 1, 26 0.45
Autumn 2014 Filtered Autumn 2014 Wholewater No 6.041 1, 26 0.021
CVM-1 Spring Filtered Spring Wholewater Yes 19.06 1, 23 0.0002
Summer Filtered Summer Wholewater No 0.418 1, 17 0.53
Autumn 2013 Filtered Autumn 2013 Wholewater No 1.486 1, 26 0.23
Winter Filtered Winter Wholewater No 1.081 1, 26 0.31
Autumn 2014 Filtered Autumn 2014 Wholewater No 9.669 1, 26 0.0045
CpV-BQ1 Summer Filtered Summer Wholewater No 2.467 1, 20 0.13
Autumn 2013 Filtered Autumn 2013 Wholewater No 0.001 1, 26 0.97
Winter Filtered Winter Wholewater No 0.823 1, 26 0.37
Autumn 2014 Filtered Autumn 2014 Wholewater No 10.33 1, 26 0.0035
F2 Vpol 1 Summer Filtered Summer Wholewater No 2.385 1, 20 0.14
Winter Filtered Winter Wholewater Yes 14.92 1, 26 0.0007
Autumn 2014 Filtered Autumn 2014 Wholewater No 2.777 1, 26 0.11
F2 MCP 1 Autumn 2014 Filtered Autumn 2014 Wholewater Yes 18.02 1, 26 0.0002
WZ CPS 8 Spring Filtered Spring Wholewater Yes 12.55 1, 14 <0.0001
Winter Filtered Winter Wholewater No 0.178 1, 26 0.68
LO.20May09.33 Spring Filtered Spring Wholewater No 2.619 1, 23
0.12
*α level = 0.0024 with Bonferroni correction
†Bolded slope is significantly more negative and thus has higher rate of decay. Italicized slope is more negative, but not significantly different.
151
Appendix Table 2.4. ANCOVA of regression slopes from the same virus and treatment in different seasons
Virus Slope 1† Slope 2† Slopes Significantly
Different?* F DFn, DFd p-value
ATCV-1 Spring Filtered Summer Filtered No 0.756 1, 22 0.39
Spring Filtered Autumn 2013 Filtered No 0.076 1, 26 0.79
Spring Filtered Winter Filtered No 1.109 1, 26 0.30
Spring Filtered Autumn 2014 Filtered No 0.0284 1, 26 0.87
Spring Wholewater Summer Wholewater No 0.011 1, 20 0.92
Spring Wholewater Autumn 2013 Wholewater Yes 35.51 1, 26 <0.0001
Spring Wholewater Winter Wholewater Yes 103.8 1, 26 <0.0001
Spring Wholewater Autumn 2014 Wholewater Yes 11.44 1, 26 0.0023
Summer Filtered Autumn 2013 Filtered No 0.762 1, 22 0.39
Summer Filtered Winter Filtered No 1.241 1, 22 0.28
Summer Filtered Autumn 2014 Filtered No 0.634 1, 22 0.43
Summer Wholewater Autumn 2013 Wholewater No 6.202 1, 20 0.021
Summer Wholewater Winter Wholewater Yes 13.95 1, 20 0.0013
Summer Wholewater Autumn 2014 Wholewater No 1.706 1, 20 0.21
Autumn 2013 Filtered Winter Filtered No 4.05 1, 26 0.055
Autumn 2013 Filtered Autumn 2014 Filtered No 0.002 1, 26 0.97
Autumn 2013 Wholewater Winter Wholewater No 4.932 1, 26 0.035
Autumn 2013 Wholewater Autumn 2014 Wholewater Yes 9.945 1, 26 0.004
Winter Filtered Autumn 2014 Filtered No 1.398 1, 26 0.25
Winter Wholewater Autumn 2014 Wholewater Yes 46.65 1, 26 <0.0001
CVM-1 Spring Filtered Summer Filtered No 2.677 1, 20 0.12
Spring Filtered Autumn 2013 Filtered No 0.002 1, 23 0.97
Spring Filtered Winter Filtered No 0.026 1, 23 0.87
Spring Filtered Autumn 2014 Filtered No 0.007 1, 23 0.94
Spring Wholewater Summer Wholewater No 0.047 1, 20 0.83
Spring Wholewater Autumn 2013 Wholewater Yes 26.54 1, 26 <0.0001
Spring Wholewater Winter Wholewater Yes 77.57 1, 26 <0.0001
Spring Wholewater Autumn 2014 Wholewater No 2.654 1, 26 0.12
Summer Filtered Autumn 2013 Filtered No 5.923 1, 23 0.023
152
Summer Filtered Winter Filtered No 8.997 1, 23 0.0064
Summer Filtered Autumn 2014 Filtered No 0.517 1, 23 0.48
Summer Wholewater Autumn 2013 Wholewater No 4.541 1, 20 0.046
Summer Wholewater Winter Wholewater No 9.485 1, 20 0.0059
Summer Wholewater Autumn 2014 Wholewater No 0.059 1, 20 0.81
Autumn 2013 Filtered Winter Filtered No 0.160 1, 26 0.69
Autumn 2013 Filtered Autumn 2014 Filtered No 0.006 1, 26 0.94
Autumn 2013 Wholewater Winter Wholewater No 4.136 1, 26 0.052
Autumn 2013 Wholewater Autumn 2014 Wholewater Yes 35.56 1, 26 <0.0001
Winter Filtered Autumn 2014 Filtered No 0.044 1, 26 0.84
Winter Wholewater Autumn 2014 Wholewater Yes 91.64 1, 26 <0.0001
CpV- BQ1 Summer Filtered Autumn 2013 Filtered No 2.058 1, 20 0.17
Summer Filtered Winter Filtered Yes 27.07 1, 23 <0.0001
Summer Filtered Autumn 2014 Filtered No 3.221 1, 23 0.086
Summer Wholewater Autumn 2013 Wholewater No 0.336 1, 23 0.57
Summer Wholewater Winter Wholewater Yes 25.73 1, 23 <0.0001
Summer Wholewater Autumn 2014 Wholewater No 0.658 1, 23 0.43
Autumn 2013 Filtered Winter Filtered No 1.047 1, 15 0.32
Autumn 2013 Filtered Autumn 2014 Filtered No 0.009 1, 15 0.93
Autumn 2013 Wholewater Winter Wholewater Yes 12.51 1, 26 0.0018
Autumn 2013 Wholewater Autumn 2014 Wholewater Yes 0.898 1, 23 0.35
Winter Filtered Autumn 2014 Filtered No 0.091 1, 26 0.77
Winter Wholewater Autumn 2014 Wholewater Yes 120.6 1, 26 <0.0001
F2 Vpol 1 Summer Filtered Winter Filtered No 0.172 1, 19 0.68
Summer Filtered Autumn 2014 Filtered No 4.048 1, 22 0.057
Summer Wholewater Winter Wholewater Yes 25.69 1, 20 <0.0001
Summer Wholewater Autumn 2014 Wholewater No 3.169 1, 23 0.087
Winter Filtered Autumn 2014 Filtered Yes 61.27 1, 26 <0.0001
Winter Wholewater Autumn 2014 Wholewater Yes 28.89 1, 26 <0.0001
WZ CPS 8 Spring Filtered Summer Filtered No 0.410 1, 11 0.54
153
Spring Filtered Winter Filtered Yes 34.13 1, 20 <0.0001
Spring Wholewater Winter Wholewater Yes 10.19 1, 15 0.0061
Summer Filtered Winter Filtered No 0.713 1, 11 0.42
*α level = 0.0025 for ATCV-1, 0.0025 for CVM-1, 0.0042 for CpV-BQ1, 0.0083 for F2VPOL1, 0.013 for WZCPS8 with Bonferroni corrections †Bolded slope is significantly more negative and thus has higher rate of decay while italicized slope is more negative, but not significantly different
154
Appendix Table.2 5. ANCOVA of regression slopes from the same treatment in the same season with different viruses
Season Slope 1† Slope 2† Slopes Significantly
Different?* F DFn, DFd p-value
Spring 2013 ATCV-1 Filtered CVM-1 Filtered No 0.028 1, 23 0.87
ATCV-1 Filtered LO.20May09.33 Filtered Yes 13.33 1, 26 0.0012
ATCV-1 Filtered IZ CPS 1 Filtered Yes 12.10 1, 20 0.0024
ATCV-1 Filtered WZ CPS 8 Filtered Yes 90.12 1, 20 <0.0001
ATCV-1 Wholewater CVM-1 Wholewater No 0.517 1, 26 0.48
ATCV-1 Wholewater LO.20May09.33 Wholewater No 0.059 1, 23 0.81
ATCV-1 Wholewater WZ CPS 8 Wholewater Yes 28.56 1, 15 <0.0001
CVM-1 Filtered LO.20May09.33 Filtered No 9.992 1, 23 0.0044
CVM-1 Filtered IZ CPS 1 Filtered No 8.609 1, 17 0.0093
CVM-1 Filtered WZ CPS 8 Filtered Yes 63.58 1, 17 <0.0001
CVM-1 Wholewater LO.20May09.33 Wholewater No 0.434 1, 23 0.517
CVM-1 Wholewater WZ CPS 8 Wholewater Yes 33.52 1, 15 <0.0001
LO.20May09.33 Filtered IZ CPS 1 Filtered No 6.501 1, 20 0.019
LO.20May09.33 Filtered WZ CPS 8 Filtered Yes 70.67 1, 20 <0.0001
LO.20May09.33 Wholewater WZ CPS 8 Wholewater Yes 84.85 1, 12 <0.0001
IZ CPS 1 Filtered WZ CPS 8 Filtered Yes 14.92 1, 14 0.0017
Summer 2013 ATCV-1 Filtered CVM-1 Filtered No 0.0003 1, 19 0.99
ATCV-1 Filtered CpV-BQ1 Filtered No 1.331 1, 19 0.26
ATCV-1 Filtered F2 Vpol 1 Filtered No 0.326 1, 18 0.58
ATCV-1 Filtered WZ CPS 8 Filtered No 0.397 1, 13 0.54
ATCV-1 Wholewater CVM-1 Wholewater No 0.014 1, 14 0.91
ATCV-1 Wholewater CpV-BQ1 Wholewater No 0.269 1, 17 0.61
ATCV-1 Wholewater F2 Vpol 1 Wholewater No 0.0001 1, 20 0.99
CVM-1 Filtered CpV-BQ1 Filtered No 3.974 1, 20 0.06
CVM-1 Filtered F2 Vpol 1 Filtered No 1.435 1, 19 0.25
CVM-1 Filtered WZ CPS 8 Filtered No 1.897 1, 14 0.19
CVM-1 Wholewater CpV-BQ1 Wholewater No 0.211 1, 17 0.65
CVM-1 Wholewater F2 Vpol 1 Wholewater No 0.002 1, 20 0.96
CpV-BQ1 Filtered F2 Vpol 1 Filtered No 7.249 1, 19 0.014
155
CpV-BQ1 Filtered WZ CPS 8 Filtered No 0.411 1, 14 0.53
CpV-BQ1 Wholewater F2 Vpol 1 Wholewater No 0.609 1, 20 0.44
F2 Vpol 1 Filtered WZ CPS 8 Filtered No 1.776 1, 13 0.21
Autumn 2013 ATCV-1 Filtered CVM-1 Filtered No 0.384 1, 26 0.54
ATCV-1 Filtered CpV-BQ1 Filtered Yes 8.816 1, 23 0.0069
ATCV-1 Wholewater CVM-1 Wholewater No 0.198 1, 26 0.66
ATCV-1 Wholewater CpV-BQ1 Wholewater No 0.243 1, 15 0.63
CVM-1 Filtered CpV-BQ1 Filtered Yes 9.483 1, 23 0.0053
CVM-1 Wholewater CpV-BQ1 Wholewater No 0.228 1, 26 0.64
Winter 2013 ATCV-1 Filtered CVM-1 Filtered No 10.94 1, 26 0.0028
ATCV-1 Filtered CpV-BQ1 Filtered Yes 34.9 1, 26 <0.0001
ATCV-1 Filtered F2 Vpol 1 Filtered No 0.408 1, 26 0.53
ATCV-1 Filtered WZ CPS 8 Filtered Yes 163.1 1, 26 <0.0001
ATCV-1 Wholewater CVM-1 Wholewater Yes 18.27 1, 26 0.0002
ATCV-1 Wholewater CpV-BQ1 Wholewater Yes 36.24 1, 26 <0.0001
ATCV-1 Wholewater F2 Vpol 1 Wholewater No 3.479 1, 26 0.073
ATCV-1 Wholewater WZ CPS 8 Wholewater Yes 137.1 1, 26 <0.0001
CVM-1 Filtered CpV-BQ1 Filtered No 4.495 1, 26 0.043
CVM-1 Filtered F2 Vpol 1 Filtered Yes 13.64 1, 26 0.001
CVM-1 Filtered WZ CPS 8 Filtered Yes 169.4 1, 26 <0.0001
CVM-1 Wholewater CpV-BQ1 Wholewater No 1.941 1, 26 0.18
CVM-1 Wholewater F2 Vpol 1 Wholewater No 2.911 1, 26 0.10
CVM-1 Wholewater WZ CPS 8 Wholewater Yes 104.7 1, 26 <0.0001
CpV-BQ1 Filtered F2 Vpol 1 Filtered Yes 41.42 1, 26 <0.0001
CpV-BQ1 Filtered WZ CPS 8 Filtered Yes 125.2 1, 26 <0.0001
CpV-BQ1 Wholewater F2 Vpol 1 Whole water No 0.881 1, 26 0.36
CpV-BQ1 Whole water WZ CPS 8 Whole water Yes 98.63 1, 26 <0.0001
F2 Vpol 1 Filtered WZ CPS 8 Filtered Yes 109.9 1, 26 <0.0001
F2 Vpol 1 Wholewater WZ CPS 8 Wholewater Yes 48.67 1, 26 <0.0001
Autumn 2014 ATCV-1 Filtered CVM-1 Filtered No 0.005 1, 26 0.94
156
ATCV-1 Filtered CpV-BQ1 Filtered No 0.003 1, 26 0.95
ATCV-1 Filtered F2 Vpol 1 Filtered Yes 23.31 1, 26 <0.0001
ATCV-1 Filtered F2 MCP 1 Filtered No 0.087 1, 26 0.77
ATCV-1 Wholewater CVM-1 Wholewater Yes 16.04 1, 26 0.0005
ATCV-1 Wholewater CpV-BQ1 Wholewater Yes 24.06 1, 26 <0.0001
ATCV-1 Wholewater F2 Vpol 1 Wholewater Yes 11.71 1, 26 0.0021
ATCV-1 Wholewater F2 MCP 1 Wholewater No 9.431 1, 26 0.005
CVM-1 Filtered CpV-BQ1 Filtered No 0.009 1, 26 0.92
CVM-1 Filtered F2 Vpol 1 Filtered No 8.331 1, 26 0.0077
CVM-1 Filtered F2 MCP 1 Filtered No 0.006 1, 26 0.94
CVM-1 Wholewater CpV-BQ1 Wholewater No 0.053 1, 26 0.47
CVM-1 Wholewater F2 Vpol 1 Wholewater No 2.427 1, 26 0.13
CVM-1 Wholewater F2 MCP 1 Wholewater No 0.396 1, 26 0.53
CpV-BQ1 Filtered F2 Vpol 1 Filtered No 6.704 1, 26 0.016
CpV-BQ1 Filtered F2 MCP 1 Filtered No 0.019 1, 26 0.89
CpV-BQ1 Wholewater F2 Vpol 1 Wholewater No 3.69 1, 26 0.066
CpV-BQ1 Wholewater F2 MCP 1 Wholewater No 0.74 1, 26 0.42
F2 Vpol 1 Filtered F2 MCP 1 Filtered Yes 24.77 1, 26 <0.0001
F2 Vpol 1 Wholewater F2 MCP 1 Wholewater No 0.863 1, 26 0.36
*α level = 0.0031 for spring, 0.00031 for summer, 0.0083 for autumn 2013, 0.0025 for winter, and 0.0025 for autumn 2014 with Bonferroni corrections
†Bolded slope is significantly more negative and thus has higher rate of decay while italicized slope is more negative, but not significantly different
157
Appendix 3
Appendix Table 3.1. Search results from blastp for polB OTU representative sequences.
OTU Stations and depths (cm) present First Cultivated blastp match (#, name) Percent
Identity (%)
45224VPOLCC1 452 2-4 AAR05084.1 Phaeocystis globosa virus PgV-03T 49
45224VPOLCC2 452 2-4; 882 6-8; 1326 0-2 ACP44143.1 Bathycoccus virus BpV178 76
45224VPOLCC7 452 2-4; 1326 0-2, 2-4, 6-8 ACP44143.1 Bathycoccus virus BpV178 80
88202VPOLCC1 882 0-2, 2-4, 4-6, 6-8 YP_009174732.1 Yellowstone lake phycodnavirus 1 51
88202VPOLCC15 882 0-2, 4-6, 6-8; 973 4-6; 1326 2-4 ACP44143.1 Bathycoccus virus BpV178 97
88224VPOLCC1 882 2-4, 6-8 ACP44143.1 Bathycoccus virus BpV178 79
88246VPOLCC5 882 4-6 YP_009174732.1 Yellowstone lake phycodnavirus 1 51
88246VPOLCC13 882 4-6 ACP44143.1 Bathycoccus virus BpV178 93
88268VPOLCC1 882 6-8; 1326 0-2, 4-6 ALH45659.1 Chrysochromulina parva virus BQ1 99
88268VPOLCC5 882 6-8 ACP44143.1 Bathycoccus virus BpV178 78
88268VPOLCC9 882 6-8 ADA81909.1 Ostreococcus lucimarinus virus OlV158 69
97346VPOLCC2 452 2-4; 882 0-2; 973 4-6; 1326 2-4 AKR54192.1 Micromonas virus RCC:4266 78
97346VPOLCC14 882 4-6; 973 4-6; 1326 2-4 AKR54181.1 Micromonas virus RCC:4236 86
132602VPOLCC4 882 6-8; 1326 0-2 ACP44143.1 Bathycoccus virus BpV178 79
132602VPOLCC8 1326 0-2, 2-4, 4-6, 6-8; 452 2-4 ACP44143.1 Bathycoccus virus BpV178 79
132602VPOLCC11 1326 0-2 AKR54192.1 Micromonas virus RCC:4266 82
132602VPOLCC19 1326 0-2 ACP44143.1 Bathycoccus virus BpV178 79
132624VPOLCC19 1326 2-4 YP_009174598.1 Yellowstone lake phycodnavirus 2 86
132646VPOLCC3 1326 0-2, 4-6 AKR54192.1 Micromonas virus RCC:4266 80
132646VPOLCC15 1326 4-6 ACP44120.1 Micromonas virus MiV130 80
158
Appendix Table 3.2. Search results from blastp for g20 OTU representative sequences.
OTU Stations and depths (cm)
present First Cultivated blastp match (#, name)
Percent Identity
(%)
45202CPSCC1 452 0-2; 1326 0-2, 2-4 YP_214363.1 Prochlorococcus phage P-SSM2 90
45202CPSCC2 452 0-2 YP_007001618.1 Synechococcus phage metaG-MbCM1 63
45202CPSCC3 452 0-2 AAC23540.1 Cyanophage S-BnM1 63
45202CPSCC12 452 0-2; 1326 0-2, 4-6 ABB17262.1 Synechococcus phage S-CBM2 66
45202CPSCC14 452 0-2 YP_007674507.1 Synechococcus phage S-SKS1 88
45202CPSCC19 452 0-2 ABB17262.1 Synechococcus phage S-CBM2 65
88202CPSCC2 882 0-2 YP_003097343.1 Synechococcus phage S-RSM4 92
88202CPSCC3 882 0-2 AAC23540.1 Cyanophage S-BnM1 65
88202CPSCC5 882 0-2, 2-4 YP_007674507.1 Synechococcus phage S-SKS1 89
88202CPSCC6 882 0-2 YP_004323487.1 Prochlorococcus phage P-HM2 62
88202CPSCC9 882 0-2 YP_009133666.1 Synechococcus phage ACG-2014g 68
88202CPSCC11 882 0-2 YP_004322786.1 Synechococcus phage S-ShM2 62
88202CPSCC13 882 0-2 ABB17262.1 Synechococcus phage S-CBM2 64
88202CPSCC17 882 0-2 YP_004322541.1 Prochlorococcus phage P-HM1 62
88202CPSCC18 882 0-2 YP_003097343.1 Synechococcus phage S-RSM4 94
88202CPSCC20 882 0-2 YP_004323727.1 Prochlorococcus phage Syn33 69
88224CPSCC1 882 2-4 YP_007673103.1 Synechococcus phage S-CAM1 94
88224CPSCC2 882 2-4 YP_195138.1 Synechococcus phage S-PM2 67
88224CPSCC4 882 2-4 YP_007673103.1 Synechococcus phage S-CAM1 92
88224CPSCC5 882 2-4 YP_214665.1 Prochlorococcus phage P-SSM4 65
88224CPSCC6 882 2-4 YP_004323487.1 Prochlorococcus phage P-HM2 59
88224CPSCC7 882 2-4; 1326 0-2 YP_007674507.1 Synechococcus phage S-SKS1 83
88224CPSCC8 882 2-4 AAK31670.1 Synechococcus phage S-PWM1 68
88224CPSCC11 882 2-4 YP_007001618.1 Synechococcus phage metaG-MbCM1 69
88224CPSCC14 882 2-4 YP_004324197.1 Synechococcus phage S-SSM7 85
88224CPSCC15 882 2-4 ACD93434.1 Cyanophage P-RSM5 90
88224CPSCC16 882 2-4 YP_004323727.1 Prochlorococcus phage Syn33 64
159
88224CPSCC18 882 2-4 AMO43137.1 Cyanophage S-RIM32 66
88224CPSCC20 882 2-4 YP_214363.1 Prochlorococcus phage P-SSM2 64
88246CPSCC2 882 0-2, 4-6; 973 0-2 YP_007673103.1 Synechococcus phage S-CAM1 94
88246CPSCC3 882 4-6 ABB17262.1 Synechococcus phage S-CBM2 64
88246CPSCC4 882 4-6 YP_009188207.1 Cyanophage P-TIM40 67
88246CPSCC7 882 4-6 YP_009213616.1 Prochlorococcus phage P-TIM68 68
88246CPSCC9 882 4-6 YP_717798.1 Synechococcus phage syn9 67
88246CPSCC10 882 4-6 AAK31670.1 Synechococcus phage S-PWM1 69
88246CPSCC11 882 4-6 ABB17262.1 Synechococcus phage S-CBM2 52
88246CPSCC13 882 4-6 YP_009188207.1 Cyanophage P-TIM40 64
88246CPSCC14 882 4-6 ABB17262.1 Synechococcus phage S-CBM2 67
88246CPSCC15 882 4-6 AAK31670.1 Synechococcus phage S-PWM1 72
88246CPSCC18 882 4-6 YP_214363.1 Prochlorococcus phage P-SSM2 91
88268CPSCC1 882 6-8 AAK31670.1 Synechococcus phage S-PWM1 69
88268CPSCC2 882 6-8 ABB17262.1 Synechococcus phage S-CBM2 66
88268CPSCC3 882 4-6, 6-8 YP_009188207.1 Cyanophage P-TIM40 64
88268CPSCC4 882 6-8 AAC23540.1 Cyanophage S-BnM1 70
88268CPSCC5 882 6-8 AIX46593.1 Synechococcus phage ACG-2014a 63
88268CPSCC6 882 6-8 ABB17262.1 Synechococcus phage S-CBM2 66
88268CPSCC8 882 6-8 YP_003097343.1 Synechococcus phage S-RSM4 91
88268CPSCC9 882 6-8 AAK31670.1 Synechococcus phage S-PWM1 68
88268CPSCC10 882 6-8 YP_004323020.1 Synechococcus phage S-SM1 70
88268CPSCC11 882 6-8 YP_717798.1 Synechococcus phage syn9 66
88268CPSCC13 882 6-8 YP_004323727.1 Prochlorococcus phage Syn33 59
88268CPSCC14 882 6-8 YP_009188207.1 Cyanophage P-TIM40 65
88268CPSCC15 882 6-8 AAC23540.1 Cyanophage S-BnM1 67
88268CPSCC16 882 6-8 YP_214665.1 Prochlorococcus phage P-SSM4 68
88268CPSCC17 882 6-8 YP_007001618.1 Synechococcus phage metaG-MbCM1 68
88268CPSCC18 882 6-8 YP_007673103.1 Synechococcus phage S-CAM1 60
88268CPSCC19 882 6-8 YP_007001618.1 Synechococcus phage metaG-MbCM1 65
88268CPSCC20 882 6-8 YP_007518198.1 Synechococcus phage S-RIM8 A.HR1 66
97302CPSCC1 882 0-2; 973 0-2 ABB17262.1 Synechococcus phage S-CBM2 62
97302CPSCC4 882 0-2, 2-4; 973 0-2 YP_004322270.1 Synechococcus phage S-SM2 66
160
97302CPSCC5 973 0-2 YP_009188207.1 Cyanophage P-TIM40 70
97302CPSCC6 973 0-2; 882 2-4 YP_004324197.1 Synechococcus phage S-SSM7 82
97302CPSCC8 973 0-2 YP_004322786.1 Synechococcus phage S-ShM2 66
97302CPSCC9 973 0-2 AAK31670.1 Synechococcus phage S-PWM1 68
97302CPSCC11 973 0-2 YP_007674507.1 Synechococcus phage S-SKS1 93
132602CPSCC1 1326 0-2 YP_004324197.1 Synechococcus phage S-SSM7 83
132602CPSCC3 1326 0-2 AAC23540.1 Cyanophage S-BnM1 67
132602CPSCC9 1326 0-2 YP_009140894.1 Synechococcus phage ACG-2014i 59
132602CPSCC10 1326 0-2 YP_004323264.1 Prochlorococcus phage P-RSM4 63
132602CPSCC16 1326 0-2 YP_004322270.1 Synechococcus phage S-SM2 85
132624CPSCC1 1326 2-4 YP_004322786.1 Synechococcus phage S-ShM2 70
132624CPSCC4 1326 2-4 YP_009213616.1 Prochlorococcus phage P-TIM68 81
132624CPSCC9 1326 2-4 YP_009188207.1 Cyanophage P-TIM40 67
132624CPSCC13 1326 2-4 YP_004322270.1 Synechococcus phage S-SM2 62
132646CPSCC1 1326 4-6 YP_004322270.1 Synechococcus phage S-SM2 85
132646CPSCC2 452 0-2; 1326 0-2, 2-4, 4-6 YP_214363.1 Prochlorococcus phage P-SSM2 90
161
Copyright Acknowledgements
Chapter 2 is reprinted with permission from The International Society for Microbial Ecology
Journal.
The original reference for this paper is as follows:
Long AM, Short SM. (2016). Seasonal determinations of algal virus decay rates reveal
overwintering in a temperate freshwater pond. ISME J 10: 1602–1612.