PCR Amplification Of Tem gene of ESBL E.coli

88
What are we working on?

Transcript of PCR Amplification Of Tem gene of ESBL E.coli

Page 1: PCR Amplification Of Tem gene of ESBL E.coli

What are we working on?

Page 2: PCR Amplification Of Tem gene of ESBL E.coli

In-vitro Production Of Short Nucleotides and SELEX Process

Page 3: PCR Amplification Of Tem gene of ESBL E.coli

Who are we?

Ramashree and Sajini

Page 4: PCR Amplification Of Tem gene of ESBL E.coli

This is going to be a long presentation!

(We will try our best to not make it boring)

Page 5: PCR Amplification Of Tem gene of ESBL E.coli

Forget the fancy title adorned by even fancier words

(Our project is for a noble cause)We are trying to find a cure for a microbe

that doesn’t respond to antibiotics

Page 6: PCR Amplification Of Tem gene of ESBL E.coli

• Our Project deals with a super strong bacteria that can kill people in different stages if left untreated.

• Oh wait! Treatment? What treatment? There is no cure.

• Didn’t we tell you that our bacteria was Super Strong?

Page 7: PCR Amplification Of Tem gene of ESBL E.coli

ESBL E.coli

It’s a mutant strain (hence, the mystery deepens!)

Page 8: PCR Amplification Of Tem gene of ESBL E.coli

ESBL E.coli

• ESBL stands for Extended Spectrum Beta Lactamase

• It means that this particular strain of E.coli is resistant to a wide range of antibiotics ( 8 different classes of antibiotics)

• We call our bacteria the Octobiotic Bacteria.(That is something we came up with)

Page 9: PCR Amplification Of Tem gene of ESBL E.coli

So, is it just a multidrug resistant microbe?

(pffft! What’s with all the hype?)

Page 10: PCR Amplification Of Tem gene of ESBL E.coli

• As much as we wish it were, IT IS NOT.• This strain of E.coli changes from being the

healthy bacteria that helps digest our food in our intestines to the mutant strain which can potentially kill us.

Page 11: PCR Amplification Of Tem gene of ESBL E.coli

WOW!Care to explain?

Page 12: PCR Amplification Of Tem gene of ESBL E.coli

Legend speaks of a legendary warrior – ESBL E.coli

(Once upon a time…….and the story unfolds)

Page 13: PCR Amplification Of Tem gene of ESBL E.coli

Chapter 1

Page 14: PCR Amplification Of Tem gene of ESBL E.coli

Nosocomial Infections

• Nosocomial infections are infections acquired by a resident of the hospital or a visitor to the hospital.

• Because hospitals are teaming with diseases harbored by a multitude of patients with an even bigger number of people visiting them

• Not to mention the army of nurses and doctors working there.

Page 15: PCR Amplification Of Tem gene of ESBL E.coli

Uhmmm, such as?

Page 16: PCR Amplification Of Tem gene of ESBL E.coli

Be scared. Be very scared!

• Urinary Tract Infections• Blood poisoning• Bacteremia• Gastro-intestinal and skin infections

Page 17: PCR Amplification Of Tem gene of ESBL E.coli

How does it get transmitted?

Page 18: PCR Amplification Of Tem gene of ESBL E.coli
Page 19: PCR Amplification Of Tem gene of ESBL E.coli

Who is responsible?

Is it you, Bacteria? Is it you, Fungus? Or is it you, Virus?

Page 20: PCR Amplification Of Tem gene of ESBL E.coli

SURPRISE!• It’s them all.• BACTERIA• VIRUS• FUNGUS• Parasites as well

Page 21: PCR Amplification Of Tem gene of ESBL E.coli

Meet the causative agents.

Page 22: PCR Amplification Of Tem gene of ESBL E.coli

We are concerned only about the bacterial

agents.

Page 23: PCR Amplification Of Tem gene of ESBL E.coli
Page 24: PCR Amplification Of Tem gene of ESBL E.coli

And this is what E.coli unleashes

Page 25: PCR Amplification Of Tem gene of ESBL E.coli

Urinary Tract Infection

Page 26: PCR Amplification Of Tem gene of ESBL E.coli

• Cloudy Urine• Pain while urinating• Burning sensations while urinating• Need to urinate often• Bloody urine• Foul smelling urine• Back pain

Page 27: PCR Amplification Of Tem gene of ESBL E.coli

And this is how they do it…

Page 28: PCR Amplification Of Tem gene of ESBL E.coli

Chapter 2

Page 29: PCR Amplification Of Tem gene of ESBL E.coli

ESBLWhat are you?

Page 30: PCR Amplification Of Tem gene of ESBL E.coli

Extended Spectrum Beta Lactamase

• They are enzymes that hydrolyze extended spectrum cephalosporins with an oxymino side chain

• These cephalasporins include cefotaxime, ceftriaxone, ceftazidime

• They are plasmid encoded enzymes.

Page 31: PCR Amplification Of Tem gene of ESBL E.coli

• The genes responsible are TEM-1, TEM-2 and SHV

• Mutations of these genes correspond to the altering of the amino acid configuration around the active site of these beta-lactamases.

Page 32: PCR Amplification Of Tem gene of ESBL E.coli

TEM-1

Amino acid substitutions take place at positions 104, 164, 238 and 240

Page 33: PCR Amplification Of Tem gene of ESBL E.coli

Chapter 3

Page 34: PCR Amplification Of Tem gene of ESBL E.coli

How do we fight it?

Page 35: PCR Amplification Of Tem gene of ESBL E.coli

WAR 1

• Collect ESBL E.coli isolates (from patients or from soil)

• Screen them• Confirm them

Page 36: PCR Amplification Of Tem gene of ESBL E.coli

CHARGE!

Page 37: PCR Amplification Of Tem gene of ESBL E.coli

Inoculation

• The sample was inoculated initially in 100ml of nutrient broth to which 10mg of ampicillin was added.

• In subsequent trials we changed the medium.• We inoculated the bacteria in Luria Bertani

broth.

Page 38: PCR Amplification Of Tem gene of ESBL E.coli

Screening – MH plate

Page 39: PCR Amplification Of Tem gene of ESBL E.coli

Sheesh!

Page 40: PCR Amplification Of Tem gene of ESBL E.coli

Success!

Page 41: PCR Amplification Of Tem gene of ESBL E.coli

Screening - DDSTAugmentin Disk (20µg of amoxilin + 10µg of clavulanic acid) in the centre surrounded by 3 cefotaxime tablets (30µg each)

Page 42: PCR Amplification Of Tem gene of ESBL E.coli

One down!

Page 43: PCR Amplification Of Tem gene of ESBL E.coli

WAR 2

• Isolate the DNA from the plasmid• Perform gel electrophoresis• Confirm by PCR amplification

Page 44: PCR Amplification Of Tem gene of ESBL E.coli

Chapter 4Plasmid DNA isolation

Page 45: PCR Amplification Of Tem gene of ESBL E.coli

Trial 1

• Bacteria was inoculated in Nutrient Broth• Two flasks containing 100 ml of broth were

taken• One contained ampicillin and the other did

not.• 1ml of culture was taken from each flask and

centrifuged at 10600rpm for 5 minutes

Page 46: PCR Amplification Of Tem gene of ESBL E.coli

Solutions 1, 2 & 3

• Solution 1: 50mM Glucose, 25mM Tris pH 8.0, 10mM EDTA pH 8.0 – Re-suspension Solution

• Solution 2: 0.2N NaOH, 1% SDS – Lysis Solution

• Solution 3: 60 ml of 5M Potassium Acetate, 11.5 ml of Glacial Acetic Acid and 28.5 ml of distilled water – Neutralizing Solution

• PCI mixture: 12.5% Phenol, 12% Chloroform and 0.5% Iso amyl alcohol

Page 47: PCR Amplification Of Tem gene of ESBL E.coli

• 200µl of ice-cold re-suspension buffer was added to the pellet and vortexed gently

• 10 mins later, 200µl of Lysis Buffer was added to the pellet and was incubated at RT

• 5 mins later, 200µl of Neutralizing solution was added ( a white precipitate was formed) and was incubated by keeping it in on ice.

Page 48: PCR Amplification Of Tem gene of ESBL E.coli

• 15 minutes later, the samples were centrifuged at 13000 rpm for 20 minutes at -4˚C

• Equal volume of PCI was added to the supernatant collected and vortexed

• It was centrifuged at 13000rpm for 5 minutes at RT and the supernatant was transferred to a fresh eppendorf tube.

Page 49: PCR Amplification Of Tem gene of ESBL E.coli

• 500µl of ice-cold ethanol (70%) was added and centrifuged at 10000 rpm for 10 minutes at -4˚C

• The alcohol was discarded and the pellet was air dried for 10 minutes

• The pellet was dissolved in 20µl of TE buffer(1X)

Page 50: PCR Amplification Of Tem gene of ESBL E.coli

1 2 3 4

Lane 1 - 100bp ladderLane 2 - Sample 1 (amp)Lane 3 - Sample 2 (w/o amp)Lane 4 - 1kb ladder

Page 51: PCR Amplification Of Tem gene of ESBL E.coli

Sigh!

Page 52: PCR Amplification Of Tem gene of ESBL E.coli

Trial 2

• We inoculated the bacteria in LB broth containing ampicillin.

• The same protocol was followed.

Page 53: PCR Amplification Of Tem gene of ESBL E.coli

1 2 3 4

Lane 1 - 100bp ladderLane 2 - Sample 1 (amp)Lane 3 - Sample 2 (amp)Lane 4 - 100bp ladder

Page 54: PCR Amplification Of Tem gene of ESBL E.coli

Oh no!

Page 55: PCR Amplification Of Tem gene of ESBL E.coli

Trial 3

• We used two samples taken from a culture grown overnight and a culture that was 2 days old.

• We added RNase to the TE buffer• The same protocol was followed.

Page 56: PCR Amplification Of Tem gene of ESBL E.coli

Lane 1 - 1kp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - Sample 3 (old)Lanes 5,6,7,8 - empty

1 2 3 4 5 6 7 8

Page 57: PCR Amplification Of Tem gene of ESBL E.coli

No. Not again!

Page 58: PCR Amplification Of Tem gene of ESBL E.coli

Trial 3

• We increased the cell mass by using 5ml of fresh culture (amp + LB broth)

• We increased the volume of the solutions added.

• From 200µl to 300µl of Lysis Buffer.• From 200µl to 250µl of Neutralizing solution

Page 59: PCR Amplification Of Tem gene of ESBL E.coli

1 2 3 4

Lane 1 - 1kp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - Sample 3 (old)

Page 60: PCR Amplification Of Tem gene of ESBL E.coli

Some hope.

Page 61: PCR Amplification Of Tem gene of ESBL E.coli

Trial 4

• We increased the incubation periods for each of the steps when the solutions are added.

• From 10 minutes to 30 minutes

Page 62: PCR Amplification Of Tem gene of ESBL E.coli

1 2 3 4

Lane 1 - 1k ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - 100bp ladder

Page 63: PCR Amplification Of Tem gene of ESBL E.coli

Nooooooo!

Page 64: PCR Amplification Of Tem gene of ESBL E.coli

Trial 5

• We realized that the increased exposure of the lysis solution to our bacterial cells degraded the DNA.

• We decreased the incubation from 30 minutes to 5 minutes and these were the observations

Page 65: PCR Amplification Of Tem gene of ESBL E.coli

Upon adding Lysis Buffer

Page 66: PCR Amplification Of Tem gene of ESBL E.coli

Upon adding neutralizing solution

Page 67: PCR Amplification Of Tem gene of ESBL E.coli

Centrifugation

Page 68: PCR Amplification Of Tem gene of ESBL E.coli

Cell Debris

Page 69: PCR Amplification Of Tem gene of ESBL E.coli

Centrifugation after adding PC

Page 70: PCR Amplification Of Tem gene of ESBL E.coli

Phase Separation

Page 71: PCR Amplification Of Tem gene of ESBL E.coli

Supernatant

Page 72: PCR Amplification Of Tem gene of ESBL E.coli

Upon adding isopropanol

Page 73: PCR Amplification Of Tem gene of ESBL E.coli

Centrifugation

Page 74: PCR Amplification Of Tem gene of ESBL E.coli

Pellet

Page 75: PCR Amplification Of Tem gene of ESBL E.coli

Supernatant discarded

Pellet

Page 76: PCR Amplification Of Tem gene of ESBL E.coli

Centrifugation after adding ethanol

Page 77: PCR Amplification Of Tem gene of ESBL E.coli

Final Pellet – Plasmid DNA

Pellet

Page 78: PCR Amplification Of Tem gene of ESBL E.coli

1 2 3 4 5

Lane 1 - 1kp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - Sample 3 (old)Lane 5 - Sample 4 (old)

Page 79: PCR Amplification Of Tem gene of ESBL E.coli

Finally!

Page 80: PCR Amplification Of Tem gene of ESBL E.coli

PCR• Milli Q water• Agarose• TBE buffer• Ethidium bromide• Primers (10p/ml)• Primer sequence (5’-3’)• TEM• TEM F CTTCCTGTTTTTGCTCAACCCA (717 bp)• TEM R TACGATACGGGAGGGCTTAC• PCR machine (eppendorf thermocyclometer)• Electrophoresis Unit

Page 81: PCR Amplification Of Tem gene of ESBL E.coli

Master mix :

• Distilled water -70µl• PCR Reaction buffer -10µl• dNTPs -2µl• Forward Primer -2µl• Reverse Primer -2µl• Taq Polymerase -2µlTotal volume was made to 22µl

Page 82: PCR Amplification Of Tem gene of ESBL E.coli

• Tube containing mastermix was spun and then 22µl of the mix was aliquoted into each of the PCR tubes.

• 3µl of the sample DNA was then added to those PCR tubes and finally the volume was made to 25µl.

• These tubes were then placed in a thermocycler and the program was set as follows.

Page 83: PCR Amplification Of Tem gene of ESBL E.coli

PCR Program

• Initial denaturation: 1min at 94°C• Annealing: 1min at 58°C• Extension: 1min at 72°C• Denaturation: 15sec at 95°C• Go to step 3 for 30 cycles• Final Extension: 7min at 72°C• 4°C forever• End

Page 84: PCR Amplification Of Tem gene of ESBL E.coli

1 2 3 4 5 6 7 8

Lane 1 - 100bp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - emptyLane 5 - Sample 3 (old)Lane 6 - Sample 4 (old)Lane 7 - Sample 5 (dh5α)Lane 8 – 1kb ladder

Page 85: PCR Amplification Of Tem gene of ESBL E.coli

White Flag!

Page 86: PCR Amplification Of Tem gene of ESBL E.coli

Chapter 5Same battle. New squad.

Page 87: PCR Amplification Of Tem gene of ESBL E.coli

Plasmid DNA isolation

• We decided to use a new bacterial culture hoping that the new bacteria would have a higher copy number which is essential for our plasmid DNA isolation. (copy number is directly proportional to the presence of plasmid in the bacterium)

• We repeated the isolation and performed PCR.

Page 88: PCR Amplification Of Tem gene of ESBL E.coli

Any questions?