[CANCER RESEARCH 49. 4740-4746. September 1. 1989]

Paraneoplastic Syndrome of Hypercalcemia and Leukocytosis Caused by SquamousCarcinoma Cells (T3M-1) Producing Parathyroid Hormone-related Protein,Inter leukin la, and Granulocyte Colony-stimulating Factor1-2

Kanji Sato,1 Yuko Fuji!, Terutaka Kakiuchi, Keizo Kasono, Hidehito Imamura, Yukio Kondo, Hiroyuki Mano,

Tetsuro Okabe, Shigetaka Asano, Fumimaro Takaku, Toshio Tsushima, and Kazuo ShizumeInstitute of Clinical Endocrinology. Tokyo Women's Medical College, Kawada-cho S-I, Shinjuku-ku, Tokyo 162 [K. Sa., K. K., l. H., T. T., K. Sh.J; Research Instituteof the Foundation for Growth Science in Japan [K. Sa., ¥.F., T. T., K. Sh.J, Shinjuku-ku, Tokyo; Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo[S. A., K. T.J; The Third Department of Internal Medicine, University of Tokyo [H. M., T. O.. F. T.], Hongo, Bunkyo-ku, Tokyo; and The First Department of InternalMedicine, Medical Center of the Saitama Medical School fY. K.J. Saitama, Japan

ABSTRACT

Previously we reported that a clonal squamous cell carcinoma cell line(T3M-1) derived from a lower jaw cancer of a patient with markedleukocytosis and hypercalcemia produced factors containing a potentbone-resorbing activity (BRA) (A/, 15,000-20,000) and a colony-stimulating activity. To elucidate the pathogenesis of this humoral hypercalcemia, BRA and colony-stimulating activity in both the conditionedmedium and cells were characterized.

The conditioned medium, when eluted at neutral pH, contained colony-stimulating activity and thymocyte proliferation-stimulating activity, thelatter of which comigrated with BRA. Upon elution with acetic acid (pH2.0), the conditioned medium contained no interleukin 1-like activity butpotent parathyroid hormone-like activity, which comigrated with BRA.Northern blot hydridization analysis revealed that T3M-1 cells producedconstitutively niKNA for parathyroid hormone-related protein and gran-ulocyte colony-stimulating factor. Furthermore, primer extension analysisrevealed that the cells also produced mRNA for interleukin la(IL-la).

Since parathyroid hormone-related protein and IL-la (osteoclast-activating factor) synergistically increase the concentration of serumcalcium, and since IL-la (hemopoietin 1) potentiates granulocyte colony-stimulating factor-induced granulocytopoiesis, we speculate that parathyroid hormone-related protein, granulocyte colony-stimulating factor, andIL-la are synergistically involved in a paraneoplastic syndrome of hypercalcemia and leukocytosis, at least in some patients with solid tumors.

INTRODUCTION

In Japan, more than 10 patients with solid tumors have beenreported to have developed marked leukocytosis and hypercalcemia (1-11). It was shown that these tumors produced CSF4

in excess amounts (3, 11), although the mechanism of thishumoral hypercalcemia remains to be elucidated.

We reported previously that a clonal squamous cell carcinoma cell line (T3M-5) derived from a squamous carcinoma of

Received 5/23/88; revised 4/7/89; accepted 5/17/89.The costs of publication of this article were defrayed in part by the payment

of page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1Part of this work was presented at the 59th Meeting of the Japan EndocrineSociety, Nagasaki, October 1986; the IXth International Conference on Calcium-regulating Hormones and Bone Metabolism. Nice. France, October 1986; and atthe 61st Meeting of the Japan Endocrine Society, July 1988.

2This work was supported by a Grant-in-Aid for Scientific Research from theMinistry of Education, Science and Culture, Japan (No. 61570563); a Granl-in-Aid for Cancer Research from the Ministry of Health and Welfare, Japan (62-26); a research grant from the Foundation for Growth Science in Japan (especiallydonations from Toshiko Sato); a research grant for bone-regulating peptides fromChugai Pharmaceutical Co.; and the Kalo Memorial Fund for Nambyou Research.

1Recipient of "Morning Star Award" of the Japan Endocrine Society. To

whom requests for reprints should be addressed.4 The abbreviations used are: CSF, colony-stimulating factor; BRA, bone-

resorbing activity; BRF, bone-resorbing factor; CSA, colony-stimulating activity;G-CSF, granulocyte colony-stimulating factor; IL-la, interleukin In; LAF, lymphocyte-activating factor; IL-2, interleukin 2, PHA, phytohemagglutinin; PTH,parathyroid hormone; PTH-rP, parathyroid hormone-related protein; rhIL-la,recombinant human IL-ln; PGE2, prostaglandin E2; poly(A)+ RNA, polyadeny-lated RNA: SSC, standard saline-citrate (1 x SSC = 150 mM NaCl-10 mM citrate,pH 7.4); cDNA. complementar) DNA; SDS, sodium dodecyl sulfate.

the thyroid of a 71-year-old patient with marked leukocytosisand hypercalcemia produced CSF and a potent BRF (1). ThisBRF was found to differ from CSF in terms of molecular weight(CSF, -30,000; BRF, -15,000) and could not be physicochem-ically separated from IL-1-like activity. The BRA and IL-1-likeactivity were completely inactivated by anti-IL-la antibody,suggesting that the IL-la-like factor produced by the tumor isrelated to malignancy-associated hypercalcemia.

Using another cell line (T3M-1) derived from a lower jawcancer of a 33-year-old patient with marked leukocytosis andhypercalcemia, which also produced CSF and BRF (12, 13), wehave found that this cell line constitutively produced mRNAfor G-CSF and IL-la. However, in view of a recent report (14)that almost all squamous cell carcinomas produce PTH-rP, ahypercalcemia-inducing factor produced by malignant tumors(15, 16), we reevaluated our data and found that, when theconditioned medium was eluted in acid solution, a potent bone-resorbing factor containing no IL-1 but possessing PTH-likeactivity was detected. Furthermore, we studied whether in vivoadministration of PTH-rP and G-CSF together with IL-lacould simulate a paraneoplastic syndrome of hypercalcemia andleukocytosis.

MATERIALS AND METHODS

Source of Tumor and Cells. Tumor LJC-1-JCK was a squamous cellcarcinoma with associated hypercalcemia and granulocytosis both inthe patient from which it was derived and in nude mice bearing thetumor (3). A clonal CSF-producing tumor cell line (T3M-1) was established from the tumor (17). Conditioned medium of T3M-1 cells (F-10medium supplemented with 5% fetal calf serum) was prepared asdescribed previously (1) and concentrated 10-20-fold by ultrafiltration,using a PM-10 membrane (Amicon, Tokyo, Japan). TC-78 cells werederived from an anaplastic cell carcinoma of the thyroid in a patientwho did not develop hypercalcemia. These cells, when transplantedinto nude mice, did not elicit hypercalcemia.

Gel Chromatography and Ion Exchange Chromatography. About 6 mlof concentrated conditioned medium were applied to a column ofSephadex G-75 (2.2 x 83 cm) equilibrated with 0.9% NaCl solutioncontaining 10 mM Tris-HCl (pH 7.4), 0.02% sodium azide, and 0.02%Tween 20. Eluate fractions, each about 5.5 ml in volume, were collectedand samples were prepared as described previously (1). These werestored at 4'C until assayed for PTH-like activity, CSA, BRA, and IL-

1-like activity. In several experiments, eluates from the Sephadex G-75column containing BRA and IL-1-like activity were applied to a DEAE-Sepharose column (1). Eluates from the Sephadex G-75 column containing CSA and BRA were dialyzed against distilled water and subjected to isoelectric focusing Chromatography as described previously(1).

In some experiments, concentrated conditioned medium was acidified to pH 2.0 by adding acetic acid and then applied to a Sephadex G-75 column (2.2 x 83 cm) equilibrated with 0.1 M acetic acid (pH 2.0).The column was eluted with 0.1 M acetic acid. Eluate fractions, eachabout 6.8 ml, were lyophilized in an evaporator. Each residue was

4740

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HYPERCALCEMIA AND LEUKOCYTOSIS

dissolved in 6 ml of minimum essential medium containing 0.2% bovineserum albumin, sterilized with a Millipore filter, and stored at 4°Cuntil

assayed for PTH-like activity, BRA, and IL-1-like activity.BRA. BRA was assayed as described previously (12). Pregnant ICR

mice were given s.c. injections of 10 ßCiof 45Ca on the 16th day of

gestation. On the 17th day, the fetuses were removed, the shafts of theradii and ulnae were dissected out, and the bones were cultured in 1 mlof minimum essential medium. After a 48-h preculture period, thebones were transferred to test or control media (0.5 ml). After 3 daysof culture, 45Ca release from bones in the test medium was comparedto 45Carelease in the control culture. BRA was expressed as

% of 45Ca release = Medium dpmMedium dpm + bone dpm

x 100

All assays were performed in quadruplicate using bones from fourfetuses. Statistical significance was analyzed by Student's i test.

CSA. CSA was assayed by the methylcellulose method using bonemarrow cells as described previously (12). CSA was expressed as thenumber of colonies (>50 cells) formed per 60,000 mouse bone marrowcells after 7 days of culture. CSA induced by a 10% sample (v/v) wasshown in the results.

PTH-like Activity. PTH-like activity was assayed by stimulation ofadenylate cyclase in ROS 17/2.8 osteoblastic cells as described previously (1, 18). Cyclic AMP produced in ROS 17/2.8-5 subclonal cellswas determined using a radioimmunoassay kit (NEN-033-10; NewEngland Nuclear, Boston, MA). Each sample was tested in triplicateculture. Data were expressed as pmol of cyclic AMP produced/dish/15min.

IL-1-like Activity. IL-1-like activity was assessed by LAP assay inthe presence or absence of PHA as described previously (1). The resultswere expressed as the arithmetic means of cpm ['Hjthymidine incor

porated into C3H/HeJ mouse thymocytes in triplicate cultures (1.5 xIO6 cells/well). An IL-1 standard was usually prepared using mouse

macrophage hybridoma cells stimulated with bacterial endotoxin (1).One unit of LAP activity was defined as the half-maximal concentrationrequired to stimulate mouse thymocyte proliferation in the presence ofPHA. As reported previously (19), 10 units/ml rhIL-1«(supplied byDainippon Pharmaceutical Co., Suita, Osaka, Japan) (20) producedmaximal stimulation of thymocyte proliferation, which was usually 55-80% of that attained by the IL-1 standard prepared from mouse

hybridomas (1).IL-2 Activity. IL-2 activity was assayed by the ['HJthymidine incor

poration of an IL-2-dependent T-cell line, CTLL, as described previously (21).

Effects of Anti-IL-1 Antiserum on IL-1-like Activity and BRA. Poly-clonal anti-IL-la and anti-IL-1/3 antisera were supplied by DainipponPharmaceutical Co. and Otsuka Pharmaceutical Co. (Tokushima, Japan), respectively. Each antiserum was highly specific for the antigen,as reported previously (1). After samples had been treated with variousconcentrations of antiserum for 3 h, IL-1-like activity and BRA weredetermined as described above.

Conditioned medium after 3 days of culture was stored at —¿�20°C

and the PGE: concentration was determined using a radioimmunoassaykit (NEK-020A; NEN Research Products, N. Billerica, MA) (1).

Demonstration of G-CSF niRV\ by Northern Blot Hybridization.Total RNA was extracted from T3M-1 cells by the acid guanidiniummethod (22). Poly(A) + RNA was selected by the use of an oligodeox-

ythymidylate cellulose column. Two Mgof sample were run on 1.2%agarose gels containing 6% formaldehyde (23). RNA was transferredto a synthetic nylon transfer membrane using 20 x SCC.

Membranes were hybridized overnight to the 12P-labeled human G-CSF cDNA at 42°Cin 50% formamide, 5 x SCC, 50 HIM sodiumphosphate, 5 x Denhardt's solution, 0.1% SDS, denatured salmon

sperm DNA (0.1 mg/ml), and 10% dextran sulfate. The filter waswashed in 2 x SCC/0.1% SDS for 15 min at room temperature, andin 0.2 x SCC/0.1% SDS for 30 min at 65°C.After drying, the

membranes were exposed to X-ray film with an intensifying screen for

15 h.DNA probe (generously supplied by Amgen, Inc., Thousand Oaks,

CA) was labeled to a specific activity of -10'' cpm/Mg. The G-CSF

probe was the Hgi\l-Dral fragment of cloned human G-CSF cDNA(24).

Northern Blot Analysis of mRNA for PTH-rP. Two nucleotide DNAprobes, hybridizable to the NH2-terminal region, 5'd(TACGTC-GCCTCTGACCAAGTCGTCACCTCG)3',andtotheCOOH-terminalregion, 5 ' d(TTCTTTTTCTTTCCGTTCGGGCCCTTTGCGTTC)3 ',

of PTH-rP (15), were synthesized by an automated DNA synthesizer(Pharmaceutical Laboratory, Kirin Brewery Co., Maebashi, Japan).Total RNA was prepared from T3M-1 cells and TC-78 cells by theguanidinium thiocyanate method followed by CsCl centrifugation.Poly(A) + RNA was selected by oligodeoxythymidylate cellulose column chromatography. Equivalent amounts of RNA (10 ¿ig)were elec-

trophoresed in agarose/formaldehyde gels, blotted to nylon filters, andhybridized with the "P-labeled, synthetic cDNA probe for PTH-rP.

Invariability of amounts of poly(A) + RNA loaded on the gel waschecked by rehybridization of the filter with 0-actin cDNA as a probe.

Demonstration of M-lo mRNA by Primer Extension. As a positivecontrol, HL-60 cells, a promyelocytic cell line in which IL-1 productionhad been induced by culturing with lipopolysaccharide and phorbolmyristate 13-acetate, were used (20). As another positive control, PTH-like factor-producing EC-GI cells established from an esophageal carcinoma of a patient with humoral hypercalcemia were used. This cellline was recently proved to produce IL-1«mRNA, both constitutivelyand exclusively, by Northern blot analysis (25). Total RNAs of T3M-1cells and EC-GI cells were prepared by the guanidinium thiocyanate-CsCl method of Chirgwin et al. (26). Poly(A) + RNA was isolated frominduced HL-60 cells as described previously (20).

The primer for IL-la mRNA was a synthetic 25-mer oligodeoxyri-bonucleotide having a sequence corresponding to positions -8 to 17 ofhuman IL-la (20). The primer for IL-1/3 mRNA was a synthetic 21-mer oligodeoxyribonucleotide having a sequence corresponding to positions 594 to 614 of the human \L-\0 cDNA sequence (27).

Primer extension was performed essentially as described previously(28). The oligodeoxyribonucleotide was end-labeled with ¡7-l:P]ATP

and T4 polynucleotide kinase. The end-labeled oligonucleotide wasannealed to 10 Mgof poly(A) + RNA from induced HL-60 cells or to50 Mgfrom total RNA of EC-GI cells and T3M-1 cells, and extendedat 42°Cfor l h by 20 units of reverse transcriptase. The products were

analyzed by electrophoresis on 8 M urea-6% polyacrylamide gel.Continuous Infusion of Recombinant Human Il-l«and G-CSF into

Mice. Male ICR mice (5 weeks old) weighing about 24-27 g werepurchased from Japan Clea Co. (Tokyo, Japan). The animals were fedrat chow (MF; Oriental Yeast Co., Tokyo, Japan) and water ad libitum.Osmotic pumps (model 2001; 1 M'/h, Alza Corp., Palo Alto, CA) wereloaded with rhlL-1« in 0.9% NaCl containing 10% mouse serum,penicillin (100 units/ml), streptomycin (100 Mg/ml), and Fungizone (1Mg/ml) and inserted s.c. into the mice as described elsewhere (29). IL-1 was infused at a rate of 1 Mg/day for 7 days. Control mice receivedan osmotic pump containing vehicle alone. From day 1, recombinanthuman G-CSF (1.25 Mg/100 M!saline) (30) was administered s.c. twiceper day for 7 days. Control mice received 100 M' of saline twice perday.

After 7 days, mice were anesthetized with ether, and blood was drawnfrom the orbita for leukocyte counting; whole blood was collected fromthe inferior vena cava. The spleen was then weighed. Serum calciumconcentrations were determined using a calorimetrie assay kit (RM117-K; latron Laboratories, Inc., Tokyo, Japan).

RESULTS

CSA, BRA, IL-1-like Activity, and PTH-like Activity on GelFiltration in Neutral Buffer. As reported previously (13), T3M-1 cells produced a potent CSA and BRA but no definite PTH-like activity (Fig. 1), when the sample was eluted with 0.9%saline containing 10 mM Tris-HCl buffer (pH 7.2). CSA waseluted as a single peak with an apparent molecular weight of20,000-30,000. In some lots of the conditioned medium, asmall peak of CSA was detected in the fraction around position38 (12), but the data in Fig. 1 are presented without this peak.

4741

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HYPERCALCEMIA AND LEUKOCYTOSIS

~ 60

"5 40

.3

D 20

Q.

OQ.

n

i""

V.«BSA

* *

RNase A5Ca

*

***>

Io

¡r\

20

o °5" a3. ñ

CT) ~O

5 f" IS: à

8 °

10 20 30 40 50 60

Fraction numberFig. 1. PTH-like activity, BRA. CSA, and IL-1-like activity of conditioned

medium of T3M-1 cells. Conditioned medium of T3M-1 cells (200 ml) wasconcentrated to 12 ml. About 5 ml were applied to a Sephadex G-75 column andeluted with 0.9% NaCI solution containing 0.02% sodium azide. 0.02% Tween20. and 10 mM Tris-HCI buffer (pH 7.2). Each eluate (5.5 ml/tube) was dialyzedextensively against 0.9% NaCI (three times) and minimum essential medium(once) (I). PTH-like activity (top, O) was expressed as cyclic AMP produced byROS 17/2.8-5 cells/35-mm dish. Data are means ±SD (bars) for triplicatecultures. BRA (top, D) was expressed as the percentage of 45Ca release from

prelabeled fetal mouse forearm bones during 3 days of culture. Data are means ±SD for quadruplicate cultures. CSA (top, •¿�)was expressed as the number ofcolonies formed per 6 x IO4 mouse bone marrow cells during 7 days of culture.

Data are means for duplicate cultures. IL-1-like activity was expressed as cpm of|'H|thymidine (['//)-TtlR) incorporated into C3H/HeJ mouse thymocytes in the

presence (bottom. •¿�)or absence (O) of PHA. Data are means for triplicatecultures. Maximal thymocyte proliferation induced by supernatant of macrophagehybridoma was 15,733 ±1,683 cpm. Protein concentration ( ) was measuredas described previously ( I ). The column markers are blue dextran for void volume(V.V.), bovine serum albumin (BSA; 67.000). RNase (13,700) and "'Ca (45).

BRA was also eluted as a single peak with an apparent molecular weight of 15,000-20,000.

Consistent with our previous findings (12), the BRA fractionof the T3M-1 conditioned medium was directly mitogenic formurine thymocytes in the absence of PHA, although only to asmall extent. However, a much more potent LAP activity wasdetected in the presence of PHA and this IL-1-like activityexactly coeluted with BRA, as shown in Fig. 1. Although T3M-1cells produced such a potent IL-1-like activity, no IL-2 activitywas detected throughout the eluates (data not shown).

Serial dilution studies of rhIL-la and fractions containingthe BRA revealed that the peak of IL-1-like activity (fraction

38) contained LAP activity equivalent to more than 20 units/ml rhIL-la, which is sufficient to elicit bone résorptionper se

(19).PTH-like Activity, BRA, and IL-1-like Activity on Gel Filtra

tion with Acetic Acid Elution. In contrast to Fig. 1, when anacidified sample was eluted in 100 mM acetic acid and thelyophilized sample was assayed immediately without any dialysis, a potent PTH-like activity was demonstrated in fractionscorresponding to a molecular weight of 6,000-30,000 (Fig. 2).

BRA was widely detected in fractions 18-42. This BRA couldnot have been due to IL-1-like activity, since no definite IL-1-

like activity was detected in the eluates. The BRA was largelycoeluted with PTH-like activity but the most potent BRA wasdetected in fraction 38, whereas the most potent PTH-likeactivity was detected in fractions 26-29 with an apparent molecular weight larger than that of RNase (13,700), suggestingthat BRA of PTH-rP fragments with the NH2-terminal regionis more potent than intact PTH-rP(l-141) (M, 16,200) (31).

Furthermore, another BRA peak was detected near the voidvolume (fraction 18) in the absence of PTH-like or IL-1-like

activity, but this BRA was not characterized further.Physicochemical Properties of CSA, BRA, and IL-1-like Ac

tivity. The isoelectric point (pi) of CSA was 5.2, whereas thatof BRA was around 4.8-5.3, at which IL-1-like activity wasdetected. The pi of rhIL-la was 5.2-5.3 (data not shown).

In order to further substantiate that BRA was present withinthe IL-1-like active fraction, fractions (fractions 32-42 of Sephadex G-75 eluates in Fig. 1) were applied to a DEAE-Sepharosecolumn and eluted with a linear gradient of NaCI (0-0.2 M). Asshown in Fig. 3, IL-1-like activity was eluted as two separate

peaks, peak A and peak B. BRA was also eluted as two separatepeaks, which exactly corresponded to each peak of IL-1-likeactivity.

When the fractions in peaks A and B were subjected to

.£ 40;o

Q.2<

30

20

10

_, 60

Oí<n<B0)

aio

in 20

D

--»•-•-••»••».»».»••-•»9-».»-*.».-

V.V BSA•¿�OO

R NAseO

°Ca

Q.

6 InO•¿�o

* I

f2 ^

1X

O,

15

10 ~

id5 ÈF

10 20 30

Fraction

50 60

number

Fig. 2. PTH-like activity. IL-1-like activity, and BRA from Sephadex G-75elution with acetic acid. Concentrated T3M-1 conditioned medium (5 ml) wasacidified to pH 2.0 by adding acetic acid and then applied to a Sephadex G-75column which had been equilibrated with 100 mM acetic acid (pH 2.0). Eacheluate (6.8 ml) was lyophilized by an evaporator and the residues were dissolvedin 6 ml minimum essential medium containing 0.2% bovine serum albumin(BSA). After sterilizing by passage through a Millipore filter, each sample wasassayed for PTH-like activity (top, •¿� •¿�),IL-1-like activity (top, •¿�—•).and BRA (bottom, D) as indicated in Fig. 1. V.V., void volume; \'H]-TdR.(3H]thymidine; bars, SD. *, P < 0.01, compared with control (fraction 1).

4742

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HYPERCALCEMIA AND LEUKOCYTOSIS

~ 60<binao>

au

LO

D'o

20

15

eoi10oaooC

et•¿�o

I J.

Peak A•¿�0.5

10

Fraction numberFig. 3. BRA and LAP activity from DEAE-Sepharose ion-exchange column

chromatography. Fractions containing BRA and IL-1-Iike activity [tubes 33-41(Fig. 1)] were combined and applied to a DEAE-Sepharose column (1). After awashing with 2 volumes of the buffer, the column was eluted with a linear gradientof 0-0.2 M NaCI solution, followed by 0.5 M NaCl solution. Samples weredialyzed extensively against 0.9% NaCl (4 times) and minimum essential medium(once). BRA and IL-1-like activity were expressed as shown in the legend to Fig.l.",F< 0.05, compared with control (fraction 4).

Table I Effects of anli-IL-1 antiserum on thymocyte proliferation-stimulatingactivity produced by TÃŒM-Icells

Fractions containing IL-1-like activity [eluates from DEAE-Sepharose columnchromatography, (Fig. 3. peaks A and B)] were assayed for thymocyte proliferation-stimulating activity in the presence of anti-IL-ln or anti-IL-10 antiserum asindicated above. Maximal thymocyte proliferation induced by supernatant ofmouse hybridoma in the presence of PHA was 28,349 ±3,732 cpm (mean ±SD,n = 3). Data are means ±SD for triplicate cultures.

[3H]Thymidine incorporation(cpm)Antiserum(-)Anti-IL-la1/42,0001/4,2001/420Anti-IL-lß1/63,0001/6,3001/630Control348

±84282

±63244±20304±181327

±81244±17309±52Peak

A8,057

±1653,024

±504"457±50°292±107°'*6,572

±9465,291±85911.290+

1,450°Peak

B11,719±

2.1168,271

±1,5331,0423439,2838,156201°65°'*50184724,449

7,225°

' P < 0.05, antiserum (—)versus antiserum (+).1Not significantly different from control (P> 0.1).

electrofocusing chromatography, their respective pi values were5.3 and 4.8.

Effects of Anti-IL-1 Antisera on BRA and LAF Activity. Anti-IL-la antiserum dose dependently and completely inactivatedthe LAF activity of peaks A and peak B of the T3M-1 conditioned medium (Table 1), whereas anti-IL-lß antiserum didnot. For some unknown reason, anti-IL-10 antiserum at a lowdilution (1/630) did not inactivate the LAF activities producedby T3M-1 cells but significantly enhanced them. These peculiarphenomenon was observed in all three experiments, although asimilar observation using rhIL-la was reported previously (1).

In accord with these findings, the BRA containing IL-1-likeactivity (Fig. 1) was completely inactivated by anti-IL-la anti-serum but not by anti-IL-1/3 antiserum (Table 2). The bonerésorptionelicited by the BRA produced by T3M-1 cells wasaccompanied by a marked increase in PGE? released into theculture medium, which was completely abolished by anti-IL-laantiserum but not at all by anti-IL-1/3 antiserum (Table 2).

These findings suggest that the BRA and LAF activitiesproduced by T3M-1 cells are very similar to those produced byT3M-5 cells and EC-GI cells (1, 25), and physicochemicallyand immunologically indistinguishable from IL-la.

Demonstration of G-CSF and PTH-rP mRNA by NorthernBlot Hybridization. As reported previously (12, 17), T3M-1cells produced CSF, which predominantly stimulated the formation of granulocyte colonies. Consistent with these findings,T3M-1 cells produced G-CSF mRNA (Fig. 4) and the size ofthe G-CSF message was exactly the same (1.6 kilobases) as thatfound in another G-CSF-producing cell line (30).

Consistent with the bioassay, T3M-1 cells also producedmRNA for PTH-rP. At least two sizes of PTH-rP mRNA were

demonstrated; one is smaller than 28S, the other larger than18S. In contrast to T3M-1 cells, no PTH-rP mRNA band wasdetected in TC-78 cells, which do not elicit hypercalcemia intumor-bearing nude mice (Fig. 5).

Demonstration of IL-la mRNA by Primer Extension. Thepresence of IL-1 mRNA in total RNA isolated from T3M-1

cells was examined by primer extension analysis, using a synthetic 25-mer primer complementary to human IL-la mRNA.It has recently been demonstrated that a 25-mer primer for IL-la mRNA was extended to a cap site of IL-la mRNA by 51nucleotides to produce a 76-nucleotide cDNA band upon urea-polyacrylamide gel electrophoresis (28).

As shown in Fig. 6, an extended product of 76 nucleotideswas observed in 50 Mgof T3M-1 cell mRNA (Lane B) as wellas in 10 ng of mRNA from induced HL-60 cells (Lane A) and50 ¿igof EC-GI cell mRNA (Lane C). However, no extendedproduct was observed in the case of uninduced HL-60 cells

(data not shown).The same experiment was performed for IL-lßmRNA using

a 21-mer primer which was expected, from the IL-1/3 genomicsequence, to be extended to a cap site of IL-ißmRNA by 594nucleotides (32). By this experiment, no IL-1/3 mRNA wasidentified in the total RNA of T3M-1 cells or in that of EC-GIcells (data not shown).

Effect of in VivoAdministration of IL-la and G-CSF on SerumCalcium Concentration and Leukocyte Count. The peripheralblood leukocyte count in control nude mice was ~5000/mm\Continuous infusion of IL-la alone at a rate of 1 /¿g/dayfor 7days produced leukocytosis (58,000/mm1). More marked leu-

kocytosis was elicited by administration of G-CSF (107,000/

Table 2 Effects ofanti-IL-l antiserum on 45Ca release and PGE2 production

Anti-lL-1«and aim II 1 - antisera (0.1 ml) were added at final dilutions of I/400 and 1/200, respectively, to 0.4 ml of minimum essential medium containing0.2% bovine serum albumin (control) or fractions containing BRA of T3M-1 cells[fractions 38-42 (Fig. 1)[. After 3 days of culture, 4!Ca release and PGEjconcentration in the medium were determined as described in "Materials andMethods." Data are means ±SD for quadruplicate cultures.

45Ca release(%)Antiserum(-)

Anti-IL-lnAnti-IL-1/3Control20.4

±2.821.0 ±3.221.5 ±3.0T3M-136.2

±7.4°18.4 ±1.1*40.4 ±9.0°PGE2

concentration(pg/ml)Control14.5

±10.722.4 ±14.027.5 ±13.7T3M-I1,083

±532°32.5 ±14.8"

1,226 ±428°

" P < 0.05, control versus T3M-1.* Not significantly different from control (P > 0.1).

4743

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HYPERCALCEMIA AND LEUKOCYTOSIS

28S

4185

18S

Fig. 4. Northern blot analysis of the G-CSF gene. Poly(A) + RNA (2 /.g)selected by use of an oligodeoxythymidylate column was denatured, electrophoresed through agarose-formaldehyde gel, transferred to a filter, and hybridizedwith the 32P-labeled G-CSF cDNA under stringent conditions. Ordinate, sizemarkers of rRNAs.

mm'). Simultaneous administration of G-CSF and IL-1 causedat least additive leukocytosis in mice (171,000/mm1). In thesemice, the spleen was enlarged about 5-fold compared with thecontrol, suggesting markedly stimulated granulocytopoiesis inthe spleen (Table 3).

Administration of IL-la for 7 days caused only a slight andnot significant increase in serum calcium concentration. Also,administration of G-CSF together with IL-la had little effecton serum calcium concentration (Table 3).

DISCUSSION

We have demonstrated that T3M-1 cells, which were derivedfrom a squamous cell carcinoma of a patient with leukocytosisand hypercalcemia, constitutively produce G-CSF and a potentBRF that is physicochemically, immunologically, and genetically identical to IL-la. Our previous findings (12) that BRFproduced by T3M-1 cells stimulated PGE2 production in fetalmouse forearm bones and that the bone résorptioninduced bythis factor was partially inhibited by indomethacin were reproduced by rhIL-la (19). As with T3M-5 cells and EC-GI cells(1, 25), the IL-la-like factor produced by T3M-1 cells showeddifferent ionic charges (peak A, pi 5.3; peak B, pi 4.8). Such acharge heterogeneity of IL-la probably reflects the presence ofproducts due to deamidation and/or partial degradation byproteinases (33).

TC78

T3

1Fig. 5. Northern blot analysis of the PTH-rP gene. Poly(A) + RNA was

prepared from TC-78 cells and T3M-1 cells. Nude mice transplanted with T3M-1 cells developed marked hypercalcemia, whereas those transplanted with TC-78cells did not. Poly(A) + RNA (10 fig each) was electrophoresed through agarose-formaldehyde gel, transferred to a filter, and hybridized with the 3!P-labeled,synthetic cDNA for PTH-rP. Ordinate, size markers of rRNAs.

IL-1, a monokine usually produced by activated macrophages, is elaborated by a number of normal tissues and malignant cells (34). In view of the fact that keratinocytes alsoproduce mRNA for IL-1 a and IL-1/3 (35) as well as for PTH-rP (16, 36), it is not surprising that several hypercalcemia-producing cell lines derived from squamous cell carcinomas(T3M-5, EC-GI, and T3M-1) produce IL-1«(1, 25) in additionto PTH-rP. Therefore, we propose that not only PTH-rP butalso IL-la should be added to the list of potential mediators ofmalignancy-associated hypercalcemia (37), even though it isproduced by solid tumors.

In addition to IL-la, T3M-1 cells produce another BRFcontaining PTH-like activity, and we have demonstrated thatthese cells constitutively produced PTH-rP mRNA. The failureof our previous study to demonstrate PTH-like activity (13)might be due to gel filtration in neutral buffer and extensivedialysis (for 3-4 days) of the sample before bioassay for bonerésorption.This was done to remove sodium azide and Tween20, and a dialysis membrane with a molecular weight cutoff of10,000 was used. Probably, PTH-rP, a highly basic protein witha pi of 11.0 (31), had become adsorbed to the gels, plastic tubes,and dialysis membrane or was degraded during storage prior tobioassay for PTH-like activity. It is also likely that activefragments of PTH-rP with a smaller molecular weight were lostduring dialysis. Recently we also found that T3M-5 cells (1),another squamous carcinoma line established from a patientwith hypercalcemia and leukocytosis, contained immunoreac-tive PTH-rP in the conditioned medium, and PTH-like activitywas demonstrated when the sample was eluted with acid buffer.5

Therefore, these findings are consistent with the recent notionthat squamous cell carcinomas ubiquitously produce PTH-rP(14, 38).

Consistent with a recent report (16) that Northern blot analy-

5Unpublished observation.

4744

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HYPERCALCEMIA AND LEUKOCYTOS1S

A B0 -*>

1385*

517-396-298•¿�»

226~

154-

75-*

Fig. 6. Detection of IL-1 mRNA by primer extension. The end-labeled 25-mer primer (a synthetic oligodeoxyribonucleotide complementary to human IL-la mRNA) was annealed to poly(A) + RNA (10 fig) from induced HL-60 cells(Lane A), total RNA (50 >ig)from T3M-1 cells (Lane B), or total RNA (50 ^g)from EC-GI cells (Lane C), and extended at 42°Cfor l h by reverse transcriptase.The transcripts were analyzed by electrophoresis on an 8 M urea-6% polyacryl-amide gel. The size markers are Pstl-Hinfl fragments of pBR322 DNA, thelengths of which are indicated in nucleotides. The positive bands of the end-labeled primer, which was extended from 25-mer to 76-mer deoxyribonucleotidesin the presence of reverse transcriptase, indicate the presence of IL-1«mRNA inthese cell lines.

Table 3 Effects of IL-1 a and G-CSF on serum calcium concentration andperipheral blood leukocyte count in mice

An osmotic minipump loaded with vehicle or IL-1 was implanted into each of20 mice. IL-lo was infused at a rate of 1 fig/day for 7 days. G-CSF was injecteds.c. at a dose of 1.25 |jg/100 p\ saline twice a day for 7 days. Six h after the lastinjection, mice were sacrificed and the number of leukocytes, serum calciumconcentration, and spleen weight were determined as described in "Materials andMethods." Data are means ±SD for 5 mice.

ControlIL-la(l„g/day)

G-CSF (2.5 i/g/day)IL-lo + G-CSFSerum

calcium(mg/dl)9.2

±0.209.8 ±0.319.7 ±0.269.6 ±0.19WBC/mm'4.760

±2,16057,600 ±9,600°

107,000 ±12,600°171,000 ±35,900°Spleen

(mg)105

±18301 ±39"419 ±83*540 ±73°"

P< 0.001.ft/><0.01.

sis of PTH-rP mRNAs from multiple tumors associated withhumoral hypercalcemia of cancer revealed a complex patternof several hybridizing transcripts, T3M-1 cells produced at leasttwo forms of PTH-rP mRNA, which is very similar to that ofYSC-B, a squamous cell carcinoma causing humoral hypercalcemia (16). As postulated by Broadus et al. (38), the most likelyexplanation for these multiple species of PTH-rP mRNAs isalternative RNA processing (39).

It is of great interest that a clonal cell line derived from apatient with leukocytosis and hypercalcemia simultaneouslyproduces PTH-rP, G-CSF, and IL-la. G-CSF, which stimulatesgranulocyte proliferation and differentiation in vitro and in vivo(40), can be produced by squamous carcinoma cells and wasmolecularly cloned from these sources (30). Of particular interest is the recent finding that hemopoietin 1, a CSF-potentiatingfactor produced by tumor cell line HBT 5637, is identical toIL-1 a (41) and that in vivo administration of G-CSF and IL-lacaused a greater than additive stimulation of stem cell recoveryand hematopoietic regeneration in fluorouracil-treated mice(42). We have shown that in vivo administration of G-CSF andIL-la in mice causes at least an additive effect on peripheralblood neutrophil count but no effect on serum calcium concentration. The latter findings are also consistent with our in vitroobservation that G-CSF had no effect on bone résorptioninduced by IL-la (data not shown). Therefore, it is possible thatexcessive production of IL-la and G-CSF was synergisticallyresponsible for eliciting the marked leukocytosis seen in thepatients.

IL-1 a is a potent BRF in vitro (19), and when a large amountis administered in vivo in mice, it can elicit hypercalcemia (43).Previously we demonstrated that IL-la, although less potent ininducing hypercalcemia per se in comparison with PTH orPTH-rP, synergistically stimulated PTH-rP-induced bone résorption in vitro and aggravated PTH-rP-induced hypercalcemia in mice in vivo (29). Therefore, by analogy with theproduction of PTH-rP and IL-la by EC-GI cells (25), it is veryreasonable to postulate that both BRFs were synergisticallyresponsible for eliciting the humoral hypercalcemia in both thepatient and the tumor-bearing nude mice.

In Japan, more than 10 patients with solid tumors have beenreported to have developed marked leukocytosis and hypercalcemia (1-11). Most of these tumors were squamous cell carcinomas. The clinical course of these patients was rapid; theyusually died of intractable hypercalcemia within a few monthsafter onset of hypercalcemia. Now that we have demonstratedthat at least two squamous cell carcinoma cell lines (T3M-1,T3M-5) derived from patients with hypercalcemia and leukocytosis constitutively produce CSF, IL-la, and PTH-rP, wepropose that the marked leukocytosis and hypercalcemia seenin some patients with solid tumors may constitute a new para-neoplastic syndrome. It is very intriguing that most of thesepatients have been reported in Japan, although a similar casehas also certainly been confirmed in the United States (41, 44).

In summary, we have demonstrated that T3M-1 cells established from a patient with marked leukocytosis and hypercalcemia produced constitutively IL-la, G-CSF, and PTH-rP. Wealso demonstrated that IL-1 elicited dual effects on the development of this paraneoplastic syndrome, i.e., as an osteoclast-activating factor for PTH-rP-induced hypercalcemia and ashemopoietin 1 for G-CSF-induced leukocytosis.

ACKNOWLEDGMENTS

The authors are greatly indebted to Dr. Masaaki Yamada and Dr.Yasuji Furutani of the Research Laboratories, Dainippon Pharmaceutical Co., for performing the primer extension studies.

REFERENCES

1. Sato, K., Fujii, Y., Ono, M., Nomura, H.. and Shizume, K. Production ofinterleukin la-like factor and colony-stimulating factor by a squamous cellcarcinoma of the thyroid (T3M-5) derived from a patient with hypercalcemiaand leukocytosis. Cancer Res., 47: 6474-6480, 1987.

4745

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HYPERCALCEMIA AND LEUKOCYTOSIS

2. Himori. T., Ujüe,S., Sugawara, N., Sugiyama, Y., Kananiaru. T., and Saito, 23.T. Marked leukocytosis in patients with advanced lung cancers. Jpn. J. Clin.Hematol. (Jpn.). 18: 187-201, 1977.

3. Kondo, Y., Sato, K., Ohkawa, H., Ueyama, Y., Okabe, T.. Sato, N., Asano,S., Mori, M., Ohsawa, N., and Kosaka, K. Association of hypercalcemia with 24.tumours producing colony-stimulating factor(s). Cancer Res., 43:2368-2374.1983.

4. Suzuki, S., Saito, T., Takai, K.. Matsuda, F., Kuzuya. K., and Yoshida, S. Acase of the uterus carcinoma associated with hypercalcemia and leukocytosis.Jpn. J. Intern. Med., 70: 614. 1981. 25.

5. Saito, K., Kuratomi, Y., Yamamoto. K., Saito, T., Kuzuya, T., Yoshida, S.,Moriyama, S.. and Takahashi, A. Primary squamous cell carcinoma of thethyroid associated with marked leukocytosis and hypercalcemia. Cancer(Phila.). 48: 2080-2083. 1981. 26.

6. Toya. M.. Kuroda, T., Obuchi, M., Ikawa, T., Habu. K., and Ishikawa, T. Acase report of the maxillary cancer associated with marked leukocytosis andhypercalcemia. J. Otolaryngol. (Jpn.), 84: 1554-1561, 1981. 27.

7. Yoneda, T., Bessho, M., Nishioka, N.. Matsumoto, K.. and Sakuda. M.Pathogenesis of hypercalcemia and leukocytosis in a patient with tonguecancer. Jpn. J. Oral. Surg.. 31: 1917-1924, 1985. 28.

8. Kanai. M., Furusawa, A., Unoura, M., Tanaka. N., Kobayashi, K., Hattori,N., and Nakanuma. Y. A case of epidermoid carcinoma of tongue associatedwith marked hypercalcemia and granulocytosis. Naika (Jpn.). 57: 585-588, 29.1986.

9. Misaki, M., Morioka, K., and Tsushima. G. A case of hepatocellular carcinoma with marked hypercalcemia and granulocytosis. Naika (Jpn.). 60:812-815, 1987.

10. Inouc, D., Sukawa. H., Hosoda, K., Miyamoto, M., Takahashi. T., Mori, T., 30.lumia. H., Kitamura, N., and Yamamoto, I. Establishment of undifferen-tiated carcinoma of the thyroid and characterization of the humoral factors.Folia Endocrinol. Jpn., 63: 1051. 1987.

11. Sato, N., Asano, S., Ueyama, Y., Mori, M., Okabe, T., Kondo, Y., Ohsawa, 31.N.. and Kosaka. K. Granulocytosis and colony-stimulating activity (CSA)produced by a human squamous cell carcinoma. Cancer (Phila.), 43: 605-610. 1979.

12. Sato. K.. Mimura. H., Han, D., Kakiuchi, T., Ueyama. Y., Ohkawa, H.,Okabe, T., Kondo, Y., Ohsawa, N., Tsushima, T., and Shizumc, K. Produc- 32.lion of bone-resorbing activity and colony-stimulating activity in vivo and invitro by a human squamous cell carcinoma associated with hypercalcemiaand leukocytosis. J. Clin. Invest., 78: 145-154, 1986.

13. Sato. K., Fujii, Y., Kakiuchi, T., Kasono, K.. and Shizume, K. Production of 33.interleukin 1«(IL-la)-like activity and colony-stimulating activity by clona)squamous cell carcinomas derived from patients with hypercalcemia andleukocytosis. In: D. V. Cohn, T. J. Martin, P. J. Meunier, (eds.). Calcium 34.Regulation and Bone Metabolism: Basic and Clinical Aspects, Vol. 9, pp.149-154. Amsterdam: Elsevier Scientific Publishers, 1987. 35.

14. Danks, J. A., Ebeling, P. R., Rodda, C. P., Hayman, J., Chou, S. T.. Moseley,J. M., Dunlop. J. M., Kemp, B. E.. and Martin. T. J. Immunocytochemicallocalization of parathyroid hormone-related protein of cancer. Tenth AnnualMeeting of the American Society for Bone and Mineral Research. June 1988,New Orleans. Abstract 581. 36.

15. Suva, L. J., Winslow, G. A., Wettenhall. R. E. H., Hammonds. R. G.,Moseley, J. M., Diefenbach-Jagger, H., Rodda, C. P., Kemp, B. E., Rodriguez. H., Chen, E. Y., Hudson, P. J., Martin, T. J.. and Wood. W. I. A 37.parathyroid hormone-related protein implicated in malignant hypercalcemia:cloning and expression. Science (Wash. DC). 237: 893-896. 1987. 38.

16. Mangin, M.. Webb, A. C.. Dryer. B. E., Posillico, J. T., Ikeda, K., Weir, E.C., Stewart, A. F., Bander, N. H.. Milstone, L.. Barton. D. E.. Francke, LI.,and Broadus, A. E. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercal- 39.cemia of malignancy. Proc. Nati. Acad. Sci. USA, 85: 597-601, 1989.

17. Okabe, T., Sato, N., Kondo, Y., Asano, S., Ohsawa, N., and Ueyama, Y.Establishment and characterization of a human cancer cell line that produces 40.human colony-stimulating factor. Cancer Res., 38: 3910-3917, 1978.

18. Sato, K., Han, D., Ozawa, M., Fujii, Y., Tsushima, T., and Shizume, K. Ahighly sensitive bioassay for PTH using ROS 17/2.8 subclonal cells. ActaEndocrinol., 116: 113-120, 1987.

19. Sato, K., Fujii, Y., Kasono, K., Saji, M., Tsushima. T., and Shizume, K. 41.Stimulation of prostaglandin E2 and bone résorptionby recombinant humaninterleukin 1«in fetal mouse bones. Biochem. Biophys. Res. Commun.. 138:618-624. 1986.

20. Furutani, Y., Notake, M., Yamayoshi, M., Yamagishi, M., Nomura, H. 42.Ohue, M., Furuta. R., Fukui. T., Y'amada, M.. and Nakamura, S. Cloningand characterization of the cDNAs for human and rabbit interleukin-1precursor. Nucí.Acids Res.. 13: 5869-5882. 1985.

21. Nariuchi. H., Mizuguchi. J., Taira, S., and Kakiuchi, T. Establishment of T- 43.cell hybridoma constitutive!) producing macrophage-dependent T-cell replacing factor. Cell. Immunol., 97: 34-43, 1986.

22. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by 44.acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: 156-159, 1987.

Mano, H.. Nishida. J.. Usuki, K., Maru, Y., Kobayashi, Y., Hirai, H., Okabe,T., Urabe, A., and Takaku, F. Constitutive expression of the granulocyte-macrophage colony-stimulating factor gene in human solid tumors. Jpn. J.Cancer Res., 78: 1041-1043, 1987.Souza, L. M., Boone. T. C, Gabrilove, J., Lai, P. H., Zsebo, K. M., Murdock,D. C., Chazin, V. R.. Bruszewski, J., Lu, H., Chen, K. K., Barendt, J..Platzer. E.. Moore. M. A. S., Mertelsmann, R., and Weite, K. Recombinanthuman granulocyte colony-stimulating factor: effects on normal and leukemicmyeloid cells. Science (Wash. DC), 232: 61-65. 1986.Sato, K., Fujii, Y.. Kasono, K., Tsushima, T., and Shizume, K. Productionof ¡nterleukinla and a parathyroid hormone-like factor by a squamous cellcarcinoma of the esophagus (EC-GI) derived from a patient with hypercalcemia. J. Clin. Endocrinol. Metab. 67: 592-601, 1988.Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J.Isolation of biologically active ribonucleic acid from sources enriched inribonuclease. Biochemistry, 18: 5294-5299, 1979.Auron, P. E., Webb. A. C., Rosenwasser. L. J., Mucci, S. F., Rich, A., Wolff,5. M., and Dinarello, C. A. Nucleotide sequence of human monocyte inler-leukin 1 precursor cDNA. Proc. Nati. Acad. Sci. USA, 81:7907-7911,1984.Furutani, Y., Notake, M., Fukui, T., Ohue, M., Nomura, H., Yamada, M.,and Nakamura. S. Complete nucleotide sequence of the gene for human¡nterleukin1«.Nucí.Acids Res., 14: 3167-3179, 1986.Sato, K., Fujii, Y., Kasono, K., Imamura. H., Ozawa, M., Kurosawa, H.,Tsushima, T.. and Shizume, K. Parathyroid hormone-related protein andinterleukin 1«synergistically stimulate bone résorptionin vitro and increaseserum calcium concentration in mice in vivo. Endocrinology, 124: 2172-2178, 1989.Nagata, S., Tsuchiya, M., Asano, S., Kaziro, Y., Yamazaki, T., Yamamoto,O., Hirata, Y., Kubota, N., Oheda, M., Nomura. H., and Ono, M. Molecularcloning and expression of cDNA for human granulocyte colony-stimulatingfactor. Nature (Lond.), 319:415-418, 1986.Thorikay, M.. Kramer. S., Reynolds, F. H., Sorvillo, J. M.. Doescher, L.,Wu, T.. Morris, C. A.. Burtis. W. J., Insogna, K. L., Valenzuela, D. M., andStewart, A. F. Synthesis of a gene encoding parathyroid hormone-like pro-tein-( 1-141): purification and biological characterization of the expressedprotein. Endocrinology, 124: 111-118, 1989.Clark, B. D., Collins, K. L., Gandy, M. S., Webb, A. C., and Auron, P. E.Genomic sequence for human prointerleukin l ß:possible evolution from areverse transcribed prointerleukin la gene. Nucí.Acids Res., 14:7897-7914,1986.Cameron, P. M., Limjuco, G. A., Chin, J., Silberstein, L., and Schmidt, L.A. Purification to homogeneity and amino acid sequence analysis of twoanionic species of human interleukin 1. J. Exp. Med., 164: 237-250, 1986.Oppenheim, J. J.. Kovacs, E. J., Matsushima, K., and Durum, S. K. Thereis more than one interleukin I. Immunol. Today 7: 45-56, 1986.Kupper, T. S., Ballard. D. W.. Chua, A. O., McGuire, J. S., Flood, P. M.,Horowitz, M. C., Langdon. R., Lightfoot. L.. and Gubler, U. Humankeratinocytes contain mRNA indistinguishable from monocyte interleukinla and /i mRNA. Keratinocyte epidermal cell-derived thymocyte-activatingfactor is identical to interleukin 1. J. Exp. Med., 164: 2095-2100, 1986.Merendino, J. J., Insogna, K. L., Milstone, L. M., Broadus, A. E., andStewart, A. F. A parathyroid hormone-like protein from cultured humankeratinocytes. Science (Wash. DC), 231: 388-390, 1986.Mundy, G. R. Hypercalcemia of malignancy revised. J. Clin. Invest. 82: 1-6, 1988.Broadus, A. E., Mangin, M., Ikeda, K., Insogna. K. L., Weir, E. C., Burtis,W. J., and Stewart, A. F. Humoral hypercalcemia of cancer. Identificationof a novel parathyroid hormone-like protein. N. Engl. J. Med., 319: 556-563. 1988.Leff, S. E., Rosenfeld, M. G., and Evans, R. M. Complex transcriptionalunits: diversity in gene expression by alternative RNA processing. Annu.Rev. Biochem., 55: 1091-1117, 1986.Tamura. M., Hattori, K., Nomura, H., Oheda, M., Kubota. N., Imazeki, L,Ono, M., Ueyama. Y., Nagata. S., Shirafuji, N.. and Asano, S. Induction ofneutrophilic granulopoiesis in mice by administration of purified humannative granulocyte colony-stimulating factor (G-CSF). Biochem. Biophys.Res. Commun.. 142: 454-460. 1987.Mochizuki. D. Y., Eisenman. J. R., Conlon, P. J., Larsen, A. D., andTushinski. R. J. Interleukin 1 regulates hematopoietic activity, a role previously ascribed to hemopoietin 1. Proc. Nati. Acad. Sci. USA, 84: 5267-5271,1987.Moore, M. A. S.. and Warren, D. J. Synergy of interleukin 1 and granulocytecolony-stimulating factor: in vivo stimulation of stem-cell recovery andhematopoietic regeneration following 5-fluorouracil treatment of mice. Proc.Nati. Acad. Sci. USA, «*7134-7138, 1987.Sabatini, M.. Boyce, B., Aufdemorte, T.. Boncwald. L., and Mundy, G. R.Infusions of recombinant human interleukin In and If) cause hypercalcemiain normal mice. Proc. Nati. Acad. Sci. USA, 85: 5235-5238, 1988.Riddle, P. E., and Dincsoy, H. P. Primary squamous cell carcinoma of thethyroid associated with leukocytosis and hypercalcemia. Arch. Pathol. Lab.Med., //7:373-374. 1987.

4746

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1989;49:4740-4746. Cancer Res   Kanji Sato, Yuko Fujii, Terutaka Kakiuchi, et al.   Granulocyte Colony-stimulating Factor

, andαParathyroid Hormone-related Protein, Interleukin 1Caused by Squamous Carcinoma Cells (T3M-1) Producing Paraneoplastic Syndrome of Hypercalcemia and Leukocytosis

  Updated version

  http://cancerres.aacrjournals.org/content/49/17/4740

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/49/17/4740To request permission to re-use all or part of this article, use this link

on March 7, 2021. © 1989 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from