PAGE #1 OF PAGE #1 O PART# SUB-1739 2015 SUBARU ......the mounting tabs through the grille. Use a...
2
2015 SUBARU IMPREZA 2015 SUBARU IMPREZA UPPER GRILLE INST UPPER GRILLE INSTALL ALL PART# SUB-1739 PART# SUB-1739 (3) #8 “FLAT” NUT (3) #8 X 5/8” HEX SCREWS (1) #8 “U-NUT” (1) #8 X 1” HEX SCREWS PAGE #1 OF For further installation details check our website installs Tel:310-970-0300 Fax:310-970-0400 www.grillcraft.com Our Project Subaru Impreza Needing a GrillCraft Grille. Removing the 10mm bolts and Plastic Clips holding the upper bumper retainer underneath the hood. In the wheel-wells, you'll need to remove the upper clip holding the bumper by pushing the center of the clip inward, then remove it. Underneath the bumper, remove the clips holding the bumper cover to the lower plastics. Once all hardware is removed, you can unclip the bumper from the vehicle by pulling towards you from the wheel-well & under the bumper. Disconnect the bumper-lights by pushing the center-tab inward. Remove the upper grille shell from the bumper by unscrewing the Phillips screws along the perimeter and unclipping it from the bumper. Place your new mesh insert into the bumper opening. Using a sharp scribe tool, mark the locations of the mounting tabs through the grille. Use a 3/16" drill bit to make the necessary mounting holes. Recomended: Paint the area behind the grille BLACK to give a clean, professional installation. To do this trace the back of the grille and tape it off in preparation for painting. 2 0 0 0 1 1 1 5 5 5 5 S S S S S UBARU IMP P P P P R R R RE E E E Z Z Z Z A A A A 2 2 2 2 2 2 0 0 0 0 0 0 0 1 1 1 1 1 5 S S S S S U U U U UB B B B B BARU I MP RE E E E E Z Z Z Z Z A A A 2 2 2 2 2 2 2 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 S S S S S S U U U U U U U UB B B B BARU I MP P P P P P R R R R R R R R R RE E E E E E E E Z Z Z Z Z Z A A A A A A A A 2 2 2 2 2 0 0 0 0 0 0 0 1 1 1 1 1 1 5 5 5 5 5 5 5 S S S S S S S S S U U U U U U UB B B B B B BARU I MP R R R R R R RE E E E E E E Z Z Z Z Z Z Z A A A A A A A UP P P P P P P E E E E E E R R R R R G G GR R R RI L LE INST UP P E R R R R R G G G GR R R R RI L L L L L L L L E I NS T UP P P P P P P E E E E E E E E R R R R R R R R R G G G G G G G G GR R R R R R R RI I I I I I I I L L L L L L L L L L L L L L E I NS T UP P E E E E E E E E R R R R R R R G G G G G G GR R R R R R RI I I I I I L L L L L L L L L L L L L L E I NS T AL L L L L L T T ALL T T T T T T ALL ALL T T P P P P P P P P P A A A A A A A A AR R R R R R RT T T T T T T# # # # # # # # # SUB B B B B B B- - - - -1 1 1 1 1 1 1 1 17 7 7 7 7 7 7 7 73 3 3 3 3 3 3 3 3 39 9 9 9 9 9 9 9 9 P P P P P P P P A A A A A A A A AR R R R R R R R R RT T T T T T T T# SUB B B B B B B B B- - - - - - -1 1 1 1 1 1 1 1 17 7 7 7 7 7 7 7 73 3 3 3 3 3 3 39 9 9 9 9 9 9 9 (3 (3 (3 (3 (3 (3 (3 (3) ) ) ) ) ) ) ) #8 #8 #8 #8 #8 #8 #8 #8 “ “ “ “ “ “ “ “F F FL F F F F F AT” NU NU NU NU NU NU NU UT T T T T T T T (3 (3 (3 (3 (3 (3 (3) ) ) ) ) ) ) ) #8 #8 #8 #8 #8 #8 #8 X X 5/8” HEX EX EX EX EX EX EX X X S S S S S S S SCR CR CR CR CR CR CR R CRE E E EW E E E S (1 (1 (1 (1 (1 (1 ( (1) ) ) #8 “U-NUT” (1) #8 X 1” HEX SCREWS PAGE #1 O O O O O O O O OF F F F F F F F F F Fo F F F r further inst t t t t t tal al al al al al al a la a a la la la l la ati ti ti ti ti ti t ti t on on on on on on on n n d d d d d d d de e et e e e e e e ails c c c c c c c che he he he e e he he eck ck ck ck ck ck ck ck o o o o o o o our ur ur ur ur ur ur r w w w w w w w website installs s s s s s Te Te Te Te Te Te Te Te el: l: l: l: l: l: l 31 31 31 31 31 31 3 3 3 0- 0- 0- 0- 0- 0 0- 0 97 97 97 97 97 9 97 970- 0- 0- 0- 0- 0- 0- 0-03 03 03 03 03 03 3 0 00 Fax: x x x: x: x x x 31 31 31 31 31 31 31 310- 0 0- 0- 0 0- 0- 0- 0-9 9 9 97 9 9 0-0400 w w w w ww w w.grillcraf t.com Our ur ur ur r ur ur Pr Pr P Pr Pr Pr Pr Pr P oje e oje oje oje oje oject ct ct t ct ct t ct Sub Su Sub ub Sub Sub Sub S aru aru aru aru aru aru aru Im Im Im Im Im Im Imp p p pre p za Needing a Gri Gri Gri Gri Gri ri Gri ri G llC llC llC llC llC llC lC C Craf raf raf raf raf f raf r t Grille. Removing the 10mm mm mm mm mm m m m m bol bol bol bol bol bol bo o ts s ts ts ts s s t and and and and and nd nd Pl Pl Pl Pl Pl Pl P ast ast ast ast ast st ast tic ic ic ic ic ic ic c C C Cli C C C C ps holding the upp p p er er er er er er r u bum bum bum bum bum bum bum bu pe pe per pe pe pe re re re re re re r r tai ta ta tai ta tai ta ner ner ner ner er ner ner un u u u un u derneath the he he he he he h ho ho ho ho h ho ho hood. od od od od od od In n n n n n n the the he the the he he e wh w w w w w w eel-wells, you'll need to r r o r o r o r remo emo emo emo emo em emo mo e ve ve ve e e ve ve e e the the the t the the the the upp upp pp upp upp up p er clip holding the bumper er er er er er by by by by by by by pus pus pus pus pus pu us pus pushin h hin hin h hin hin hing t g t g t g t g t g th h he he h h h he center of the clip inwar ar ar ar ar ard, d, d, d, d, d d d the the the the the th h h n n n r n r n n emo emo emo emo emo emo ove ve ve ve ve ve ve it. it it. it. it. it. it. Und Und Und Und Und Und d nd dern ern ern ern ern ern ern r eat eat eat eat eat t e th the bum m m m m m m mper per per per per per e e er , r , r , r , r , r , r , remo mo mo mo o mo emove ve v ve ve v ve v the the the the the the e he cl cl cl cl cl cl cli ips ho ho ho hol ho ho h din din din din din din di di g g t g g g g g he he he he he he he b b bum b b b b per co o o o o over ver ver ver ver ve ver v to to to to to t to th th th th th th t e l e l e l e l el el e owe owe owe owe owe owe o ow r plastics. Once all har har har har har har r ar hardwa dwa dwa dwa dwa dwa are r r r is removed, you ou ou ou ou ou u ca ca ca ca ca ca c n u n u n n n u n u n ncl ncl ncl ncl ncl ncl lip ip ip ip ip ip p the bu u u u u mpe mpe mp mpe mpe mpe mpe mp rf r f rf rf rf rf rf from rom rom rom rom rom rom th t th th th th t e vehicle by by by by by y by by pu pu pu pu pu p p lli li li li li li ling ng ng ng ng ng ng tow tow tow tow ow ow o ard ard ard ard ard ard ard rds s s s s s s you you you you you you you you yo fr fr fr fr fr fr rom om om om om m om om m the th the the the the the h wh wh wh wh wh whee ee ee eel ee ee ee e -well & u u u u u u unde nde nde nde nde nde nde de der t r t r t r t rt r t r t the e e he he e he e e bum bum bum bum bum bum bum bu u per per per per per per per per . Disconnect the bumper-lights by pushing the center ter er ter ter er ter e -ta -ta -ta -ta -ta -tab inward. Remove th th th th h th th the u e u e u eu e e e e pp ppe ppe pp pp pp p r g g g g gril ril ril ril ril r ri le e e e e e e e she she she she she she h she ell l ll ll ll ll f from the bumper by uns uns uns uns uns uns uns n u cre c cre cre cre cre crewin win win win win win ng t g t g t g t g t g the he he he he he he he Phi Phi P Phi Phi Phi Phi hilli lli lli lli lli li ips screws along the per per p per per per pe e ime ime ime me ime me e i ter ter ter te ter ter ter r an n n n an n nd u du d u d u du d uncl ncl l ncl ncl ncl ncl nc ip ip ip ipp ip ip ing it from the bumper. Place your new mesh i i h i h i h i h i inse nse nse ns ns ns ns ns rt t rt rt rt rt t int n nt nt nt nt nto t t t t t o t t t the he he he he he bum bum um um bum um um u p p per p p p p ope ope ope ope ope pe openin nin nin ni nin ning. g g g g g g g Usi Usi Usi Usi Usi Usi Us ng ng ng ng g ng ng a s a s as as a s a s shar har har ha ha har ha h p scribe tool, mark the loc oc oc oc oc ocati at at ati ati ati ati at ons ons ons ons ons ons ons o o of o o o o the the the th the the th t mounting tabs through t t t t t t the he he he he e he h h gri gri gri gri g gri grille le le e le e e. Use Use Use Use Use Use se Use a 3 3 3/1 3 3 3 3 6" drill bit to to to to to to to ma ma ma ma ma ma make ke ke ke ke ke ke ke the the the the the the the ne ne ne ne ne ne ne eces ces ces ces ces ces s ces e sar sa sa sa sa sa sa a s y mounti nt nt nt nt nt t t ng ng ng ng ng ng ng ho ho h hol ho h ho h es. es es. es. es es es. es. es. Recomende e e ed: d d d d d d Paint the area behind d d d d d d th th th th th th th the g e g e g e g e g g e g gril il il ril ril i ille e e e e e BLACK to to to o to to to to giv giv giv giv giv give a e a e a ea e a e e clean, profession ion on on on n on ion onal al al al al al al ins ns ns ns ns insta tal ta ta ta ta lat at at at at t tion on ion on on ion ion on. T To T To T To T do this trace the back of the grille and tape it off in preparation for painting.
Transcript of PAGE #1 OF PAGE #1 O PART# SUB-1739 2015 SUBARU ......the mounting tabs through the grille. Use a...
2015 SUBARU IMPREZA2015 SUBARU IMPREZA UPPER GRILLE INSTUPPER GRILLE INSTALLALLPART# SUB-1739
PART# SUB-1739(3) #8 “FLAT” NUT(3) #8 X 5/8” HEX SCREWS(1) #8 “U-NUT”(1) #8 X 1” HEX SCREWS
PAGE #1 OF
For further installation details check our website installsTel:310-970-0300 Fax:310-970-0400
www.grillcraft.com
Our Project Subaru Impreza Needing aGrillCraft Grille.
Removing the 10mm bolts and Plastic Clipsholding the upper bumper retainer underneath
the hood.
In the wheel-wells, you'll need to remove theupper clip holding the bumper by pushing the
center of the clip inward, then remove it.
Underneath the bumper, remove the clipsholding the bumper cover to the lower plastics.
Once all hardware is removed, you can unclipthe bumper from the vehicle by pulling towardsyou from the wheel-well & under the bumper.
Disconnect the bumper-lights by pushing thecenter-tab inward.
Remove the upper grille shell from the bumperby unscrewing the Phillips screws along theperimeter and unclipping it from the bumper.
Place your new mesh insert into the bumperopening.
Using a sharp scribe tool, mark the locations ofthe mounting tabs through the grille.
Use a 3/16" drill bit to make the necessarymounting holes.
Recomended: Paint the area behind the grilleBLACK to give a clean, professional installation.
To do this trace the back of the grille and tapeit off in preparation for painting.
200011155555 SSSSSUBARU IMPPPPPRRRREEEEZZZZAAAA2222220000000111115 SSSSSUUUUUBBBBBBARU IMPREEEEEZZZZZAAA222222200000001111111155555555 SSSSSSUUUUUUUUBBBBBARU IMPPPPPPRRRRRRRRRREEEEEEEEZZZZZZAAAAAAAA2222200000001111115555555 SSSSSSSSSUUUUUUUBBBBBBBARU IMPRRRRRRREEEEEEEZZZZZZZAAAAAAA UPPPPPPPEEEEEERRRRR GGGRRRRILLE INSTUPPERRRRR GGGGRRRRRILLLLLLLLE INSTUPPPPPPPEEEEEEEERRRRRRRRR GGGGGGGGGRRRRRRRRIIIIIIIILLLLLLLLLLLLLLE INSTUPPEEEEEEEERRRRRRR GGGGGGGRRRRRRRIIIIIILLLLLLLLLLLLLLE INSTALLLLLLTTALLTTTTTTALLALLTTPPPPPPPPPAAAAAAAAARRRRRRRTTTTTTT######### SUBBBBBBB-----1111111117777777773333333333999999999
PPPPPPPPAAAAAAAAARRRRRRRRRRTTTTTTTT# SUBBBBBBBBB-------1111111117777777773333333399999999(3(3(3(3(3(3(3(3) ))))))) #8#8#8#8#8#8#8#8 ““““““““FFFLFFFFF AT” NUNUNUNUNUNUNUUTTTTTTTT(3(3(3(3(3(3(3) ) ) ) ))) )) #8#8#8#8#8#8#8 X X 5/8” HEXEXEXEXEXEXEXXX S S S SSSSSCRCRCRCRCRCRCRRCREEEEWEEE S(1(1(1(1(1(1((1)) ) #8 “U-NUT”(1) #8 X 1” HEX SCREWS
PAGE #1 OOOOOOOOOFFFFFFF
FFFFoFFF r further instttttttalalalalalalala laaalalalallaatitititititittit onononononononnn d d d d dd ddeeeteeeeee ails ccccccccheheheheeeheheeckckckckckckckck ooo ooooourururururururr wwwwwwwwebsite installsssssssTeTeTeTeTeTeTeTeel:l:l:l:l:l:l 313131313131333 0-0-0-0-0-00-0 9797979797997970-0-0-0-0-0-0-0-03030303030330 00 Fax:xxx:x:xxx 31313131313131310-00-0-00-0-0-0-9999799 0-0400
wwwwwww w.grillcraft.com
Oururururrurur Pr PrP Pr PrPr PrPrP ojeeojeojeojeojeoject ct ct tct cttct SubSuSububSubSubSubS aruaruaruaruaruraruaru ImImImImImImImpppprep za Needing aGriGriGriGriGririGririG llCllCllCllCllCllClCCCrafrafrafrafraffrafr t Grille.
Removing the 10mm mm mm mm mm mmmm bolbolbolbolbolbolboo ts sts tsts sst andandandandandndnd PlPlPlPlPlPlP astastastastaststasttic ic icic icicicc CCCliCCCC psholding the upppppppperererer ererr ubumbumbumbumbumbumbumbu pepeperpepepe rererererererr taitatataitataita nernernernerernerner un u u u un u derneath
theheheheheheh hohoho hohhohohood.odododododod
In nnnnnn thethehethethehehee whwwwwww eel-wells, you'll need to rro ro ro r remoemoemoemoemoememomoe ve veveeeveveee thethethetthethethetheuppuppppuppuppupp er clip holding the bumper er er er erer by by by by byby by puspuspuspuspuspuuspuspushinhhinhinhhinhinhing tg tg tg tg tg thhhehehhhhe
center of the clip inwarararararard,d,d,d,d, ddd thethethethethethhh n n n rn rn n emoemoemoemoemoemooveve ve veve veve it.itit.it.it.it.it.
UndUndUndUndUndUnddnddernernernernernernernr eateateateateatte th the bummmmmmmmperperperperperpereeer, r, r, r, r, r, r, remomomomoomoemovevevve vevvev thethethethethetheehe clclclclclclcliipshohohoholhohoh dindindindindindindidi gg tgggggg he he he hehe he he bbbumbbbb per cooooooverververververveverv to to to to to t to th thththththt e le le le le le le oweoweoweoweoweoweoow r plastics.
Once all harharharharharharrarhardwadwadwadwadwadwaare rrr is removed, yououououououu ca ca caca ca cac n un unn n un un nclnclnclnclnclncllipipipipipippthe buuuuuumpempempmpempempempemp r fr fr fr fr fr fr fr fromromromromromromrom thtththththt e vehicle bybybybybyybyby pu pu pu pu pu p p llililililililing ngng ng ng ng ngg towtowtowtowowowo ardardardardardardardrdsssssssyouyouyouyouyouyouyouyouyo frfrfr frfr frrom om om om om mom omm theththethethethetheh whwhwhwhwhwheeeeeeeeleeeeeee -well & uuuuuuundendendendendendendededer tr tr tr tr tr tr tthe eeheheehee e bumbumbumbumbumbumbumbuu perperperperperperperper.
Disconnect the bumper-lights by pushing thecentertererterterertere -ta-ta-ta-ta-ta-tab inward.
Remove thth th thh thth the ue ue ue ue e e e ppppeppeppppppp r gr ggr ggrilrilrilrilrilrri le eeee eee sheshesheshesheshehsheell lllllllll ffrom the bumperby yyyyyy unsunsunsunsunsunsunsnu creccrecrecrecrecrewinwinwinwinwinwinng tg tg tg tg tg thehehehe he hehehe PhiPhiPPhiPhiPhiPhihillillillillilliliips screws along theperperpperperperpee imeimeimemeimemeei terterterteterterterr annnn annnd ud ud ud ud ud unclncllnclnclnclnclnc ipipipippipip ing it from the bumper.
Place your new mesh iih ih ih ih iinsensensensnsnsnsns rt t rt rt rt rtt intnntntntntnto ttttto tttthehehehe hehe bumbumumumbumumumu ppperppppopeopeopeopeopepeopeninninninnininning.ggggggg
UsiUsiUsiUsiUsiUsiUs ng ng ng ng gng ng a sa sa sa sa sa ss harharharhahaharhah p scribe tool, mark the lococococococatiatatatiatiatiatiat onsonsonsonsonsonsons ooofoooothethetheththethetht mounting tabs through ttttttthe hehehe heehe hh grigrigrigriggrigrilleleleeleee.
UseUseUseUseUseUseseUse a 333/13333 6" drill bit tototototototo ma mama mama mamake ke ke ke kekekeke thethethethethethethe ne nenene ne neneecescescescescescesscese sarsasasasasasaas ymountintntntntnttt ng ngngng ngngng g hohohholhohhoh es.eses.es.eseses.es.es.
Recomendeeeed: dddddd Paint the area behinddddddd thth th thththththe ge ge ge ge gge ggrilrililrilriliilleeeeeeBLACK to to tooto to toto givgivgivgivgivgive ae ae ae ae aee clean, professioniononononnoniononal alalalal alal insnsnsnsnsinstataltatatata latatatatatttiononionononionionon.
TToTTo TToT do this trace the back of the grille and tapeit off in preparation for painting.
Place the mesh insert back into the bumperopening.
The top tab utilizes the 1" Hex Screw andmounts through the upper plactic reinforcement
on the bumper.
The side tabs attach as shown with the flat-nuts opposite to the hex-screw.
The lower screw will attach as shown throughthe bumper into the previously attached U-Nut.
Reinstall the bumper back onto vehicle andinstallation is complete. Shown here in Black.
Another view of our MX-Series Signature MeshGrilles.
PAGE #2 OF
For further installation details check our website installsTel:310-970-0300 Fax:310-970-0400
www.grillcraft.com
Another view of the painted section. Locate the included hardware. On the bottom tab of the grille, attach the pro-vided U-Clip. Smooth side faces downward.
Another view of the taped section. Once painted the bumper should look likeshown.
Another view of the painted section.
PlaPlaPlaPlaPlaPlalalace cece cececece the mesh insert back into the bumperopening.
TheTheThehTheeTheTheThe tttottottotott p tp tp tp tp tp tp tp tab abab ab ab ab ab utiutiutiutiutitit lizlizlizlizlizlizlizizeees eeee the 1" Hex Screw andmoumoumoumoumoumomoum ntsntsntsntsntsntsnts th th th th th throurourourouoorough ghgh gh ghgh ggh ttthetttt upper plactic reinforcement
on the bumper.
The side tabs as as as aaas aattattattattattattattat ch ch chhchch h as asassasas shoshoshoshoshoshsh wn wn wn wnwn wn w witwitwitwitwitwittitw hhhh thhh he flat-nutttttutts os os os os os os oppopopoppoppopopositsittsitsitsite te te te te te tee to too to to to to to he he he he he he h hexhexhexhexhexhexhehex-screw.
The lower screw will attach assss shshsh shshshhshshowowownowowowoww thh thth ththththrororouoro ghghghghgghghtheeeeeee bubu bubu bu buuub mpempmpmpmpmpmpmmp r into the previouououououuuouo slyslyslyslyslyslysly a at at at at at attactactactactactact chedededededede U- U- U- U- U-U-UU-NutNutNutNutNutNutN .
Reinstall the bumper back onto vehicle anddddddinstallation is complete. Shown here in BlBlBlBlBlBlBlackackackackacackackc .....
AnoAnoAnoAnAnoAnoA othethethethetheheeer vr vr vr vr vvviiiiewieie of our MX-SX-SX-SX-SX-S-SX-Sererererierer es eses es eses SigSigSigigSigSigSigSignature MeshGrilleleleleeees.s.s.s.s.ss
PAGE #2 OOOOOOOOOFFFFFFFFF
FFFFoFFFF r further insttttalalalalalalala lalalalalalaaalatitititititiiononononononononon dd d dd ddetetetetetetetetee ails cccccccheehehehehheheheckckckckckckckck o o o oo ooourururururururr w ww w www website installsTeTeTeTeTeTeeeel:l:l:l:l:l:l:3131313131313133 0-0-0-0-0-000-979797979797970-0-0-0-0-0-0-0 030303030303030 00 Fax:x:x:x:xx:x:3131313313131310-0-0-00-0-0-0-0-99997999 0-0400
wwwwwwww w.grillcraft.com
Anothethethethehetheer vr vr vr vr vr vr vvviewiewiewiewiewiewiew ofofofofofofofo th th th th ththhhhe pe pe pe pe pe ppainainainainainainia tetetetetedtett section. Locate the includeudeudeudeudeudeeudeud d hd d hd hhd hd hardardardardarddwarwarwarwarwarware.e.e.e.e On the bottom tab of the grille, attachhhhhh thth th th th ththt e pe pe pe pe pe ppe pro-ro-o-o---vided U-CU Clip. Smooth side faceees ds ds ds ds ds ds dowowownownowowowww warwawawawawawaa ddd. ddd
AnoAnoAnoAnoAnoAnoAnoAn thethehethethethehther vr vr vr vr vr vr vr iewiewiewiewiewiewiewwew ofofof of of offf thth th th th ththhthe e e e e teeee aped sectectecectectectectc iononononononon. Once painted the be be be be be be bbumpumpumpumpumpumpumpuum er rer erer erer e shohohohohhohoould look likeeeeeeeshoshoshoshoshoshoshownwn.wn.wnwnwnw
AnoAnoAnoAnoAnoAnoAnAn ther view of the painted sesection.
