Page 1 of 42 Diabetes › content › diabetes › ... · 2014-07-28 · 1 Adiponectin stimulates...
Transcript of Page 1 of 42 Diabetes › content › diabetes › ... · 2014-07-28 · 1 Adiponectin stimulates...
1
Adiponectin stimulates autophagy and reduces oxidative stress to enhance
insulin sensitivity during high fat diet feeding in mice
Ying Liu1, Rengasamy Palanivel1, Esther Rai1, Min Park1,
Tim V. Gabor1, Michael P. Scheid1, Aimin Xu2 & Gary Sweeney1
1Department of Biology, York University, Toronto, Canada
and 2State Key Laboratory of Pharmaceutical Biotechnology, and Department of Medicine, the University of Hong Kong
Corresponding author Dr. Gary Sweeney Department of Biology York University 4700 Keele Street Toronto, ON, M3J 1P3 Canada Tel: 416-736-2100 Fax: 416-736-5698 Email: [email protected]
Keywords: Adiponectin, autophagy, oxidative stress, insulin sensitivity, skeletal muscle
Page 1 of 42 Diabetes
Diabetes Publish Ahead of Print, published online July 28, 2014
2
Abstract
Numerous studies have characterized the anti-diabetic effects of adiponectin yet the
precise cellular mechanisms in skeletal muscle, in particular changes in autophagy,
require further clarification. In the current study we used high fat diet (HFD) to induce
obesity and insulin resistance in wild type (wt) or adiponectin knockout (Ad-KO) mice ±
adiponectin replenishment. Temporal analysis of glucose tolerance and insulin sensitivity
using hyperinsulinemic-euglycemic clamp and muscle IRS and Akt phosphorylation
demonstrated exaggerated and more rapid HFD-induced insulin resistance in skeletal
muscle of Ad-KO mice. SOD activity, GSH/GSSG ratio and lipid peroxidation indicated
that HFD-induced oxidative stress was corrected by adiponectin and gene array analysis
implicated several antioxidant enzymes, including Gpxs, Prdx, Sod and Nox4 in
mediating this effect. Adiponectin also attenuated palmitate-induced ROS production in
cultured myotubes and improved insulin-stimulated glucose uptake in primary muscle
cells. Increased LC3-II and decreased p62 expression suggested that HFD induced
autophagy in muscle of wt mice, however these changes were not observed in Ad-KO
mice. Replenishing adiponectin in Ad-KO mice increased LC3-II and Beclin1 and
decreased p62 protein levels, inducec FGF-21 expression and corrected HFD-induced
decreases in LC3, beclin1 and ULK1 gene expression. In vitro studies examining
changes in phospho-ULK1(Ser555), LC3-II and lysosomal enzyme activity confirmed
that adiponectin directly induced autophagic flux in cultured muscle cells in an AMPK-
dependent manner. We overexpressed an inactive mutant of Atg5 to create an
autophagy-deficient cell model and, together with pharmacological inhibition of
autophagy, demonstrated reduced insulin sensitivity under these conditions. In
summary, adiponectin stimulated skeletal muscle autophagy and antioxidant potential to
reduce insulin resistance caused by HFD.
Page 2 of 42Diabetes
3
Introduction
Adiponectin normally circulates abundantly in the concentration range of 2-
20ug/ml and decreased plasma adiponectin, in particular the high molecular weight
(HMW) form, has been found in patients with obesity and type 2 diabetes (1). Extensive
studies have shown that adiponectin exerts beneficial anti-diabetic actions via direct
metabolic and insulin-sensitizing effects in various tissues (2). Skeletal muscle is the
major site for glucose disposal and maintenance of insulin sensitivity is critical for
optimal glucose homeostasis. Generation of reactive oxygen species (ROS) and the
resulting oxidative stress, mitochondrial dysfunction and accumulation of triglyceride and
lipotoxic metabolites have all been shown to contribute to insulin resistance (3; 4).
Transgenic mice overexpressing adiponectin show improved insulin sensitivity and
mitochondrial function (5; 6) while Ad-KO mice are more susceptible to HFD-induced
insulin resistance.
In response to cellular stressors, increased levels of autophagy permit cells to
efficiently adapt by altering protein catabolism, however autophagy is viewed as a
double edged sword, with too much or too little and the temporal nature of the process
determining cellular consequences (7; 8). Several studies have recently begun to
establish the importance of autophagy in skeletal muscle metabolism. In autophagy-
deficient mice with skeletal muscle-specific deletion of Atg7 the induction of Fgf21
expression in muscle mediated peripheral effects leading to protection from diet-induced
obesity and insulin resistance (9). Another mouse model of stimulus-deficient autophagy,
the BCL2 AAA mice which contain knock-in mutations in BCL2 phosphorylation sites
(Thr69Ala, Ser70Ala and Ser84Ala) that prevent autophagy activation, showed altered
glucose metabolism during acute exercise, as well as impaired chronic exercise-
mediated protection against high-fat-diet-induced glucose intolerance (10). Activation of
autophagy in skeletal muscle has been reported by others in response to exercise and
Page 3 of 42 Diabetes
4
caloric restriction (11-14). The ability to induce autophagy has been shown to deteriorate
with aging in skeletal muscle (15). Thus, recent literature suggests that induction of
skeletal muscle autophagy by various stimuli may give rise to beneficial metabolic
effects. Numerous studies have also established the importance of crosstalk between
autophagy and oxidative stress (16).
It is clear that adiponectin exerts beneficial metabolic effects by direct actions
and enhancing insulin sensitivity (2), however the underlying molecular mechanisms are
incompletely understood. We used Ad-KO mice fed HFD for 2, 4 and 6 weeks with and
without adiponectin replenishment to examine corrective effects of adiponectin in this
model. We examined changes in oxidative stress and underlying mechanisms and also
established that adiponectin directly stimulates autophagy in skeletal muscle. These
studies provide new insight into skeletal muscle actions of adiponectin which contribute
to the beneficial anti-diabetic effects of this adipokine.
Page 4 of 42Diabetes
5
Materials and Methods
Reagents and Antibodies
3H-2-Deoxy-glucose was purchased from PerkinElmer (Ontario, Canada). Insulin
(Humulin R) was purchased from Eli Lilly (Toronto, Canada). TRIzol reagent was from
Invitrogen Life Technologies (Burlington, ON). Polyclonal phosphospecific antibodies to
Akt (Thr308, Ser473) and ULK1 (Ser555), LC3B, Beclin1, GAPDH and horseradish
peroxidase (HRP)-conjugated anti-rabbit-IgG were from Cell Signaling Technology
(Beverly, MA) while polyclonal phosphospecific antibody to IRS1 (Y612) was from Life
Technologies (Burlington, ON), p62 antibody from BD Biosciences (Mississauga, ON)
and FGF21 antibody from Antibody Immunoassay Services (Hong Kong). Polyvinylidene
difluoride (PVDF) membrane was from Bio-Rad (Burlington, ON) and
chemiluminescence reagent plus from PerkinElmer (Boston, MA). AMEM and FBS were
purchased from GIBCO®, Invitrogen life technology (Burlington, ON). All other reagents
and chemicals used were of the highest purity available.
Experimental animals, glucose tolerance test (GTT) and hyperinsulinemic euglycemic
clamp
Animal facilities met the guidelines of the Canadian Council on Animal Care, and the
protocols were approved by the Animal Care Committee of York University. Animals
were fed either regular chow diet or 60% HF diet as we described (22). HF diet AdKO
animals received either saline or adiponectin (3µg/g body weight) twice daily for 1wk and
2wks for the 2wks diet and 6wks diet groups, respectively, via intraperitoneal injection.
GTT and clamp studies were performed as we described (22).
Preparation of muscle homogenates, cell lysates and Western blotting
Page 5 of 42 Diabetes
6
Stably transfected L6 cells were serum starved 4 hr or incubated with or without
bafilomycin (200nM, 24hr), chloroquine (100µM, 24hr), compound C (10µM, 1hr)
followed by insulin stimulation (10, 100 nM, 5 min) or adiponectin (5µg/ml, 30 and 60
min) treatment. All tissue and cell samples were prepared as we described before (22)
and primary antibodies used at 1:1000 dilution. Membranes were then washed four
times in 1x wash buffer for 15 min each at room temperature and incubated with
appropriate HRP-coupled secondary antibody (1:10,000) for 1 h. Membranes were
washed five times in 1x wash buffer for 10 min each and proteins visualized using
enhanced chemiluminescence. Non-denaturing, non-reducing conditions were applied to
allow analysis of different forms of adiponectin (HMW>250KDa, MMW=180KDa and
LMW=90KDa) with in-house polyclonal anti-adiponectin antibody in the concentration of
1ug/ml and anti-rabbit as secondary antibody. Quantitation of each specific protein band
was then determined via densitometric scanning and correction for the respective
loading control.
Superoxide dismutase (SOD) activity assay
Tissue specific SOD activity was assessed with a colorimetric kit “Superoxide Dismutase
Activity Assay Kit” purchased from Biovision (California, USA). Gastrocnemius skeletal
muscle samples were powderized in liquid N2 and protein extracted according to
manufacturer’s instruction. Approximately 10µg protein from each sample was used to
measure SOD activity under OD450nm by a microplate photometric reader. Data
represented in the results section were normalized for protein concentration loaded for
each sample.
Glutathione (GSH) assay
Page 6 of 42Diabetes
7
Tissue specific total and reduced GSH level were analyzed with a “ApoGSHTM
Glutathione Colorimetric Detection Kit” from Biovision (California, USA). Tibialis Anterior
(TA) skeletal muscle samples were crushed into powder in liquid N2 and protein
extracted according to manufacturer’s instruction. Same volume of lysate for each
sample was used to determine total and reduced GSH level and assay read at 412nm by
a microplate photometric reader. Data represented in the results section were
normalized by protein concentration loaded for each sample.
TBARS assay
Tissue specific lipid peroxidation level was analyzed with a “Thiobarbituric Acid Reactive
Substances (TBARS) Assay Kit” from Cayman Chemical (Michigan, USA). Tibialis
Anterior (TA) skeletal muscle samples were crushed into powder in liquid N2 and protein
extracted according to manufacturer’s instruction. In total 600ug protein from each tissue
sample lysate was used to determine lipid peroxidation level and assay read at 540nm
by a microplate photometric reader. Data represented in the results section were
normalized by protein concentration loaded for each sample.
Oxidative stress-related and autophagy-related gene expression analysis.
Gastrocnemius skeletal muscle samples collected from animals were powderized in
liquid N2 and total RNA extracted with TRIzol reagent (Invitrogen Life Technologies,
Burlington, ON) and cleaned up by RNEasy mini-ki (Qiagen, Toronto, Ontario). cDNAs
were synthesized by reverse transcription with 1µg total RNA by using RT² First-Stand
cDNA Synthesis Kit (Qiagen). A mixture of cDNAs and RT2 qPCR Master Mix was
aliquoted to 96-well plates pre-coated with primers encoding different genes involved in
the regulation of oxidative stress pathway (Qiagen). The plate was loaded onto a qPCR
machine and real time PCR program was set according to the company’s instruction.
Page 7 of 42 Diabetes
8
Results collected from each well after qPCR were adjusted by several housekeeping
genes including GAPDH, beta-actin before analyzing. For analysis of autophagy-related
gene expression, RNA (0.2 µg) was reverse-transcribed in a 20-µl reaction volume using
specific primers (Invitrogen) listed in supplementary table 1 and GoScript reverse
transcriptase according to the manufacturer's instructions (Promega). RT-PCR was
performed with KAPA Polymerase Chain Reaction Master Mix (KAPA Biosystem Inc,
Wilmington, MA, USA) and SYTO® 9 Green Fluorescent Nucleic Acid Stain (Life
Technologies) under standard thermocycling conditions (2 min at 95°C and followed by
40 cycles of 5 s each at 95, 60, and 72°C). Relative expression levels of genes,
normalized using beta-actin as a housekeeping gene, were calculated using the
comparative critical threshold method.
Immunofluorescent analysis of endogenous LC3
Analysis of LC3 cellular localization was performed by culturing cells on glass cover slips
and treating with adiponectin for 1hr and 2hrs. Thereafter, the media was aspirated and
the cells were washed (3X) in phosphate-buffered saline (PBS) at room temperature and
then fixed for 20 min in 4% paraformaldehyde (PFA) at room temperature, then further
washed (3X for 5 min) with PBS. Cells were permeabilized with 0.1% Triton X-100 for 3
minutes and blocked with blocking buffer (3% BSA) for 30 minutes. Following fixation,
permeabilization and blocking, the cells were washed once in PBS and then sequentially
stained with LC3 primary antibody (1:1000) overnight at 40C then secondary antibody
conjugated with Alexa Fluor 488 (1h at room temperature). Cells were then washed with
PBS before incubation with 2 µg/ml 4,6-diamidino-2-phenylindole (DAPI, Roche
Diagnostics) in PBS, 20 min at room temperature. The samples were washed with PBS
(4X) and finally mounted with Dako fluorescence mounting medium (Dako North
Page 8 of 42Diabetes
9
America Inc, CA) and observed with an Olympus confocal microscope equipped with a
60X objective.
Cell culture using L6 and primary skeletal muscle cells.
We used the L6 skeletal muscle cell line grown as previously described (17) for some in
vitro studies as indicated in figure legends. To prepare primary skeletal muscle cells we
also isolated muscle strips from mouse hind leg and cut them into small pieces which
were then incubated in 3ml dipase/collagenous solution (0.1 type II collagenase + 0.05%
dipase in serum free Ham’s F12 media) for 30mins in 37ºC water bath with agitation
(~100rpm). Digested solutions were then filtered through a 100um cell filter, and only
flow through was collected and centrifuged at room temperature for 7mins at 1600rpm.
The cell pellet was then resuspended in growth media (10% FBS, 0.5% antibiotics and
antimycotics, 5ng/ml rhFGF in Ham’s F12) and plated onto a 35mm dish overnight. The
supernatant which contained non-adherent cells were then seeded on a laminin-coated
35 mm dish. These cells were differentiated into myotubes in Ham’s F12 media
containing 2% horse serum for 5-7 days and experiments were performed using fully
differentiated myotubes.
Generation of L6 cell line with stable overexpression of tandem RFP/GFP-LC3 (tfLC3) or
ATG5-K130R by retroviral infection
We used the L6 skeletal muscle cell line for in vitro studies. After identifying relevant and
unique restriction sites matching with the retroviral cloning vector pQCXIP, and
RFP/GFP-LC3 target vector, ptfLC3 (Addgene), the retroviral vector expressing the gene
of interest, tfLC3, and all other essential elements for retroviral integration and
expression was successfully generated and purified. We also subcloned the target RFP-
ATG5-K130R sequence from the vector pmCherry-ATG5-K130R (Addgene) into the
Page 9 of 42 Diabetes
10
vector pQCXIP. In both cases, the viral vector was then transfected into HEK-derived
packaging cell line, EcoPack 2-293 (Clontech), expressing the MMLV Gag, Pol and Env
proteins. The culture medium containing the virus was collected 48 hours post
transfection. 100 ul of the collected supernatant, or viral soup, was directly applied to L6
cells in presence of polybrene (4ug/ml) in 10 cm culture dish on the next day after being
seeded. Cells were incubated with the virus for 24 hours in the incubator, and the
medium was replaced with fresh growth medium containing the selection antibiotic,
puromycin (2ug/ml) (Sigma Aldrich). The pool of cells resistant to the antibiotic was
selected, and the stable overexpression of the target gene was verified by detecting the
expression of GFP using FACS Calibur flow cytometry (BD Bioscience).
Analysis of autophagic flux using tandem RFP/GFP-LC3
L6 cells stably transfected with tfLC3 were seeded on glass cover slips and cells were
then maintained in culture medium until reaching 70–80% confluence then treated with
adiponectin (5ug/ml up to 24hr). Cells were then washed with PBS (phosphate-buffered
saline) and fixed with 4% paraformaldehyde for 20 min, followed by permeabilization
with 0.1% Triton X-100 for 3 minutes. Cells were blocked with PBS containing 3%BSA
for 30 minutes at room temperature. After washing three times with PBS, coverslips
were mounted with Dako fluorescence mounting medium (Dako North America Inc, CA),
and GFP and RFP fluorescence detected by confocal microscopy.
Analysis of cathepsin B activity using MagicRed
L6 cells were cultured on glass coverslips and treated with adiponectin for 1h and 2hr
then lysosomal activity determined with Magic Red Cathepsin B kit (Immunochemistry
Technologies, Bloomington, MN) according to the manufacturer's instruction. Nuclei
Page 10 of 42Diabetes
11
were counterstained with DAPI for 20 min. After washing (4X) with PBS, cells were
mounted with Dako fluorescence mounting medium and images were observed with an
Olympus confocal microscope equipped with a 60X objective.
2-Deoxy-glucose uptake
L6 myoblasts stably overexpressing GLUT4-myc (17) were incubated with media
contaiing 0.5% FBS with or without bafilomycin (200nM, 24hr) or chloroquine (100µM,
24hr) followed by insulin (10 and100 nM, 20 min). After treatments, glucose uptake was
determined as previously described (17).
Statistical analysis
All data were analyzed by using Graphpad Prism 5 and presented as means ± S.E.M.
One-way or two-way ANOVA was performed where appropriate and differences were
considered statistically significant at P<0.05.
Page 11 of 42 Diabetes
12
Results
We first validated the model used here to study the mechanisms via which adiponectin
improved insulin sensitivity. Temporal analysis after 2, 4 and 6 weeks of HFD of area
under curve upon glucose tolerance test (Fig 1A), plasma insulin (Fig 1B), plasma
glucose (Fig 1C) and HOMA-IR (Fig 1D) indicated an exaggerated and more rapid
development of insulin insensitivity in Ad-KO mice subjected to HFD when compared
with wt mice. This was reflected in significantly reduced insulin-stimulated
phosphorylation of IRS(Y612) and Akt(S473) in skeletal muscle of Ad-KO mice at 4 and
6 weeks, yet only after 6 weeks in wt mice (Figs 1E&F). Original Western blot data is
shown for all insulin signaling analysis in supplementary figure 1. Detailed investigation
of insulin sensitivity using hyperinsulinemic-euglycemic clamp in these mice
demonstrated impaired glucose homeostasis in Ad-KO mice after only two weeks HFD.
This was evident from decreased glucose infusion rate (Fig 2A) and insulin altered
glucose appearance rate (Fig 2B&E), despite an increased glucose disappearance rate
(Fig 2C&E). After 2wks high fat diet, but not after 6 weeks (22), we observed an
elevation in insulin stimulated glucose uptake in skeletal muscle, indicating an important
initial compensatory role of skeletal muscle in maintaining whole body glucose
homeostasis in the Ad-KO mouse. There was no difference observed in the glycolytic
rate in Ad-KO mice fed either chow or HFD for 2wks (Fig 2D).
We next examined changes in oxidative stress and observed a rapid significant
decrease in SOD activity after 2 weeks of HFD in Ad-KO, but not wt, mice (Fig 3A). After
4 weeks, HFD-induced a decrease in SOD activity in both groups of mice. Interestingly,
this decreased SOD activity was transient and recovered in both wt and HFD mice after
6 weeks HFD (Fig 3A). Under chow fed conditions, Ad-KO mice had a lower GSH/GSSG
ratio than wt mice (Fig 3B) and there was an increase in GSH/GSSG ratio in muscle of
Page 12 of 42Diabetes
13
Ad-KO mice after 4 and 6 weeks of HFD (Fig 3B). Wt mice showed an apparent
decrease after 2 weeks and a significant decrease in GSH/GSSG ratio after 4 weeks of
HFD (Fig 3B). After replenishing normal circulating levels of adiponectin to Ad-KO mice
we observed that the HFD-induced decrease in SOD activity was corrected (Fig 3C).
Furthermore, analysis of lipid peroxidation using TBARS assay confirmed an elevated
level of oxidative stress in muscle of Ad-KO mice after 2 weeks of HFD and this was
corrected in mice which received adiponectin replenishment (Fig 3D). Analysis of ROS
generation in response to palmitate in vitro using L6 myotubes confirmed adiponectin’s
effect on preventing free fatty acid induced oxidative stress (Fig 3E). We measured
glucose uptake in primary skeletal muscle cells to determine changes in insulin
sensitivity and found that adiponectin enhanced sensitivity of cells to submaximal (10nM)
insulin concentration and that palmitate-induced insulin resistance was alleviated in the
presence of adiponectin (Fig 3F).
To further investigate potential mechanisms underlying these changes we performed
gene array analysis of those implicated in regulation of oxidative stress. Within a total of
84 genes which were analyzed, high fat diet altered the expression of genes involved in
the regulation of not only glutathione peroxidase, peroxiredoxin, superoxide dismutase,
superoxide metabolism but also oxidative stress responsive and oxygen transporter
genes (Fig 4A). Adiponectin supplementation effectively reversed HFD-induced changes
in expression of several of the main anti-oxidant genes: Gpx1&3, SOD1&2, Prdx1,3&4,
Ptgs 1&2 (Fig 4B). HFD also induced the reactive oxygen species production gene Nox4
and a direct upregulation of the copper chaperone for superoxide dismutase (Ccs) by
adiponectin was also observed (Fig 4B). A heat map showing specific information on the
full range of genes tested and changes therein is shown in supplementary figure 2.
Page 13 of 42 Diabetes
14
We investigated temporal changes in skeletal muscle autophagy in these mice using
well established markers. HFD feeding for 6 weeks significantly increased levels of LC3-
II in wt skeletal muscle, but this was not observed in Ad-KO mice (Fig 5A). Original
Western blot data is shown for all autophagy analysis in supplementary figures 3 and 4.
We found that replenishing adiponectin to Ad-KO mice restored the higher level of LC3-II
expression (Fig 5B). A decrease in p62 levels was observed at all time points in wt
mouse muscle, however accumulation of p62 was evident in Ad-KO mouse muscle (Fig
5C), the latter being reduced by adiponectin supplementation (Fig 5D). The enhanced
LC3-II levels observed after 6 weeks of HFD in wt mice correlated with enhanced
expression of beclin1 (Fig 5E). Beclin1 expression did not change in Ad-KO mice,
however adiponectin did induce beclin1 expression in muscle of these mice (Fig 5E).
Skeletal muscle FGF-21 content was enhanced after 2, 4 and 6 weeks of HFD only in wt
mice (Fig 5G), however replenishing adiponectin in Ad-KO mice led to increased FGF-21
expression (Fig 5H). We also analyzed changes in expression of genes which play a key
role at various stages of autophagic flux. Our data indicated that HFD decreased
expression of several autophagy-related genes and three of these, beclin1, LC3 and
ULK1, were corrected by adiponectin treatment (Fig 5I).
We then examined changes in autophagy in cultured skeletal muscle cells treated with
or without adiponectin. Conversion of LC3-I to LC3-II is the most widely used marker for
autophagosomes and when this was assessed by Western blotting (Fig 6A) we found
increased LC3-II levels after adiponectin treatment. We hypothesized that the
mechanism via which adiponectin stimulated autophagy was via AMPK and after
inhibition of AMPK using compound C, adiponectin stimulated LC3-II formation and
phosphorylation of ULK1 on Ser555 was attenuated (Fig 6A). Autophagosome formation
in response to adiponectin was also confirmed by punctate appearance of endogenous
Page 14 of 42Diabetes
15
LC3 upon immunofluorescent detection (Fig 6B). To more accurately examine
autophagic flux we generated skeletal muscle cells stably overexpressing RFP/GFP-
LC3. This approach is advantageous in that it allows analysis of autophagic flux since
GFP, but not RFP, is sensitive to quenching by the acidic environment of the
autophagolysosome. We observed that adiponectin initially stimulated punctate
appearance of fluorescent LC3 while comparison of merged images showing maintained
red and decreased green fluorescence indicated completion of autophagic flux in
response to adiponectin (Fig 6C). Lysosomal enzyme activity, measured using
MagicRed, was increased in response to adiponectin (Fig 6D). We used bafilomycin or
chloroquine to inhibit autophagic flux and demonstrated that this led to decreased
insulin-stimulated glucose uptake (Fig 7A). Similarly, insulin-stimulated phosphorylation
of IRS1 (Tyr612), Akt (Thr308) and Akt (Ser473) was attenuated under these conditions
as seen in the representative Western blots (Fig 7B) and quantitative analysis (Fig 7C-
E). We also generated L6 skeletal muscle cells stably overexpressing the dominant-
negative inhibitor of autophagy (Atg5K130R). In these autophagy-deficient cells we also
observed a reduction in insulin stimulated phosphorylation of IRS1 and Akt as seen in
the representative Western blots (Fig 7F) and quantitative analysis (Fig 7G-I).
Page 15 of 42 Diabetes
16
Discussion
Numerous studies have demonstrated that adiponectin improves insulin sensitivity and
alleviates metabolic dysfunction in skeletal muscle (2; 18). Various mechanisms via
which adiponectin acts have been established, yet further detailed investigation and
uncovering of novel aspects is needed. Here, we used Wt and Ad-KO (± adiponectin
replenishment) mice fed chow or HFD. We previously validated that HFD-fed Ad-KO
mice developed skeletal muscle insulin resistance and glucose intolerance and that
replenishment of adiponectin corrected these defects (19). We also conducted a
metabolomic profiling analysis and found that adiponectin alleviated HFD-induced
changes in metabolites such as several diacylglycerol species, branched-chain amino
acids and various lysolipids (19). Here, an important goal of our study was to analyze
temporal changes (at 2,4,6 weeks) in glucose homeostasis (glucose tolerance test and
hyperinsulinemic-euglycemic clamp) and skelatal muscle insulin sensitivity to confirm an
exaggerated and more rapid effect in Ad-KO mice which was alleviated by administering
recombinant adiponectin.
Oxidative stress is well established as a causative factor in the development of skeletal
muscle insulin resistance and mitochondrial dysfunction and one which can be modified
by adiponectin (3; 4; 18; 20). One conclusion from our current study is that the ability of
adiponectin to correct HFD induced reductions in antioxidant gene expression is one of
the mechanisms via which adiponectin exerts its insulin sensitizing effect in skeletal
muscle and improves peripheral glucose homeostasis. Superoxide dismutase, catalase
and glutathione peroxidase are major anti-oxidative enzymes with which cells are
equipped to fight damage caused by ROS (21; 22). The increased expression of these
anti-oxidative enzymes was indeed correlated with measures of oxidative stress, such as
GSH/GSSG ratio, SOD activity and TBARS assay to assess lipid peroxidation. One
Page 16 of 42Diabetes
17
additional interesting observation we made was that Ad-KO mice had higher initial
oxidative stress level compared to wt mice. The elimination of ROS can also be
catalyzed by nitric oxide synthase (Nos2), and we observed that expression of this
enzyme was reduced by HFD and induced by adiponectin. Other studies have
demonstrated that adiponectin reduced oxidative stress by down regulating NADPH
oxidase via inactivating the phosphorylation of P47phox, the regulatory subunit of NADPH
oxidase (23). Many studies have now established an important crosstalk between
oxidative stress and autophagy (24) although the significance in terms in skeletal muscle
metabolism (9-12; 14; 15) requires further investigation.
An important and novel focus of our study, therefore, was the analysis of skeletal muscle
autophagy (9-12; 14; 15). First of all, increased LC3-II and decreased p62 levels
indicated that HFD induced autophagy in skeletal muscle (25). The increased induction
of autophagy may be at least partly due to an increase in beclin-1, which has a well
characterized role in the induction of autophagosome formation (25). To date there have
been no studies documenting regulation of skeletal muscle autophagy by adiponectin,
however in recent months direct regulation of autophagy by adiponectin has been
shown in liver and macrophages (26; 27). Importantly, we found that the induction of
skeletal muscle autophagy observed in Wt mice was not apparent in Ad-KO mice.
However, replenishing adiponectin to the circulation of HFD-fed Ad-KO mice restored the
increase in LC3-II formation and reduced accumulation of p62. Based on our data and
recent studies which have begun to document the association between skeletal muscle
autophagy and metabolism (9; 10; 28; 29) we propose an important role of adiponectin
in the ability of skeletal muscle to elevate autophagy in response to HFD.
Page 17 of 42 Diabetes
18
To further investigate this observation we then examined whether adiponectin directly
induced autophagy in skeletal muscle cells. We measured autophagic flux using a
combination of approaches to determine autophagosome formation and
autophagolysosomal formation and activity (25), all of which demonstrated that
adiponectin directly stimulated autophagic flux. Our data on stimulation of autophagy by
adiponectin adds a novel perspective to the growing body of work documenting the
relationship of skeletal muscle autophagy with insulin sensitivity and metabolism. For
example, exercise stimulated skeletal muscle autophagy and autophagy-deficient mice
also exhibited altered glucose metabolism during acute exercise, as well as impaired
chronic exercise-mediated protection against HFD-induced glucose intolerance (10).
Activation of autophagy in skeletal muscle has been reported by others in response to
exercise and caloric restriction (11-14). Furthermore, starvation-induced autophagic flux
was greater in glycolytic versus highly oxidative muscle and this was related to AMPK
and mTOR activities which are both important determinants of autophagy (11; 13; 30;
31). The regulatory events required to induce autophagy were attenuated with aging in
skeletal muscle (15). We investigated the mechanistic role of AMPK in mediating the
stimulation of autophagic flux in skeletal muscle cells in response to adiponectin and
observed that the well established target of AMPK in inducing autophagy, ULK1
phosphorylation on Ser555, was directly increased by adiponectin. Furthermore,
stimulation of both LC3-II levels and phospho-ULK1 by adiponectin were attenuated
upon inhibition of AMPK, confirming an important role of AMPK signaling (26; 32). Thus,
both our current data and recent literature suggest that induction of skeletal muscle
autophagy by various stimuli gives rise to beneficial metabolic effects.
Perhaps the most striking observation in recent literature was that autophagy-deficient
mice with skeletal muscle specific deletion of Atg7 were protected from diet-induced
Page 18 of 42Diabetes
19
obesity and insulin resistance (9). Mechanistically, in this model mitochondrial
dysfunction was overcome by autophagy-dependent FGF-21 expression in skeletal
muscle after 13 weeks of HFD. This FGF-21 acted as a myokine to mediate peripheral
effects leading to protection from diet-induced obesity and insulin resistance (9). We
investigated FGF-21 expression in skeletal muscle of HFD-fed Wt and Ad-KO mice and
our data indicated that only skeletal muscle from Wt, but not Ad-KO mice, had elevated
FGF-21 content. This suggests that HFD-induced autophagy and FGF-21 production
were dependent on adiponectin and we also observed that adiponectin directly induced
FGF-21 expression in cultured skeletal muscle cells. Interestingly, there are two recently
published reports that beneficial metabolic effects of FGF-21 are mediated via
adiponectin action (33; 34). Thus, conceivably, adiponectin may act as a front- and back-
end master regulator of FGF-21 physiology. The reciprocal interactions between
autophagy and oxidative stress (11) should also be further investigated, for example
using autophagy-deficient animal models.
In summary, this work significantly extends our understanding of mechanisms via which
adiponectin alleviates HFD-induced insulin resistance and metabolic dysfunction in
skeletal muscle. In particular, we document that HFD-induced obesity elicits increased
skeletal muscle autophagy and for the first time show the facilitatory role of adiponectin
in this process. We propose that adiponectin stimulates autophagic flux in skeletal
muscle, especially under pathological conditions, and that this represents an important
mechanistic component of its beneficial metabolic effects. Nevertheless, other cellular
events such as oxidative stress precede changes in autophagy and autophagy itself may
still be viewed as a doubled edged sword whereby too much or too little and the
temporal nature of the process can determine distinct cellular consequences (7; 8).
Page 19 of 42 Diabetes
20
Acknowledgements
This work was supported by an operating grant to GS from Canadian Institutes of Health
Research. GS also acknowledges Career Investigator support from Heart & Stroke
Foundation of Ontario. GS is guarantor of this article. No conflict of interest is declared
by any authors in this study. Author contributions: YL performed the majority of
experimental work, researched the work, helped in planning protocols and experiments
and with writing of manuscript. PR, ER, MP & TVG all conducted experimental work
included in the figures. MPS contributed to design of experimental work. AX contributed
to planning of study, analysis of data and editing of manuscript. GS designed the project,
supervised the experimental work, wrote the manuscript and provided funding.
Page 20 of 42Diabetes
21
References
1. Liu Y, Retnakaran R, Hanley A, Tungtrongchitr R, Shaw C, Sweeney G: Total and
high molecular weight but not trimeric or hexameric forms of adiponectin correlate with
markers of the metabolic syndrome and liver injury in Thai subjects. J Clin Endocrinol
Metab 2007;92:4313-4318
2. Turer AT, Scherer PE: Adiponectin: mechanistic insights and clinical implications.
Diabetologia 2012;55:2319-2326
3. Newsholme P, Gaudel C, Krause M: Mitochondria and diabetes. An intriguing
pathogenetic role. Adv Exp Med Biol 2012;942:235-247
4. Samuel VT, Shulman GI: Mechanisms for insulin resistance: common threads and
missing links. Cell 2012;148:852-871
5. Combs TP, Pajvani UB, Berg AH, Lin Y, Jelicks LA, Laplante M, Nawrocki AR, Rajala
MW, Parlow AF, Cheeseboro L, Ding YY, Russell RG, Lindemann D, Hartley A, Baker
GR, Obici S, Deshaies Y, Ludgate M, Rossetti L, Scherer PE: A transgenic mouse with a
deletion in the collagenous domain of adiponectin displays elevated circulating
adiponectin and improved insulin sensitivity. Endocrinology 2004;145:367-383
6. Ge Q, Rycken L, Noel L, Maury E, Brichard SM: Adipokines identified as new
downstream targets for adiponectin: lessons from adiponectin-overexpressing or
deficient-mice. Am J Physiol Endocrinol Metab 2011;
7. Gurusamy N, Das DK: Is autophagy a double-edged sword for the heart? Acta Physiol
Hung 2009;96:267-276
8. Kubisch J, Turei D, Foldvari-Nagy L, Dunai ZA, Zsakai L, Varga M, Vellai T, Csermely
P, Korcsmaros T: Complex regulation of autophagy in cancer - Integrated approaches to
discover the networks that hold a double-edged sword. Semin Cancer Biol 2013;23:252-
261
9. Kim KH, Jeong YT, Oh H, Kim SH, Cho JM, Kim YN, Kim SS, Kim do H, Hur KY, Kim
HK, Ko T, Han J, Kim HL, Kim J, Back SH, Komatsu M, Chen H, Chan DC, Konishi M,
Itoh N, Choi CS, Lee MS: Autophagy deficiency leads to protection from obesity and
insulin resistance by inducing Fgf21 as a mitokine. Nat Med 2013;19:83-92
10. He C, Bassik MC, Moresi V, Sun K, Wei Y, Zou Z, An Z, Loh J, Fisher J, Sun Q,
Korsmeyer S, Packer M, May HI, Hill JA, Virgin HW, Gilpin C, Xiao G, Bassel-Duby R,
Scherer PE, Levine B: Exercise-induced BCL2-regulated autophagy is required for
muscle glucose homeostasis. Nature 2012;481:511-515
Page 21 of 42 Diabetes
22
11. Mofarrahi M, Guo Y, Haspel JA, Choi AM, Davis EC, Gouspillou G, Hepple RT,
Godin R, Burelle Y, Hussain SN: Autophagic flux and oxidative capacity of skeletal
muscles during acute starvation. Autophagy 2013;9:1604-1620
12. Lira VA, Okutsu M, Zhang M, Greene NP, Laker RC, Breen DS, Hoehn KL, Yan Z:
Autophagy is required for exercise training-induced skeletal muscle adaptation and
improvement of physical performance. FASEB J 2013;27:4184-4193
13. Cui M, Yu H, Wang J, Gao J, Li J: Chronic caloric restriction and exercise improve
metabolic conditions of dietary-induced obese mice in autophagy correlated manner
without involving AMPK. J Diabetes Res 2013;2013:852754
14. Jamart C, Naslain D, Gilson H, Francaux M: Higher activation of autophagy in
skeletal muscle of mice during endurance exercise in the fasted state. Am J Physiol
Endocrinol Metab 2013;305:E964-974
15. Kim YA, Kim YS, Oh SL, Kim HJ, Song W: Autophagic response to exercise training
in skeletal muscle with age. J Physiol Biochem 2013;69:697-705
16. Wang Y, Li YB, Yin JJ, Wang Y, Zhu LB, Xie GY, Pan SH: Autophagy regulates
inflammation following oxidative injury in diabetes. Autophagy 2013;9:272-277
17. Ceddia RB, Somwar R, Maida A, Fang X, Bikopoulos G, Sweeney G: Globular
adiponectin increases GLUT4 translocation and glucose uptake but reduces glycogen
synthesis in rat skeletal muscle cells. Diabetologia 2005;48:132-139
18. Liu Y, Sweeney G: Adiponectin action in skeletal muscle Best Practice & Research
Clinical Endocrinology & Metabolism 2013;in press
19. Liu Y, Turdi S, Park T, Morris NJ, Deshaies Y, Xu A, Sweeney G: Adiponectin
corrects high-fat diet-induced disturbances in muscle metabolomic profile and whole-
body glucose homeostasis. Diabetes 2013;62:743-752
20. Matsuda M, Shimomura I: Roles of adiponectin and oxidative stress in obesity-
associated metabolic and cardiovascular diseases. Rev Endocr Metab Disord 2013;
21. Forstermann U: Nitric oxide and oxidative stress in vascular disease. Pflugers Arch
2010;459:923-939
22. Roberts CK, Barnard RJ, Sindhu RK, Jurczak M, Ehdaie A, Vaziri ND: Oxidative
stress and dysregulation of NAD(P)H oxidase and antioxidant enzymes in diet-induced
metabolic syndrome. Metabolism 2006;55:928-934
23. Carnevale R, Pignatelli P, Di Santo S, Bartimoccia S, Sanguigni V, Napoleone L,
Tanzilli G, Basili S, Violi F: Atorvastatin inhibits oxidative stress via adiponectin-mediated
Page 22 of 42Diabetes
23
NADPH oxidase down-regulation in hypercholesterolemic patients. Atherosclerosis
2010;213:225-234
24. Yuzefovych LV, LeDoux SP, Wilson GL, Rachek LI: Mitochondrial DNA damage via
augmented oxidative stress regulates endoplasmic reticulum stress and autophagy:
crosstalk, links and signaling. PLoS One 2013;8:e83349
25. Klionsky DJ, et al: Guidelines for the use and interpretation of assays for monitoring
autophagy. Autophagy 2012;8:445-544
26. Lin Z, Wu F, Lin S, Pan X, Jin L, Lu T, Shi L, Wang Y, Xu A, Li X: Adiponectin
protects against acetaminophen-induced mitochondrial dysfunction and acute liver injury
by promoting autophagy in mice. J Hepatol 2014;S0168-8278:00380-00388
27. Qi GM, Jia LX, Li YL, Li HH, Du J: Adiponectin Suppresses Angiotensin II-Induced
Inflammation and Cardiac Fibrosis through Activation of Macrophage Autophagy.
Endocrinology 2014;155:2254-2265
28. Wu JJ, Quijano C, Chen E, Liu H, Cao L, Fergusson MM, Rovira, II, Gutkind S,
Daniels MP, Komatsu M, Finkel T: Mitochondrial dysfunction and oxidative stress
mediate the physiological impairment induced by the disruption of autophagy. Aging
(Albany NY) 2009;1:425-437
29. Wen H, Gris D, Lei Y, Jha S, Zhang L, Huang MT, Brickey WJ, Ting JP: Fatty acid-
induced NLRP3-ASC inflammasome activation interferes with insulin signaling. Nat
Immunol 2011;12:408-415
30. Castets P, Ruegg MA: MTORC1 determines autophagy through ULK1 regulation in
skeletal muscle. Autophagy 2013;9
31. Castets P, Lin S, Rion N, Di Fulvio S, Romanino K, Guridi M, Frank S, Tintignac LA,
Sinnreich M, Ruegg MA: Sustained activation of mTORC1 in skeletal muscle inhibits
constitutive and starvation-induced autophagy and causes a severe, late-onset
myopathy. Cell Metab 2013;17:731-744
32. Nepal S, Park PH: Activation of autophagy by globular adiponectin attenuates
ethanol-induced apoptosis in HepG2 cells: involvement of AMPK/FoxO3A axis. Biochim
Biophys Acta 2013;1833:2111-2125
33. Lin Z, Tian H, Lam KS, Lin S, Hoo RC, Konishi M, Itoh N, Wang Y, Bornstein SR, Xu
A, Li X: Adiponectin mediates the metabolic effects of FGF21 on glucose homeostasis
and insulin sensitivity in mice. Cell Metab 2013;17:779-789
34. Holland WL, Adams AC, Brozinick JT, Bui HH, Miyauchi Y, Kusminski CM, Bauer
SM, Wade M, Singhal E, Cheng CC, Volk K, Kuo MS, Gordillo R, Kharitonenkov A,
Page 23 of 42 Diabetes
24
Scherer PE: An FGF21-adiponectin-ceramide axis controls energy expenditure and
insulin action in mice. Cell Metab 2013;17:790-797
Page 24 of 42Diabetes
25
Figure Legends
Figure 1. Metabolic characterization of wild type and adiponectin knockout mice ±
adiponectin administration
Wild type (WT) or adiponectin knockout (KO) mice were fed either regular chow (Chow)
or 60% high fat diet (HFD) at the age of 6wks for a period of 2, 4 or 6 wks. Mice were
weighted and experiments performed, or serum samples collected for analysis, after 5-
6hrs fasting. Skeletal muscle insulin signaling was assessed 15 min after a bolus
injection of insulin (4 U/kg body weight) via tail vein. During intraperitoneal glucose
tolerance test (IPGTT), blood samples were collected and glucose level determined 15,
30, 60, 90 mins after a bolus intraperitoneal injection of glucose. A. IPGTT-area under
curve (AUC); B. Fasting insulin level (before IPGTT, ng/ml); C. Fasting glucose level
(before IPGTT, mM); D. Homeostatic model assessment for insulin resistant (HOMA-IR)
were calculated using the formula: (fasting glucose(mM)*fasting insulin(mU/L))/22.5; E.
Quantitative analysis of Western blot to determine insulin stimulated p-Akt(S473) and p-
IRS1(Y612) in skeletal muscle, p-Akt data were corrected by total Akt2 and pIRS1 data
were corrected by GAPDH. Data represent mean ± SEM; n=5-11. * indicates significant
difference between HFD and chow in WT animal; # indicates significant difference
between HFD and chow in AdKO; $ indicates significant difference between WT and
AdKO mice; & significant difference during time course within one genotype. *,#,$,&
P<0.05; **,##,$$,&&; P<0.01; ***,###,$$$,&&&; P<0.001.
Figure 2. Hyperinsulinemic-euglycemic clamp analysis
Ad-KO mice were fed either regular chow (Chow) or 60% high fat diet (HFD) at the age
of 6 wks for the period of 2 wks. Jugular vein and carotid artery catheters were
embedded into animals 4 days before the hyperinsulinemic euglycemic clamp
Page 25 of 42 Diabetes
26
procedure, and clamps were performed on animals after 5-6 h starvation. Blood samples
were collected during the clamp procedure and calculations were made based on the
radioactivity readings from serum to represent whole body glucose metabolism. A.
Glucose infusion rate (GIR) (mg/kg/min); B. Glucose appearance rate (Ra:mg/kg/min);
C. Glucose disappearance rate (Rd:mg/kg/min); D. Glycolytic rate (mg/kg/min); E.
Glucose turnover rate (fold change calculated by post (after insulin clamp)/basal (before
insulin clamp)). Data represent mean ± SEM; n=4-5. * significant compare between HFD
and chow animal; # significant difference between before (basal) and after (post) insulin
clamp. *,# P<0.05; **,## P<0.01; ***,### P<0.001.
Figure 3. Analysis of oxidative stress in skeletal muscle
Wild type (WT) or adiponectin knockout (KO) mice were fed either regular chow (Chow)
or 60% high fat diet (HFD) at the age of 6wks for the period of 2,4 and 6 wks. Skeletal
muscle samples were collected after 5-6 hrs fasting for subsequent analysis of A. SOD
activity and B. Ratio between reduced glutathione (GSH) over oxidized glutathione
(GSSG). Data represent mean ± SEM; n=4-8. * significant difference between HFD and
chow in WT animal; # significant difference between HFD and chow in KO; $ significant
difference between WT and KO mice. KO mice were fed either regular chow (Chow) or
60% high fat diet (HFD) at the age of 6wks. After 2 wks, mice were treated with either
saline (Chow, 60% HF) or fAd (60% HF + fAd) at dosage of 3ug/g body weight twice a
day via intraperitoneal injection for an additional 1 wk. Skeletal muscle samples were
collected after 5-6 hrs starvation to analyze C. SOD activity; D. TBARS assay. Data
represent mean ± SEM; n=6-7. * significant difference comparing HFD and chow; #
significant difference between saline and adiponectin treated HFD-fed mice. Primary
skeletal muscle cells isolated from C57BL6 mice were cultured with or without
adiponectin (Ad; 5ug/ml) until differentiated into myotubes then treated with 250uM
Page 26 of 42Diabetes
27
palmitate for 2 hrs (E) and 48 hrs (F) followed by analysis of oxidative stress by ROS
production (E) and insulin resistance by glucose uptake (F). Flow cytometry was used to
detect intracellular ROS followed by H2DCFDA staining for 30mins (E). Insulin was used
at submaximal (10nM) and maximal (100nM) concentrations during the final 1 hr before
glucose uptake assay (F; pmol/mg/min). Data represent mean ± SEM; n=4-5. *
significant difference compared to control; # significant difference compared to palmitate
treatment. *,#,$ P<0.05; **,##,$$ P<0.01; ***,###,$$$ P<0.001.
Figure 4. Oxidative stress gene array
Ad-KO mice were fed either regular chow or 60% high fat diet (HFD) at the age of 6wks.
After 2wks, the mice were treated with either saline or adiponectin at a dosage of 3ug/g
body weight twice a day via intraperitoneal injection for an additional 1 wk. Skeletal
muscle samples were collected after 5-6 hrs starvation and mRNA extracted and
analyzed by PCR array. A. Pie chart of global dataset (84 genes) indicating differentially
expressed genes after HFD treatment categorized based on pathways involved in the
regulation of oxidative stress; B. Quantitative analysis of gene expressions that were
most highly altered by HFD and/or adiponectin administration. n=4-5.
Figure 5. Analysis of skeletal muscle autophagy using Western blotting
Wild type (WT) or adiponectin knockout (KO) mice were fed either regular chow (Chow)
or 60% high fat diet (HFD) at the age of 6wks for the period of 2,4 and 6 wks. In
additional studies with Ad-KO mice, after 2 wks and 6 wks these mice were treated with
either saline or adiponectin (Ad) at a dosage of 3ug/g body weight twice a day via
intraperitoneal injection for an additional 1 wk and 2 wks, respectively. Skeletal muscle
samples were collected after 5-6 hrs fasting for subsequent analysis by Western blotting.
In WT and KO animals on Chow or HFD for 2, 4 and 6 weeks we examined expression
Page 27 of 42 Diabetes
28
of LC3 (A), p62 (C), Beclin1 (E) and FGF21 (G), all corrected for GAPDH content. n=8
and * indicates P<0.05 compared to Chow. We also examined the effect of adiponectin
replenishment after 2 or 6 wks HFD in Ad-KO mice on expression of LC3 (B), p62 (D),
Beclin1 (F) and FGF21 (H). Expression of autophagy-related genes were also
determined by RT-PCR (n=6) and changes in relative expression levels shown as fold
changes in heat map (I). In A-H, n=8 and * indicates P<0.05 compared to Chow and #
indicates P<0.05 comparing HFD + Ad to HFD alone.
Figure 6. Stimulation of autophagy flux by adiponectin in L6 cells.
(A) L6 cells were treated with adiponectin (5ug/ml) for 1hr or 2hrs in the presence or
absence of compound C (10µM, 1hr) then LC3 and phospho-ULK1 (Ser555) analyzed
by Western blotting cell lysates. Representative images and quantitation of n=3-5
experiments (mean ± SEM) are shown. *P>0.05 comparing control versus adiponectin
treatment. (B) Immunofluorescent detection of intracellular endogenous LC3 by confocal
microscopy. Nucleus was identified using DAPI. Representative images for DAPI, LC3
and merged image are shown on left side with higher magnification of single cells on
right side. (C) Analysis of tandem RFP/GFP-LC3 expressing L6 cells showing
representative images from n=3 of the relative GFP and RFP signals, and merged
image. (D) Representative fluorescence images of Magic Red, cathepsin B activity,
detected by confocal microscopy.
Figure 7. Functional significance of altered autophagy on insulin sensitivity
(A) L6 cells stably overexpressing GLUT4-myc were pretreated ± bafilomycin (200nM,
24hr) or chloroquine (100µM, 24hr) and stimulated with insulin (10 or 100 nM, 20 min)
prior to anlaysis of glucose uptake. In B-E, cells were pretreated ± bafilomycin or
chloroquine and stimulated with insulin (10 or 100 nM, 5 min) then cell lysates prepared
Page 28 of 42Diabetes
29
to determine phosphorylation of IRS Y612 (B&C), Akt T308 (B&D) and Akt S473 (B&E).
An autophagy-deficient stable cell line was created using Atg5K130R overexpression
and comparing these cells (Atg5K) versus cells infected with empty vector (EV) shows
that insulin sensitivity (1, 10 and 100 nM, 5 min) was attenuated (F-I). n=3-5 and *
indicates P<0.05 compared to no insulin and # indicates P<0.05 comparing insulin action
in the Atg5K versus EV cells.
Page 29 of 42 Diabetes
30
Supplementary Figure 1
Representative Western blots for phosphoAkt (S473) and phosphoIRS (Y612) in WT and
AdKO mice 2,4,6 weeks after chow or HFD. Quantitative analysis of these samples is
shown in figure 1.
Supplementary Figure 2
Complete dataset for the list of all oxidative stress-related genes tested by PCR array,
categorized by functional gene group (left column) and heat map data showing the fold
change in gene expression in response to HFD (HFD:chow) or Ad (HFD+Ad:HFD). Red
indicates reduced, and green indicates increased gene expression.
Supplementary Figure 3
Representative Western blots for LC3, p62, Beclin1 and FGF21 in WT and AdKO mice
2,4,6 weeks after chow or HFD. Quantitative analysis of samples shown in figure 5.
Supplementary Figure 4
Representative Western blots for LC3, p62, Beclin1 and FGF21 in AdKO mice at 2
and/or 6 weeks after HFD feeding ± adiponectin replenishment. Quantitative analysis of
samples shown in figure 5.
Page 30 of 42Diabetes
279x361mm (300 x 300 DPI)
Page 31 of 42 Diabetes
279x361mm (300 x 300 DPI)
Page 32 of 42Diabetes
279x361mm (300 x 300 DPI)
Page 33 of 42 Diabetes
279x361mm (300 x 300 DPI)
Page 34 of 42Diabetes
279x361mm (300 x 300 DPI)
Page 35 of 42 Diabetes
279x361mm (300 x 300 DPI)
Page 36 of 42Diabetes
279x361mm (300 x 300 DPI)
Page 37 of 42 Diabetes
Supplementary Table 1: The sequences of the forward and reverse primers used to
analyze expression of autophagy related genes are listed from 5′-3′ and are as follows.
Gene Forward (5' > 3') Reverse (5' > 3')
Beclin1 ATGTGGAAAAGAACCGCAAG TTGATTGTGCCAAACTGTCC
ATG12 TGACACACTGGAGGATGTGC TTGGGAGATGGGTAAGTTGG
ULK1 AGCACACGGAAACCCTACAC AGCTCGAATCTGGTCAATGG
LC3B AGCCACACCCTTTCACTCAG GTCTGGAGCATTGGACTTGC
ATG7 AGGCACCCAAAGACATCAAG CGAAGGTCAGGAGCAGAAAC
Lamp2 AGACCAAACTCCCACCACTG GAGCACTTTGAGGTTGACAGC
ULK2 AGGAGCCTGTGGTGTTATGC CACACATACTCGGACTTG
ATG4B GTGCTTTGAGAACCCAGACC GCCTTCTGATGAGCGACTTC
Bnip3 TGGGGATCTACATTGGAAGG CAGGAACACCGCATTTACAG
ATG5 TAGAGCCAATGCTGGAAACC TGTTGCCTCCACTGAACTTG
β-actin AGCCATGTACCTAGCCATCC TTTGATGTCACGCACGATTT
Page 38 of 42Diabetes
279x361mm (300 x 300 DPI)
Page 39 of 42 Diabetes
279x361mm (300 x 300 DPI)
Page 40 of 42Diabetes
279x361mm (300 x 300 DPI)
Page 41 of 42 Diabetes
279x361mm (300 x 300 DPI)
Page 42 of 42Diabetes