p53 Mutations in Malignant Gliomas’cebp.aacrjournals.org/content/cebp/7/4/303.full.pdf · Beth...

Vol. 7, 303-308, April 1998 Cancer Epidemiology, Biomarkers & Prevention 303

3 The abbreviations used are: SSCA. single-strand conformation analysis: FFPE,

formalin-fixed, paraffin-embedded.

p53 Mutations in Malignant Gliomas’

Yu Li, Robert C. Millikan, Susan Carozza,Beth Newman, Edison Liu, Richard Davis, Rei Miike, andMargaret Wrensch2

Department of Epidemiology, School of Public Health, University of North

Carolina, Chapel Hill, North Carolina 27599-7400 [Y. L., R. C. M., B. NI;

Cancer Registry Division, Texas Department of Health, Austin, Texas 78756

[S. Cl; Division of Clinical Sciences, National Cancer Institute, Bethesda,Maryland 20892-2440 [E. LI; Departments of Neuropathology ER. D.l and

Epidemiology and Biostatistics [R. M., M. W.], School of Medicine,

University of California, San Francisco, Califomia 94143

Abstract

A population-based series of incident cases of malignantglioma were analyzed for mutations in the tumorsuppressor gene p53. Exons 4-8 were screened usingPCR-single-strand conformation analysis and confirmedthrough direct sequencing. Of 62 tumors analyzed, 12(19%) contained mutations in pS3: one 18-bp duplicationin exon 5, five point mutations in exon 4, three pointmutations in exon 7, two point mutations in exon 8, and asplice-site mutation at the exon 6/intron 7 boundary. Incontrast to previous studies of malignant glioma, theprevalence of transversion mutations (56%) was higherthan transition mutations (33%). A large proportion oftransversion mutations occurred in exon 4, a region thatis not routinely screened in gliomas. We present here animproved method for screening exon 4 (and other GC-rich regions) ofp53 using PCR-single-strandconformation analysis. The high frequency oftransversion mutations suggests a role for exogenouscarcinogens in the etiology of malignant glioma.

Introduction

Approximately 34,000 benign and malignant brain tumors arediagnosed every year in the United States (1). The most fre-quent primary malignant brain tumor is cerebral glioma (2, 3).

Gliomas are classified morphologically as astrocytomas, oligo-dendromas, ependymomas, and mixed tumors. Astrocytomas,

the most common category, include a spectrum of tumorsranging from slow-growing juvenile pilocytic astrocytomas to

highly malignant glioblastoma multiforme. The incidence ofmalignant glioma has increased over the past 20 years (4), andthe etiology remains largely unknown (5-7). Even with themost aggressive available treatment, overall survival averages1-3 years (8).

Received 8/7/97; revised 12/1 2/97; accepted 1/8/98.

The costs of publication of this article were defrayed in part by the payment of

page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

� Supported by American Cancer Society Grant IRG-15-33 and USPHS Grant

CA 52689.

2 To whom requests for reprints should be addressed, at Department of Epide-

miology and Biostatistics, School of Medicine, University of California, San

Francisco, CA 94143-0560.

Mutations in the tumor suppressor gene p53 are found in-25% ofhuman gliomas (9, 10). Mutations occur in both high-

and low-grade astrocytomas (1 1-14) but are less common innon-astrocytic brain tumors ( 15). The majority of p53 muta-(ions in gliomas are reported to be transitions, including a high

proportion of G:C-�A:T transitions at CpG sites ( 10, 1 1, 16,17). The observed high frequency of transition mutations and

low frequency of transversions have lead some reviewers tosuggest that the etiology of gliomas is most compatible withendogenous mutagenic mechanisms, rather than the influenceof exogenous environmental carcinogens ( 13, 16, 17).

Most previous studies of gliomas have screened only ex-ons 5-8 (14, 18-19) or exons 5-9 (20) of the p53 gene. Only

one study screened introns within the exon 5-8 region (1 1); thesame study analyzed exon 4, but only a portion of this exon was

screened ( 1 1). Exon 4 is not routinely screened using SSCA3because its high GC content and complicated secondary struc-

ture interfere with conformation analysis. However, exon 4contains part of the highly conserved domain 2 of p53, as well

as a portion of the core DNA-binding domain critical for tumorsuppressor activity (21). Mutations in exon 4 ofp53 have been

reported in a wide variety of human tumors using direct se-quencing and other screening techniques (22, 23).

In this study, we screened 62 gliomas for mutations in p53using PCR-SSCA, followed by direct sequencing (24). We

developed methods for screening exon 4 of p53, includingrestriction enzymatic digestion of PCR products before SSCA

and variation in gel conditions.

Subjects and Methods

Human Tumor Samples. As part of the San Francisco BayArea Adult Glioma Study, a population-based, case-controlstudy of brain cancer (6), all histologically confirmed incidentcases of malignant glioma (ICD-0-2 morphology codes 9380-

9481) in adults aged 20 years and older were identified in sixSan Francisco Bay Area counties (Alameda, Contra Costa,Mann, San Mateo, San Francisco, and Santa Clara) for theperiod August 1 , 199 1 to March 3 1 , 1994. FFPE tumor blockswere obtained from a consecutive series of 62 incident cases to

develop techniques for p53 mutation analysis.

Centralized Histological Review. Pathology slides were re-viewed by a single neuropathologist (R. D.), who indicated the

most informative tumor block for molecular studies. Theseblocks were then sectioned and areas of tumor were marked on

an H&E-stained slide, which identified areas of interest forDNA extraction from 10-sm unstained sections.

Interviews. Structured in-person interviews were conducted toobtain personal and family history of cancer, as well as otherinformation. Details for obtaining and validating personal and

family medical histories, as well as the algorithm used for

on May 6, 2019. © 1998 American Association for Cancer Research. cebp.aacrjournals.org Downloaded from

http://cebp.aacrjournals.org/

304 p53 Mutations in Gliomas

Table I p53 mutational ana lysis: Sequence of oligonucleotide primers for PCR-SSC A and direct DNA-sequencing

Exon” Size (bp) 5-primer” 3-primer

4.1 188 GACCTGGTCCTCTGACTGCT

( IN) CCTCTGACTGCTCTTTTCAC

CGGTGTAGGAGCTGCTGGTG

( IN) CGGTGTAGGAGCTGCTGGTG

4.2 249 TCCAGATGAAGCTCCCAGAA

(IN) AAGCTCCCAGAATGCCAGAG

ACGGCCAGGCATTGAAGTCT

(IN) TCTCATGGAAGCCAGCCCCT

5 294 GCTGCCGTGTTCCAGTTGCT

( IN) CCAGTTTCTTTATCTGTTCA

CCAGCCCTGTCGTCTCTCCA

( IN) TGTCGTCTCTCCAGCCCCAG

6 199 GGCCTCTGATTCCTCACTGA

(IN) CCTCTGATTCCTCACTGATT

GCCACTGACAACCACCCTTA

(IN) ACCACCCTTAACCCCTCCTC

7 196 TGCCACAGGTCTCCCCAAGG

(IN) GCGCACTGGCCTCATCTTGG

AGTGTGCAGGGTGGCAAGTG

(IN) TGTGCAGGGTGGCAAGTGGC

S 225 CCTTACTGCCTCTTGCTTCT ATAACTGCACCCTTGGTCTC

( IN) TCTCCTCCACCGCTTCTTGT( IN) CCTCTTGCTTCTCTTTTCCT

“ Exon 4 is divided into two fragments. For Exon 4-1, the 3-inner and outer primers share the same sequence.

I, (IN). internal primers for direct DNA sequencing.

classifying family history of cancer, have been presented else-where (6).

Extraction of Tumor DNA. For each tumor sample, areas of

tumor tissue were individually microdissected and scraped intoa I .5-ml microcentnfuge tube. Approximately three to fourunstained sections were used from each tumor. Tissues were

deparaffinized by adding 1 ml of xylenes, vortexing, and al-lowing the samples to sit at room temperature for 20 mm. Afterdecanting off the xylenes, samples were precipitated by adding1 ml of 95% ethanol. Samples were then dried by vacuum for2-3 h. After drying, 150 pA of lysis buffer containing 1% TritonX-l00, 1 x PCR reaction buffer (Perkin-Elmer Cetus, Norwalk,

CT), and 3 pA of 10 mg/ml proteinase K were added. Themixture was incubated at 58#{176}Cfor 3 h, followed by incubation

at 95#{176}Cfor 10 mm to inactivate the proteinase. The finalsolution was centrifuged at 12,000 rpm/mm for 10 mm and

stored at 20#{176}C.For analysis of p53 mutations, each tissueextract was divided into two aliquots. The first aliquot was usedto screen for mutations using SSCA and direct sequencing. Thesecond aliquot was used to confirm the presence of mutation in

a separate set of amplification and sequencing PCR reactions(described below).

PCR. The initial PCR amplification was conducted using a100-pA reaction mixture containing 10 mrvi Tris-HC1 (pH 8.3),50 mM KC1, 1 .5 mM MgCl,, 200 �tM deoxynucleotide triphos-phates, 2.5 units of Taq DNA polymerase (Perkin-Elmer Ce-

tus), 0.6 .LM 3’ and 5’ PCR-primers (exons 4-8 of the p53gene), and 1 pA lysis DNA solution. Primer sequences arepresented in Table 1.

Because exon 4 is a larger exon, we designed two over-lapping primer pairs to amplify each half of exon 4 separately

(exons 4- 1 and 4;2, see Table 1 ). The reaction mixture wasoverlaid with 75 pA of mineral oil and subjected to 35 cycles ofPCR amplification using a DNA thermocycler (Perkin-Elmer

Cetus). The first cycle consisted of 5 mm at 95#{176}C,1 mm at55#{176}C,and I mm at 72#{176}C,followed by 33 cycles of I mm at

94#{176}C,1 mm at 55#{176}C,and 1 mm at 72#{176}C.The final cycle was 1mm at 94#{176}Cand 10 mm at 60#{176}C.

SSCA. For SSCA, PCR products were subjected to a secondround of PCR amplification using radioactive labeling. The20-pA reaction mixture contained 10 msi Tris-HC1 (pH 8.3), 50

mM KC1-,, 1 .5 mM MgC1.,, and 120 mrvi of each deoxynucleotidetriphosphate, mixed with 1 pA of PCR product from the pre-

liminary PCR reaction, 0.2 p1 of [a-32P]dCTP (3000 Ci/ml),

0.5 unit of Taq polymerase, and 0.6 �.LM 3’ and 5’ internalprimers for each exon (Table 1 ). The reaction mixture was

subjected to the same cycle sequence as described for the initial

PCR reaction. Two pA of the amplified product were withdrawn

and mixed with 100 pA of 0. 1% SDS and 10 mrsi EDTA. Three

pA of this solution were mixed with 3 pA of 95% formamide, 20mM EDTA, and 0.05% xylene cyanol, heated to 95#{176}Cfor 6 mm,

and then placed on ice. To overcome problems generated by the

GC-rich secondary structure of exon 4-2, 5 pA of the second-round SSCA-PCR product for exon 4-2 were digested by A!uI

(United States Biochemical Corp., Cleveland, OH) in a totalvolume of 25 pA at 37#{176}Covernight.

Electrophoresis for SSCA was performed under two con-ditions for each sample: (a) 6 pA of the denatured PCR products

were electrophoresed for 4 h at 30 W in a 6% nondenaturing

polyacrylamide gel containing 10% glycerol at room tempera-

ture (cooled by a fan); and (b) a second 6-pA aliquot of eachsample was electrophoresed for 2 h at 30 W in a nondenaturing

polyacrylamide gel without glycerol at 4#{176}C(in a refrigerator).

Autoradiographs were exposed at -70#{176}Cfor 1-3 days. DNAfrom FFPE normal spleen was used as a negative control.

Specimens showing electrophoretic mobility shifts at eithertemperature compared with the negative control DNA were

deemed SSCA positive and were submitted to direct DNAsequencing.

Fig. 1 presents an example of SSCA analysis for exon 4-2.

SSCA patterns before and after restriction enzyme digestion areshown, with the electrophoretic mobility shift designated with

an arrow (sample 80).

DNA Sequencing. Direct sequencing of PCR products was

used to confirm positive SSCA results. First-round PCR prod-ucts were purified using Centricon 30 spin columns (Amicon,

Beverly, MA). For sequencing, a second round of amplification

was performed using the primers used for SSCA analysis (in-

ternal primers, Table 1). Primers were used in a ratio of 1 :50 togenerate single-strand amplification of the antisense DNAstrand and in a 50: 1 ratio for single-strand amplification of the

sense strand. Asymmetric PCR cycling conditions were iden-tical to those described for previous PCR reactions. Second-round PCR products were purified using Centricon 30 spin

columns. Sequencing of the purified asymmetric PCR productwas performed using the standard dideoxy-chain termination

approach recommended by the manufacturer (United StatesBiochemical). Samples were electrophoresed on an 8% Se-

quencing gel at 55 W for 2 h. The gel was dried and exposed

to Hyper film (Amersham, Arlington Heights, IL) overnight atroom temperature. Ten % of all SSCA negatives were submit-

ted to direct DNA sequencing as a standard procedure to



Cancer Epidemiology, Biomarkers & Prevention 305

SamplelD: � � � �

(a)

. --� .1

SamplelD: � � E �

. � � � =�4e a a

I

(b)

Fig. 1. SSCA ofp53. exon 4 (2). a. SSCA-PCR gel electrophoresis. b, SSCA-

PCR gel electrophoresis after AluI restriction enzyme digestion of PCR products.

determine the false-negative rate of SSCA screening. In ourcumulative experience with over 300 samples analyzed for p53

mutations using SSCA, we have not uncovered any false neg-atives.

A sample was scored as a preliminary positive for p53mutation only if the same mutation was observed on both the

sense and antisense DNA strand of PCR products from the firstaliquot of tissue lysate. Preliminary positives were submitted toa second round of PCR amplification and sequencing using the

second stored aliquot of the original tissue lysate. Samples werescored as a final positive only if the same mutation appeared on

both sense and antisense strands of both aliquots of the tissuelysate.

Statistical Analysis. Fisher’s exact test was used to evaluateassociations between the presence of p53 mutation and family

history of any cancer, family history of brain tumors, andpersonal history of other cancers (25). Two-sided Ps werecalculated using SAS (26).

Results

Histological Classification. Tumors were classified into the

following histological categories: glioblastoma multiforme(WHO grade IV; n 39); highly anaplastic astrocytomas(WHO grade III; n = 11); mixed gliomas, including oligoas-

trocytomas and other mixed types (n = 6); and other tumors,

consisting of juvenile pilocytic astrocytomas (n = 2), oligo-dendroglioma (n 1), ependymoma (n = 1), low-grade astro-cytoma (n = 1), and an anaplastic glioma too small to be

classified.

p53 Mutation. Of 62 tumors analyzed, 12 (19%) showed mu-

tations in p53. Histological characteristics of gliomas with andwithout p53 mutations are presented in Table 2. The proportion

of tumors bearing p53 mutations within each histological cat-egory were: 8 of 39 (21%) glioblastomas; 1 of 1 1 (8%) highly

anaplastic astrocytomas; and 2 of 6 (33%) mixed gliomas. Inthe “other” category, the only tumor showing p53 mutation was

an anaplastic glioma too small to be classified.

Patient Characteristics. Characteristics of patients with p53mutation-positive and p53 mutation-negative gliomas are pre-sented in Table 3. Patients were categorized as White or non-

Table 2 San Francisco Bay Area Adult Glioma Study ) 1991-1995):

Histological characteristics of gliomas according to p53 mutation status

J)53 mutationMorphology --------� �-- �- �- -

Negative (%) Positive (‘Ic)

Glioblastoma 31 (62) S (67)

Highly anaplastic astrocytoma 0 (20) I (8)

Mixed glioma 4 (8) 2 ) I7

Other 5” (10) I” (8)

Total 50 (100) 12 (1(8))

“ Includes juvenile pilocytic astrocytoma (n = 2). oligodendroglionia (ii

ependymoma (n = 1 ). and low-grade astrocytoma (ii = I).

I, Anaplastic glioma (too small to be classified).

Table 3 San Francisco Bay Area Adult Glioma Study ( 199 1-1995):

Characteristics of glioma patients according to pSi mutation status

= I

GroupJS53 mutation

Negative (‘/) Positive (‘k)

�1 50 12

Age

Mean (yr) ± SD 54.7 � 16.1 55.5 ± 20.2

20-29 3 (6.0) I (8.3)

30-39 8l6.0) 2(lfl.7

40-49 714.0) 3)25.0)

50-59 13 (26.0) I (8.3)

60-69 6(12.0) I(8.3

70 or over 13 (26.0) 4 (33.3)

Race

White 45 (90.0) 1 1 (91.7)

Non-White” 5 ( 10.0) I (8.3)

Sex

Male 28 (56.0) 7 (58.3)

Female 22(44.0) 5(41.7)

Family history of any cancer

Positive 21 (42.0) 7 (58.3)

Negative 22 (44.0) 4 (25.0)

Missing 7 ( 14.0) 1 ) 16.7)

Family history of brain tumors

Positive I (2.0) 0

Negative 45 (90.0) 1 1 (92.0)

Missing 4 (8.0) I (8.0)

Personal history of other cancers

Positive 4(8.0) 2)16.7)

Negative 46 (92.0) 10 (83.3)

Includes one African-American, three Asian-Americans. and two Hispanics.

White (including African-American, Asian-American, or His-

panic). Differences between those with and without p53mutations were minimal for age, race, and gender. The patientgroups also did not differ significantly according to family

history of other cancers (P = 0.30), family history of braintumors (P = 0.81), or personal history of other cancers (P =

0.33).

Spectrum and Location ofp53 Mutations. The location andspectrum of observed p53 mutations are presented in Table 4.All mutations were single-base pair point mutations except fora duplication of 18 bases (TGAGCGCTGCCCCCACCA) inexon 5. The majority of mutations were transversions (7 of 12,

58%), whereas only 33% (4 of 12) were transitions. Transitionmutations occurred at CpG sites (27) in two patients (cases 3

and 1 83). In three patients, the DNA alteration did not result ina change in amino acid (cases 3, 80, and 142). Excludingpatients with noncoding mutations, the proportion of transver-

sions was 56% (5 of 9), and 33% (3 of 9) contained transitions.



306 p53 Mutations in Gliomas

Table 4 San Francisco Bay Area Adult Glioma Study (1991-1995): Location and spectrum of p53 mutations

Block number Tumor typeAge at . . . .. . Location Codon Nucleotide change Amino acid Type

diagnosis

Family history

of cancer

3 GBM 77 Exon 4 36 CCG -� CCA Pro -“ Pro G -“ A Transition Yes

65 GBM 49 Exon 4 69 GCT -s GAT Ala -� Asp G - A Transversion Adopted

258 AG 77 Exon 4 53 TGG -“ TGC Trp -‘ Cys G -� C Transversion Yes

80 GBM 85 Exon 4 1 12 GGC -“ GGA Gly -“ GIy C -“ A Transversion Yes

142 GBM 76 Exon 4 1 12 GOC -“ GGA Gly -‘ Gly C -“ A Transversion No

45 GBM 58 Exon 5 TGAGCGCTGCCCCCACCA (18 bps) Duplication No

92 GBM 63 Exon 7 234 TAC -a CAC Tyr -“ His T -a C Transition Yes

238 GBM 47 Exon 7 251 ATC - AGC lIe -� 5cr T -“ G Transversion Yes

183 GBM 39 Exon 8 273 CGT -a CAT Arg -“ His G � A Transition No

159 HAA 40 Exon 6/ Splice gt -“ gg T -“ G Transversion

Intron 7 Site

Yes

84 Mixed 30 Exon 7 234 TAC -* TGC Tyr -� Cys A -“ G Transition Yes

I I I Mixed 25 Exon 8 270 1TI’ -“ TGT Phe -“ Cys T -“ G Transversion No

“ GBM, glioblastom a multiforme; A G, anaplastic glioma (too small to be classified); HAA, highly anaplastic astrocytoma; Mixed, mixed gliomas.

Discussion

We analyzed p53 mutations from 62 incident cases of malig-

nant glioma from a population-based, case-control study. Mu-

tations were found in 12 tumors ( 19%). Previous studies of

glioma report an average mutation prevalence of 25%, with arange of 18-37% (reviewed in Refs. 10, 12, 13, 17, and 28).Most previous studies screened only exons 5-8 of p53. Ouroverall prevalence of p53 mutation is low relative to otherstudies, despite more extensive screening of exon 4 as well as

intron/exon boundaries. This lower prevalence may reflect the

fact that our study is population based. However, the distribu-(ion of gliomas by histological type is similar to previous

hospital-based studies (Table 2). The lower prevalence of mu-

tation could also have resulted from the fact that we repeatedamplification and sequencing on all positive samples, avoidingpotential PCR artifacts.

We observed p53 mutations only in high-grade and mixed

tumors (Table 2). However, the number of low-grade tumorsanalyzed was small. Some previous studies report that theprevalence of p53 mutations is similar in low- and high-grade

gliomas (1 1, 15). However, Fulls et a!. (29) reported a highprevalence ofp53 mutation in high-grade gliomas and absenceof mutation in low-grade gliomas, and Rasheed et a!. (20)reported a higher prevalence of p.53 mutation in patients with

anaplastic astrocytomas. Sidransky et a!. (30) hypothesized thatp53 mutation may be involved in progression of gliomas fromlow to high grade. Van Meir el a!. (31) reported that many

glioblastomas contain only wild-type p53, suggesting that in-activation of p53 is not an obligatory step in formation of

high-grade brain tumors. Additional models for development ofmalignant glioma that combine histology and molecular alter-ations at a variety of loci have been presented (17, 28).

Previous studies suggest that patients with p53 mutation-

positive gliomas are younger than patients with mutation-neg-ative tumors (reviewed in Ref. 12). We compared these twopatient groups in our dataset and did not observe appreciabledifferences based on age, race, or gender (Table 3). Patientswith p53 mutations were slightly more likely to have a historyof cancer in first-degree relatives (58% versus 42%) as well as

a personal history of other cancers (17% versus 8%; Table 3),but these differences were not statistically significant.

The prevalence of germ-line p53 mutation among uns-

elected glioma patients is reported to be quite low (32, 33). Liet a!. (34) detected germ-line p53 mutations in only 1 of 80unselected glioma patients. Prevalence of inherited p53 muta-

tion is reported to be higher among patients with a family

history of cancer, a personal history of other primary malig-

nancies, or both (8, 34). We felt it was important to address thepossibility of germ-line mutation, because some patients in ourstudy reported a positive family history and/or a personal his-

tory of other malignancies (Table 3). However, we were unableto perform p53 mutation screening using germ-line DNA sam-ples because the informed consent for our case-control study

did not grant permission for genetic testing.The CGT-*CAT mutation at codon 273 (case 183) has

been reported previously as an inherited mutation in Li-Frau-

meni syndrome (32, 33). However, codon 273 also represents a

hotspot for somatic alteration in gliomas ( 10, 1 1, 13, 16, 18),

and the CGT-+CAT mutation has been reported as a somaticalteration in sporadic brain tumor patients (9, 14, 27). The

patient with the codon 273 mutation (case 183) did not reporta positive family history. In addition to codon 273, a high

frequency of somatic mutation has been reported in codons 175and 248 ofp53 in gliomas (1 1, 18; reviewed in Refs. 10, 13, and

17). We did not observe mutations at codons 175 or 248 in ourdataset. The CCG-*CCA alteration at codon 36 has beenreported as a germ-line polymorphism (35) and as a somatic

genetic alteration in lung cancer (23, 27). The remaining mu-

tations have been reported previously in tumors from a varietyof sites ( 10, 22-23, 27, 36).

In three patients, the mutations in p53 were not predictedto lead to a change in amino acid sequence (cases 3, 80, and

142). Noncoding mutations in p53 mutations have been re-ported in gliomas (14, 18, 27) and other tumors (27, 36). Some

noncoding mutations in p53 (37) and other genes (38, 39, 40)have the potential to create cryptic splice sites. However, the

functional significance of the noncoding mutations observed incases 3, 80, and 142 is unknown. In the database of Hollstein

et a!. (27), 3% ofp53 mutations in all tumors as well as gliomasare silent. According to Strauss (41), the high frequency ofsilent mutations in p53 suggests that a hypermutability processmay operate on this gene during tumorigenesis. However, it is

possible that silent mutations bear no relationship to tumor

etiology (10, 41). Thus, in the discussion of potential etiologyof glioma (below), we exclude noncoding mutations.

Our observed proportion of transversion mutations (56%

of coding mutations) is higher than previous reports of gliomas

[19% in the p53 databases of both Greenblatt et a!. (10) andHollstein et a!. (27)]. Two of the coding transversion mutations

in our dataset were observed in exon 4. Although exon 4 is one



Cancer Epidemiology, Biomarkers & Prevention 307

of the larger exons of p53 and contains a portion of the coreDNA-binding domain (21), only 20% of studies that screen for

p53 mutations analyze exons other than 5-8 (41). Studies that

sequence additional exons of p53 often find a different patternof mutation (42, 43). Interestingly, in the database of Hollstein

et a!. (27), of five mutations reported in exon 4 in gliomas, fourwere transversions and one was an insertion mutation.

One reason for failure to screen exon 4 of p53 may betechnical difficulties using the most common screening method,

SSCA. To address the relatively large size of exon 4, as well assecondary structures created by regions of high GC content, we

modified our SSCA protocol to screen for mutations in this

region: (a) to decrease the size of the PCR amplicon, we

designed two overlapping primer pairs within exon 4, ampli-

fying fragments of 1 88 bp (primer set 4- 1) and 249 bp (primer

set 4-2). Sensitivity of SSCA has been shown to decrease withfragment sizes larger than 300 bp (24). We followed protocolsaimed at achieving 90% or greater sensitivity for SSCA screen-ing using FFPE tissue extracts (24); (b) we performed restric-tion enzyme digestion of the second exon 4 fragment (exon 4-2)with A!uI to relieve intrastrand binding and reduce secondarystructures (e.g., hairpin loops) created by regions of high GCcontent; and (c) we modified the gel running conditions, in-

cluding variations in temperature and glycerol content. Thesemodifications increased the number of SSCA bands and facil-itated detection of mobility shifts required for identification of

sequence alterations (Fig. 1).Our finding of a high prevalence of transversion mutations

in p53 suggests that exposure to exogenous environmental

factors should be considered in the etiology of malignant gli-

oma. A high prevalence of transversion mutations has beeninterpreted as suggestive of the action of exogenous carcino-

gens (e.g. , chemical mutagens), whereas a high prevalence oftransitions, particularly at CpG sites, suggests endogenous mu-

tagenic processes (10, 16, 44). Previous studies of gliomasreport a higher prevalence of transition than transversion mu-

tations in p53 (10, 1 1, 18, 27). Our observed prevalence oftransversion mutations (56%) is similar to that of lung tumors

(57%; Ref. 10). Our results must be regarded as preliminary,because our series of glioma patients is small (n = 62). We

suggest that future studies of glioma (and perhaps other malig-nancies) routinely screen for mutations in exon 4 of the p53

gene. The laboratory techniques presented in this report mayprove useful in this regard. In epidemiological studies aimed at

identifying risk factors for glioma, history of exposure to en-vironmental factors (including solvents and other occupationalexposures) should be considered.

Acknowledgments

We thank two anonymous reviewers for helpful comments on the manuscript.

References

1 . Central Brain Tumor Registry of the United States (CBTRUS). 1996 Annual

Report. Chicago: CBTRUS, 1997.

2. Kleihues, P., Soylemezoglu. F., Schauble, B., Scheithauer, B., and Burger, P.

Histopathology, classification and grading of gliomas. Glia, 15: 21 1-221, 1995.

3. Parker, S., Tong, T., Bolden, S., and Wingo, P. Cancer statistics, 1997. CA

Cancer J. Clin., 47: 5-27, 1997.

4. Ries, L. A. G., Miller, B., Hankey, B., Kosary, D., Harris. A., and Edwards,

B. K. (eds.). SEER Cancer Statistics Review, 1973-1991. NIH Pub. No. 94-2789.

Bethesda, MD: National Cancer Institute, 1994.

5. Wrensch, M., Bondy, M. L., Wiencke, J., and Yost, M. Environmental risk

factors for primary malignant brain tumors: a review. J. Neuro-oncol., 17: 47-64.

1993.

6. Wrensch, M.. Lee, M., Miike, R., Newman, B.. Barger. G., Davis, R..

Wiencke, J., and Neuhaus, J. Family and personal medical history of cancer and

nervous system conditions among adults with glioma and controls. Am. J.

Epidemiol., 145: 581-593, 1997.

7. Inksip, P., Linet, M., and Heineman. E. Etiology of brain tumors in adults.

Epidemiol. Rev., 17: 382-414, 1995.

8. Kyritsis, A., Bondy, M., Xiao, M., Berman, E., Cunningham. J., Lee, P., Levin,

V., and Saya, H. Germline p53 gene mutations in subsets of glioma patients.

J. NatI. Cancer Inst., 86: 344-349, 1994.

9. Nigro, J., Baker, S., Presisinger, A., Hostetter, R., Cleary, K.. Bigner, S.,

Davidson, N., Baylin, S., Devilee, P., Glover, T., Collins, F., Weston, A.. Modali,

R., Harris, C., and Vogelstein, B. Mutations in the p53 gene occur in diverse

human tumor types. Nature (Lond.), 342: 705-708, 1989.

10. Greenblatt, M., Bennett, W.. Hollstein, M., and Harris, C. Mutations in the

p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis.

Cancer Rca., 54: 4855-4878. 1994.

1 1. Koga, H., Zhang, S., Kumanishi, T., Washiyama, K., Ichikawa, T., Tanaka,

R., and Mukawa, J. Analysis of p53 gene mutations in low- and high-grade

astrocytomas by polymerase chain reaction-assisted single-strand conformation

polymorphism and immunohistochemistry. Acta Neuropathol., 87: 225-232,

1994.

12. Dalrymple. S., and Jenkins, R. Molecular genetics of astrocytomas and

meningiomas. Curr. Opin. Neurol., 7: 477-484. 1994.

I 3. Kleihues, P., Aguzzi, A., and Ohgaki. H. Genetic and environmental factors

in the etiology of human brain tumors. Toxicol. Lets. (Amst.). 82/83: 601-605,

1995.

14. Ohgaki, H., Eibl, R., Schwab, M., Beichel, M., Mariani, L., Genring, M.,

Petersen, I., Boll, T., Wiestler, 0., and Kleihues, P. Mutations of the p53 tumor

suppressor gene in neoplasms of the human nervous system. Mol. Carcinog.. 8:

74-80, 1993.

15. Von deimling, A., Eibl, R., Ohgaki, H.. Louis, D., Von Ammon, K., Petersen,

I., Kleihues, P., Chung, R., and Seizinger, B. p53 mutations are associated with

I ‘lp allelic loss in grade II and grade III astrocytoma. Cancer Rca., 52: 2987-

2990, 1992.

16. Bogler, 0., Huang, H-J., Kleihues, P., and Cavenee, W. The p53 gene and itsrole in human brain tumors. Glia, 15: 308-327, 1995.

17. Louis, D. A molecular genetic model of astrocytoma histopathology. Brain

Pathol., 7: 755-764. 1997.

18. Sarkar, F., Kupsky. W., Li, Y-W., and Sreepathi, P. Analysis of p53 gene

mutations in human gliomas by polymerase chain reaction-based single-strand

conformation polymorphism and DNA sequencing. Diag. Mol. Pathol., 3: 2-8,

1994.

19. Mashiyama. S.. Murakami, Y., Yoshimoto, T., Sekiya. T., and Hayashi, K.

Detection of p53 gene mutations in human brain tumors by single strand con-

formation polymorphism analysis of polymerase chain reaction products. Onco-

gene, 6: 1313-1318, 1991.

20. Rasheed, B., McLendon, R., Hemdon, J., Friedman, H., Friedman, A.,

Bigner, D., and Bigner, S. Alterations of the TPS3 gene in human gliomas. Cancer

Res., 54: 1324-1330, 1994.

21. Cho, Y., Gorina, S., Jeffrey, P.. and Pavletich, N. Crystal structure of a p53

tumor suppressor-DNA complex: understanding tumorigenic mechanisms. Sci-

ence (Washington DC). 265: 346-355. 1994.

22. Hollstein, M., Sidransky, D., Vogelstein. B., Harris, C. p53 mutations in

human cancers. Science (Washington DC). 253: 49-53. 1991.

23. deFromentel, C., and Soussi, T. TPS3 tumor suppressor gene: a model for

investigating human mutagenesis. Genes Chromosomes Cancer. 4: 1-15. 1992.

24. Hayashi, K., and Yandell, D. How sensitive is PCR-SSCP? Hum. Mutat., 2:

338-346, 1993.

25. Rosner, B. Fundamentals of Biostatistics. Boston: PWS-Kent. 1990.

26. SAS version 6.11. Cary, NC: SAS Institute, 1995.

27. Hollstein, M., Shmoer, B., Greenblatt, M., Soussi, T., Hovig. E., Montesano,

R., and Hams, C. Somatic point mutations in the p.53 gene of human tumors and

cell lines: updated compilation. Nucleic Acids Res., 24: 141-146, 1996.

28. Von Deimling. A., Louis, D., and Wiestler, 0. Molecular pathways in the

formation of gliomas. Glia, 15: 328-338, 1995.

29. Fults, D., Brockmeyer, D., Tullous, M., Pedone, C.. and Cawthon, R. p53

mutation and loss of heterozygosity on chromosome 17 and 10 during human

astrocytoma progression. Cancer Rca., 52: 674-679. 1992.

30. Sidransky, D., Mikkelsen, T., Schwechheimer, K., Rosenblum, M., Cavenee,W., and Vogelstein, B. Clonal expansion of p53 mutant cells is associated with

brain tumor progression. Nature (Lond.), 355: 846-847, 1992.

31. Van Meir, E., Kikuchi, T., Tada, M., Li, H.. Diserens. A-C., Wojcik. B.,Huang. H-H., Friedmann, T., de Tribolet, N., and Cavenee, W. Analysis of the



308 p53 MutatIons In Gliomas

p53 gene and its expression in human glioblastoma cells. Cancer Res., 54:

649-652, 1994.

32. Kovar. H., Auinger, A., Jug, G., Muller, T., and Pillwein, K. p53 mosaicismwith an exon 8 germline mutation in the founder of a cancer-prone pedigree.

Oncogene. 7: 2169-2173, 1992.

33. Frebourg. T., Kassel, J.. Lam. K., Gryka. M., Barbier, N., Andersen, T.,

Borresen. A-L., and Friend, S. Germ-line mutations of the p53 tumor suppressor

gene in patients with high risk for cancer inactivate the p53 protein. Proc. NatI.Aced. Sci. USA. 89: 6413-6417. 1992.

34. Li, Y-J.. Sanson, M., Hoang-Xuan, K., Delattre. J-Y., Poisson, M., Thomas.

G., and Hamelin, R. Incidence of germ-line p53 mutations in patients with

gliomas. Int. J. Cancer. 64: 383-387, 1995.

35. Felix, C., Brown, D., Mitsudomi, T., Ikagaki, N., Wong, A., Wasserman, R.,

Womer, R., and Biegel, J. Polymorphism at codon 36 of the p53 gene. Oncogene,

9: 327-328, 1994.

36. Cariello, N.. Cui, L., Beroud, C., and Soussi, T. Database and software for the

analysis of mutations in the human p53 gene. Cancer Res., 54: 4454-4460, 1994.

37. Hongyo. T.. Buzard, G., Palli, D., Weghorst, C., Amorosi. A., Galli, M..

Caporaso. N., Fraumeni, J., and Rice, J. Mutations of the K-ras and p53 genes in

gastric adenocarcinomas from a high-incidence region around Florence, Italy.

Cancer Res., 55: 2665-2672, 1995.

38. Liu. W., Qian, C., and Francke. U. Silent mutation induces exon skipping of

the fibrillin-1 gene in Marfan syndrome. Nat. Genet., 16: 328-329, 1997.

39. Li. S., Park, W., Pyeritz, P., and Jabs, E. Effect of splicing of a silent FGR2

mutation in Crouzon syndrome. Nat. Genet.. 9: 232-233, 1995.

40. Berg, M., Guevara-Aguirre, J., Rosenbboom. A., Rosenfeld, R., and Francke,U. Mutation creating a new splice site in the growth hormone receptor genes of

37 Ecuadorean patients with Laron syndrome. Hum. Mutat., 1: 24-34, 1995.

41. Strauss, B. Silent and multiple mutations in p53 and the question of the

hypermutability of tumors. Carcinogenesis (Lend.), 18: 1445-1452, 1997.

42. Greenblau, M., GrolIman, A., and Harris, C. Deletions and insertions in the

p53 tumor suppressor gene in human cancers: confirmation of the DNA polym-

erase slippage/misalignment model. Cancer Res.. 56: 2130-2136, 1996.

43. Casey, G., Lopez, M., Ramos, J., Plummer, S., Arboleta, M., Shaughnessy,

M., Karlan, B., and Slamon, D. DNA sequence analysis ofexons 2 through 1 1 and

immunohistochemical staining are required to detect all known p53 alterations in

human malignancies. Oncogene, 13: 1971-1981, 1996.

44. Biggs, P., Warren, W., Veniu, S., and Stratton, M. Does a genotoxic carein-

ogen contribute to human breast cancer? The value of mutations spectra in

unravelling the etiology of cancer. Mutagenesis, 8: 275-283, 1993.



1998;7:303-308. Cancer Epidemiol Biomarkers Prev Y Li, R C Millikan, S Carozza, et al. p53 mutations in malignant gliomas.

Updated version

http://cebp.aacrjournals.org/content/7/4/303

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cebp.aacrjournals.org/content/7/4/303To request permission to re-use all or part of this article, use this link



http://cebp.aacrjournals.org/cgi/alerts

mailto:[email protected]



p53 Mutations in Malignant Gliomas’cebp.aacrjournals.org/content/cebp/7/4/303.full.pdf · Beth...

Documents

Transcript of p53 Mutations in Malignant Gliomas’cebp.aacrjournals.org/content/cebp/7/4/303.full.pdf · Beth...