P-glycoprotein drug transporters in the parasitic ...
Transcript of P-glycoprotein drug transporters in the parasitic ...
Graduate Theses and Dissertations Iowa State University Capstones, Theses and Dissertations
2019
P-glycoprotein drug transporters in the parasitic nematodes P-glycoprotein drug transporters in the parasitic nematodes
Toxocara canis and Parascaris Toxocara canis and Parascaris
Jeba Rose Jennifer Jesudoss Chelladurai Iowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/etd
Part of the Parasitology Commons, and the Veterinary Medicine Commons
Recommended Citation Recommended Citation Jesudoss Chelladurai, Jeba Rose Jennifer, "P-glycoprotein drug transporters in the parasitic nematodes Toxocara canis and Parascaris" (2019). Graduate Theses and Dissertations. 17707. https://lib.dr.iastate.edu/etd/17707
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].
P-glycoprotein drug transporters in the parasitic nematodes Toxocara canis and Parascaris
by
Jeba Rose Jennifer Jesudoss Chelladurai
A dissertation submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
Major: Veterinary Pathology (Veterinary Parasitology)
Program of Study Committee:
Matthew T. Brewer, Major Professor
Douglas E. Jones
Richard J. Martin
Jodi D. Smith
Tomislav Jelesijevic
The student author, whose presentation of the scholarship herein was approved by the program
of study committee, is solely responsible for the content of this dissertation. The Graduate
College will ensure this dissertation is globally accessible and will not permit alterations after a
degree is conferred.
Iowa State University
Ames, Iowa
2019
Copyright © Jeba Rose Jennifer Jesudoss Chelladurai, 2019. All rights reserved.
ii
TABLE OF CONTENTS
Page
LIST OF FIGURES .........................................................................................................................v
LIST OF TABLES ........................................................................................................................ vii
NOMENCLATURE .................................................................................................................... viii
ACKNOWLEDGMENTS ............................................................................................................. ix
ABSTRACT .....................................................................................................................................x
CHAPTER 1. GENERAL INTRODUCTION ................................................................................1 1. Use of macrocyclic lactones against nematodes of veterinary importance ........................... 1
2. A brief note on Ascarids, genome status and P-glycoproteins .............................................. 3 3. Thesis organization ................................................................................................................ 4 4. References ............................................................................................................................. 5
CHAPTER 2. METHODS IN THE STUDY OF P-GLYCOPROTEINS IN NEMATODE
PARASITES OF VETERINARY IMPORTANCE.........................................................................9
Abstract ...................................................................................................................................... 9 1. ATP binding cassette (ABC) superfamily ............................................................................. 9
1.1. Classification of the ABC superfamily ......................................................................... 9
1.2. Roles of subfamilies of ABC transporters ................................................................... 10
2. ABCB1 transporter family ................................................................................................... 13
2.1. P-glycoproteins ............................................................................................................ 13 2.2. Structure of P-glycoprotein ......................................................................................... 13
2.3. Mechanism of drug efflux ........................................................................................... 14 2.4. Substrate binding and prediction ................................................................................. 15 2.5. Substrates and inhibitors of P-gps ............................................................................... 15
2.6. Role of ABCB1 efflux proteins in veterinary species ................................................. 17 2.7. Role of ABCB1 efflux proteins in nematodes............................................................. 18
3. Methods used in the study of nematode P-gps .................................................................... 19
3.1. Gene identification ...................................................................................................... 19 3.2. Gene expression, polymorphism and induction studies .............................................. 20 3.3. Nematode P-gps in heterologous systems ................................................................... 22 3.4. Whole organism pharmacology................................................................................... 24
3.5. Localization studies ..................................................................................................... 26 3.6. In vivo assays ............................................................................................................... 26
4. Conclusions ......................................................................................................................... 26 5. References ........................................................................................................................... 27 Figures and tables .................................................................................................................... 43
iii
CHAPTER 3. EFFECTS OF IN VITRO AND IN VIVO EXPOSURE TO MACROCYCLIC
LACTONES ON THE EXPRESSION PATTERNS OF P-GLYCOPROTEINS IN
TOXOCARA CANIS LARVAE ......................................................................................................68 Abstract .................................................................................................................................... 68
1. Introduction ......................................................................................................................... 68 2. Methods ............................................................................................................................... 70
2.1 Ethics statement ............................................................................................................ 70 2.2 Parasites ........................................................................................................................ 71 2.3 In vitro motility assays ................................................................................................. 71
2.4 In vitro larval dye efflux assay ..................................................................................... 71 2.5 Genomic survey and Phylogenetic analysis ................................................................. 72 2.6 qPCR in adults Toxocara canis .................................................................................... 73 2.7 qPCR following in vitro drug exposure ....................................................................... 73
2.8 qPCR following in vivo drug exposure in mice ........................................................... 74 3. Results ................................................................................................................................. 75
3.1 In vitro motility assay ................................................................................................... 75 3.2 In vitro efflux of P-gp is inhibited ................................................................................ 75 3.3 Thirteen P-gp genes identified in T .canis genome ...................................................... 75
3.4 Ten P-gp genes are expressed in adults ........................................................................ 76 3.5 In vitro effects of IVM on P-gp expression in larvae ................................................... 76 3.6 In vivo effects of MLs on P-gp expression in somatic larvae ...................................... 77
4. Discussion ............................................................................................................................ 77 5. References ........................................................................................................................... 80
Figures and tables .................................................................................................................... 83 Supplementary data ................................................................................................................. 91
CHAPTER 4. IDENTIFICATION AND FUNCTIONAL CHARACTERIZATION OF
P-GLYCOPROTEIN 11.1 OF TOXOCARA CANIS ......................................................................92 Abstract .................................................................................................................................... 92
1. Introduction ......................................................................................................................... 92 2. Materials and methods ......................................................................................................... 94
2.1. Ethics statement ........................................................................................................... 94 2.2. Molecular and phylogenetic characterization .............................................................. 94 2.3. Bioinformatic analyses ................................................................................................ 95
2.4. Heterologous expression in MDCK cells .................................................................... 96 2.5. Tca-Pgp-11.1 mediated efflux assays ......................................................................... 98 2.6. Chromogenic in situ mRNA hybridization ................................................................. 99 2.7. Statistical analysis ....................................................................................................... 99
3. Results ................................................................................................................................. 99 3.1. Bioinformatic analysis of Tca-Pgp-11.1 ..................................................................... 99 3.2. Expression of Tca-Pgp-11.1 in CRISPR-edited MDCK cells ................................... 100 3.3. Functional transport activity by Tca-Pgp-11.1.......................................................... 101 3.4. Unique pharmacology of Tca-Pgp-11.1 .................................................................... 101
3.5. Tissue specific expression of Tca-Pgp-11................................................................. 102 4. Discussion .......................................................................................................................... 102 5. References ......................................................................................................................... 107
iv
Figures and tables .................................................................................................................. 111 Supplementary data ............................................................................................................... 122
CHAPTER 5. DETECTION AND QUANTIFICATION OF PARASCARIS
P-GLYCOPROTEIN DRUG TRANSPORTER EXPRESSION WITH A NOVEL MRNA
HYBRIDIZATION TECHNIQUE ..............................................................................................128 Abstract .................................................................................................................................. 128 1. Introduction ....................................................................................................................... 129 2. Materials and methods ....................................................................................................... 131
2.1. Parasites ..................................................................................................................... 131
2.2. Probe targets .............................................................................................................. 132 2.3. Analysis ..................................................................................................................... 133
3. Results ............................................................................................................................... 133
3.1. Multiple nucleic acid hybridization is sensitive and specific for Parascaris P-gp ... 133 3.2. Qualitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in
Parascaris ........................................................................................................................ 134
3.3. Quantitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in
Parascaris ........................................................................................................................ 136 4. Discussion .......................................................................................................................... 137
5. References ......................................................................................................................... 140 Figures and tables .................................................................................................................. 160 Supplementary data ............................................................................................................... 166
CHAPTER 6. GENERAL CONCLUSIONS ...............................................................................167
v
LIST OF FIGURES
Page
Figure 2-1. UPGMA phylogenetic tree of ABC superfamily proteins annotated in the
genomes of Toxocara canis and C. elegans. ............................................................ 43
Figure 2-2. Secondary structure of C. elegans Pgp-1 ................................................................... 44
Figure 2-3. Transmembrane view of the X-ray diffraction crystal structure of C. elegans
Pgp-1 ........................................................................................................................ 45
Figure 3-1. WormLab output obtained with Toxocara canis larvae ............................................. 83
Figure 3-2. Representative bright-field overlays and fluorescence images of T. canis larvae
stained with Hoechst 33342 ...................................................................................... 84
Figure 3-3. Area of H33342 staining of T. canis larvae exposed to P-gp inhibitors. ................... 85
Figure 3-4. Maximum Likelihood phylogenetic tree of conceptually translated P-gp genes. ...... 86
Figure 3-5. Mean + SE of expression levels of P-gp genes in adult T. canis worms. .................. 87
Figure 3-6. Mean + SE of induction of P-gp expression following exposure to ivermectin. ....... 88
Figure 3-7. Mean + SE of expression of P-gp genes in somatic T. canis larvae derived from
mice treated with (A) ivermectin or (B) moxidectin. ............................................... 89
Figure 4-1. Bioinformatic analysis of conceptually translated protein sequence of Tca-Pgp-
11.1. ........................................................................................................................ 111
Figure 4-2. Maximum likelihood phylogenetic tree of cloned and predicted T. canis Pgp
genes in comparison with those from other nematodes. ......................................... 113
Figure 4-3. Expression of Tca-Pgp-11.1 in transfected MDCK-ΔMDR cells............................ 114
Figure 4-4. Western blot and dot blot using anti-Tca-Pgp-11 polyclonal antibodies raised in
rabbits ..................................................................................................................... 114
Figure 4-5. Flow cytometry histograms of EffluxID dye transport activity in WT cells, Tca-
Pgp-11 transfected, and KO cells ........................................................................... 115
Figure 4-6.Flow cytometry histograms of Calcein-AM (A) and Rhodamine 123 (C) dye
transport activity in WT cells, Tca-Pgp-11 transfected, and KO cells with no
drugs. ...................................................................................................................... 116
vi
Figure 4-7. Flow cytometry histograms of Calcein-AM dye transport activity in WT cells,
Tca-Pgp-11 transfected, and KO cells. ................................................................... 117
Figure 4-8. Normalized mean fluorescence obtained with Calcein-AM .................................... 118
Figure 4-9. Mean fluorescence intensity ratios in Tca-Ppg-11 transfected cells co-incubated
with Calcein-AM and inhibitors. ............................................................................ 119
Figure 4-10. Representative images of multiple nucleic acid in situ hybridization in adult
female and male Toxocara canis. ........................................................................... 120
Figure 5-1. Representative images of adult male Parascaris. .................................................... 160
Figure 5-2. Representative images of adult female Parascaris. ................................................. 161
Figure 5-3. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult male Parascaris. ....... 162
Figure 5-4. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult female Parascaris. .... 163
Figure 5-5. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of
adult male Parascaris. ............................................................................................ 164
Figure 5-6. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of
adult female Parascaris. ......................................................................................... 165
vii
LIST OF TABLES
Page
Table 2-1. ABC transporter genes in humans and nematodes, derived from the KEGG
pathways (Kanehisa et al., 2017). ............................................................................. 46
Table 2-2. P-glycoprotein encoding genes in pathogenic nematodes of veterinary
importance ................................................................................................................ 49
Table 2-3. Summary of gene expression and polymorphism studies in parasitic nematodes
of veterinary importance. .......................................................................................... 51
Table 2-4. Drug interaction studies of nematode P-gps in heterologous systems. ....................... 58
Table 2-5. In vitro P-gp-drug interaction assays with whole organisms. ..................................... 60
Table 2-6. Localization studies in nematodes of veterinary importance. ..................................... 65
Table 2-7. In vivo studies of effect on P-gps when MLs are co-administrated with P-gp
inhibitors. .................................................................................................................. 66
Table 3-1. Nomenclature for P-gp protein sequences in Toxocara canis ..................................... 90
Table 4-1. Peptide sequences used as antigens for antibody production in rabbits. ................... 121
viii
NOMENCLATURE
P-gp P-glycoprotein
ABCB1 ATP binding cassette family B1
MDR1 Multi drug resistance gene 1
MLs Macrocyclic Lactones
TMD Transmembrane Domain
NBD Nucleotide Binding Domain
ATP Adenosine tri-phosphate
GluClR Glutamate gated chloride channel receptor
ix
ACKNOWLEDGMENTS
I would like to thank my committee chair, Dr. Matthew T. Brewer, and my committee
members, Douglas E. Jones, Jodi D. Smith, Richard J. Martin, and Tomislav Jelesijevic, for their
guidance and support throughout the course of this research. A special thanks to Dr. Brewer,
under whose tutelage as one author put it, “I have changed in taste, improved in theory, and
probably in craft” (J.R.R Tolkien, The Letters of J.R.R. Tolkien) . I would also like to thank
NCVP for funding my residency and PhD training.
I would like to thank my parents for their prayers, encouragement and patience during my
long graduate school journey in the United States. I would also like to acknowledge the
contributions of my church families and family groups, who made my stay in Ames a wonderful
experience. And to those special few who have become my closest friends, I thank my God every
time I remember you, and I hope we will be friends till we leave the shadowlands, sail past the
gray havens and meet in the glorious city!
In addition, I would also like to thank my friends, colleagues, the department faculty and
staff for making my time at Iowa State University memorable.
x
ABSTRACT
P-glycoproteins (P-gp) are ATP-binding cassette transporters capable of effluxing a wide
range of structurally unrelated compounds from cells. Parasitic nematodes express P-gps that
have the potential to contribute toward anthelmintic resistance via transport of macrocyclic
lactone drugs. This thesis characterizes the expression and function of P-gps from ascarid
nematodes. In canines, somatic larvae in bitches are the source of transplacentally transmitted T.
canis to neonates. Somatic larvae are tolerant to the macrocyclic lactone (ML) class of
anthelmintics. We hypothesized that P-gps may play a role in larval tolerance to MLs. This
dissertation sought to identify P-gp expression in T. canis stages and to characterize the unique
pharmacology and localization of Pgp-11, which has been implicated in resistance in other
nematodes.
13 P-gps were identified in the T. canis genome, of which 10 were found to be expressed
in adults and infective larvae. P-gps expression could not be induced in infective larvae treated
with MLs in vitro, but Pgp-10 was upregulated in somatic larvae treated with moxidectin in vivo.
P-gp mediated efflux in infective larvae could be mitigated by some P-gp inhibitors. T. canis
Pgp-11 was heterologously expressed in a canine cell line expressing no endogenous P-gp and
could not be inhibited by verapamil, cyclosporine A and reserpine. Pgp-11 was expressed in
adult worm intestines but was absent in reproductive tissues.
P-gps have been implicated in ML resistance in the equine nematode Parascaris spp.
Pgp-11 and Pgp-16 have been previously described from Parascaris, but the exact localization of
their expression was unknown. This dissertation sought to semi-quantitatively determine the
localization of Pgp-11 and Pgp-16 mRNA in adult worm tissues using a novel chromogenic in
situ hybridization assay.
1
CHAPTER 1. GENERAL INTRODUCTION
1. Use of macrocyclic lactones against nematodes of veterinary importance
Nematodes are common parasites of domestic animals and chemotherapeutic
interventions are the mainstay in veterinary medicine to mitigate their effects on animal health.
Resistance to anthelmintics is an emerging problem across all the drug classes licensed for
veterinary use in many domestic species (Gasbarre et al., 2009). It is difficult to quantify the loss
that is caused due to anthelmintic resistance given the variability of a number of factors, which
include (a) parasite population characteristics such as refugia, predominance of dose-limiting
species, (b) host factors such as age, nutrition, immune status, breed-dependent inherent
resistance, (c) production factors such as stocking density and degree of environmental
contamination. It has been suggested that an increase in anthelmintic resistance in nematodes is
due to the indiscriminate overuse of anthelmintics, route of administration, use of slow-release
formulations, failure to establish a refugia population of nematodes susceptible to anthelmintics
and failure to treat during the quarantine period (Sutherland and Leathwick, 2011). Resistance
often involves multigenic loci and mechanisms of resistance in nematodes to different drug
classes have been studied (Whittaker et al., 2017). Several studies use the non-parasitic nematode
Caenorhabditis elegans, which has proved to be a reasonable but not an absolute model to study
anthelmintic resistance (Geary and Thompson, 2001).
Macrocyclic lactones (MLs) constitute a class of endectocide drugs that are effective
against many nematodes and arthropods. MLs approved for veterinary use include ivermectin,
selamectin, doramectin, eprinomectin, moxidectin and milbemycin oxime. They act on glutamate
gated chloride channels (GluCl) in nematodes, insects, crustaceans, and molluscs. The
phenotypic effects of ML action in nematodes observed in vitro include worm death and
2
impaired motility in adults, motility cessation and death in microfilaria and L3s, and potentiation
of the immune system (Tompkins et al., 2010; Vatta et al., 2014). The phenotypic effects
observed in vivo include alteration of embryonic morphology, degenerative changes to nematode
enterocytes, microfilarial death in utero, abnormalities in the morphology and motility of adult
worms, and adult worm death (Bazzocchi et al., 2008; McCall, 2005; McCall et al., 2008;
Tompkins et al., 2010).
Resistance to MLs have risen in many important nematodes including Dirofilaria immitis
of dogs (Bourguinat et al., 2011a), Haemonchus contortus of sheep (Xu et al., 1998), Parascaris
spp. of equines (Boersema et al., 2002), Cooperia spp. of cattle (Fiel et al., 2001), Onchocerca
volvulus in humans (Churcher et al., 2009) among others. Two main paradigms of resistance
mechanisms have been extensively evaluated to understand the reduction of susceptibility or
increased resistance to the MLs. These are (a) changes in the receptor target of the MLs – the
glutamate gated chloride channels, and (b) efflux proteins that decrease effective drug
concentration at the receptor site of action.
Glutamate gated chloride channels of nematodes are pentameric structures made of two
or three different subunits and has been reviewed in (Lynagh and Lynch, 2012; Wolstenholme
and Rogers, 2005). Sensitivity to ivermectin in nanomolar concentrations is conferred by a
glycine residue (Gly-281, also known as M3-Gly) in the membrane bound helix M3 of the alpha
subunit of GluClR (Hibbs and Gouaux, 2011; Lynagh and Lynch, 2010, 2012). Sensitivity to
moxidectin was not due to the same interactions (Prichard et al., 2012). Changes in GluClR that
were previously thought to confer ivermectin resistance on nematodes included: (a) an amino
acid change (L256F) in the GluCl alpha3 subunit (Njue et al., 2004), (b) an amino acid change in
the M3-Gly residue in the GluClR alpha3B subunit (Lynagh and Lynch, 2010), (c) changes in
3
the frequency of alleles encoding the alpha subunits (Blackhall et al., 1998b) and (d) changes in
the expression levels of ligand gated chloride channel subunits glc-3, glc-5 (Williamson et al.,
2011). However, these changes were not able to definitively provide an explanation for
resistance in the field isolates.
The second most important mechanism of resistance to the macrocyclic lactones are the
permeability glycoproteins (P-gp), also known as ATP Binding Cassette Family B1 (ABCB1).
They belong to the large family of ATP Binding Cassette transporters and are capable of
effluxing xenobiotic compounds (Lespine et al., 2012; Prichard and Roulet, 2007). Changes in P-
glycoprotein that are thought to confer resistance to MLs include (a) SNPs in P-gp genes
(Bourguinat et al., 2011b; Sangster et al., 1999; Xu et al., 1998) and (b) increased expression of
P-gps in resistant field isolates (Dicker et al., 2011b; Janssen et al., 2013a; Tydén et al., 2014), in
vitro (Raza et al., 2016b) and in experimental in vivo studies (Lloberas et al., 2013).
2. A brief note on Ascarids, genome status and P-glycoproteins
Ascarids are a group of large parasitic nematodes that belong to the Superfamily
Ascaridoidea. Ascarids found in domestic hosts include Toxocara canis that infects canids,
Toxocara cati that infects felids, Toxascaris leonina that infects canids and felids, Toxocara
vitulorum that infects bovids, Parascaris univalens and Parascaris equorum that infect equids,
and Ascaris suum and Ascaris lumbricoides that infect pigs and humans. Adult ascarids are
generally susceptible to label doses of FDA approved macrocyclic lactones, benzimidazoles,
imidathiazoles, tetrahydropyrimidines and cyclic depsipeptides, given at the appropriate time to
the appropriate host species. Multiple reports of macrocyclic lactone resistance in adult
Parascaris spp. has been documented across the world (Boersema et al., 2002; Craig et al., 2007;
Slocombe et al., 2007). A single report of reduced susceptibility to albendazole in Ascaris spp. in
humans also exists (Krücken et al., 2017). While resistance in adult Toxocara canis has not been
4
reported, somatic larvae which causes visceral larval migrans in humans and non-human hosts
show an apparent tolerance to label doses of approved macrocyclic lactones (Fok and Kassai,
1998). Arrested somatic larvae are an important feature of the lifecycle of T. canis, T. cati and T.
vitulorum, and are a reservoir of infection to progeny by transplacental or transmammary routes
in the definitive hosts. Mechanisms of tolerance to the MLs in T. canis somatic larvae may be
similar to mechanisms of resistance in other nematodes.
The genes encoding P-glycoproteins and their function in ML efflux have been studied in
Parascaris spp. (Janssen et al., 2013a). But very little is known about P-glycoproteins in
Toxocara canis and Ascaris spp. The availability of draft genomes of these organisms will
facilitate the study of P-gp genes. One draft genome each of Ascaris lumbricoides, Parascaris
equorum and P. univalens have been assembled (Consortium, 2019; Wang et al., 2017). Two
draft genomes each of Ascaris suum and Toxocara canis have also been made available
(Consortium, 2019; Jex et al., 2011; Wang et al., 2012b; Zhu et al., 2015). While draft genomes
that are available as fragments and/or scaffolds are valuable resources for research, they do not
provide a chromosome level resolution of the genome. Additionally, since ab initio gene
prediction models are often used for gene prediction and annotation, single genes are often
fragmented and genome quality may later be improved by empirical transcription data such as
ESTs, RNA-seq and ChIP-seq (Wang et al., 2017).
3. Thesis organization
This thesis investigates P-glycoproteins in the ascarid nematodes Toxocara canis and
Parascaris spp. Chapter 2 reviews the ATP binding cassette superfamily in general followed by
a detailed summary of the methods of study of P-glycoproteins in nematodes. Chapter 3
examines the P-gp repertoire of T. canis expressed in adults and larval stages. Chapter 4
describes the unique pharmacology of T. canis Pgp-11. Chapter 5 shows the localization of two
5
P-gps in Parascaris adults. The final chapter summarizes the knowledge gap filled by this work
and identifies future work that must be pursued in this field.
4. References
Bazzocchi, C., Mortarino, M., Grandi, G., Kramer, L.H., Genchi, C., Bandi, C., Genchi, M.,
Sacchi, L., McCall, J.W., 2008. Combined ivermectin and doxycycline treatment has
microfilaricidal and adulticidal activity against Dirofilaria immitis in experimentally
infected dogs. Int J Parasitol 38, 1401-1410.
Blackhall, W.J., Pouliot, J.F., Prichard, R.K., Beech, R.N., 1998. Haemonchus contortus:
selection at a glutamate-gated chloride channel gene in ivermectin- and moxidectin-
selected strains. Exp Parasitol 90, 42-48.
Boersema, J.H., Eysker, M., Nas, J.W., 2002. Apparent resistance of Parascaris equorum to
macrocylic lactones. Vet Rec 150, 279-281.
Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011a. Macrocyclic
lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.
Bourguinat, C., Keller, K., Blagburn, B., Schenker, R., Geary, T.G., Prichard, R.K., 2011b.
Correlation between loss of efficacy of macrocyclic lactone heartworm anthelmintics and
P-glycoprotein genotype. Vet Parasitol 176, 374-381.
Churcher, T.S., Pion, S.D., Osei-Atweneboana, M.Y., Prichard, R.K., Awadzi, K., Boussinesq,
M., Collins, R.C., Whitworth, J.A., Basáñez, M.G., 2009. Identifying sub-optimal
responses to ivermectin in the treatment of River Blindness. Proc Natl Acad Sci U S A
106, 16716-16721.
Consortium, I.H.G., 2019. Comparative genomics of the major parasitic worms. Nat Genet 51,
163-174.
Craig, T.M., Diamond, P.L., Ferwerda, N.S., Thompson, J.A., 2007. Evidence of ivermectin
resistance by Parascaris equorum on a Texas horse farm. Journal of Equine Veterinary
Science 27, 67-71.
Dicker, A.J., Nisbet, A.J., Skuce, P.J., 2011. Gene expression changes in a P-glycoprotein (Tci-
pgp-9) putatively associated with ivermectin resistance in Teladorsagia circumcincta. Int
J Parasitol 41, 935-942.
Fiel, C.A., Saumell, C.A., Steffan, P.E., Rodriguez, E.M., 2001. Resistance of Cooperia to
ivermectin treatments in grazing cattle of the Humid Pampa, Argentina. Vet Parasitol 97,
211-217.
Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the
chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.
Gasbarre, L.C., Smith, L.L., Lichtenfels, J.R., Pilitt, P.A., 2009. The identification of cattle
nematode parasites resistant to multiple classes of anthelmintics in a commercial cattle
population in the US. Vet Parasitol 166, 281-285.
6
Geary, T.G., Thompson, D.P., 2001. Caenorhabditis elegans: how good a model for veterinary
parasites? Vet Parasitol 101, 371-386.
Hibbs, R.E., Gouaux, E., 2011. Principles of activation and permeation in an anion-selective
Cys-loop receptor. Nature 474, 54-60.
Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-Himmelstjerna, G.,
2013. Genetic variants and increased expression of Parascaris equorum P-glycoprotein-11
in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.
Jex, A.R., Liu, S., Li, B., Young, N.D., Hall, R.S., Li, Y., Yang, L., Zeng, N., Xu, X., Xiong, Z.,
Chen, F., Wu, X., Zhang, G., Fang, X., Kang, Y., Anderson, G.A., Harris, T.W.,
Campbell, B.E., Vlaminck, J., Wang, T., Cantacessi, C., Schwarz, E.M., Ranganathan, S.,
Geldhof, P., Nejsum, P., Sternberg, P.W., Yang, H., Wang, J., Gasser, R.B., 2011.
Ascaris suum draft genome. Nature 479, 529-533.
Krücken, J., Fraundorfer, K., Mugisha, J.C., Ramünke, S., Sifft, K.C., Geus, D., Habarugira, F.,
Ndoli, J., Sendegeya, A., Mukampunga, C., Bayingana, C., Aebischer, T., Demeler, J.,
Gahutu, J.B., Mockenhaupt, F.P., von Samson-Himmelstjerna, G., 2017. Reduced
efficacy of albendazole against Ascaris lumbricoides in Rwandan schoolchildren. Int J
Parasitol Drugs Drug Resist 7, 262-271.
Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other
multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for
reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist
2, 58-75.
Lloberas, M., Alvarez, L., Entrocasso, C., Virkel, G., Ballent, M., Mate, L., Lanusse, C.,
Lifschitz, A., 2013. Comparative tissue pharmacokinetics and efficacy of moxidectin,
abamectin and ivermectin in lambs infected with resistant nematodes: Impact of drug
treatments on parasite P-glycoprotein expression. Int J Parasitol Drugs Drug Resist 3, 20-
27.
Lynagh, T., Lynch, J.W., 2010. A glycine residue essential for high ivermectin sensitivity in
Cys-loop ion channel receptors. Int J Parasitol 40, 1477-1481.
Lynagh, T., Lynch, J.W., 2012. Ivermectin binding sites in human and invertebrate Cys-loop
receptors. Trends Pharmacol Sci 33, 432-441.
McCall, J.W., 2005. The safety-net story about macrocyclic lactone heartworm preventives: a
review, an update, and recommendations. Vet Parasitol 133, 197-206.
McCall, J.W., Genchi, C., Kramer, L., Guerrero, J., Dzimianski, M.T., Supakorndej, P.,
Mansour, A.M., McCall, S.D., Supakorndej, N., Grandi, G., Carson, B., 2008.
Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 158, 204-214.
Njue, A.I., Hayashi, J., Kinne, L., Feng, X.P., Prichard, R.K., 2004. Mutations in the
extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from
ivermectin-resistant Cooperia oncophora affect agonist sensitivity. J Neurochem 89,
1137-1147.
7
Prichard, R., Ménez, C., Lespine, A., 2012. Moxidectin and the avermectins: Consanguinity but
not identity. Int J Parasitol Drugs Drug Resist 2, 134-153.
Prichard, R.K., Roulet, A., 2007. ABC transporters and beta-tubulin in macrocyclic lactone
resistance: prospects for marker development. Parasitology 134, 1123-1132.
Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016. Effects of in vitro exposure
to ivermectin and levamisole on the expression patterns of ABC transporters in
Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.
Sangster, N.C., Bannan, S.C., Weiss, A.S., Nulf, S.C., Klein, R.D., Geary, T.G., 1999.
Haemonchus contortus: sequence heterogeneity of internucleotide binding domains from
P-glycoproteins. Exp Parasitol 91, 250-257.
Slocombe, J.O., de Gannes, R.V., Lake, M.C., 2007. Macrocyclic lactone-resistant Parascaris
equorum on stud farms in Canada and effectiveness of fenbendazole and pyrantel
pamoate. Vet Parasitol 145, 371-376.
Sutherland, I.A., Leathwick, D.M., 2011. Anthelmintic resistance in nematode parasites of cattle:
a global issue? Trends Parasitol 27, 176-181.
Tompkins, J.B., Stitt, L.E., Ardelli, B.F., 2010. Brugia malayi: in vitro effects of ivermectin and
moxidectin on adults and microfilariae. Exp Parasitol 124, 394-402.
Tydén, E., Skarin, M., Höglund, J., 2014. Gene expression of ABC transporters in Cooperia
oncophora after field and laboratory selection with macrocyclic lactones. Mol Biochem
Parasitol 198, 66-70.
Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,
Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and
peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet
Parasitol 206, 38-42.
Wang, J., Gao, S., Mostovoy, Y., Kang, Y., Zagoskin, M., Sun, Y., Zhang, B., White, L.K.,
Easton, A., Nutman, T.B., Kwok, P.Y., Hu, S., Nielsen, M.K., Davis, R.E., 2017.
Comparative genome analysis of programmed DNA elimination in nematodes. Genome
Res 27, 2001-2014.
Wang, J., Mitreva, M., Berriman, M., Thorne, A., Magrini, V., Koutsovoulos, G., Kumar, S.,
Blaxter, M.L., Davis, R.E., 2012. Silencing of germline-expressed genes by DNA
elimination in somatic cells. Dev Cell 23, 1072-1080.
Whittaker, J.H., Carlson, S.A., Jones, D.E., Brewer, M.T., 2017. Molecular mechanisms for
anthelmintic resistance in strongyle nematode parasites of veterinary importance. J Vet
Pharmacol Ther 40, 105-115.
Williamson, S.M., Storey, B., Howell, S., Harper, K.M., Kaplan, R.M., Wolstenholme, A.J.,
2011. Candidate anthelmintic resistance-associated gene expression and sequence
polymorphisms in a triple-resistant field isolate of Haemonchus contortus. Mol Biochem
Parasitol 180, 99-105.
8
Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of
action of the avermectin/milbemycin anthelmintics. Parasitology 131 Suppl, S85-95.
Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998. Ivermectin
resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol
Biochem Parasitol 91, 327-335.
Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,
Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,
A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic
pathogen Toxocara canis. Nat Commun 6, 6145.
9
CHAPTER 2. METHODS IN THE STUDY OF P-GLYCOPROTEINS IN NEMATODE
PARASITES OF VETERINARY IMPORTANCE
Jeba R. J. Jesudoss Chelladurai, Matthew T. Brewer
A review paper to be submitted
Abstract
Macrocyclic lactones (ML) are commonly used endectocides in veterinary medicine. But,
resistance to the MLs is an emerging threat to their use. P-glycoproteins and other multidrug
resistance transporters belonging to the ATP binding cassette (ABC) superfamily have been
associated with ML resistance in many nematodes. Little is known about the repertoire and
function of ABC superfamily members in nematodes. This review summarizes the available
knowledge of ABC subfamilies studied in nematodes, followed by an overview of the methods
used in the study and pharmacological characterization of the efflux proteins of the ABCB1
family in nematodes. The review also discusses the role of P-glycoproteins in nematodes and
animals of veterinary importance.
1. ATP binding cassette (ABC) superfamily
Members of the ATP binding cassette superfamily are membrane proteins, characterized
by an ATPase domain that hydrolyses ATP and an integral membrane domain that lies in the
membrane. They are involved in multiple cellular functions such as the import of nutrients in
prokaryotes, export of molecules in both eukaryotes and prokaryotes, in DNA repair, in
translation and gene regulation processes (Dassa and Bouige, 2001).
1.1. Classification of the ABC superfamily
Proteins in the ABC superfamily can be broadly classified into 3 classes based on
molecular structure: (a) Class 1 in which ATPase and membrane domains are fused and present
as one long polypeptide, (b) Class 2 in which there are no membrane domains but the ATPase
10
domain is tandemly repeated and (c) Class 3 in which the ATPase and membrane domains may
or may not be on different polypeptides (Davidson et al., 2008). Eukaryotes including mammals
and nematode parasites possess several ABC proteins listed in Table 2-1. The functions of these
proteins have been studied in humans but are incompletely understood in nematodes. Their
presence in model non-pathogenic nematodes and a few pathogenic zoonotic nematodes have
been predicted by orthology of genes annotated with KEGG Orthology (KO) identifiers.
1.2. Roles of subfamilies of ABC transporters
Relatively little is known about ABC proteins other than ABCB1 transporters in parasitic
nematodes. But they have been reasonably researched in humans and C. elegans allowing for
broad inferences of putative functional roles of gene orthologues in parasitic nematodes. In the
following descriptions, a special emphasis has been laid on the ascarid nematode of dogs,
Toxocara canis, in order to provide context for the study of ABCB1 genes of the nematode
discussed in Chapters 3 and 4. A phylogenetic tree has been constructed to illustrate relationships
of ABC proteins of Toxocara canis and C. elegans (Figure 2-1).
ABCA proteins are large proteins generally involved in lipid transport and theorized to be
involved in drug sequestration in human carcinomas (Albrecht and Viturro, 2007). ABCA
orthologues exist in the model nematode Caenorhabditis elegans, C. briggsae and C. remanei
(Sheps et al., 2004). These include the genes Abt-1, Abt-2, , Abt-3, Abt-4, Abt-5 and Ced-7 (Zhao
et al., 2007). Ced-7 is known to engulf cell corpses during programmed cell death in
embryogenesis in C. elegans (Wu and Horvitz, 1998). Among pathogenic nematodes, Toxocara
canis encodes a ced-7, whose function has not been experimentally studied.
ABCB proteins in nematodes and animals have been extensively studied in the context of
anthelmintic resistance and drug detoxification. These include the full transporter genes known
as pgp or mdr and half transporter genes known as hafs (Zhao et al., 2007). Cel-Pgp-3 has been
11
shown to protect C. elegans against naturally produced toxins such as colchicine and chloroquine
(Broeks et al., 1995). Phylogenetic analysis of vertebrate and nematode P-gp orthologues reveal
a significant divergence of nematode P-gps from mammalian and avian P-gps. In parasitic
nematodes, several homologs of C. elegans P-gps exist. However, a few novel P-gps with no
known C. elegans homologs have also been described. Nematode P-gps sequences share 35 –
64% identity with mammalian P-gps (Kerboeuf and Guégnard, 2011; Sangster et al., 1999).
Other ABCB genes in nematodes include ABCB6/hmt-1 which is involved in cadmium and
copper detoxification in C. elegans (Schwartz et al., 2010). There is a knowledge gap in the
identification and characterization of ABCB transporters in T. canis.
ABCC protein encoding genes in Caenorhabditis spp. includes at least 8 “MDR-related
protein” genes that are known as Mrp1 to Mrp8 (Zhao et al., 2007). Mrp-1 in C. elegans
regulates the diapause state known as dauer (Yabe et al., 2005) and may be involved in resistance
to heavy metals (Broeks et al., 1996). Cel-mrp-5 is involved in heme and vitamin B12 transport
during embryogenesis (Korolnek et al., 2014; Na et al., 2018). Cel-Mrp-7 inhibits toxicity
associated with methyl mercury (VanDuyn and Nass, 2014). The function of mrp genes in other
nematodes is yet unknown.
ABCD protein encoding genes in C. elegans include several “Peroxisomal Membrane
Protein” genes that are known as pmp-1 to pmp-5 (Zhao et al., 2007). Cel-pmp-1, Cel-pmp-2 and
Cel-pmp-4 are involved in transport of very long chain fatty acids to peroxisomes, and are
implicated in nematode development (Morita and Imanaka, 2012). Orthologs of pmp genes are
encoded in the pathogenic nematode, T. canis, but their functions have not been experimentally
studied.
12
The single ABCE protein encoding gene in C. elegans is known as abce-1 (Yan et al.,
2012a; Zhao et al., 2007). Cel-abce-1 is involved in transcriptional and translational control, in
protein transport between the nucleus and cytoplasm, and appears to be involved in molting
(Zhao et al., 2004). SNPs in a ABCE1 gene were found to be IVM resistance associated (Luo et
al., 2017). In the pathogenic nematode T. canis, an ortholog of abce-1 is encoded in the genome,
but its function is unknown.
ABCF protein encoding genes in C. elegans include at least 4 members named abcf-1 to
abcf-4 (Zhao et al., 2007). Abcf-3 in C. elegans appears to be involved in apoptosis regulation
(Hirose and Horvitz, 2014). In the pathogenic nematode T. canis, orthologs of ABCF genes are
encoded in the genome, but their functions have not been empirically tested.
ABCG/BCRP protein is represented by the wht-6 gene in C. elegans, which is involved in
the mitochondrial uptake of the Vitamin B12 (cobalamin) (McDonald et al., 2017). Orthologs of
ABCG are encoded in the genome of T. canis but their functions have not been identified.
ABCH protein is encoded by a single gene in the C. elegans genome. There is no
ortholog in the T. canis genome.
A number of other ATP binding cassette domain containing proteins have been assigned
to the ABC superfamily that do not have significant similarity or identity with the classical ABC
transporters described above. These include the structural maintenance of chromosomes (SMC)
proteins that are involved in chromatin organization, DNA damage sensor proteins such as rfc-2,
double stranded break (DSB) repair proteins and DNA mismatch repair protein (MutS) involved
in mismatch repair (Dassa, 2011; Stergiou and Hengartner, 2004). These also include proteins
involved in (a) cytokinesis such as kinesin-like protein, spindle apparatus protein lin-5, (b)
molting such as mlt-10 related, (c) developmental cellular migration, (d) neurotransmitter release
13
such as nsf-1 etc. (Ali and Siddiqui, 2000; Barclay et al., 2012; Meli et al., 2010; Srinivasan et
al., 2003; Stringham et al., 2002). There are orthologs of ABC ATPase genes in the Toxocara
canis genome.
2. ABCB1 transporter family
2.1. P-glycoproteins
Members of the ABCB1 family are also known as permeability glycoprotein (P-gp) and
multiple drug resistance 1 (mdr1) protein, and the terms are used interchangeably. Orthologous
genes are named mdr1 in humans and mice, and pgp with a number designation in nematodes.
Rarely, abcb1 is also used to refer to the protein. The first known member of this family was
described as a 170kDa cell surface glycoprotein in Chinese hamster ovary cell line that was
resistant to colchicine (Juliano and Ling, 1976). Since then, multiple studies have shown that P-
glycoproteins have detoxification roles in mammals and are involved in multiple drug resistance
in several neoplasia.
2.2. Structure of P-glycoprotein
P-glycoproteins are translated into a single polypeptide from mRNA transcripts. The
crystal structure of P-glycoprotein has been elucidated for human mdr1 (Kim and Chen, 2018),
mouse mdr1a (Aller et al., 2009), and C. elegans pgp-1 (Jin et al., 2012) using crystallography
techniques, and were found to be structurally similar. P-gps have a pseudo two-fold symmetry
with two transmembrane (TM) domains and two nucleotide binding domains (NBD), made of
helices, bridges and beta strands. The two halves of the protein are connected by a flexible linker
allowing flexibility in the conformation of the protein during the transport cycle (Ward et al.,
2013). Each NBD is composed of Walker A, Walker B and C motifs, with the latter being the
distinguishing feature that differentiates ABCB1 transporters from other proteins that bind ATP
(Silva et al., 2015). The secondary structure of C. elegans Pgp-1 is illustrated in Figure 2-2 and
14
the transmembrane view of the ribbon model of the crystal structure in the inward facing
conformation obtained by X ray diffraction at 3.4Å in Figure 2-3. Crystal structures of P-gps
from pathogenic nematodes of veterinary or human importance are not available yet.
2.3. Mechanism of drug efflux
P-gp molecules have a substrate binding pocket that involves most of the transmembrane
helices (Ward et al., 2013). In the inward facing conformation, the most likely active state, two
portals allow molecules access to the substrate binding pocket. These allow access from the
cytoplasm and inner leaflet of the cell membrane but preclude access from the extracellular space
or the outer leaflet. There are two leading models to explain efflux action – the pump or vacuum
cleaner model and the flippase model.
In the vacuum cleaner model, P-gp substrate molecules partition and aggregate near the
lipid headgroups of the inner layer of the cell membrane bilayer where they enter the substrate
binding pocket of P-gp and are effluxed into the extracellular space. In this model, some drugs
that enter the bilipid membrane may be effluxed out before gaining entry into the cytosol.
Evidence for this model is provided by transport studies with fluorescent molecules such as
Hoechst 33342 (Shapiro and Ling, 1997; Sharom, 2014).
In the flippase model, P-gp substrate molecules aggregate near phospholipid acyl cores of
the inner leaflet and by interaction with the drug binding pocket are translocated to the outer
leaflet of the membrane from where they passively diffuse into extracellular space. Evidence for
this model is provided by the efflux of phospholipid and glycosphingolipids (Eckford and
Sharom, 2005; Romsicki and Sharom, 2001; Sharom, 2014).
The two models are not mutually exclusive and experimental studies to accurately
ascertain the mechanism is constrained by available technologies (Sharom, 2014).
Conformational change from the inward facing confirmation to the outward facing conformation
15
occurs when a substrate is bound to the substrate binding pocket. ATP binding causes
dimerization of the NBD. ATP hydrolysis causes disruption of the NBD dimers, causing a
reversal back to the inward facing conformation. ATP binding is seen only in the inward binding
state, but not in the outward state (Aller et al., 2009).
2.4. Substrate binding and prediction
There is a marked “substrate promiscuity” by which structurally diverse compounds can
be effluxed by P-gps. There is a large amount of flexibility in the transmembrane domains
manifested by helical kinking and/or unwinding of the helices allowing for the binding of diverse
substrates (Wen et al., 2013). Many of the compounds effluxed are hydrophobic and amphipathic
with variable molecular weights, chemical sidechains, linkages and topologies. In computer-
based molecular dynamics studies, distinct binding sites are not observed but rather a “binding
belt” of amino acids that interact with drugs (Jagodinsky and Akgun, 2015). Thus, the versatility
displayed by the amino acid residues in the drug binding pocket of the protein in addition to
diversity in the substrates are the biggest challenge to substrate binding prediction by in silico
methods. Despite the challenges, docking studies have shown the P-gps from pathogenic
nematodes such as Haemonchus contortus can be modelled using in silico algorithms on the
experimentally obtained crystal structure of C. elegans Pgp-1 (David et al., 2018). These can be
improved as higher resolution crystal structures of nematode P-gps are made available in the
future.
2.5. Substrates and inhibitors of P-gps
P-gps efflux a range of chemically diverse compounds, that may be hydrophobic or
amphipathic. Several fluorescent substrates of P-gps such as Rhodamine 123, Hoechst 33342,
Calcein-AM are known (Lebedeva et al., 2011) and are frequently used in research studies. P-gp
substrates approved as drugs for human and animal use have been reviewed and include
16
antibacterials like erythromycin, antifungals like ketaconazole, cardiac drugs such as diltiazem,
opioids such as loperamide among others (Mealey and Fidel, 2015). Anthelmintics such as
macrocyclic lactones and monepantel are effluxed by P-gps and compete with rhodamine 123 for
efflux (Raza et al., 2016a). Eprinomectin, abamectin, doramectin, selamectin were capable of
causing an accumulation of Rhodamine 123 by competing for P-gp binding. Moxidectin, a
milbemycin, showed lower potency than the others (Lespine et al., 2007).
P-gp inhibitors are used frequently used to cause a reversal of resistant to susceptible
phenotype in human neoplasia (Nanayakkara et al., 2018). These act on the protein in one of
three different ways, viz. (a) blocking transport of another compound by direct interaction and
competitive or non-competetive antagonism at the active site; (b) inhibiting ATP hydrolysis, or
(c) altering drug interactions with the cellular membrane (Stouch and Gudmundsson, 2002).
There are three generations of P-gp inhibitors: (a) first generation inhibitors had low P-gp
specificity and were agonists of other receptors. These include verapamil, cyclosporine A,
caffeine, (b) second generation inhibitors had higher specificity and fewer side effects. These
include valspodar, dexverapamil and dexniguldipine, (c) third generation inhibitors have high
specificity and efficacy. These include zosuquidar, elacridar, tariquidar, and (d) fourth generation
inhibitors having the highest efficacy. These include peptidomimetics and dual activity ligands
like flavonoids, quercetin (Palmeira et al., 2012).
ATPase activity is also altered by the P-gp modulators, with the drugs being classified
into three classes: (a) Class I drugs like verapamil inhibit ATPase activity at high concentrations,
but enhance activity at low concentrations, (b) Class II drugs like valinomycin have no inhibitory
action but act in a dose dependent manner to enhance ATPase function, (c) Class III drugs like
Cyclosporine A inhibit basal and stimulated ATPase activity (Ambudkar et al., 1999).
17
Several of these inhibitors have been used to inhibit P-glycoproteins in nematodes in
vitro and in vivo. However, nematode specific P-gp inhibitors have not been discovered and are
the holy grail of nematode research in order to overcome anthelmintic resistance.
2.6. Role of ABCB1 efflux proteins in veterinary species
In clinical veterinary medicine, there is evidence that P-gps in host animals interact with
multiple classes of drugs and alter pharmacokinetics and bioavailability in different tissues
(Virkel et al., 2019). They are briefly reviewed here.
In dogs, basal levels of tissue expression of the sole P-gp protein - mdr1 and MDR-
related proteins (mrp-1 and -2) have been studied (Conrad et al., 2001). P-gp in dogs is expressed
in enterocytes, endothelia of brain capillaries, canalicular cells of the liver, proximal tubular cells
of the kidneys, testes and placenta (Dowling, 2006). The most important clinical application of
studying the canine MDR1 gene has been the identification of breed related distribution and
elimination of oncotherapeutic drugs, macrocyclic lactones and several other drugs (Mealey,
2013). A 4-basepair deletion resulting in a mutated Can-mdr-1 gene conferring increased
ivermectin sensitivity in collies and herding breeds has been well characterized (Mealey et al.,
2001).
In adult cats, tissue distribution of P-gps at basal levels have been studied by
immunohistochemistry and found to similar to dogs (Van Der Heyden et al., 2009). Distribution
and function in neonatal or geriatric cats is unknown (Merola and Eubig, 2012). A premature
stop codon in the feline mdr-1 gene conferring a phenotype similar to the collie when exposed to
P-gp substrates has also been identified (Mealey and Burke, 2015).
In bovines, MDR1 is expressed in the rumen wall (Haslam and Simmons, 2014). It is also
expressed in mammary epithelial cells, and may be upregulated by mdr1 substrates (Yagdiran et
al., 2016).
18
In swine, abcb1 gene function and pharmacology have been recently studied. Co-
administration of verapamil was found to increase the intestinal absorption of enrofloxacin (Guo
et al., 2016). There was also a decrease in abcb1 gene expression when fenbendazole or flunixin
meglumine were administered to certain breeds of commercial swine (Howard et al., 2015).
In horses, the P-gp gene is expressed in the intestines, liver and kidney. It is about 100
amino acids longer than P-gps of dogs, humans, rhesus macaques, sheep, mice and rats (Tydén
et al., 2009).
2.7. Role of ABCB1 efflux proteins in nematodes
P-glycoproteins in the nematodes C. elegans and Haemonchus contortus were first
discovered by Sangster et al. (Sangster, 1994). The role of nematode P-glycoproteins in (a) the
physiological maintenance of homeostasis and (b) their role in anthelmintic resistance have long
been debated (Sangster, 1994).
C. elegans has been used as a model to study P-gp pharmacology. C. elegans is a
rhabditid non-parasitic nematode and phylogenetically is a Clade IV nematode (Blaxter et al.,
1998). The suitability of C. elegans as a model for parasitic nematodes of distant clades such as
the Clade III ascarids (Ascaris, Parascaris, Toxocara) and spirurids (Dirofilaria, Brugia,
Onchocerca) and Clade I (Trichuris) has been questioned (Beech et al., 2011). However, this
might not be true for P-gps as an in silico analysis revealed a close relationship between various
P-gps genes from C. elegans, C. brenneri, C. briggsae, C. remanei and the parasitic nematodes
Ascaris spp., Brugia spp., Cooperia spp., Haemonchus spp., Loa spp., Onchocerca spp.,
Parascaris spp., Strongyloides spp., Trichuris spp. and Wuchereria sp.(Figueiredo et al., 2018).
A physiological role for P-gps in nematodes can be argued for, on the evidence of basal
levels of P-gp mRNA expression even in the absence of drugs (Figueiredo et al., 2018; Raza et
al., 2016a). Additionally, there is evidence that p-glycoproteins significantly contribute to
19
molecular defenses against natural toxins in C. elegans (Lindblom and Dodd, 2006). However,
physiological roles of p-gps in parasitic nematodes have not been empirically demonstrated yet.
P-glycoproteins have been strongly associated with macrocyclic lactone resistance in
several parasitic nematodes (Janssen et al., 2015; Xu et al., 1998). In C. elegans, there are 14
functional P-gps and 1 pseudogene. Deletion/loss of function strains in which any one of the 14
functional P-gps had been altered showed a greater susceptibility to ivermectin, with pgp-11 and
pgp-14 being particularly important (Janssen et al., 2013b).
In the past, P-gps were also associated with benzimidazole resistance (Beugnet et al.,
1997; Lespine et al., 2012) but subsequent research has shown that benzimidazoles do not
significantly modulate P-gp activity (Kerboeuf and Guégnard, 2011; Kwa et al., 1998).
Several molecular techniques and model systems have been used to study nematode P-
glycoproteins. These are reviewed in detail below. These can be broadly classified into (a)
nematode P-gp gene identification studies by in silico mining of genomes, (b) gene expression,
polymorphism and induction studies (c) pharmacological studies in heterologous systems (d)
pharmacological studies in whole organisms (e) localization studies and (f) studies to alter
parasite p-gp pharmacology in vivo.
3. Methods used in the study of nematode P-gps
3.1. Gene identification
In general, nematodes possess more than one ABCB1/P-glycoprotein gene when
compared to mammals of veterinary interest which typically possess one gene with one or more
isoforms. The model nematode C. elegans has 14 functional genes and 1 pseudogene (Janssen et
al., 2013b). Isoforms are known to exist in some nematode P-gp genes, such as pgp-9 of
Haemonchus contortus which has three isoforms - Hco-pgp-9.1, Hco-pgp-9.2 and Hco-pgp-9.3
20
(Issouf et al., 2014). P-gp genes that have been described in nematodes of veterinary and human
importance are listed in Table 2-2.
Several of these genes were described in the context of known clinical anthelmintic
resistance while others were identified by genomic analysis. Table 2-2 is not comprehensive list
as more genes are expected to be described as genome qualities of whole genomes improve and
as annotations are validated by cloning approaches, RNA-seq, gene silencing studies and
proteomics for each nematode genome separately (Palevich et al., 2018). Alternatively, accurate
chromosomal mapping and annotation of genes may result in a reduction in the number of total
genes. In a recent study, transcripts analyzed in the past as Hco-pgp-1 and Hco-pgp-11 were
revealed to be products of a single gene, as were the transcript of Hco-pgp-12 and Hco-pgp-14,
which matched Hco-pgp-13 (Maté et al., 2018).
Accurate gene naming is important for systematic comparison as inventories of genes that
do not follow gene naming conventions leads to confusion (Ardelli et al., 2010). However,
accurate identification of nematode genes are compounded by the fact that (a) only draft
genomes exist for several parasitic nematodes (Consortium, 2019) and (b) P-gp mRNAs have
multiple transcription start sites (Ince and Scotto, 1995) and different transcripts may map
differently to genomic sequences leading to inaccuracies in the annotation of draft genomes.
3.2. Gene expression, polymorphism and induction studies
P-glycoprotein genes have become increasingly associated with clinical resistance of
nematodes to macrocyclic lactones in companion and food animals. The extremely complex
nature of the transcriptional regulation mechanisms that govern P-gp mRNA expression have
been studied in eukaryotes (Ince and Scotto, 1995; Scotto and Egan, 1998; Shtil and Azare,
2005) but not in nematodes. P-gps are constitutively expressed in all life stages of Cooperia
oncophora (De Graef et al., 2013). It is not known if this is true of all parasitic nematodes.
21
In the model nematode C. elegans, exposure to ever increasing doses of ivermectin
(IVM) was demonstrated to increase P-gp mRNA expression and induce resistance (James and
Davey, 2009). Selection for tolerance by exposure to non-toxic doses of MLs in C. elegans
caused an induced upregulation of certain P-gp mRNA (Pgp-1, Pgp-6, Pgp-10 and Pgp-14 in
IVM selected strains and Pgp-1, Pgp-6, Pgp-8 and Pgp-14 in MOX selected strains) (Ménez et
al., 2016). Similar research had previously led to the conclusion that certain individual P-gp
genes may not play a critical role in conferring IVM resistance (Yan et al., 2012b). P-gp
upregulation appears to occur in short time scales without sustained changes even over 2.5 hours
in individual genes in C. elegans in MOX-selected and IVM-resistant strains (Bygarski et al.,
2014). P-gp upregulation in parasitic nematodes may not necessarily be accurately reflected by
studies in C. elegans, since P-gp homologs of certain genes such as pgp-6 and pgp-8 have not
been found in parasitic nematodes so far (Table 2-2).
Several methods have been used to quantify expression changes and understand allelic
variations in different stages of the nematodes. These are summarized in Table 2-3. The most
frequently used assay is quantitative PCR (qPCR) to estimate mRNA transcription levels of
specific P-gps. Basal levels of P-gp transcription, upregulation or downregulation of
transcription when clinically susceptible or resistant nematode stages are exposed to drugs in
vivo or in vitro can be quickly and conveniently calculated using qPCR. Since substrate
specificity changes can occur even in the presence of silent mutations in mdr1 genes, SNP
analysis after sanger sequencing has also been used as a method to correlate genetic mutations
with clinical anthelmintic resistance (Kimchi-Sarfaty et al., 2007). RNA-seq analysis is a
promising new -omics platform tool that has been used to quantify transcription levels of P-gp
genes (Kenealy, 2019; Maté et al., 2018). The drawbacks that would have to be addressed in its
22
use are: a possible transcript length bias in detecting differentially expressed genes (Oshlack and
Wakefield, 2009), over-detection of highly expressed transcripts (Young et al., 2010), and
biochemical selection bias in cDNA library preparation (Roberts et al., 2011). The emergence of
these assays in the 2000s based on improved molecular technologies have largely supplanted
older radioactive isotope-based assays used in the 1990s such as southern blotting (hybridization
of DNA with DNA probes) to detect restriction fragment length polymorphism and northern
blotting (hybridization of RNA with DNA or RNA probes) to detect RNA transcription.
There is considerable variation in the conclusions reached in these studies that can be
attributed to (a) differences in genetic make-up of isolates studied, (b) differences in mechanisms
of resistance and (c) differences in assay sensitivity. As assay technologies improve, future
studies are needed to understand how changes in gene expression correlate with clinically
detectable resistance/tolerance.
3.3. Nematode P-gps in heterologous systems
Heterologous expression systems are useful for expression of intact and mutant variants
of a protein in isolation. Mammalian P-gps have not been successfully expressed in prokaryotic
systems but have been expressed in yeast, baculovirus/insect cell systems and eukaryotic cell
lines (Bartley et al., 2009; Evans et al., 1995; Mealey et al., 2017; Tang et al., 2002). Nematode
P-gp genes have been expressed in cell lines, yeast or C. elegans to study efflux activity and
pharmacological interactions, with the most frequently used being the epithelial pig kidney cell
line LLC-PK1. An ideal cell line must allow protein translation from mRNA transcribed from a
transfected plasmid, followed by post-translational modifications and trafficking to the correct
protein compartment. In the study of P-gps, endogenous P-gp levels in the native cell lines must
be accounted for on a cell line to cell line basis. LLC-PK1 is a good model because it has very
low endogenous P-gp expression (Goh et al., 2002). This allows true estimation of transfected
23
Pgp, when compared to other cell lines like Madin-Darby canine kidney (MDCK) in which the
higher endogenous activity leads to underestimation of activity of the transfected P-gp
(Kuteykin-Teplyakov et al., 2010).
Protein expression in heterologous models is often confirmed using Western blotting
using the anti-mammalian-Pgp antibody UIC2. However, the relevance of this is questionable as
(a) UIC2 binds to a conformational epitope in human P-gp (but not mouse Pgp) (Vahedi et al.,
2018), and (b) the absence of the same conformational epitope in nematode P-gps. Some
researchers have used antibodies raised against the specific nematode P-gp under study (Godoy
et al., 2015b). In these studies, glycosylation differences must be accounted for, as inter-species
glycosylation differences exist. Rat P-gp has an apparent molecular weight of 140 kDa due to
lower levels of glycosylation than human P-gp which has a higher apparent molecular weight of
170kDa due to higher glycosylation (Dong et al., 1998). The effect of these glycosylation
differences may result in differences in pharmacological responses in the heterologous system.
Pharmacology of transporters are determined by biochemical assays after heterologous
expression of the protein. Given the increasing association between anthelmintic resistance and
P-gp expression, there has been a growing interest in the pharmacological interaction of
anthelmintic molecules with nematode P-glycoproteins. The most frequently used assays in
nematode P-gp study are competitive efflux of a fluorescent substrate such as Rhodamine 123,
Hoechst 33342, Calcein-AM in the presence of a drug such as a macrocyclic lactone. Ivermectin,
eprinomectin, abamectin, doramectin, selamectin and moxidectin, interact with mammalian P-
gps by competitively inhibiting efflux of a fluorescent P-gp substrate (Lespine et al., 2007).
Other anthelmintics such as closantel, triclabendazole and rafoxanide also competitively inhibit
Rhodamine 123 efflux by mammalian P-gp (Dupuy et al., 2010). However, since nematode P-
24
gps share only 35 - 64% identity with mammalian P-gps, efflux capabilities of the former cannot
be directly extrapolated from data of the latter. Additionally, different nematode P-gps may have
different affinities and responses to drugs, which can only be determined by empirical testing.
Other assays including measurements of ATPase activity have also occasionally been used. Drug
interaction studies in heterologous systems are summarized in Table 2-4.
3.4. Whole organism pharmacology
One or more free-living stages of nematodes are often used to assess the pharmacological
response of P-gps with the assumption that free-living stages are a surrogate for parasitic stages.
These assays involve the incubation of eggs or larvae with different drugs followed by flow
cytometry, development or motility assay (Demeler et al., 2012; Demeler et al., 2010; Kerboeuf
et al., 1996). In vitro tests possess the advantage that receptors and proteins are expressed in their
homologous state, and specific or class-wide ML resistance can be detected (Kotze et al., 2014).
They suffer from the disadvantage that free living stages are not generally accessible to drugs
and tissue specific responses may not be the same in different life stages unless empirically
proven. In some groups of nematodes such as the ascarids, no free-living larval stages exist.
Therefore, assays have to be optimized with biological relevance in mind. Relevant whole
organism studies of P-gps have been summarized in Table 2-5.
Larval development assay (LDA) is based on the inhibition of the biological development
and hatching of larvae from a single cell/morula that is present in a freshly laid egg in the
presence of drugs. Some drugs such as the benzimidazoles have known ovicidal properties while
the ovicidal effects of others such as the ivermectin depends on the route of administration in in
vivo studies (Tyrrell et al., 2002). Several lines of evidence led to the conclusion that LDA
suffers from having poor correlation between clinical phenotype and in vitro assay output, being
the best for benzimidazoles such as thiabendazole, which has known ovicidal property, and the
25
worst for levamisole and ivermectin (Tandon and Kaplan, 2004). This was further demonstrated
in a comparison of two variants of the LDA in which the assays were able to detect
benzimidazole and levamisole resistance but not ivermectin resistance (Várady et al., 2009). But,
a more recent study has demonstrated its use in distinguishing susceptible and resistant isolates
of nematodes (Dolinská et al., 2013). Some researchers have used the LDA with known P-gp
inhibitors and MLs to test if P-gp inhibition leads to developmental arrest/death. The LDA has
only been used to study strongyle nematodes.
The Larval motility inhibition assay/test (LMIA/LMIT) is based on the behavioral
propensity of third larval stages of strongyles to actively migrate up grass blades to await
ingestion by a host. The in vitro assay setup involves a filter mesh through which larvae are
allowed to migrate in the presence or absence of drugs (Rothwell and Sangster, 1993). The assay
can be modified to detect paralysis after hatching in the presence of avermectins (Gill et al.,
1995).
The larval feeding inhibition assay is based on the inhibition of bacterivoral behavior of
first stage strongyle larvae in the presence of drugs (Alvarez-Sánchez et al., 2005). This assay
cannot be used in nematode groups such as ascarids, oxyurids and spirurids which do not have
free-living L1s.
Motility as measured by number of movements of the posterior end of the adult worm per
unit time, as measured by an operator has been used in studies of filarid nematodes (Tompkins et
al., 2010). Given the great variation in sizes of nematode life stages, motility measurements
cannot be easily compared between groups of nematodes. Further research is needed to optimize
motility measures for each drug class and each parasitic nematode.
26
Phenotypic assays such as pharyngeal pumping and velocity have been used as outputs in
the model organism C. elegans to demonstrate the role of P-gps in cross resistance of IVM and
MOX (Bygarski et al., 2014). These have not been used in parasitic nematodes so far.
3.5. Localization studies
Tissue specific transporter activity is important for understanding
pharmacokinetic disposition of drugs. In nematodes, P-gp expression in different tissues is
relevant in understanding compartmentalization of anthelmintics. Antibodies raised against
mammalian P-gps are frequently used as reagents to understand nematode P-gp localization.
Nucleic acid-based assays including chromogenic in situ hybridization RNAscope have been
recently used. These are summarized in Table 2-6.
3.6. In vivo assays
ML resistance in parasitic nematodes is due to adult populations that survive
anthelmintic treatments. P-gp activity in these parasites can be inhibited by administering P-gp
inhibitors to host animals. Pharmacokinetic studies have shown that plasma concentrations of the
ivermectin and moxidectin increase when P-gp inhibitors such as loperamide, quercetine,
verapamil, closantel, ketaconazole, itraconazole, albendazole and triclabendazole are co-
administered (Alvarez et al., 2008; Alvinerie et al., 2008; Ballent et al., 2007; Cromie et al.,
2006; Dupuy et al., 2003; Lifschitz et al., 2009; Lifschitz et al., 2002; Molento et al., 2004).
Several in vivo studies that have examined the effect of co-administration of drugs on parasites
are summarized in Table 2-7.
4. Conclusions
Macrocyclic lactone resistance in nematodes of veterinary importance is an
emerging issue which has morphed into a massive economic burden on producers in recent
years. In companion animals, emerging loss of efficacy of MLs in controlling Dirofilaria immitis
27
has resulted in poor life quality. Research efforts have identified a role for P-glycoproteins in ML
resistance and tolerance. However, several questions remain about the mechanism by which P-
gps confer resistance.
Given the variation in expression levels obtained by different research groups in different
nematodes, empirical studies are essential in parasites in which P-gps have not been studied so
far. Methods used in the study of nematode P-gps have to be developed and optimized for each
nematode with biologically relevant life stages prioritized over easily obtainable free-living
stages. Regulatory mechanisms that govern P-gp expression such as transcription factors (Ménez
et al., 2019) must be identified, along with interactions between glutamate-gated chloride
channels, other ion channels and P-gps. Candidate gene based approaches in the study of
macrocyclic lactone resistance are being slowly supplanted by whole genome scale approaches
when chromosomal scale genome assemblies are available (Doyle and Cotton, 2019), but these
have yet to be used in P-gp studies.
Pharmacological profiles of different nematode P-gps have to be individually
assessed to identify those with unique profiles that can be exploited to reverse drug resistance.
Further, there is a need for P-gp inhibitors that will specifically inhibit nematode P-gps.
Finally, selection protocols may dictate the development of resistance and more
than one mechanism may exist for resistance development (Gill et al., 1998). Clinically relevant
anthelmintic selection and use protocols, tailored for used in different vegetation and climate
belts of the world must be developed to lower the selection pressure on parasites.
5. References
Albrecht, C., Viturro, E., 2007. The ABCA subfamily--gene and protein structures, functions and
associated hereditary diseases. Pflugers Arch 453, 581-589.
28
AlGusbi, S., Krücken, J., Ramünke, S., von Samson-Himmelstjerna, G., Demeler, J., 2014.
Analysis of putative inhibitors of anthelmintic resistance mechanisms in cattle
gastrointestinal nematodes. Int J Parasitol 44, 647-658.
Ali, M.Y., Siddiqui, S.S., 2000. cDNA cloning and expression of a C-terminus motor kinesin-
like protein KLP-17, involved in chromosomal movement in Caenorhabditis elegans.
Biochem Biophys Res Commun 267, 643-650.
Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M., Trinh, Y.T.,
Zhang, Q., Urbatsch, I.L., Chang, G., 2009. Structure of P-glycoprotein reveals a
molecular basis for poly-specific drug binding. Science 323, 1718-1722.
Alvarez, L., Lifschitz, A., Entrocasso, C., Manazza, J., Mottier, L., Borda, B., Virkel, G.,
Lanusse, C., 2008. Evaluation of the interaction between ivermectin and albendazole
following their combined use in lambs. J Vet Pharmacol Ther 31, 230-239.
Alvarez, L., Suarez, G., Ceballos, L., Moreno, L., Canton, C., Lifschitz, A., Maté, L., Ballent,
M., Virkel, G., Lanusse, C., 2015. Integrated assessment of ivermectin pharmacokinetics,
efficacy against resistant Haemonchus contortus and P-glycoprotein expression in lambs
treated at three different dosage levels. Vet Parasitol 210, 53-63.
Alvarez-Sánchez, M.A., Pérez García, J., Bartley, D., Jackson, F., Rojo-Vázquez, F.A., 2005.
The larval feeding inhibition assay for the diagnosis of nematode anthelmintic resistance.
Exp Parasitol 110, 56-61.
Alvinerie, M., Dupuy, J., Kiki-Mvouaka, S., Sutra, J.F., Lespine, A., 2008. Ketoconazole
increases the plasma levels of ivermectin in sheep. Vet Parasitol 157, 117-122.
Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M., Pastan, I., Gottesman, M.M., 1999.
Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu
Rev Pharmacol Toxicol 39, 361-398.
Ardelli, B.F., Stitt, L.E., Tompkins, J.B., 2010. Inventory and analysis of ATP-binding cassette
(ABC) systems in Brugia malayi. Parasitology 137, 1195-1212.
Areskog, M., Engström, A., Tallkvist, J., von Samson-Himmelstjerna, G., Höglund, J., 2013.
PGP expression in Cooperia oncophora before and after ivermectin selection. Parasitol
Res 112, 3005-3012.
Ballent, M., Lifschitz, A., Virkel, G., Sallovitz, J., Lanusse, C., 2007. Involvement of P-
glycoprotein on ivermectin kinetic behaviour in sheep: itraconazole-mediated changes on
gastrointestinal disposition. J Vet Pharmacol Ther 30, 242-248.
Barclay, J.W., Morgan, A., Burgoyne, R.D., 2012. Neurotransmitter release mechanisms studied
in Caenorhabditis elegans. Cell Calcium 52, 289-295.
Bartley, D.J., McAllister, H., Bartley, Y., Dupuy, J., Ménez, C., Alvinerie, M., Jackson, F.,
Lespine, A., 2009. P-glycoprotein interfering agents potentiate ivermectin susceptibility
in ivermectin sensitive and resistant isolates of Teladorsagia circumcincta and
Haemonchus contortus. Parasitology 136, 1081-1088.
29
Bartley, D.J., Morrison, A.A., Dupuy, J., Bartley, Y., Sutra, J.F., Menez, C., Alvinerie, M.,
Jackson, F., Devin, L., Lespine, A., 2012. Influence of Pluronic 85 and ketoconazole on
disposition and efficacy of ivermectin in sheep infected with a multiple resistant
Haemonchus contortus isolate. Vet Parasitol 187, 464-472.
Bazzocchi, C., Mortarino, M., Grandi, G., Kramer, L.H., Genchi, C., Bandi, C., Genchi, M.,
Sacchi, L., McCall, J.W., 2008. Combined ivermectin and doxycycline treatment has
microfilaricidal and adulticidal activity against Dirofilaria immitis in experimentally
infected dogs. Int J Parasitol 38, 1401-1410.
Beech, R.N., Skuce, P., Bartley, D.J., Martin, R.J., Prichard, R.K., Gilleard, J.S., 2011.
Anthelmintic resistance: markers for resistance, or susceptibility? Parasitology 138, 160-
174.
Beugnet, F., Gauthey, M., Kerboeuf, D., 1997. Partial in vitro reversal of benzimidazole
resistance by the free-living stages of Haemonchus contortus with verapamil. Vet Rec
141, 575-576.
Blackhall, W.J., Liu, H.Y., Xu, M., Prichard, R.K., Beech, R.N., 1998a. Selection at a P-
glycoprotein gene in ivermectin- and moxidectin-selected strains of Haemonchus
contortus. Mol Biochem Parasitol 95, 193-201.
Blackhall, W.J., Pouliot, J.F., Prichard, R.K., Beech, R.N., 1998b. Haemonchus contortus:
selection at a glutamate-gated chloride channel gene in ivermectin- and moxidectin-
selected strains. Exp Parasitol 90, 42-48.
Blackhall, W.J., Prichard, R.K., Beech, R.N., 2008. P-glycoprotein selection in strains of
Haemonchus contortus resistant to benzimidazoles. Vet Parasitol 152, 101-107.
Blaxter, M.L., De Ley, P., Garey, J.R., Liu, L.X., Scheldeman, P., Vierstraete, A., Vanfleteren,
J.R., Mackey, L.Y., Dorris, M., Frisse, L.M., Vida, J.T., Thomas, W.K., 1998. A
molecular evolutionary framework for the phylum Nematoda. Nature 392, 71-75.
Boersema, J.H., Eysker, M., Nas, J.W., 2002. Apparent resistance of Parascaris equorum to
macrocylic lactones. Vet Rec 150, 279-281.
Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter genes in
Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.
Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011a. Macrocyclic
lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.
Bourguinat, C., Keller, K., Blagburn, B., Schenker, R., Geary, T.G., Prichard, R.K., 2011b.
Correlation between loss of efficacy of macrocyclic lactone heartworm anthelmintics and
P-glycoprotein genotype. Vet Parasitol 176, 374-381.
Broeks, A., Gerrard, B., Allikmets, R., Dean, M., Plasterk, R.H., 1996. Homologues of the
human multidrug resistance genes MRP and MDR contribute to heavy metal resistance in
the soil nematode Caenorhabditis elegans. EMBO J 15, 6132-6143.
Broeks, A., Janssen, H.W., Calafat, J., Plasterk, R.H., 1995. A P-glycoprotein protects
Caenorhabditis elegans against natural toxins. EMBO J 14, 1858-1866.
30
Bygarski, E.E., Prichard, R.K., Ardelli, B.F., 2014. Resistance to the macrocyclic lactone
moxidectin is mediated in part by membrane transporter P-glycoproteins: Implications for
control of drug resistant parasitic nematodes. Int J Parasitol Drugs Drug Resist 4, 143-
151.
Bártíková, H., Vokřál, I., Kubíček, V., Szotáková, B., Prchal, L., Lamka, J., Várady, M.,
Skálová, L., 2012. Import and efflux of flubendazole in Haemonchus contortus strains
susceptible and resistant to anthelmintics. Vet Parasitol 187, 473-479.
Churcher, T.S., Pion, S.D., Osei-Atweneboana, M.Y., Prichard, R.K., Awadzi, K., Boussinesq,
M., Collins, R.C., Whitworth, J.A., Basáñez, M.G., 2009. Identifying sub-optimal
responses to ivermectin in the treatment of River Blindness. Proc Natl Acad Sci U S A
106, 16716-16721.
Conrad, S., Viertelhaus, A., Orzechowski, A., Hoogstraate, J., Gjellan, K., Schrenk, D.,
Kauffmann, H.M., 2001. Sequencing and tissue distribution of the canine MRP2 gene
compared with MRP1 and MDR1. Toxicology 156, 81-91.
Consortium, I.H.G., 2019. Comparative genomics of the major parasitic worms. Nat Genet 51,
163-174.
Craig, T.M., Diamond, P.L., Ferwerda, N.S., Thompson, J.A., 2007. Evidence of ivermectin
resistance by Parascaris equorum on a Texas horse farm. Journal of Equine Veterinary
Science 27, 67-71.
Cromie, L., Ferry, M., Couper, A., Fields, C., Taylor, S.M., 2006. Pharmacokinetics of a novel
closantel/ivermectin injection in cattle. J Vet Pharmacol Ther 29, 205-211.
Dassa, E., 2011. Natural history of ABC systems: not only transporters. Essays Biochem 50, 19-
42.
Dassa, E., Bouige, P., 2001. The ABC of ABCS: a phylogenetic and functional classification of
ABC systems in living organisms. Res Microbiol 152, 211-229.
David, M., Lebrun, C., Duguet, T., Talmont, F., Beech, R., Orlowski, S., André, F., Prichard,
R.K., Lespine, A., 2018. Structural model, functional modulation by ivermectin and
tissue localization of Haemonchus contortus P-glycoprotein-13. Int J Parasitol Drugs
Drug Resist 8, 145-157.
Davidson, A.L., Dassa, E., Orelle, C., Chen, J., 2008. Structure, function, and evolution of
bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev 72, 317-364, table of
contents.
De Graef, J., Demeler, J., Skuce, P., Mitreva, M., Von Samson-Himmelstjerna, G., Vercruysse,
J., Claerebout, E., Geldhof, P., 2013. Gene expression analysis of ABC transporters in a
resistant Cooperia oncophora isolate following in vivo and in vitro exposure to
macrocyclic lactones. Parasitology 140, 499-508.
Demeler, J., Kleinschmidt, N., Küttler, U., Koopmann, R., von Samson-Himmelstjerna, G.,
2012. Evaluation of the Egg Hatch Assay and the Larval Migration Inhibition Assay to
detect anthelmintic resistance in cattle parasitic nematodes on farms. Parasitol Int 61,
614-618.
31
Demeler, J., Krücken, J., AlGusbi, S., Ramünke, S., De Graef, J., Kerboeuf, D., Geldhof, P.,
Pomroy, W.E., von Samson-Himmelstjerna, G., 2013. Potential contribution of P-
glycoproteins to macrocyclic lactone resistance in the cattle parasitic nematode Cooperia
oncophora. Mol Biochem Parasitol 188, 10-19.
Demeler, J., Küttler, U., von Samson-Himmelstjerna, G., 2010. Adaptation and evaluation of
three different in vitro tests for the detection of resistance to anthelmintics in gastro
intestinal nematodes of cattle. Vet Parasitol 170, 61-70.
Dicker, A.J., Nath, M., Yaga, R., Nisbet, A.J., Lainson, F.A., Gilleard, J.S., Skuce, P.J., 2011a.
Teladorsagia circumcincta: the transcriptomic response of a multi-drug-resistant isolate to
ivermectin exposure in vitro. Exp Parasitol 127, 351-356.
Dicker, A.J., Nisbet, A.J., Skuce, P.J., 2011b. Gene expression changes in a P-glycoprotein (Tci-
pgp-9) putatively associated with ivermectin resistance in Teladorsagia circumcincta. Int
J Parasitol 41, 935-942.
Doligalska, M., Jóźwicka, K., Kiersnowska, M., Mroczek, A., Pączkowski, C., Janiszowska, W.,
2011. Triterpenoid saponins affect the function of P-glycoprotein and reduce the survival
of the free-living stages of Heligmosomoides bakeri. Vet Parasitol 179, 144-151.
Dolinská, M., Königová, A., Letková, V., Molnár, L., Várady, M., 2013. Detection of ivermectin
resistance by a larval development test--back to the past or a step forward? Vet Parasitol
198, 154-158.
Dong, M., Ladavière, L., Penin, F., Deléage, G., Baggetto, L.G., 1998. Secondary structure of P-
glycoprotein investigated by circular dichroism and amino acid sequence analysis.
Biochim Biophys Acta 1371, 317-334.
Dowling, P., 2006. Pharmacogenetics: it's not just about ivermectin in collies. Can Vet J 47,
1165-1168.
Doyle, S.R., Cotton, J.A., 2019. Genome-wide Approaches to Investigate Anthelmintic
Resistance. Trends Parasitol 35, 289-301.
Drogemuller, M., Schnieder, T., von Samson-Himmelstjerna, G., 2004. Evidence of p-
glycoprotein sequence diversity in cyathostomins. J Parasitol 90, 998-1003.
Dupuy, J., Alvinerie, M., Ménez, C., Lespine, A., 2010. Interaction of anthelmintic drugs with P-
glycoprotein in recombinant LLC-PK1-mdr1a cells. Chem Biol Interact 186, 280-286.
Dupuy, J., Larrieu, G., Sutra, J.F., Lespine, A., Alvinerie, M., 2003. Enhancement of moxidectin
bioavailability in lamb by a natural flavonoid: quercetin. Vet Parasitol 112, 337-347.
Eckford, P.D., Sharom, F.J., 2005. The reconstituted P-glycoprotein multidrug transporter is a
flippase for glucosylceramide and other simple glycosphingolipids. Biochem J 389, 517-
526.
Evans, G.L., Ni, B., Hrycyna, C.A., Chen, D., Ambudkar, S.V., Pastan, I., Germann, U.A.,
Gottesman, M.M., 1995. Heterologous expression systems for P-glycoprotein: E. coli,
yeast, and baculovirus. J Bioenerg Biomembr 27, 43-52.
32
Fiel, C.A., Saumell, C.A., Steffan, P.E., Rodriguez, E.M., 2001. Resistance of Cooperia to
ivermectin treatments in grazing cattle of the Humid Pampa, Argentina. Vet Parasitol 97,
211-217.
Figueiredo, L.A., Rebouças, T.F., Ferreira, S.R., Rodrigues-Luiz, G.F., Miranda, R.C., Araujo,
R.N., Fujiwara, R.T., 2018. Dominance of P-glycoprotein 12 in phenotypic resistance
conversion against ivermectin in Caenorhabditis elegans. PLoS One 13, e0192995.
Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the
chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.
Garavelli, J.S., 2004. The RESID Database of Protein Modifications as a resource and annotation
tool. Proteomics 4, 1527-1533.
Gasbarre, L.C., Smith, L.L., Lichtenfels, J.R., Pilitt, P.A., 2009. The identification of cattle
nematode parasites resistant to multiple classes of anthelmintics in a commercial cattle
population in the US. Vet Parasitol 166, 281-285.
Geary, T.G., Thompson, D.P., 2001. Caenorhabditis elegans: how good a model for veterinary
parasites? Vet Parasitol 101, 371-386.
Gill, J.H., Kerr, C.A., Shoop, W.L., Lacey, E., 1998. Evidence of multiple mechanisms of
avermectin resistance in haemonchus contortus--comparison of selection protocols. Int J
Parasitol 28, 783-789.
Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1995. Avermectin inhibition of larval
development in Haemonchus contortus--effects of ivermectin resistance. Int J Parasitol
25, 463-470.
Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2015a. Characterization of Haemonchus
contortus P-glycoprotein-16 and its interaction with the macrocyclic lactone
anthelmintics. Mol Biochem Parasitol 204, 11-15.
Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2016. Characterisation of P-glycoprotein-9.1 in
Haemonchus contortus. Parasit Vectors 9, 52.
Godoy, P., Lian, J., Beech, R.N., Prichard, R.K., 2015b. Haemonchus contortus P-glycoprotein-
2: in situ localisation and characterisation of macrocyclic lactone transport. Int J Parasitol
45, 85-93.
Goh, L.B., Spears, K.J., Yao, D., Ayrton, A., Morgan, P., Roland Wolf, C., Friedberg, T., 2002.
Endogenous drug transporters in in vitro and in vivo models for the prediction of drug
disposition in man. Biochem Pharmacol 64, 1569-1578.
Guo, T., Huang, J., Zhang, H., Dong, L., Guo, D., Guo, L., He, F., Bhutto, Z.A., Wang, L., 2016.
Abcb1 in Pigs: Molecular cloning, tissues distribution, functional analysis, and its effect
on pharmacokinetics of enrofloxacin. Sci Rep 6, 32244.
Haslam, I.S., Simmons, N.L., 2014. Expression of the ABC transport proteins MDR1 (ABCB1)
and BCRP (ABCG2) in bovine rumen. J Comp Physiol B 184, 673-681.
33
Heckler, R.P., Almeida, G.D., Santos, L.B., Borges, D.G., Neves, J.P., Onizuka, M.K., Borges,
F.A., 2014. P-gp modulating drugs greatly potentiate the in vitro effect of ivermectin
against resistant larvae of Haemonchus placei. Vet Parasitol 205, 638-645.
Hibbs, R.E., Gouaux, E., 2011. Principles of activation and permeation in an anion-selective
Cys-loop receptor. Nature 474, 54-60.
Hirose, T., Horvitz, H.R., 2014. The translational regulators GCN-1 and ABCF-3 act together to
promote apoptosis in C. elegans. PLoS Genet 10, e1004512.
Howard, J.T., O'Nan, A.T., Maltecca, C., Baynes, R.E., Ashwell, M.S., 2015. Differential Gene
Expression across Breed and Sex in Commercial Pigs Administered Fenbendazole and
Flunixin Meglumine. PLoS One 10, e0137830.
Ince, T.A., Scotto, K.W., 1995. Differential utilization of multiple transcription start points
accompanies the overexpression of the P-glycoprotein-encoding gene in Chinese hamster
lung cells. Gene 156, 287-290.
Issouf, M., Guégnard, F., Koch, C., Le Vern, Y., Blanchard-Letort, A., Che, H., Beech, R.N.,
Kerboeuf, D., Neveu, C., 2014. Haemonchus contortus P-glycoproteins interact with host
eosinophil granules: a novel insight into the role of ABC transporters in host-parasite
interaction. PLoS One 9, e87802.
Jagodinsky, J.C., Akgun, U., 2015. Characterizing the binding interactions between P-
glycoprotein and eight known cardiovascular transport substrates. Pharmacol Res
Perspect 3, e00114.
James, C.E., Davey, M.W., 2009. Increased expression of ABC transport proteins is associated
with ivermectin resistance in the model nematode Caenorhabditis elegans. Int J Parasitol
39, 213-220.
Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-Himmelstjerna, G.,
2013a. Genetic variants and increased expression of Parascaris equorum P-glycoprotein-
11 in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.
Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2013b. Caenorhabditis
elegans: modest increase of susceptibility to ivermectin in individual P-glycoprotein loss-
of-function strains. Exp Parasitol 134, 171-177.
Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2015. Transgenically
expressed Parascaris P-glycoprotein-11 can modulate ivermectin susceptibility in
Caenorhabditis elegans. Int J Parasitol Drugs Drug Resist 5, 44-47.
Jesudoss Chelladurai, J., Brewer, M.T., 2019. Detection and quantification of Parascaris P-
glycoprotein drug transporter expression with a novel mRNA hybridization technique.
Vet Parasitol 267, 75-83.
Jex, A.R., Liu, S., Li, B., Young, N.D., Hall, R.S., Li, Y., Yang, L., Zeng, N., Xu, X., Xiong, Z.,
Chen, F., Wu, X., Zhang, G., Fang, X., Kang, Y., Anderson, G.A., Harris, T.W.,
Campbell, B.E., Vlaminck, J., Wang, T., Cantacessi, C., Schwarz, E.M., Ranganathan, S.,
Geldhof, P., Nejsum, P., Sternberg, P.W., Yang, H., Wang, J., Gasser, R.B., 2011.
Ascaris suum draft genome. Nature 479, 529-533.
34
Jin, M.S., Oldham, M.L., Zhang, Q., Chen, J., 2012. Crystal structure of the multidrug
transporter P-glycoprotein from Caenorhabditis elegans. Nature 490, 566-569.
Juliano, R.L., Ling, V., 1976. A surface glycoprotein modulating drug permeability in Chinese
hamster ovary cell mutants. Biochim Biophys Acta 455, 152-162.
Kabsch, W., Sander, C., 1983. Dictionary of protein secondary structure: pattern recognition of
hydrogen-bonded and geometrical features. Biopolymers 22, 2577-2637.
Kanehisa, M., Furumichi, M., Tanabe, M., Sato, Y., Morishima, K., 2017. KEGG: new
perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res 45, D353-
D361.
Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T., Kerboeuf,
D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in
interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus
elongatus and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.
Kellerová, P., Matoušková, P., Lamka, J., Vokřál, I., Szotáková, B., Zajíčková, M., Pasák, M.,
Skálová, L., 2019. Ivermectin-induced changes in the expression of cytochromes P450
and efflux transporters in Haemonchus contortus female and male adults. Vet Parasitol
273, 24-31.
Kenealy, J.S., 2019. Anthelmintic resistance in equine parasites: mechanisms and treatment
approaches. University of Kentucky, Lexington, KY.
Kerboeuf, D., Aycardi, J., Soubieux, D., 1996. Flow-cytometry analysis of sheep-nematode egg
populations. Parasitol Res 82, 358-363.
Kerboeuf, D., Chambrier, P., Le Vern, Y., Aycardi, J., 1999. Flow cytometry analysis of drug
transport mechanisms in Haemonchus contortus susceptible or resistant to anthelmintics.
Parasitol Res 85, 118-123.
Kerboeuf, D., Guégnard, F., 2011. Anthelmintics are substrates and activators of nematode P
glycoprotein. Antimicrob Agents Chemother 55, 2224-2232.
Kerboeuf, D., Guégnard, F., Vern, Y.L., 2003. Detection of P-glycoprotein-mediated multidrug
resistance against anthelmintics in Haemonchus contortus using anti-human mdr1
monoclonal antibodies. Parasitol Res 91, 79-85.
Kim, Y., Chen, J., 2018. Molecular structure of human P-glycoprotein in the ATP-bound,
outward-facing conformation. Science 359, 915-919.
Kimchi-Sarfaty, C., Oh, J.M., Kim, I.W., Sauna, Z.E., Calcagno, A.M., Ambudkar, S.V.,
Gottesman, M.M., 2007. A "silent" polymorphism in the MDR1 gene changes substrate
specificity. Science 315, 525-528.
Korolnek, T., Zhang, J., Beardsley, S., Scheffer, G.L., Hamza, I., 2014. Control of metazoan
heme homeostasis by a conserved multidrug resistance protein. Cell Metab 19, 1008-
1019.
35
Kotze, A.C., Ruffell, A.P., Knox, M.R., Kelly, G.A., 2014. Relative potency of macrocyclic
lactones in in vitro assays with larvae of susceptible and drug-resistant Australian isolates
of Haemonchus contortus and H. placei. Vet Parasitol 203, 294-302.
Krücken, J., Fraundorfer, K., Mugisha, J.C., Ramünke, S., Sifft, K.C., Geus, D., Habarugira, F.,
Ndoli, J., Sendegeya, A., Mukampunga, C., Bayingana, C., Aebischer, T., Demeler, J.,
Gahutu, J.B., Mockenhaupt, F.P., von Samson-Himmelstjerna, G., 2017. Reduced
efficacy of albendazole against Ascaris lumbricoides in Rwandan schoolchildren. Int J
Parasitol Drugs Drug Resist 7, 262-271.
Kuteykin-Teplyakov, K., Luna-Tortós, C., Ambroziak, K., Löscher, W., 2010. Differences in the
expression of endogenous efflux transporters in MDR1-transfected versus wildtype cell
lines affect P-glycoprotein mediated drug transport. Br J Pharmacol 160, 1453-1463.
Kwa, M.S., Okoli, M.N., Schulz-Key, H., Okongkwo, P.O., Roos, M.H., 1998. Use of P-
glycoprotein gene probes to investigate anthelmintic resistance in Haemonchus contortus
and comparison with Onchocerca volvulus. Int J Parasitol 28, 1235-1240.
Laing, R., Martinelli, A., Tracey, A., Holroyd, N., Gilleard, J.S., Cotton, J.A., 2016.
Haemonchus contortus: Genome Structure, Organization and Comparative Genomics.
Adv Parasitol 93, 569-598.
Le Jambre, L.F., Lenane, I.J., Wardrop, A.J., 1999. A hybridisation technique to identify
anthelmintic resistance genes in Haemonchus. Int J Parasitol 29, 1979-1985.
Lebedeva, I.V., Pande, P., Patton, W.F., 2011. Sensitive and specific fluorescent probes for
functional analysis of the three major types of mammalian ABC transporters. PLoS One
6, e22429.
Lespine, A., Martin, S., Dupuy, J., Roulet, A., Pineau, T., Orlowski, S., Alvinerie, M., 2007.
Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship.
Eur J Pharm Sci 30, 84-94.
Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other
multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for
reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist
2, 58-75.
Lifschitz, A., Entrocasso, C., Alvarez, L., Lloberas, M., Ballent, M., Manazza, G., Virkel, G.,
Borda, B., Lanusse, C., 2010a. Interference with P-glycoprotein improves ivermectin
activity against adult resistant nematodes in sheep. Vet Parasitol 172, 291-298.
Lifschitz, A., Suarez, V.H., Sallovitz, J., Cristel, S.L., Imperiale, F., Ahoussou, S., Schiavi, C.,
Lanusse, C., 2010b. Cattle nematodes resistant to macrocyclic lactones: comparative
effects of P-glycoprotein modulation on the efficacy and disposition kinetics of
ivermectin and moxidectin. Exp Parasitol 125, 172-178.
Lifschitz, A., Virkel, G., Ballent, M., Sallovitz, J., Lanusse, C., 2009. Combined use of
ivermectin and triclabendazole in sheep: in vitro and in vivo characterisation of their
pharmacological interaction. Vet J 182, 261-268.
36
Lifschitz, A., Virkel, G., Sallovitz, J., Imperiale, F., Pis, A., Lanusse, C., 2002. Loperamide-
induced enhancement of moxidectin availability in cattle. J Vet Pharmacol Ther 25, 111-
120.
Lindblom, T.H., Dodd, A.K., 2006. Xenobiotic detoxification in the nematode Caenorhabditis
elegans. J Exp Zool A Comp Exp Biol 305, 720-730.
Lloberas, M., Alvarez, L., Entrocasso, C., Virkel, G., Ballent, M., Mate, L., Lanusse, C.,
Lifschitz, A., 2013. Comparative tissue pharmacokinetics and efficacy of moxidectin,
abamectin and ivermectin in lambs infected with resistant nematodes: Impact of drug
treatments on parasite P-glycoprotein expression. Int J Parasitol Drugs Drug Resist 3, 20-
27.
Lucchetti, C., Genchi, M., Venco, L., Menozzi, A., Serventi, P., Bertini, S., Bazzocchi, C.,
Kramer, L.H., Vismarra, A., 2019. Differential ABC transporter gene expression in adult
Dirofilaria immitis males and females following in vitro treatment with ivermectin,
doxycycline or a combination of both. Parasit Vectors 12, 401.
Luo, X., Shi, X., Yuan, C., Ai, M., Ge, C., Hu, M., Feng, X., Yang, X., 2017. Genome-wide SNP
analysis using 2b-RAD sequencing identifies the candidate genes putatively associated
with resistance to ivermectin in Haemonchus contortus. Parasit Vectors 10, 31.
Lynagh, T., Lynch, J.W., 2010. A glycine residue essential for high ivermectin sensitivity in
Cys-loop ion channel receptors. Int J Parasitol 40, 1477-1481.
Lynagh, T., Lynch, J.W., 2012. Ivermectin binding sites in human and invertebrate Cys-loop
receptors. Trends Pharmacol Sci 33, 432-441.
Mani, T., Bourguinat, C., Keller, K., Ashraf, S., Blagburn, B., Prichard, R.K., 2016. Interaction
of macrocyclic lactones with a Dirofilaria immitis P-glycoprotein. Int J Parasitol 46, 631-
640.
Maté, L., Ballent, M., Cantón, C., Ceballos, L., Lifschitz, A., Lanusse, C., Alvarez, L., Liron,
J.P., 2018. Assessment of P-glycoprotein gene expression in adult stage of Haemonchus
contortus in vivo exposed to ivermectin. Vet Parasitol 264, 1-7.
McCall, J.W., 2005. The safety-net story about macrocyclic lactone heartworm preventives: a
review, an update, and recommendations. Vet Parasitol 133, 197-206.
McCall, J.W., Genchi, C., Kramer, L., Guerrero, J., Dzimianski, M.T., Supakorndej, P.,
Mansour, A.M., McCall, S.D., Supakorndej, N., Grandi, G., Carson, B., 2008.
Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 158, 204-214.
McDonald, M.K., Fritz, J.A., Jia, D., Scheuchner, D., Snyder, F.F., Stanislaus, A., Curle, J., Li,
L., Stabler, S.P., Allen, R.H., Mains, P.E., Gravel, R.A., 2017. Identification of ABC
transporters acting in vitamin B. Mol Genet Metab 122, 160-171.
Mealey, K.L., 2013. Adverse drug reactions in veterinary patients associated with drug
transporters. Vet Clin North Am Small Anim Pract 43, 1067-1078.
Mealey, K.L., Bentjen, S.A., Gay, J.M., Cantor, G.H., 2001. Ivermectin sensitivity in collies is
associated with a deletion mutation of the mdr1 gene. Pharmacogenetics 11, 727-733.
37
Mealey, K.L., Burke, N.S., 2015. Identification of a nonsense mutation in feline ABCB1. J Vet
Pharmacol Ther 38, 429-433.
Mealey, K.L., Dassanayake, S., Burke, N.S., 2017. Establishment of a cell line for assessing
drugs as canine P-glycoprotein substrates: proof of principle. J Vet Pharmacol Ther 40,
545-551.
Mealey, K.L., Fidel, J., 2015. P-glycoprotein mediated drug interactions in animals and humans
with cancer. J Vet Intern Med 29, 1-6.
Meli, V.S., Osuna, B., Ruvkun, G., Frand, A.R., 2010. MLT-10 defines a family of DUF644 and
proline-rich repeat proteins involved in the molting cycle of Caenorhabditis elegans. Mol
Biol Cell 21, 1648-1661.
Merola, V.M., Eubig, P.A., 2012. Toxicology of avermectins and milbemycins (macrocylic
lactones) and the role of P-glycoprotein in dogs and cats. Vet Clin North Am Small Anim
Pract 42, 313-333, vii.
Molento, M.B., Lifschitz, A., Sallovitz, J., Lanusse, C., Prichard, R., 2004. Influence of
verapamil on the pharmacokinetics of the antiparasitic drugs ivermectin and moxidectin
in sheep. Parasitol Res 92, 121-127.
Montecchi-Palazzi, L., Beavis, R., Binz, P.A., Chalkley, R.J., Cottrell, J., Creasy, D., Shofstahl,
J., Seymour, S.L., Garavelli, J.S., 2008. The PSI-MOD community standard for
representation of protein modification data. Nat Biotechnol 26, 864-866.
Morita, M., Imanaka, T., 2012. Peroxisomal ABC transporters: structure, function and role in
disease. Biochim Biophys Acta 1822, 1387-1396.
Ménez, C., Alberich, M., Courtot, E., Guegnard, F., Blanchard, A., Aguilaniu, H., Lespine, A.,
2019. The transcription factor NHR-8: A new target to increase ivermectin efficacy in
nematodes. PLoS Pathog 15, e1007598.
Ménez, C., Alberich, M., Kansoh, D., Blanchard, A., Lespine, A., 2016. Acquired Tolerance to
Ivermectin and Moxidectin after Drug Selection Pressure in the Nematode
Caenorhabditis elegans. Antimicrob Agents Chemother 60, 4809-4819.
Na, H., Ponomarova, O., Giese, G.E., Walhout, A.J.M., 2018. C. elegans MRP-5 Exports
Vitamin B12 from Mother to Offspring to Support Embryonic Development. Cell Rep
22, 3126-3133.
Nanayakkara, A.K., Follit, C.A., Chen, G., Williams, N.S., Vogel, P.D., Wise, J.G., 2018.
Targeted inhibitors of P-glycoprotein increase chemotherapeutic-induced mortality of
multidrug resistant tumor cells. Sci Rep 8, 967.
Njue, A.I., Hayashi, J., Kinne, L., Feng, X.P., Prichard, R.K., 2004. Mutations in the
extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from
ivermectin-resistant Cooperia oncophora affect agonist sensitivity. J Neurochem 89,
1137-1147.
Oshlack, A., Wakefield, M.J., 2009. Transcript length bias in RNA-seq data confounds systems
biology. Biol Direct 4, 14.
38
Palevich, N., Britton, C., Kamenetzky, L., Mitreva, M., de Moraes Mourão, M., Bennuru, S.,
Quack, T., Scholte, L.L.S., Tyagi, R., Slatko, B.E., (IMHAN), I.M.H.A.N., include, I.c.a.,
2018. Tackling Hypotheticals in Helminth Genomes. Trends Parasitol 34, 179-183.
Palmeira, A., Sousa, E., Vasconcelos, M.H., Pinto, M.M., 2012. Three decades of P-gp
inhibitors: skimming through several generations and scaffolds. Curr Med Chem 19,
1946-2025.
Peachey, L.E., Pinchbeck, G.L., Matthews, J.B., Burden, F.A., Lespine, A., von Samson-
Himmelstjerna, G., Krücken, J., Hodgkinson, J.E., 2017. P-glycoproteins play a role in
ivermectin resistance in cyathostomins. Int J Parasitol Drugs Drug Resist 7, 388-398.
Prichard, R., Ménez, C., Lespine, A., 2012. Moxidectin and the avermectins: Consanguinity but
not identity. Int J Parasitol Drugs Drug Resist 2, 134-153.
Prichard, R.K., Roulet, A., 2007. ABC transporters and beta-tubulin in macrocyclic lactone
resistance: prospects for marker development. Parasitology 134, 1123-1132.
Raza, A., Bagnall, N.H., Jabbar, A., Kopp, S.R., Kotze, A.C., 2016a. Increased expression of
ATP binding cassette transporter genes following exposure of Haemonchus contortus
larvae to a high concentration of monepantel in vitro. Parasit Vectors 9, 522.
Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016b. Effects of in vitro exposure
to ivermectin and levamisole on the expression patterns of ABC transporters in
Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.
Raza, A., Kopp, S.R., Jabbar, A., Kotze, A.C., 2015. Effects of third generation P-glycoprotein
inhibitors on the sensitivity of drug-resistant and -susceptible isolates of Haemonchus
contortus to anthelmintics in vitro. Vet Parasitol 211, 80-88.
Raza, A., Kopp, S.R., Kotze, A.C., 2016c. Synergism between ivermectin and the tyrosine
kinase/P-glycoprotein inhibitor crizotinib against Haemonchus contortus larvae in vitro.
Vet Parasitol 227, 64-68.
Riou, M., Guégnard, F., Sizaret, P.Y., Le Vern, Y., Kerboeuf, D., 2010. Drug resistance is
affected by colocalization of P-glycoproteins in raft-like structures unexpected in
eggshells of the nematode Haemonchus contortus. Biochem Cell Biol 88, 459-467.
Riou, M., Koch, C., Delaleu, B., Berthon, P., Kerboeuf, D., 2005. Immunolocalisation of an
ABC transporter, P-glycoprotein, in the eggshells and cuticles of free-living and parasitic
stages of Haemonchus contortus. Parasitol Res 96, 142-148.
Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L., Pachter, L., 2011. Improving RNA-Seq
expression estimates by correcting for fragment bias. Genome Biol 12, R22.
Romsicki, Y., Sharom, F.J., 2001. Phospholipid flippase activity of the reconstituted P-
glycoprotein multidrug transporter. Biochemistry 40, 6937-6947.
Rothwell, J.T., Sangster, N.C., 1993. An in vitro assay utilising parasitic larval Haemonchus
contortus to detect resistance to closantel and other anthelmintics. Int J Parasitol 23, 573-
578.
39
Sangster, N.C., 1994. P-glycoproteins in nematodes. Parasitol Today 10, 319-322.
Sangster, N.C., Bannan, S.C., Weiss, A.S., Nulf, S.C., Klein, R.D., Geary, T.G., 1999.
Haemonchus contortus: sequence heterogeneity of internucleotide binding domains from
P-glycoproteins. Exp Parasitol 91, 250-257.
Sarai, R.S., Kopp, S.R., Coleman, G.T., Kotze, A.C., 2013. Acetylcholine receptor subunit and
P-glycoprotein transcription patterns in levamisole-susceptible and -resistant
Haemonchus contortus. Int J Parasitol Drugs Drug Resist 3, 51-58.
Schwartz, M.S., Benci, J.L., Selote, D.S., Sharma, A.K., Chen, A.G., Dang, H., Fares, H.,
Vatamaniuk, O.K., 2010. Detoxification of multiple heavy metals by a half-molecule
ABC transporter, HMT-1, and coelomocytes of Caenorhabditis elegans. PLoS One 5,
e9564.
Scotto, K.W., Egan, D.A., 1998. Transcriptional regulation of MDR genes. Cytotechnology 27,
257-269.
Shapiro, A.B., Ling, V., 1997. Extraction of Hoechst 33342 from the cytoplasmic leaflet of the
plasma membrane by P-glycoprotein. Eur J Biochem 250, 122-129.
Sharom, F.J., 2014. Complex Interplay between the P-Glycoprotein Multidrug Efflux Pump and
the Membrane: Its Role in Modulating Protein Function. Front Oncol 4, 41.
Sheps, J.A., Ralph, S., Zhao, Z., Baillie, D.L., Ling, V., 2004. The ABC transporter gene family
of Caenorhabditis elegans has implications for the evolutionary dynamics of multidrug
resistance in eukaryotes. Genome Biol 5, R15.
Shtil, A.A., Azare, J., 2005. Redundancy of biological regulation as the basis of emergence of
multidrug resistance. Int Rev Cytol 246, 1-29.
Silva, R., Vilas-Boas, V., Carmo, H., Dinis-Oliveira, R.J., Carvalho, F., de Lourdes Bastos, M.,
Remião, F., 2015. Modulation of P-glycoprotein efflux pump: induction and activation as
a therapeutic strategy. Pharmacol Ther 149, 1-123.
Slocombe, J.O., de Gannes, R.V., Lake, M.C., 2007. Macrocyclic lactone-resistant Parascaris
equorum on stud farms in Canada and effectiveness of fenbendazole and pyrantel
pamoate. Vet Parasitol 145, 371-376.
Smith, J.M., Prichard, R.K., 2002. Localization of p-glycoprotein mRNA in the tissues of
Haemonchus contortus adult worms and its relative abundance in drug-selected and
susceptible strains. J Parasitol 88, 612-620.
Srinivasan, D.G., Fisk, R.M., Xu, H., van den Heuvel, S., 2003. A complex of LIN-5 and GPR
proteins regulates G protein signaling and spindle function in C elegans. Genes Dev 17,
1225-1239.
Stergiou, L., Hengartner, M.O., 2004. Death and more: DNA damage response pathways in the
nematode C. elegans. Cell Death Differ 11, 21-28.
40
Stitt, L.E., Tompkins, J.B., Dooley, L.A., Ardelli, B.F., 2011. ABC transporters influence
sensitivity of Brugia malayi to moxidectin and have potential roles in drug resistance.
Exp Parasitol 129, 137-144.
Stouch, T.R., Gudmundsson, O., 2002. Progress in understanding the structure-activity
relationships of P-glycoprotein. Adv Drug Deliv Rev 54, 315-328.
Stringham, E., Pujol, N., Vandekerckhove, J., Bogaert, T., 2002. unc-53 controls longitudinal
migration in C. elegans. Development 129, 3367-3379.
Sutherland, I.A., Leathwick, D.M., 2011. Anthelmintic resistance in nematode parasites of cattle:
a global issue? Trends Parasitol 27, 176-181.
Tandon, R., Kaplan, R.M., 2004. Evaluation of a larval development assay (DrenchRite) for the
detection of anthelmintic resistance in cyathostomin nematodes of horses. Vet Parasitol
121, 125-142.
Tang, F., Horie, K., Borchardt, R.T., 2002. Are MDCK cells transfected with the human MDR1
gene a good model of the human intestinal mucosa? Pharm Res 19, 765-772.
Tompkins, J.B., Stitt, L.E., Ardelli, B.F., 2010. Brugia malayi: in vitro effects of ivermectin and
moxidectin on adults and microfilariae. Exp Parasitol 124, 394-402.
Tompkins, J.B., Stitt, L.E., Morrissette, A.M., Ardelli, B.F., 2011. The role of Brugia malayi
ATP-binding cassette (ABC) transporters in potentiating drug sensitivity. Parasitol Res
109, 1311-1322.
Turnbull, F., Jonsson, N.N., Kenyon, F., Skuce, P.J., Bisset, S.A., 2018. P-glycoprotein-9 and
macrocyclic lactone resistance status in selected strains of the ovine gastrointestinal
nematode, Teladorsagia circumcincta. Int J Parasitol Drugs Drug Resist 8, 70-80.
Tydén, E., Skarin, M., Höglund, J., 2014. Gene expression of ABC transporters in Cooperia
oncophora after field and laboratory selection with macrocyclic lactones. Mol Biochem
Parasitol 198, 66-70.
Tydén, E., Tallkvist, J., Tjälve, H., Larsson, P., 2009. P-glycoprotein in intestines, liver, kidney
and lymphocytes in horse. J Vet Pharmacol Ther 32, 167-176.
Tyrrell, K.L., Dobson, R.J., Stein, P.A., Walkden-Brown, S.W., 2002. The effects of ivermectin
and moxidectin on egg viability and larval development of ivermectin-resistant
Haemonchus contortus. Vet Parasitol 107, 85-93.
Vahedi, S., Lusvarghi, S., Pluchino, K., Shafrir, Y., Durell, S.R., Gottesman, M.M., Ambudkar,
S.V., 2018. Mapping discontinuous epitopes for MRK-16, UIC2 and 4E3 antibodies to
extracellular loops 1 and 4 of human P-glycoprotein. Sci Rep 8, 12716.
Van Der Heyden, S., Chiers, K., Ducatelle, R., 2009. Tissue distribution of p-glycoprotein in
cats. Anat Histol Embryol 38, 455-460.
VanDuyn, N., Nass, R., 2014. The putative multidrug resistance protein MRP-7 inhibits
methylmercury-associated animal toxicity and dopaminergic neurodegeneration in
Caenorhabditis elegans. J Neurochem 128, 962-974.
41
Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,
Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and
peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet
Parasitol 206, 38-42.
Virkel, G., Ballent, M., Lanusse, C., Lifschitz, A., 2019. Role of ABC Transporters in Veterinary
Medicine: Pharmaco- Toxicological Implications. Curr Med Chem 26, 1251-1269.
Várady, M., Corba, J., Letková, V., Kovác, G., 2009. Comparison of two versions of larval
development test to detect anthelmintic resistance in Haemonchus contortus. Vet
Parasitol 160, 267-271.
Wang, J., Gao, S., Mostovoy, Y., Kang, Y., Zagoskin, M., Sun, Y., Zhang, B., White, L.K.,
Easton, A., Nutman, T.B., Kwok, P.Y., Hu, S., Nielsen, M.K., Davis, R.E., 2017.
Comparative genome analysis of programmed DNA elimination in nematodes. Genome
Res 27, 2001-2014.
Wang, J., Mitreva, M., Berriman, M., Thorne, A., Magrini, V., Koutsovoulos, G., Kumar, S.,
Blaxter, M.L., Davis, R.E., 2012. Silencing of germline-expressed genes by DNA
elimination in somatic cells. Dev Cell 23, 1072-1080.
Ward, A.B., Szewczyk, P., Grimard, V., Lee, C.W., Martinez, L., Doshi, R., Caya, A., Villaluz,
M., Pardon, E., Cregger, C., Swartz, D.J., Falson, P.G., Urbatsch, I.L., Govaerts, C.,
Steyaert, J., Chang, G., 2013. Structures of P-glycoprotein reveal its conformational
flexibility and an epitope on the nucleotide-binding domain. Proc Natl Acad Sci U S A
110, 13386-13391.
Wen, P.C., Verhalen, B., Wilkens, S., Mchaourab, H.S., Tajkhorshid, E., 2013. On the origin of
large flexibility of P-glycoprotein in the inward-facing state. J Biol Chem 288, 19211-
19220.
Whittaker, J.H., Carlson, S.A., Jones, D.E., Brewer, M.T., 2017. Molecular mechanisms for
anthelmintic resistance in strongyle nematode parasites of veterinary importance. J Vet
Pharmacol Ther 40, 105-115.
Williamson, S.M., Storey, B., Howell, S., Harper, K.M., Kaplan, R.M., Wolstenholme, A.J.,
2011. Candidate anthelmintic resistance-associated gene expression and sequence
polymorphisms in a triple-resistant field isolate of Haemonchus contortus. Mol Biochem
Parasitol 180, 99-105.
Williamson, S.M., Wolstenholme, A.J., 2012. P-glycoproteins of Haemonchus contortus:
development of real-time PCR assays for gene expression studies. J Helminthol 86, 202-
208.
Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of
action of the avermectin/milbemycin anthelmintics. Parasitology 131 Suppl, S85-95.
Wu, Y.C., Horvitz, H.R., 1998. The C. elegans cell corpse engulfment gene ced-7 encodes a
protein similar to ABC transporters. Cell 93, 951-960.
42
Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998. Ivermectin
resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol
Biochem Parasitol 91, 327-335.
Yabe, T., Suzuki, N., Furukawa, T., Ishihara, T., Katsura, I., 2005. Multidrug resistance-
associated protein MRP-1 regulates dauer diapause by its export activity in
Caenorhabditis elegans. Development 132, 3197-3207.
Yagdiran, Y., Oskarsson, A., Knight, C.H., Tallkvist, J., 2016. ABC- and SLC-Transporters in
Murine and Bovine Mammary Epithelium--Effects of Prochloraz. PLoS One 11,
e0151904.
Yan, C., Bi, Y., Yin, D., Zhao, Z., 2012a. A method for rapid and simultaneous mapping of
genetic loci and introgression sizes in nematode species. PLoS One 7, e43770.
Yan, R., Urdaneta-Marquez, L., Keller, K., James, C.E., Davey, M.W., Prichard, R.K., 2012b.
The role of several ABC transporter genes in ivermectin resistance in Caenorhabditis
elegans. Vet Parasitol 190, 519-529.
Young, M.D., Wakefield, M.J., Smyth, G.K., Oshlack, A., 2010. Gene ontology analysis for
RNA-seq: accounting for selection bias. Genome Biol 11, R14.
Zhao, Z., Fang, L.L., Johnsen, R., Baillie, D.L., 2004. ATP-binding cassette protein E is
involved in gene transcription and translation in Caenorhabditis elegans. Biochem
Biophys Res Commun 323, 104-111.
Zhao, Z., Thomas, J.H., Chen, N., Sheps, J.A., Baillie, D.L., 2007. Comparative genomics and
adaptive selection of the ATP-binding-cassette gene family in caenorhabditis species.
Genetics 175, 1407-1418.
Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,
Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,
A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic
pathogen Toxocara canis. Nat Commun 6, 6145.
43
Figures and tables
Figure 2-1. UPGMA phylogenetic tree of ABC superfamily proteins annotated in the genomes of Toxocara canis and C. elegans.
44
Figure 2-2. Secondary structure of C. elegans Pgp-1 after (Jin et al., 2012), created using RCSB
PDB (PDB: 4F4C) with DSSP, RESID and PSI-MOD tools (Garavelli, 2004; Kabsch and
Sander, 1983; Montecchi-Palazzi et al., 2008). The secondary structure has an estimated 54%
helical and 9% beta sheet structure.
45
Figure 2-3. Transmembrane view of the X-ray diffraction crystal structure of C. elegans Pgp-1at
3.4Å in the inward facing confirmation created using NGL viewer PDB ID: 4F4C after (Jin et
al., 2012).
46
Table 2-1. ABC transporter genes in humans and nematodes, derived from the KEGG pathways (Kanehisa et al., 2017).
Family Sub family HGNC name Function in humans Present in nematodes
Class 1 systems
DPL Drug, peptides and lipid
P-gp ABCB1 Efflux pump xenobiotic compounds with
broad substrate specificity, multiple drug
resistance
C. elegans, C. briggsae, B. malayi, L. loa, N.
americanus
TAP ABCB2 Transport of degraded cytosolic peptides
TAP ABCB3 Peptide transport
MDR/TAP ABCB4 Function unknown. Phosphatidylcholine
substrate
ABCB5 Transport of small ions, sugars, peptides C. elegans, C. briggsae
HMI/HMT ABCB6 Heavy metal importer / transporter;
porphyrin transport
C. elegans, T. spiralis, N. americanus
MDR/TAP ABCB7 Fe/S cluster transporter C. elegans, C. briggsae, B. malayi, L. loa, T.
spiralis, N. americanus
MDR/TAP ABCB8 Organic and inorganic molecule transport
from mitochondria
C. elegans, C. briggsae, N. americanus
MDR/TAP ABCB9 Peptide transport from cytosol to
lysosome
C. elegans, C. briggsae, B. malayi, L. loa, T.
spiralis, N. americanus
ABCB10 Mitochondrial protein; function unknown B. malayi, L. loa, N. americanus
ABCB11P Pseudogene in humans
OAD MRP ABCC1 Conjugate drug exporters, organic anion
and bile salt transporter
C. elegans, C. briggsae, L. loa, T. spiralis, N.
americanus
ABCC2 Drug resistance in mammalian cells
ABCC3 Organic anion transport in biliary and
intestinal excretion
ABCC4 Organic anion transport; ciliogenesis N. americanus
ABCC5 Multiple drug resistance; nucleotide
export
C. elegans, C. briggsae, B. malayi, L. loa, T.
spiralis, N. americanus
ABCC6 Cellular detoxification; extracellular
matrix deposition
47
Table 2-1 continued
Family Sub family HGNC name Function in humans Present in nematodes
CFTR ABCC7 Chloride anion transport
SUR ABCC8 Potassium channel regulation
ABCC9 Potassium channels in cardiac and skeletal
muscle
ABCC10 Cellular detoxification, lipophilic anion
extrusion
T. spiralis, N. americanus
ABCC11 Transport of lipophilic anions, glucose, bile
salts, organic acids
ABCC12 Transmembrane transport
ABCC13 Pseudogene in humans
FAE ABCD very long chain Fatty Acid Export
ABCD1 Fatty acid transport in peroxisomes L. loa
ABCD2 Fatty acid transport in peroxisomes C. elegans, C. briggsae, N. americanus
ABCD3 Fatty acid transport in peroxisomes C. elegans, C. briggsae, N. americanus
ABCD4 Fatty acid transport in peroxisomes C. elegans, C. briggsae, B. malayi, L. loa, T.
spiralis, N. americanus
EPD WHITE ABCG or
BCRP
Eye pigment precursors and drugs C. elegans
Class 2 systems
RLI ABCE1 RNase L inhibitor in mammals
ART REG ABCF Translation regulation
Class 3 systems
DRA ABCA;
previously
ABC1
ABCA Exclusive to multicellular eukaryotes;
Lipid trafficking
ABCA1 Cholesterol efflux regulatory
protein/cholesterol metabolism
C. elegans, C. briggsae, B. malayi, L. loa, N.
americanus
48
Table 2-1 continued
Family Sub family HGNC name Function in humans Present in nematodes
DRA ABCA ABCA2 Macrophage lipid metabolism and neural
development
ABCA3 Resistance to xenobiotics and engulfment
during programmed cell death
C. elegans, C. briggsae, L. loa, N.
americanus, T. spiralis
ABCA4 Retina photoreceptor specific ABC
transporter that transports N-retinylidene-
PE
T. spiralis
ABCA5 Possibly lysosomal trafficking; Substrate
and function unknown
ABCA6 Macrophage lipid homeostasis
ABCA7 Immune cell lipid homeostasis
ABCA8 Formation and maintenance of myelin;
possibly drug transport
ABCA9 Monocyte differentiation
ABCA10 Lipid transport
ABCA11P Pseudogene in humans
ABCA12 Lipid transport in skin
ABCA13 Lipid transport
ABCA17P Pseudogene in humans
ABCA14 to
ABCA17
Present in rodents only
*HGNC= Human Gene Nomenclature Committee
49
Table 2-2. P-glycoprotein encoding genes in pathogenic nematodes of veterinary importance
Species Protein encoded Gene Reference
Clade V nematodes
Haemonchus contortus Pgp-2 /Pgp-A Hco-Pgp-2 (Xu et al., 1998)
Pgp-1 Hco-Pgp-1 (Le Jambre et al., 1999)
Pgp 3 Hco-Pgp-3 (Issouf et al., 2014; Raza et al., 2016b;
Williamson and Wolstenholme, 2012)
Pgp-4 Hco-Pgp-4 (Williamson and Wolstenholme, 2012)
Pgp-9.1 Hco-Pgp-9.1 (Issouf et al., 2014; Raza et al., 2016b;
Williamson and Wolstenholme, 2012)
Pgp-9.2 Hco-Pgp-9.2 (Issouf et al., 2014; Raza et al., 2016b)
Pgp-9.3 Hco-Pgp-9.3 (Issouf et al., 2014; Raza et al., 2016b)
Pgp-10 Hco-Pgp-10 (Issouf et al., 2014; Raza et al., 2016b;
Williamson and Wolstenholme, 2012)
Pgp-11 Hco-Pgp-11 (Issouf et al., 2014; Raza et al., 2016b;
Williamson and Wolstenholme, 2012)
Pgp-12 Hco-Pgp-12 (Raza et al., 2016b)
Pgp-13 Hco-Pgp-13 (David et al., 2018)
Pgp-14 Hco-Pgp-14 (Issouf et al., 2014; Raza et al., 2016b;
Williamson and Wolstenholme, 2012)
Pgp-16 Hco-Pgp-16 (Issouf et al., 2014; Raza et al., 2016b)
Pgp-17 Hco-Pgp-17 (Laing et al., 2016; Maté et al., 2018)
Oesophagostomum
dentatum
2 P-gps (Laing et al., 2016)
Necator americanus Pgp10 tandem duplication (Laing et al., 2016)
Novel Pgp not present in H. contortus
or C. elegans
(Laing et al., 2016)
Teladorsagia
circumcincta
Pgp-2 Tci-Pgp-2 (Dicker et al., 2011b)
Pgp-3 or 4 Tci-Pgp-3 (Dicker et al., 2011b)
Pgp-9 Tci-Pgp-9 (Dicker et al., 2011b; Turnbull et al., 2018)
Putative Pgp10 Tci-Pgp-10 (Dicker et al., 2011b)
50
Table 2-2 continued
Species Protein encoded Gene Reference
Cooperia oncophora Pgp-1 Con-Pgp-1 (De Graef et al., 2013)
Pgp-2 Con-Pgp-2 (Demeler et al., 2013)
Pgp-3 Con-Pgp-3 (Demeler et al., 2013)
Pgp-9 Con-Pgp-9 (Areskog et al., 2013; Tydén et al., 2014)
Pgp-11 Con-Pgp-11 (De Graef et al., 2013; Tydén et al., 2014)
Pgp-12 Con-Pgp-12 (Demeler et al., 2013; Tydén et al., 2014)
Pgp-16 Con-Pgp-16 (Demeler et al., 2013; Tydén et al., 2014)
Cylicocyclus elongatus Pgp-9 Ceg-Pgp-9 (Kaschny et al., 2015; Peachey et al., 2017)
Other cyathostome spp. (Drogemuller et al., 2004)
Clade III nematodes
Parascaris spp. Pgp-11 Peq-Pgp-11 (Janssen et al., 2013a; Janssen et al., 2015;
Jesudoss Chelladurai and Brewer, 2019)
Pgp-16 Peq-Pgp-16 (Janssen et al., 2013a; Jesudoss Chelladurai
and Brewer, 2019)
Dirofilaria immitis Pgp-3 Dim-Pgp-3 (Bourguinat et al., 2016)
Pgp-10 Dim-Pgp-10 (Bourguinat et al., 2016)
Pgp-11 Dim-Pgp-11 (Bourguinat et al., 2016; Mani et al., 2016)
51
Table 2-3. Summary of gene expression and polymorphism studies in parasitic nematodes of veterinary importance.
Nematode Assay and experimental set-up Significant result Reference
Haemonchus
contortus
Restriction fragment length polymorphism of
Hco-Pgp-2 in adult male worms from IVM or
MOX selected and unselected strains
Polymorphism in P-gp genes as a result of
allelic differences in genes may be associated
with IVM and MOX resistance.
(Blackhall et
al., 1998a)
(a) Northern blotting of RNA from eggs from
IVM selected and unselected strains. (b)
Southern blotting of DNA on adults of both
strains
Increased expression of P-gp mRNA in IVM-
selected strain. Qualitative differences in DNA
restriction patterns between IVM selected strain
and unselected strain.
(Xu et al.,
1998)
(a) Cloning and sequencing of internucleotide
binding domains. (b) Northern blotting of RNA
from eggs, immature adult and adult males from
IVM susceptible strain. (c) Southern blotting of
DNA from adult worms of IVM resistant strain
Heterogeneity in IBDs of Hco-Pgps found. P-gp
mRNA is developmentally regulated and
differentially expressed in life stages. There is
evidence for P-gp involvement in IVM
resistance.
(Sangster et al.,
1999)
PCR followed by RFLP of Hco-Pgp-2 in
cambendazole selected and unselected strains
Difference in allelic frequency between
cambendazole selected and unselected strains
(Blackhall et
al., 2008)
PCR followed by RFLP of Hco-Pgp-9 in IVM
selected and unselected worms
Allelic frequency increase in ML selected
worms compared to unselected
(Le Jambre et
al., 1999)
Southern blotting to analyze restriction
fragment length polymorphism between
susceptible and resistant strains
First study to show that P-gps did not show any
selection in BZ or LEV resistance
(Kwa et al.,
1998)
52
Table 2-3 continued
Nematode Assay and experimental set-up Significant result Reference
Haemonchus
contortus
qPCR to analyze P-gp transcription patterns in an
isolate resistant to benzimidazole, levamisole and
avermectins
Hco-Pgp-2 and -9 levels were significantly
upregulated; Hco-Pgp-1 level was
downregulated in the resistant strain
compared to susceptible lab isolate. No
changes in expression levels of Hco-pgp-3, -
4, -10, -11, -12 or -14 were noted.
(Williamson et
al., 2011)
qPCR to analyze P-gp transcription patterns in
isolate experimentally selected for IVM
resistance over 3 generations
In L3 of the selected strain, no significant
changes in expression level were found in
Hco-Pgp-1, -2, -3, -4, -9, -10, -11, -12 and -
14.
(Williamson
and
Wolstenholme,
2012)
qPCR to analyze P-gp transcription pattern of
Hco-Pgp-2 in resistant isolate treated in vivo with
MLs
Only ivermectin, not abamectin or moxidectin
caused upregulation of P-gp expression in
adults
(Lloberas et al.,
2013)
qPCR to analyze P-gp transcription patterns in
levamisole resistant strains
No consistent changes in P-gp gene
expression seen
(Sarai et al.,
2013)
qPCR to analyze P-gp transcription patterns in H.
contortus larvae exposed to eosinophil granules
Hco-Pgp-3 and -16 were upregulated when
larvae were exposed to eosinophil granules
(Issouf et al.,
2014)
qPCR to analyze P-gp transcription patterns in
IVM resistant adult worms from lambs 14 days
post treatment
IVM dosed at 10x recommended dose did not
modify P-gp homolog expression
(Alvarez et al.,
2015)
53
Table 2-3 continued
Nematode Assay and experimental set-up Significant result Reference
Haemonchus
contortus
qPCR to analyze P-gp transcription patterns in
susceptible worms exposed to monepantel
Transcription of Hco-pgp-11, -12 and -14 genes
were upregulated, with a sustained increase in
Hco-pgp-11 after drug removal
(Raza et al.,
2016a)
qPCR to analyze P-gp transcription patterns in
L3s hatched from eggs derived from sheep feces
of an isolate resistant to benzimidazoles,
closantel, levamisole and ivermectin
L3s from resistant isolate expressed
significantly higher levels of Hco-Pgp-1, -2, -3,
-9.1, -9.2, -9.3, -10, -11, -12, -14 and -16
compared to susceptible isolate
(Raza et al.,
2016b)
qPCR to analyze P-gp transcription patterns in
L3s exposed in vitro to drugs for 3 – 6 hrs.
No changes in the susceptible isolate following
exposure to IVM for 3 hrs. or 6 hrs. Hco-pgp-2,
-9.1, -11, -1, -10 upregulated in resistant isolate
after IVM or LEV exposure for 3 hrs. but not 6
hrs. LEV exposure also upregulated Hco-pgp11
at 6hrs.
(Raza et al.,
2016b)
RNA-seq and qPCR to analyze P-gp gene
transcription in adult males and females after in
vivo exposure to 10x the therapeutic dose
Hco-pgp-3 and -9 were downregulated and
Hco-Pgp-2 was upregulated over 24 hrs after in
vivo IVM exposure. Hco-pgp-1 and -11 levels
did not change over time
(Maté et al.,
2018)
54
Table 2-3 continued
Nematode Assay and experimental set-up Significant result Reference
Haemonchus
contortus
(a) qPCR to analyze basal P-gp transcription
patterns in adult male and female worms. (b)
qPCR to analyze transcription response to low
doses of IVM in vitro in adult males and
females.
Hco-Pgp-2 was the highest basal transcription
level in females while Hco-Pgp-3 and -9.1 had
the highest basal transcription levels in males.
Significant upregulation of Hco-pgp-9.2 in
IVM exposed males and of Hco-pgp-10 and -11
in IVM exposed females
(Kellerová et
al., 2019)
Cooperia
oncophora
SNP analysis of Con-Pgp-2 and Con-Pgp-3 in
various field isolates
32 SNPs found among 6 isolates that caused
increase/ decrease/ complete change in amino
acid variability in Con-Pgp-2, while Con-Pgp-3
had low to no variability and was highly
conserved
(Demeler et al.,
2013)
Reverse transcription-qPCR to analyze
transcription response to selection with IVM in
vivo 10 days post treatment in IVM selected and
unselected populations.
Amplified fragment length polymorphism
(AFLP) to detect gene diversity variations
between pre and post treatment populations.
Con-Pgp-9 expression was higher in female
worms than male worms. No differences in
expression pattern between IVM selected and
unselected groups were observed.
No differences in gene diversity between pre
and post treatment populations were observed.
(Areskog et al.,
2013)
55
Table 2-3 continued
Nematode Assay and experimental set-up Significant result Reference
qPCR to analyze basal P-gp expression after in
vivo and in vitro ML exposure of IVM resistant
and susceptible isolates
Basal levels of P-gp expression in eggs, L3 and
adult was not significantly different between
resistant and susceptible worms. Significant
upregulation of Con-pgp-11 was found in IVM-
resistant adults exposed to IVM. Con-pgp-2 and
-11 were upregulated IVM-resistant adults
exposed to MOX. Con-pgp-12 and Con-pgp-16
were upregulated in IVM-exposed susceptible
and IVM-resistant L3s.
(De Graef et
al., 2013)
qPCR to analyze transcription in adult worms
of a field selected isolate exposed to MLs in
vivo
Con-pgp-9, -11, -12 and -16 basal expression
levels were higher in male and female worms in
field-selected isolate compared to susceptible
isolate. Con-Pgp-16 was upregulated after
treatment with ivermectin in field and lab
selected isolates. No changes were induced by
doramectin.
(Tydén et al.,
2014)
Teladorsagia
circumcincta
qPCR to analyze transcription of Tci-pgp-9 in
susceptible and triple resistant (FBZ, LEV,
IVM) field isolate
Triple resistant field isolate had higher levels of
Tci-pgp-9 than the susceptible isolate at all life
stages (eggs, L1, exsheathed L3, L4, adults)
(Dicker et al.,
2011b)
56
Table 2-3 continued
Nematode Assay and experimental set-up Significant result Reference
Teladorsagia
circumcincta
SNP analysis of partial Tci-pgp-9 in
susceptible and triple resistant (FBZ,
LEV, IVM) field isolate
Partial sequence analysis of the second internuclotide
binding domain of Tci-pgp-9 revealed several non-coding
SNPs between the susceptible and triple resistant isolates
(Dicker et al.,
2011b)
Transcriptomic (EST) analysis
following in vitro exposure of
resistant adult worms to IVM
P-gp genes were poorly represented in the exposed and
unexposed EST datasets
(Dicker et al.,
2011a)
Sequence and SNP analysis of
complete Tci-pgp-9 in IVM, LEV and
BZ isolate
9 non-synonymous SNPs were found in the multidrug
resistant isolate. High intra-worm allelic variability in IBD
region was found. Selection for specific gene variants
observed in resistant strain.
(Turnbull et
al., 2018)
Mixed spp. of
Cyathostomins
qPCR to quantify transcription of
Pgp-9 in mixed population L3s after
exposure to IVM in vitro
Higher levels of Pgp-9 transcription was found in IVM
resistant isolate after IVM exposure compared to the IVM
sensitive isolate
(Peachey et al.,
2017)
Parascaris
spp.
qPCR to quantify expression of Peq-
pgp-11 and -16 in eggs, pre-adults
and adults of resistant and susceptible
populations.
SNP analysis of Peq-Pgp-11 in
resistant and susceptible populations
No significant differences P-gp expression were found in
embryonated eggs derived from ML resistant and
susceptible populations. Peq-pgp-11 was overexpressed in
preadults resistant to MLs. IVM incubation of adults did
not affect Peq-pgp-11 and -16 expression. Three SNPs
were identified in Peq-Pgp-11 and were associated with
ML resistance.
(Janssen et al.,
2013a)
57
Table 2-3 continued
Nematode Assay and experimental set-up Significant result Reference
Dirofilaria
immitis
SNP analysis of Dim-Pgp-11 Partial sequence analysis of Dim-Pgp-11 revealed 2 SNPs
(one in the coding region in the IBD and one in non-coding
region) between putative IVM resistant and susceptible
isolates. Diplotype analysis revealed significant high
presence of GG-GG in resistant isolates
(Bourguinat et
al., 2011b)
qPCR to quantify expression of Dim-
Pgp-10, Dim-Pgp-11 in male and
female adults treated in vitro with
IVM, doxycycline or both
In IVM treated females, both genes were downregulated,
but were upregulated when treated with DOX alone.
Combination therapy caused upregulation of Dim-Pgp-10.
In IVM treated males, both genes were upregulated in
IVM treated and combination therapy but not when treated
with DOX alone.
(Lucchetti et
al., 2019)
58
Table 2-4. Drug interaction studies of nematode P-gps in heterologous systems.
Model P-gp studied Assay used to study Inhibitors used Significant results Reference
Pig epithelial
kidney cell line -
LLC-PK1
Hco-Pgp-2 Rhodamine 123 and
Calcein-AM accumulation
in a ligand competition
assay
IVM, ABA,
MOX,
Valspodar
IVM and abamectin but not MOX
had inhibitory effect on R123
efflux similar to VSP. All three
MLs had an inhibitory effect on
Calcein-AM efflux
(Godoy et
al., 2015b)
Hco-Pgp-9.1 Rhodamine 123
accumulation in a ligand
competition assay
IVM, ABA,
MOX, VSP
IVM and abamectin but not MOX
had inhibitory effect on R123
efflux, similar to VSP
(Godoy et
al., 2016)
Hco-Pgp-16 Rhodamine 123
accumulation in a ligand
competition assay
IVM, ABA,
MOX, VSP
IVM and abamectin and high
concentrations of moxidectin had
inhibitory effect on R123 efflux,
similar to VSP
(Godoy et
al., 2015a)
Dim-Pgp-11 Rhodamine 123 and
Hoechst 33342
accumulation in a ligand
competition
IVM, SEL,
MOX, MBO,
VSP
IVM and selamectin but not MOX
had inhibitory effect on R123 and
H33342 efflux
(Mani et al.,
2016)
Pichia pastoris Hco-Pgp-13 Vanadate sensitive
ATPase activity
IVM,
Actinomycin D
Inhibition by IVM and stimulation
of ATPase activity by ACD in a
concentration depended biphasic
manner
(David et
al., 2018)
59
Table 2-4 continued
Model P-gp studied Assay used to study Inhibitors used Significant results Reference
Saccharomyces
cerevisiae lacking
seven endogenous
transporters
Pgp-9 from
Cylicocyclus
elongatus
Direct Growth assay Actinomycin D,
Daunorubicin,
Valinomycin,
Ketaconazole,
Thiabendazole
Ceg-Pgp-9 decreased yeast
susceptibility to Ket. EC50
was higher for actinomycin,
daunorubicin and
valinomycin. No differences
were found for TBZ
(Kaschny et
al., 2015)
Pgp-9 from
Cylicocyclus
elongatus
Indirect growth assay;
competitive killing assay
in the presence of
Ketoconazole
IVM, EPM, MOX,
SEL, DORA
Fungicidal effect of Ket was
significantly increased when
EPM, IVM and MOX, but not
SEL or DORA are added
Ceg-Pgp-9
Antibody binding in the
presence of drugs
IVM, MOX, SEL,
Daunorubicin
IVM, MOX, daunorubicin
increased binding of UIC2 to
yeast cells. Selamectin had no
effect.
C. elegans
deficient in Pgp11
Pgp-11
Parascaris
spp.
Thrashing assay IVM EC50 for IVM in transfected
strain of C. elegans was higher
than control strain
(Janssen et
al., 2015)
60
Table 2-5. In vitro P-gp-drug interaction assays with whole organisms.
Organism Stage used Assay Results/comments Reference
Haemonchus
contortus
Eggs Rhodamine 123 accumulation in a
ligand competition assay using flow
cytometry
Higher levels of accumulation of R123
when verapamil was added to IVM
resistant strain eggs
(Kerboeuf et
al., 1999)
Eggs Rhodamine 123 accumulation in a
ligand competition assay
MLs except ivermectin stimulated P-gps (Kerboeuf and
Guégnard,
2011)
Eggs Rhodamine 123 accumulation after
exposure to eosinophil granules
Eosinophil granules caused a dose
dependent increase in R123 accumulation
(Issouf et al.,
2014)
Eggs and
L3s
Larval migration inhibition assay
with IVM and P-gp inhbitors.
Larval development assay
LMA: Third generation P-gp inhibitors
increased larval sensitivity to ivermectin.
Synergism seen between tariquidar and
IVM in the resistant strain in the LMA.
Synergism was also seen between
zosuquidar and IVM, and between
verapamil and IVM in larval development
assays.
(Raza et al.,
2015)
L3s Rhodamine 123 efflux
spectrophotometrically measured in
supernatant following ligand
competition assay
In vitro exposure to high doses of
monepantel caused increased efflux of
Rhodamine 123
(Raza et al.,
2016a)
61
Table 2-5 continued
Organism Stage used Assay Results/comments Reference
Haemonchus
contortus
L3s Larval migration inhibition assay with
IVM or LEV dilutions after pre-
exposure to monepantel
Dose response curves obtained. In vitro
pre-exposure to high doses of monepantel
increased larval migration at high
concentrations of IVM but not LEV
(Raza et al.,
2016a)
L3s Rhodamine 123 efflux
spectrophotometrically measured in
supernatant following ligand
competition assay. Larval migration
inhibition assay in the presence of
different concentrations of drugs with
in vitro pre-exposure to IVM or LEV
In vitro exposure to IVM and LEV
increased efflux of Rhodamine 123.
Dose response curves obtained. In vitro
pre-exposure to high concentrations of
IVM increased larval motility through a
filter mesh system.
(Raza et al.,
2016b)
Eggs and
L3s
Larval development assay with IVM
and P-gp inhibitor. Larval migration
inhibition assay in the presence of
different concentrations of IVM and
P-gp inhibitor
Dose response curves obtained. In LDA,
crizotinib decreased IVM IC50 in both
susceptible and resistant strains. In LMIA,
crizotinib caused a 2.6 fold decrease in
IVM IC50 in the resistant but not
susceptible strain.
(Raza et al.,
2016c)
Eggs Larval development assay with ML
resistant strain against IVM, MOX,
EPR
Dose response curves obtained with MOX
having 29 fold and 280 fold lower EC50
than IVM and EPR
(Ménez et al.,
2016)
62
Table 2-5 continued
Organism Stage used Assay Results/comments Reference
Adults HPLC analysis of flubendazole in
worms incubated verapamil
Flubendazole accumulation was not
affected by Ver in any strains
(Bártíková et
al., 2012)
Haemonchus
placei
L3s Larval migration inhibition assay in
the presence of different
concentrations of IVM with fixed
concentrations of P-gp modulators
Increased IVM efficacy with a reduction in
EC50 was seen with cyclosporine A,
dexamethasone, verapamil, vinblastine,
ceftriaxone, quercetin, trifluperazine
(Heckler et
al., 2014)
T. circumcinta
and H. contortus
L1s Larval feeding inhibition by IVM in
the presence and absence of P-gp
interfering agents with FITC-E. coli
Resistant worms required more IVM than
sensitive worms to arrest feeding behavior.
P-gp inhibitors decreased larval feeding.
(Bartley et
al., 2009)
C. oncophora Eggs (Eggs
and larvae
counted in
output)
Larval development assay with IVM
VPL
Dose response curves obtained. Resistance
worms had higher EC50 than susceptible
worms in the absence of VPL. In the
presence of VPL, resistance worms had
lower EC50s than susceptible strain.
(Demeler et
al., 2013)
Sheathed
L3s
Larval migration inhibition assay
(LMIA) with IVM VPL
Dose response curves obtained. IVM
resistant isolates had higher EC50 in the
presence of IVM only. VPL addition
lowered the EC50 below that of the
susceptible isolate.
(Demeler et
al., 2013)
63
Table 2-5 continued
Organism Stage used Assay Results/comments Reference
C. oncophora and
Ostertagia
ostertagi
Eggs
L3s
Larval development assay
Larval migration inhibition
Dose response curves obtained. Verapamil
and piperonyl butoxide caused a decrease
in EC50 of ivermectin
In LMIA, verapamil increases
susceptibility of ivermectin
(AlGusbi et
al., 2014)
Mixed population
of Cyathostomins
Eggs and
L3s
Larval development assay
Larval migration inhibition test
Dose response curves obtained. P-gp
inhibitors - Ketaconzole and Pluronic 85
caused a higher reduction in EC50 in
susceptible population than in the resistant
population in LDA.
Ketaconazole and ivermectin-aglycone
caused a decrease in EC50 in the resistant
population only in LMIT
(Peachey et
al., 2017)
Heligmosomoides
bakeri
Eggs and
L3
Rhodamine 123 accumulation
measured as % of R123 positive eggs
following a ligand competition assay
Verapamil co-incubated with
phytochemicals had an additive lethal
effect on eggs and larvae
(Doligalska
et al., 2011)
64
Table 2-5 continued
Organism Stage used Assay Results/comments Reference
Brugia
malayi
Male and
female
adults
Microfilaria
Motility measured as no. of
movements per minute in adults with
IVM verapamil, cyclosporine A,
vinblastine, daunorubicin
Motility was significantly inhibited in
males and females when P-gp inhibitors
were co-administered with ivermectin.
Motility of microfilariae were lower when
co-incubated with IVM + verapamil,
quinidine, vincristine, vinblastine,
colchicine, actinomycin d, daunorubicin,
doxorubicin, etoposide, rhodamine and
forskolin over a period of 7 days
(Tompkins et al.,
2011)
Male and
female
adults
Microfilaria
Motility measured as no. of
movements per minute in adults with
MOX Verapamil or daunorubicin
Mf treated with Mox P-gp
inhibitors
Motility was significantly inhibited in
females only but not males when inhibitors
were co-incubated .
Motility of microfilariae were lower when
co-incubated with MOX + verapamil,
vinblastine, colchicine, etoposide,
forskolin.
(Stitt et al., 2011)
65
Table 2-6. Localization studies in nematodes of veterinary importance.
Parasite Life stage Assay and reagent Results/comments Reference
Haemonchus
contortus
In situ hybridization using a labelled
cDNA probe
P-gps were mainly expressed in the intestine
and lateral cords. no differences between
ML-selected and susceptible strains
(Smith and
Prichard,
2002)
Eggs Flow cytometry with mammalian P-gp
antibodies UIC2 and C219
P-gps detected on eggshells (Kerboeuf et
al., 2003)
Eggs, L1s.
L2s, L3s,
adults
Indirect immunofluorescence with
mammalian P-gp antibody UIC2
P-gps expressed in external layers of the
eggshell, sheath of L3 larvae, cuticles of
larval stages, intestinal cells of male worms,
intestinal cells of L1 and L2 larvae
(Riou et al.,
2005)
Eggs Flow cytometry with mammalian P-gp
antibody UIC2
P-gps colocalized with raft-like cholesterol-
enriched microdomains on the egg shells
(Riou et al.,
2010)
Cooperia
oncophora
Eggs Flow cytometry with mammalian P-gp
antibody UIC2
Higher binding seen with resistant eggs than
with susceptible eggs
(Demeler et
al., 2013)
Parascaris
spp.
Adults Dissection of worm and qPCR for P-
gp expression
Peq-pgp-11 expression was highest in the
intestines in both males and females. Peq-
pgp-16 expression was highest in the body
wall of males.
(Janssen et al.,
2013a)
66
Table 2-7. In vivo studies of effect on P-gps when MLs are co-administrated with P-gp inhibitors.
Parasite Host animal
used
P-gp inhibitor used Results Reference
Haemonchus contortus
Jird Verapamil with IVM or
MOX
Efficacy of IVM determined by worm count at
necropsy increased from 80% (without Ver) to
93% (with Ver) and MOX from 70% (without
Ver) to 96% (with Ver)
(Xu et al.,
1998)
Sheep Loperamide with IVM FECRT improved from 78.6% with IVM alone to
96% with IVM+LPM. Worm counts improved
from 0% efficacy with IVM alone to 72.5% with
IVM+LPM
(Lifschitz et
al., 2010a)
Sheep IVM + Ketaconazole
IVM + Pluronic 85
Worm burden in sheep given IVM with P-gp
inhibitor decreased by 16% and 51%
(Bartley et
al., 2012)
Trichostrongylus axei Sheep Loperamide with IVM Worm counts improved from 98.6% efficacy with
IVM alone to 99.6% with IVM+LPM
(Lifschitz et
al., 2010a)
Trichostrongylus
colubriformis
Sheep Loperamide with IVM Worm counts improved from 77.9% efficacy with
IVM alone to 96.3% with IVM+LPM
(Lifschitz et
al., 2010a)
67
Table 2-7 continued
Parasite Host animal
used
P-gp inhibitor used Results Reference
Nematodirus spp. Sheep Loperamide with IVM Worm counts improved from 85.5% efficacy with
IVM alone to 93% with IVM+LPM
(Lifschitz et
al., 2010a)
Mixed infection with
resistant Ostertagia,
Trichostrongylus,
Cooperia,
Haemonchus
Cattle Loperamide with IVM
or MOX
FECRT improved from 23.5% with IVM alone to
50% with IVM+LPM. FECRT improved from
69% with MOX alone to 87.1% with MOX+LPM.
(Lifschitz et
al., 2010b)
68
CHAPTER 3. EFFECTS OF IN VITRO AND IN VIVO EXPOSURE TO
MACROCYCLIC LACTONES ON THE EXPRESSION PATTERNS OF P-
GLYCOPROTEINS IN TOXOCARA CANIS LARVAE
Jeba R J Jesudoss Chelladurai, Alan Robertson, Matt T Brewer
Modified from a manuscript to be submitted
Abstract
Toxocara canis has a complex lifecycle that includes somatic larval stages in the
tissues of adult dogs, paratenic hosts and humans. These larvae are tolerant to therapeutic doses
of macrocyclic lactones. We investigated hatched T. canis L3s and observed that ivermectin did
not halt motility of larvae. However, a combination of ivermectin and the P-glycoprotein
inhibitor verapamil decreased the area and wavelength during swimming motility of larvae.
Whole organism assays revealed total P-glycoprotein efflux activity could be mitigated by drugs
known to inhibit these proteins in mammals, but in an unusual rank order of potency. Analysis of
the T. canis draft genome resulted in the identification of 13 annotated P-gp genes which enabled
naming of genes and isoforms. Quantitative PCR was used to measure P-glycoprotein mRNA
expression in adult worms, hatched larvae, and somatic larvae derived from experimentally
infected mice. 10 of the predicted genes were expressed in adults and hatched larvae, and 6 were
expressed in visceral larvae. There were no differences in expression patterns between adults and
hatched larvae. Tca-Pgp-10 was significantly upregulated in somatic larvae from mice treated
with moxidectin. Further studies are needed to understand the role of the different ATP binding
cassette transporters leading to macrocyclic lactone tolerance in T. canis.
1. Introduction
Toxocara canis is a cosmopolitan zoonotic nematode of dogs. T. canis larvae are
transplacentally transferred from bitches to neonatal puppies and after a complex hepato-
pulmonary-tracheal migration develop to adult worms in the small intestines. In older puppies
69
and adult dogs, larvae that hatch following the ingestion of infective eggs migrate to the skeletal
muscles, kidneys, liver and heart and persist for years as somatic larvae (Schnieder et al., 2011).
Somatic larvae in the tissues of bitches are reactivated during pregnancy and are a reservoir of
infection for up to three litters following a single infection (Soulsby, 1983). Prenatal
transmission of reactivated larvae has been stopped in infections using a few experimental drug
regimens (Burke and Roberson, 1983; Krämer et al., 2006; Payne and Ridley, 1999). However,
somatic non-reactivated larvae are not killed by macrocyclic lactones in dogs. Somatic larvae in
paratenic hosts such as mice are not amenable to death by ivermectin (Carrillo and Barriga,
1987; Fok and Kassai, 1998). Larval migration to somatic musculature or brain allowed
survivability and protection against drugs (Abo-Shehada and Herbert, 1984). These studies point
to an unknown mechanism of tolerance to the macrocyclic lactones exhibited by somatic T. canis
larvae to the macrocyclic lactones.
Ivermectin (IVM) is multimodal in its mechanism and in the effects that it produces on
nematodes. Ivermectin acts on glutamate-gated chloride channels, causing hyperpolarization of
muscles resulting in pharyngeal muscle paralysis, ES pore-associated muscle paralysis, and
inhibition of larval motility (Geary et al., 1993; Gill et al., 1991; Moreno et al., 2010). It
potentiates the adherence of mononuclear cells and activated neutrophils to nematode cuticle
(Vatta et al., 2014). IVM and other macrocyclic lactones are also substrates of P-glycoproteins
and multidrug resistance proteins (MRPs) that efflux xenobiotics from cells (Lespine et al., 2006;
Lespine et al., 2007).
P-glycoproteins are encoded by genes from the ATP-binding cassette (ABC) class B1
family. Typically, one or two isoforms of the ABCB1 gene are expressed in vertebrates. In
contrast, nematodes commonly express multiple ABCB1 genes. Gene identification, assessment
70
of expression and function have been carried out for a few nematode P-gps (Godoy et al.,
2015b). The role of P-glycoproteins in anthelmintic resistance in ruminant gastrointestinal
nematodes and filarid nematodes have been widely studied (Bourguinat et al., 2016; Lespine et
al., 2012). Several in vitro studies have demonstrated that P-gp substrates and blockers can
compete for efflux at the binding site and potentiate the others’ effects (Kaschny et al., 2015;
Raza et al., 2016c). Initial preliminary observations of Toxocara canis larval motility in the
presence of P-gp substrate – ivermectin, and P-gp competitive inhibitor – verapamil led to the
investigation of P-gps. However, the identity, expression and function of genes encoding P-
glycoproteins in T. canis are unknown.
Based on our observations on larval motility in the face of ML treatment, we
hypothesized that P-glycoproteins may play a role in larval tolerance to MLs, since somatic
larvae of T. canis are present at sites where macrocyclic lactones are bioavailable. Additionally,
we hypothesized that known inhibitors may affect function of P-gp in T. canis. To those ends,
the aim of this study was to identify P-gp genes in T. canis by bioinformatically mining the draft
genome and to evaluate constitutive P-gp gene expression in adults and larvae. We also sought to
detect differences in P-gp expression in larvae exposed to macrocyclic lactones in vitro and in
vivo.
2. Methods
2.1 Ethics statement
All experiments were conducted in accordance with the recommendations of the NIH
Guide for the care and use of laboratory animals. The studies were approved by the Iowa State
University Institutional Animal Care and Use Committee.
71
2.2 Parasites
Toxocara canis were obtained from dogs that expelled adult worms after treatment with
anthelmintics. Worms were washed in tap water and eggs were isolated from the uteri of female
adult worms by careful dissection. Eggs were washed and incubated in 1x phosphate buffered
saline (PBS) at room temperature for at least 2 weeks to allow development of larvae to the third
larval (L3) stage. L3 larvae were isolated by a chemical hatching protocol (Ponce-Macotela et
al., 2011).
2.3 In vitro motility assays
Stock solutions of 10mM ivermectin and verapamil were prepared in 100%
DMSO and diluted in 1x PBS to obtain working dilutions of drugs with 0.1% final DMSO
concentration. Hatched T. canis L3 larvae were individually transferred to 24 well plates in
RPMI1640. The drugs were added to the wells and the final volume adjusted to 400L using
RPMI. Videos of larval motility were recorded using the WormLab software (MBF Bioscience,
Williston, VT) using the default settings. All larvae were tracked for 2 minutes and videos
analysed using the default settings. Motility parameters including wavelength, amplitude, linear
speed and peristaltic speed, linear and peristaltic track length and mean area occupied by the
larvae were obtained as outputs. One-way ANOVA with Tukey’s multiple comparison test was
used to compare each motility parameter of the larvae using GraphPad Prism version 8 (San
Diego, CA).
2.4 In vitro larval dye efflux assay
The larval efflux assay was modified from Raza et al. (2016b). Hatched larvae were
washed in 1x Dulbecco’s PBS and exposed to 10 M ivermectin or P-gp inhibitors (cyclosporine
A, loperamide, reserpine, verapamil or tariquidar) for 1 hr at 37°C with horizontal shaking at 200
72
rpm. The larvae were washed in 1x D-PBS and then incubated in the fluorescent P-gp substrate
15M Hoechst 33342, a fluorescent P-gp substrate for 10 min at 37°C. Images obtained by
fluorescence microscopy were analyzed using the fluorescence area module in Halo (Indica
Labs, Advanced Cell Diagnostics, Hayward, CA). Percentage of Hoechst staining in larvae was
calculated using the formula: (fluorescently stained area/ total area of larva) x 100. Percentage of
fluorescence was compared to larvae that were not exposed to drugs. One way ANOVA with
Tukey’s multiple comparison test was used to analyze percentage of staining in GraphPad Prism
version 8 (San Diego, CA).
2.5 Genomic survey and Phylogenetic analysis
The 317Mb draft genome of Toxocara canis (Zhu et al., 2015) on NCBI (Toxocara canis
isolate PN_DK_2014, whole genome shotgun sequencing project, GenBank Accession
JPKZ00000000) was surveyed and annotated P-gp genes obtained. These were annotated as
either pgp-1 or pgp-3. Nucleotide sequences of P-gp genes of Toxocara canis retrieved from
GenBank were used to design custom primers to amplify partial sequences from cDNA. Protein
sequences translated from nucleotide sequences of P-gp genes described in other nematodes such
as Haemonchus contortus, Cooperia oncophora, Teladorsagia circumcinta, Cylicocyclus spp.,
Parascaris spp., Dirofilaria immitis, and C. elegans were obtained from GenBank and aligned
with the MAFFT algorithm (Katoh and Standley, 2013). Substitution model was selected using
the SMS tool with Bayesian Information Criteria (Lefort et al., 2017). The model with lowest BIC
value was LG+F+I+G with 4 parameter gamma distribution (Le and Gascuel, 2008). Maximum
likelihood phylogenetic analyses performed using PhyML3.0 (Guindon et al., 2010). The tree
was visualized using Mega X (Kumar et al., 2018).
73
2.6 qPCR in adults Toxocara canis
Expression levels of P-gp genes was determined using qPCR in adult male and female
worms separately and results pooled. qPCR primers were designed to amplify the genes (Table
3-S1) and specificity was confirmed using BLAST in silico. RNA extracted from pools of adult
male and female worms was extracted with Trizol reagent (Ambion by Life Technologies,
Carlsbad, CA) followed by purification using the Direct-zol RNA Miniprep kit (Zymo Research)
according to the manufacturer's instructions. cDNA was synthesized from 50 ng of total RNA in
a 20L volume using the iScript cDNA synthesis kit (Bio-rad), using random oligonucleotides.
qPCR reactions were individually optimized using diluted cDNA synthesized from adult
Toxocara canis worms. Specificity was determined using melt curve analysis and sequencing.
18S was used as a reference gene (Durant et al., 2012). qPCR was carried out in a volume of 20
L with 2 L of diluted cDNA, 1x of SSoAdvanced Universal SYBR Green Master Mix (Bio-
rad) and 0.2 - 0.5 M of diluted primers. PCR efficiency was determined for each primer pair
using LinRegPCR (Ramakers et al., 2003) and change in gene expression was calculated using
the efficiency corrected Ct method based on single samples (Pfaffl, 2004). One way ANOVA
with Tukey’s multiple comparison test was used to analyze fold changes in expression using
GraphPad Prism version 8 (San Diego, CA).
2.7 qPCR following in vitro drug exposure
Groups of 500 hatched L3 larvae were washed in 1x Dulbecco’s PBS and exposed to 10
M Ivermectin (MP Biomedicals, Solon, OH) or no drugs (control) in RPMI 1640 (Gibco, Grand
Island, NY) at 37°C with horizontal shaking at 200 rpm for 24 hours. Drug exposure assays were
carried out separately with three different isolates of Toxocara canis eggs. Immediately after
drug exposure, larvae were washed in RPMI1640. Sterile 0.1mm, 0.5mm and 2mm Zymo
74
bashing beads (Zymo research, Irvine, CA) were used to homogenize larvae in Trizol reagent
and total RNA was extracted following manufacturer’s protocol. RNA concentration and purity
were measured using a Nanodrop spectrophotometer and stored at -80°C. cDNA was synthesized
from 50 ng of total RNA in a 20L volume using the iScript cDNA synthesis kit (Bio-rad), using
random oligonucleotides and stored at -20C till use. To determine differences between drug
exposed and unexposed larvae, qPCR was carried out in a volume of 20 L with 2 L of
undiluted cDNA, 1x of SSoAdvanced Universal SYBR Green Master Mix and 0.2 - 0.5 M of
diluted primers. PCR efficiency was determined for each primer pair using LinRegPCR
(Ramakers et al., 2003). Fold changes in gene expression were calculated using the efficiency
corrected Ct method based on single samples (Pfaffl, 2004). One way ANOVA with Tukey’s
multiple comparison test was used to analyze fold changes in expression using GraphPad Prism
version 8 (San Diego, CA).
2.8 qPCR following in vivo drug exposure in mice
Male and female C3H/HEJ mice were obtained from Jackson Labs and housed in
ventilated rack cage system with standard enrichment. After acclimatization, mice were gavaged
with 5000 larvated Toxocara canis eggs. Mice were injected subcutaneously with ivermectin
(200 g/kg), moxidectin (500 g/kg), or sham (saline) on day 7 PI and euthanized on day 10 PI.
Liver, lungs, brain were collected from each mouse and frozen at -80°C for RNA extraction.
qPCR following cDNA synthesis was performed using the methods outlined above for T. canis
adult and larvae. One way ANOVA with Tukey’s multiple comparison test was used to analyze
fold changes in expression using GraphPad Prism version 8 (San Diego, CA).
75
3. Results
3.1 In vitro motility assay
T. canis larvae exhibit sinusoidal thrashing motility in liquid media without
progressive or forward movement. The WormLab software tracked swimming larvae using
anterior, middle and posterior markers. Larvae treated with a combination of ivermectin and
verapamil had a lower mean area than larvae in any other treatment group (p<0.05, Figure 3-1).
Larvae treated with the combination also had lower wavelength than verapamil alone(p<0.05).
Speed of larvae was reduced following treatment with the combination, although this change was
not statistically different (P=0.0942).
3.2 In vitro efflux of P-gp is inhibited
Total P-gp activity and inhibition was measured by a Hoechst 33342 efflux assay.
Fluorescent H33342 is a substrate of P-gps which efflux it from the plasma membrane. It does
not fluoresce when not associated with membranes (Shapiro et al., 1997), allowing fluorescence
microscopy of larvae without fluorescent background signal on a slide. Larvae were co-
incubated with and without P-gp inhibitors, photographed, and positive H33342 staining was
quantitated using computer software (Figure 3-2). Untreated larvae had constitutive P-gp efflux
activity, indicated by absence of H33342 staining. In contrast, larvae treated with P-gp inhibitors
had low P-gp activity leading to retention of H33342. Interestingly, reserpine, verapamil, and
tariquidar caused a significant decrease in P-gp activity (p<0.05, Figure 3-3). On the other hand,
P-gp inhibition by ivermectin, cyclosporine A, and loperamide were modest and not statistically
different (Figure 3-3).
3.3 Thirteen P-gp genes identified in T .canis genome
The draft genome of Toxocara canis on NCBI GenBank nucleotide database was initially
used for primer design. Thirteen P-gp protein sequences with length > 450 amino acids annotated
76
in the T. canis genome were identified in the analysis. Conceptually translated amino acid
sequences from P-gp genes annotated in the T. canis genome, annotated in genomes of other
nematodes obtained from GenBank, and cloned sequences obtained in this study were used in the
Maximum Likelihood phylogenetic analyses (Figure 3-4). Names for the 13 P-gp genes are given
in Table 3-1. Based on the phylogenetic analysis, several of these were determined to be
isoforms. Isoforms have been observed in other nematode P-gps including Haemonchus
contortus Pgp-9 (Godoy et al., 2016). In our analysis, three annotated isoforms of Pgp-11, two
isoforms each of Pgp-9, Pgp-13 and Pgp-16 were found. One P-gp (KHN86334) has an
ambiguous position with low statistical support in the tree and was named (Tca-Pgp-16.3/3.2).
PCR investigation resulted in six partial and one full length Pgp cloned from mRNA. Thus, these
seven annotated P-gp genes are not pseudogenes.
3.4 Ten P-gp genes are expressed in adults
Constitutive expression levels of P-gp genes were determined using qPCR in
adult T. canis nematodes and infective larvae hatched from eggs. Ct values from 10 P-gp genes
and isoforms were compared between adults and larvae (Figure 3-5). Variability in expression
levels were seen between biological replicates with no significant differences between the genes.
Specific primer sets could not be designed/optimized for Tca-Pgp-3, Tca-Pgp-11.3 and Tca-Pgp-
13.2 because of very high sequence cross-identity and the presence of multiple peaks in melt
curve analyses of products, reinforcing our finding that isoforms of the genes exist as predicted
in the phylogenetic analysis.
3.5 In vitro effects of IVM on P-gp expression in larvae
Expression profile of 10 P-gp genes and isoforms in T. canis larvae was determined
before and after treatment with 10 M ivermectin for 24 hrs (Figure 3-6). Variability in
expression levels were seen between biological replicates with no differences between the genes.
77
3.6 In vivo effects of MLs on P-gp expression in somatic larvae
Expression profile of P-gp genes was determined in somatic T. canis larvae derived from
infected mice. P-gp expression was detected in larvae from mice treated with ivermectin or
moxidectin (Figure 3-7). There were no differences among genes in the ivermectin-treated group.
Tca-Pgp-10 was significantly upregulated in larvae from moxidectin-treated mice. Tca-Pgp-10
was also significantly upregulated compared to Tca-Pgp-16.1. Several P-gp genes and isoforms
could not be amplified from somatic larvae due to poor RNA quality, RNA degradation and
overabundance of host RNA.
4. Discussion
Bitches harboring somatic T. canis larvae are reservoirs for infection of puppies
which occurs primarily by a transplacental route. Arrested somatic larvae evade drug-mediated
killing until they are reactivated, and the reason for this drug-resistant phenotype has not been
elucidated. Our hypothesis is that nematode P-glycoproteins contribute to evasion of drug-
mediated killing of somatic larvae. In this study we described the repertoire of P-gp genes,
phenotypic effects of P-gp inhibition, and induction of P-gp mRNA expression. In addition,
experiments with hatched larvae revealed larval expulsion of the P-gp substrate H33342 and this
activity could be blocked by some but not all P-gp inhibitors tested.
Motility has been used to determine the activity of anthelmintics against different
stages of nematodes (Blanchard et al., 2018; Kotze et al., 2004; Storey et al., 2014).
Interestingly, we observed that ivermectin treatment did not alter motility of T. canis larvae
(Figure 3-1). Combination of ivermectin and the P-gp inhibitor verapamil resulted only in
modest changes in measures of motility. Our results are largely in agreement with previous
studies of nematodes in which exposure to physiological levels of macrocyclic lactones fails to
78
inhibit larval motility, thus supporting the hypothesis that ivermectin exerts an effect beyond
paralysis (Vatta et al., 2014).
An important finding of this study was that T. canis larvae constitutively expel
H33342, indicating the presence of functional P-gps. The P-gp inhibitors tariquidar, verapamil,
and reserpine caused significant inhibition of H33342 efflux. Interestingly, numerous other
known inhibitors failed to inhibit P-gp activity in T. canis larvae. Although our assays represent
the net effect of inhibition on total larval P-gp activity, we demonstrated that T. canis P-gp
cannot be inhibited by all P-gp inhibitors unlike mammalian P-gps. This supports further
investigation of these putative drug targets.
Analysis of the T. canis draft genome led to an estimate of 530 genes that were likely to
be transporters (out of the 18,596 protein coding genes), of which 10.8% were predicted to be
ABC transporters by computer algorithms (Zhu et al., 2015). Of all the genes annotated as P-gp
genes in the genome of T. canis, our phylogenetic analysis suggests that only 13 genes likely
exist, of which several are isoforms. >1000 base pair fragments of seven of these genes could be
cloned from mRNA, suggesting that they are functional genes. Gene naming conventions based
on C. elegans genes as suggested by Beech et al. (2010) were used except where cases of
ambiguity existed such as Tca-Pgp-16.3/3.2. Uncertainties in the assigning of genes can be
resolved as genome assemblies of organisms improve and as paralogs are studied in closely
related nematodes.
We demonstrated that at least 10 of the 13 named genes/isoforms are expressed in T.
canis adults and larvae. While comparisons of adults and hatched infective larvae did not yield
significant differences, constitutive expression of P-gps are likely to have functional significance
in both stages. In larvae exposed to ivermectin in vitro for 24 hours, significant changes in P-gp
79
gene expression did not occur. These results have to be cautiously interpreted as biological
compensation may occur by which a single P-gp gene may be upregulated to compensate for the
downregulation of another as has been shown in H. contortus (Maté et al., 2018). Additionally,
larval gene regulatory changes may occur earlier than 24 hours. Further research is essential to
map fine scale temporal gene expression changes that result from drug exposure, with an assay
that provides greater molecular resolution such as RNA-seq.
Finally, P-gp gene expression was determined in T. canis somatic larvae derived
from liver granulomas of experimentally infected mice. Mice are natural paratenic hosts for T.
canis and are a tractable model for study of somatic larval migrans of humans. Ivermectin at
various doses and routes is unable to eliminate larvae in mice (Fok and Kassai, 1998). Several
genes in larvae from ivermectin and moxidectin treated animals had differential expression, with
only one gene – Tca-Pgp-10 having a significant increase. Gene expression in larvae derived
from other organs in the paratenic host is essential to determine if larvae in relatively immuno-
privileged sites exhibit the similar gene changes.
This study revealed significant findings regarding P-gps of the zoonotic nematode
Toxocara canis. First, we curated and named putative P-gp genes present in the genome which
was supported by phylogenetic analysis and molecular cloning. We then demonstrated
phenotypic evidence that T. canis larvae exhibit physiologic responses to P-gp inhibition with a
unique pharmacological profile. In addition, we detected the expression of numerous P-gp genes
in adult worms, larvae hatched in vitro, and somatic larvae recovered from mice. While a few P-
gps were induced by macrocyclic lactone treatment, many were constitutively expressed in both
larvae and adults. In conclusion, T. canis expresses a large repertoire of P-gps, some of which
80
appear unresponsive to mammalian P-gp inhibitors. Taken together, our findings support further
study of this protein family in the search for new nematode-specific drug targets.
5. References
Abo-Shehada, M.N., Herbert, I.V., 1984. Anthelmintic effect of levamisole, ivermectin,
albendazole and fenbendazole on larval Toxocara canis infection in mice. Res Vet Sci 36,
87-91.
Beech, R.N., Wolstenholme, A.J., Neveu, C., Dent, J.A., 2010. Nematode parasite genes: what's
in a name? Trends Parasitol 26, 334-340.
Blanchard, A., Guégnard, F., Charvet, C.L., Crisford, A., Courtot, E., Sauvé, C., Harmache, A.,
Duguet, T., O'Connor, V., Castagnone-Sereno, P., Reaves, B., Wolstenholme, A.J.,
Beech, R.N., Holden-Dye, L., Neveu, C., 2018. Deciphering the molecular determinants
of cholinergic anthelmintic sensitivity in nematodes: When novel functional validation
approaches highlight major differences between the model Caenorhabditis elegans and
parasitic species. PLoS Pathog 14, e1006996.
Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter genes in
Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.
Burke, T.M., Roberson, E.L., 1983. Fenbendazole treatment of pregnant bitches to reduce
prenatal and lactogenic infections of Toxocara canis and Ancylostoma caninum in pups. J
Am Vet Med Assoc 183, 987-990.
Carrillo, M., Barriga, O.O., 1987. Anthelmintic effect of levamisole hydrochloride or ivermectin
on tissue toxocariasis of mice. Am J Vet Res 48, 281-283.
Durant, J.F., Irenge, L.M., Fogt-Wyrwas, R., Dumont, C., Doucet, J.P., Mignon, B., Losson, B.,
Gala, J.L., 2012. Duplex quantitative real-time PCR assay for the detection and
discrimination of the eggs of Toxocara canis and Toxocara cati (Nematoda,
Ascaridoidea) in soil and fecal samples. Parasit Vectors 5, 288.
Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the
chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.
Geary, T.G., Sims, S.M., Thomas, E.M., Vanover, L., Davis, J.P., Winterrowd, C.A., Klein,
R.D., Ho, N.F., Thompson, D.P., 1993. Haemonchus contortus: ivermectin-induced
paralysis of the pharynx. Exp Parasitol 77, 88-96.
Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1991. Detection of resistance to ivermectin in
Haemonchus contortus. Int J Parasitol 21, 771-776.
Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2016. Characterisation of P-glycoprotein-9.1 in
Haemonchus contortus. Parasit Vectors 9, 52.
Godoy, P., Lian, J., Beech, R.N., Prichard, R.K., 2015. Haemonchus contortus P-glycoprotein-2:
in situ localisation and characterisation of macrocyclic lactone transport. Int J Parasitol
45, 85-93.
81
Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New
algorithms and methods to estimate maximum-likelihood phylogenies: assessing the
performance of PhyML 3.0. Syst Biol 59, 307-321.
Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T., Kerboeuf,
D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in
interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus
elongatus and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.
Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Mol Biol Evol 30, 772-780.
Kotze, A.C., Clifford, S., O'Grady, J., Behnke, J.M., McCarthy, J.S., 2004. An in vitro larval
motility assay to determine anthelmintic sensitivity for human hookworm and
Strongyloides species. Am J Trop Med Hyg 71, 608-616.
Krämer, F., Hammerstein, R., Stoye, M., Epe, C., 2006. Investigations into the prevention of
prenatal and lactogenic Toxocara canis infections in puppies by application of moxidectin
to the pregnant dog. J Vet Med B Infect Dis Vet Public Health 53, 218-223.
Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: Molecular Evolutionary
Genetics Analysis across Computing Platforms. Mol Biol Evol 35, 1547-1549.
Le, S.Q., Gascuel, O., 2008. An improved general amino acid replacement matrix. Mol Biol Evol
25, 1307-1320.
Lefort, V., Longueville, J.E., Gascuel, O., 2017. SMS: Smart Model Selection in PhyML. Mol
Biol Evol 34, 2422-2424.
Lespine, A., Dupuy, J., Orlowski, S., Nagy, T., Glavinas, H., Krajcsi, P., Alvinerie, M., 2006.
Interaction of ivermectin with multidrug resistance proteins (MRP1, 2 and 3). Chem Biol
Interact 159, 169-179.
Lespine, A., Martin, S., Dupuy, J., Roulet, A., Pineau, T., Orlowski, S., Alvinerie, M., 2007.
Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship.
Eur J Pharm Sci 30, 84-94.
Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other
multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for
reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist
2, 58-75.
Maté, L., Ballent, M., Cantón, C., Ceballos, L., Lifschitz, A., Lanusse, C., Alvarez, L., Liron,
J.P., 2018. Assessment of P-glycoprotein gene expression in adult stage of Haemonchus
contortus in vivo exposed to ivermectin. Vet Parasitol 264, 1-7.
Moreno, Y., Nabhan, J.F., Solomon, J., Mackenzie, C.D., Geary, T.G., 2010. Ivermectin disrupts
the function of the excretory-secretory apparatus in microfilariae of Brugia malayi. Proc
Natl Acad Sci U S A 107, 20120-20125.
Payne, P.A., Ridley, R.K., 1999. Strategic use of ivermectin during pregnancy to control
toxocara canis in greyhound puppies. Vet Parasitol 85, 305-312.
82
Pfaffl, M.W., 2004. A–Z of Quantitative PCR, 1 Edition. International University Line, La Jolla,
CA.
Ponce-Macotela, M., Rodríguez-Caballero, A., Peralta-Abarca, G.E., Martínez-Gordillo, M.N.,
2011. A simplified method for hatching and isolating Toxocara canis larvae to facilitate
excretory-secretory antigen collection in vitro. Vet Parasitol 175, 382-385.
Ramakers, C., Ruijter, J.M., Deprez, R.H., Moorman, A.F., 2003. Assumption-free analysis of
quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62-66.
Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016a. Effects of in vitro exposure
to ivermectin and levamisole on the expression patterns of ABC transporters in
Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.
Raza, A., Kopp, S.R., Kotze, A.C., 2016b. Synergism between ivermectin and the tyrosine
kinase/P-glycoprotein inhibitor crizotinib against Haemonchus contortus larvae in vitro.
Vet Parasitol 227, 64-68.
Schnieder, T., Laabs, E.M., Welz, C., 2011. Larval development of Toxocara canis in dogs. Vet
Parasitol 175, 193-206.
Shapiro, A.B., Corder, A.B., Ling, V., 1997. P-glycoprotein-mediated Hoechst 33342 transport
out of the lipid bilayer. Eur J Biochem 250, 115-121.
Soulsby, E.J., 1983. Toxocariasis. Br Vet J 139, 471-475.
Storey, B., Marcellino, C., Miller, M., Maclean, M., Mostafa, E., Howell, S., Sakanari, J.,
Wolstenholme, A., Kaplan, R., 2014. Utilization of computer processed high definition
video imaging for measuring motility of microscopic nematode stages on a quantitative
scale: "The Worminator". Int J Parasitol Drugs Drug Resist 4, 233-243.
Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,
Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and
peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet
Parasitol 206, 38-42.
Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,
Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,
A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic
pathogen Toxocara canis. Nat Commun 6, 6145.
83
Figures and tables
Figure 3-1. WormLab output obtained with Toxocara canis larvae exposed to DMSO control, 10 M ivermectin, 10 M verapamil or
combination of 10 M ivermectin with 10 M verapamil. Various motility parameters are shown : (A) track length in m (forward +
reverse), (B) peristaltic track length in m (forward – reverse), (C) speed in m/s (track length/time), (D) peristaltic speed in m/sec
(peristaltic track length/time), (E) mean area occupied by the larvae, (F) Wavelength in m, (G) mean amplitude in m and (H)
maximum amplitude in m. Statistically significant differences are marked by * (One-way ANOVA, p<0.05)
84
Figure 3-2. Representative bright-field overlays and fluorescence images of T. canis larvae stained with Hoechst 33342 in the absence
of drugs (A,B) and presence of inhibitors - ivermectin (C,D), cyclosporine A (E, F), loperamide (G, H), reserpine (I, J), verapamil (K,
L) and tariquidar (M,N) (400x). The brightfield image was used to annotate the outline of the larvae which was overlaid on the
fluorescent image. The area stained was quantitated using image analysis software (Figure 3-3).
85
Figure 3-3. Area of H33342 staining of T. canis larvae exposed to P-gp inhibitors. Experiments
were performed in triplicate with larvae hatched from different batches of eggs (n ≥ 5 larvae per
replicate). Mean ± SE are shown, asterisks denote statistical differences (p<0.05).
86
Figure 3-4. Maximum Likelihood phylogenetic tree of conceptually translated P-gp genes. Pgp
genes predicted in the genome (o) and cloned () are highlighted along with assigned names for
T. canis P-gp genes provided in red.
87
Figure 3-5. Mean + SE of expression levels of P-gp genes in adult T. canis worms. Three pools
of adult worms with two technical replicates each were compared to three biological replicate
populations of hatched larvae from different pools of eggs with two technical each. Fold change
was calculated using the efficiency corrected Ct method using T. canis 18S as the reference
gene.
Tca-
Pgp-2
Tca-
Pgp-9
.1
Tca-
Pgp-9
.2
Tca-
Pgp-1
0
Tca-
Pgp-1
1.1
Tca-
Pgp-1
1.2
Tca-
Pgp-1
3.1
Tca-
Pgp-1
6.1
Tca-
Pgp-1
6.2
Tca-
Pgp-1
6.3/
3.2
-5
0
5
10
15
20
25F
old
ch
an
ge o
ver
hatc
hed
larv
ae
88
Figure 3-6. Mean + SE of induction of P-gp expression following exposure to ivermectin. Three
biological replicate populations of hatched larvae from different pools of eggs with two technical
replicates were used to obtain Ct values. Each biological replicate had ivermectin treated and
untreated groups of larvae derived from the same population of eggs. Fold change was obtained
using the efficiency corrected Ct method using T. canis 18S as the reference gene.
Tca-
Pgp-2
Tca-
Pgp-9
.1
Tca-
Pgp-9
.2
Tca-
Pgp-1
0
Tca-
Pgp-1
1.1
Tca-
Pgp-1
1.2
Tca-
Pgp-1
3.1
Tca-
Pgp-1
6.1
Tca-
Pgp-1
6.2
Tca-
Pgp-1
6.3/
3.2
0
1
2
3
4
Fo
ld c
han
ge o
ver
un
treate
d larv
ae
89
Figure 3-7. Mean + SE of expression of P-gp genes in somatic T. canis larvae derived from mice
treated with (A) ivermectin or (B) moxidectin. Six biological replicate populations of somatic
larvae with two technical replicates each were used to obtain Ct values. Fold change was
calculated using the efficiency corrected Ct method using T. canis 18S as the reference gene.
90
Table 3-1. Nomenclature for P-gp protein sequences in Toxocara canis
GenBank accession number
(Protein database)
Length of annotated protein Assigned gene names
KHN80157 1285aa Tca-Pgp-2
KHN86334 1700aa Tca-Pgp-16.3/3.2
KHN78383 1352aa Tca-Pgp-3
KHN77280 741aa Tca-Pgp-9.1
KHN76604 462aa Tca-Pgp-9.2
KHN84692 1368aa Tca-Pgp-10
KHN73709 1337aa Tca-Pgp-11.1
KHN87227 1337aa Tca-Pgp-11.2
KHN89031 1268aa Tca-Pgp-11.3
KHN87070 1355aa Tca-Pgp-13.1/14.1
KHN87068 1330 aa Tca-Pgp-13.2/14.2
KHN80315 1368aa Tca-Pgp-16.1
KHN80341 2130aa Tca-Pgp-16.2
91
Supplementary data
The following is the supplementary data to this article:
Table 3-S 1. qPCR primers used in this study
Gene name Primer sequence
Tca-Pgp- 2 5’ ATGCGATCTAGACAAGTTGAGG 5’ TCAGGCCACTGCAACAAGTG
Tca-Pgp-9.1 5’ AGGGCGGTATGAGAGATGGT 5’ CGAGCGCATAAGAGCCAAAC
5’ GACGACACGCAGCATATAATTC 5’ GATTGGTGTTGTATCGCAAGAG
Tca-Pgp-9.2 5’ GCTATAACAAGGACGCGAAGG 5’ TGAATTTTTGTGCGGTCTTTCC
Tca-Pgp-10 5’ TGGTCATGGCTTCTGTGGTC 5’ AGACGACCTGGAGTGTTCCT
Tca-Pgp-11.1 5’ TGCAACGGTCAGGAAACGAT 5’ AATATCGCCCGGCTCTTTGA
Tca-Pgp-11.2 5’ TGCAAGAGGCGCTCAAAAAG 5’ AAGCGACGACAAGCGATGAG
Tca-Pgp-13.1 5’ GAGGACGTATCATCGAACAAGG 5’ GAGTTGAAACTGTTGGGCTTTC
Tca-Pgp-16.1 5’ GGATATGACCGAGGAAGAAATGG 5’ GCACGTGCGATAGCGATAC
Tca-Pgp-16.2 5’ GCTCGTGTTGAAATGTGGGAG 5’ GTTCTTGACCGTTGTAAGCGA
Tca-Pgp-16.3/3.2 5’ TGCAGATCCAGGTGAAACGA 5’ TCCCGAGACGGCATCATAGT
Tca-18S 5’ CTACCACATCCAAGGAAGGCA 5’ TTATTTTTCGTCACTACCTCCTCATG
92
CHAPTER 4. IDENTIFICATION AND FUNCTIONAL CHARACTERIZATION OF P-
GLYCOPROTEIN 11.1 OF TOXOCARA CANIS
Jeba Jesudoss Chelladurai, Tomislav Jelesijevic, Matthew T. Brewer
Modified from a manuscript to be submitted
Abstract
The interaction of macrocyclic lactones with P-glycoproteins has been studied in
nematodes with reduced susceptibility to the drug class. Toxocara canis somatic larvae exhibit a
remarkable tolerance to systemically bioavailable macrocyclic lactones and resist death, except
when they are hormonally reactivated during the third trimester of pregnancy in dogs. We
hypothesized that the tolerance to MLs could be due to P-glycoprotein mediated efflux of drugs
from their sites of action. In the present study, a full length Toxocara canis P-gp was studied by
cloning, and by phylogenetic analysis was named Tca-Pgp-11.1. The cloned P-gp was expressed
and its pharmacological substrate profile was studied by fluorescent substrate efflux in
transfected cells using flow cytometry in the presence and absence of known P-gp substrates and
inhibitors. Tissue distribution of two isoforms of Tca-Pgp-11 mRNA in adult male and female
worms was studied using chromogenic in situ hybridization and expression was found to be the
highest in the intestine and absent in the reproductive tissues. We have previously shown that
somatic larvae express isoforms of Tca-Pgp-11. Taken together, these results indicate that Tca-
Pgp-11.1 transports macrocyclic lactones, which could contribute to somatic larval tolerance to
MLs.
1. Introduction
Toxocara canis is a cosmopolitan ascarid nematode of dogs. Dogs acquire infection by
one of four routes - ingestion of eggs with infective L3 larvae, ingestion of paratenic hosts
harboring infective L3, transplacentally transferred larvae or lactogenically derived larvae from
93
infected dams. Upon ingestion of infective eggs, the larvae are released in the stomach and
undergo extensive migration in the body. In dogs that are > 8 weeks of age, the larvae are
retained in skeletal muscles, kidneys, liver, heart, lungs and diaphragm as arrested somatic larvae
(Schnieder et al., 2011). Transplacentally and lactogenically transmitted T. canis larvae are
important in neonates and worms grow to adulthood in the small intestines.
The efficacy of the macrocyclic lactones in the treatment of infections with adult T. canis
is well-established and there have been no reports of resistance. However, somatic larvae are not
completely eliminated by macrocyclic lactones. We hypothesized that P-glycoproteins may be
involved in the transport of MLs out of target cells in somatic larvae, as ML resistance in several
nematodes has been associated with P-gp mediated efflux of drugs from target sites.
P-glycoproteins are a family of transporters located on the cell membrane that have a
characteristic ATP-binding cassette and are involved in the ATP-mediated efflux of a wide range
of xenobiotics. Nematode P-gps have several paralogs that have been studied in the context of
anthelmintic resistance (Figueiredo et al., 2018). Specifically, Pgp-11 appears to be important in
parasitic nematodes of veterinary importance and its role has been studied in Parascaris
(Janssen et al., 2013a; Janssen et al., 2015), Dirofilaria immitis (Mani et al., 2016), Haemonchus
contortus (Issouf et al., 2014), Cooperia oncophora (De Graef et al., 2013) and others.
The pharmacological interactions of drugs and Toxocara canis P-glycoproteins have not
been characterized. The draft genome of T. canis has been surveyed to identify ABC transporters
and the expression levels of P-gps have been studied in adults, hatched third stage larvae and
somatic larvae recovered from mice (Chapter 3 of this thesis). In this study, we cloned and
bioinformatically analyzed a P-gp gene from Toxocara canis. We characterized the unique
94
pharmacology of Tca-Pgp-11.1 in stably transfected MDCK II cMDR1-KO cells and localized
gene expression in adult worm tissue by chromogenic in situ hybridization.
2. Materials and methods
2.1. Ethics statement
All experiments were conducted in accordance with the recommendations of the NIH
Guide for the care and use of laboratory animals. The studies were approved by the Iowa State
University Institutional Animal Care and Use Committee.
2.2. Molecular and phylogenetic characterization
Adult Toxocara canis worms were obtained from feces of puppies recently treated with
anthelmintics. To extract RNA for cloning, adult worms were homogenized with Trizol reagent
(Life Technologies) followed by purification using the Direct-zol RNA Miniprep kit (Zymo)
according to the manufacturer's instructions. RNA was eluted into 50µL of nuclease free water,
quantified using a Nanodrop1000 spectrophotometer, and stored at -80C. RNA quality was
assessed using the 260/280 ratio and by electrophoresis in a denaturing bleach agarose gel
(Aranda et al., 2012). cDNA was synthesized using 0.5g of total RNA, 200U of SuperScript IV
Reverse Transcriptase enzyme (Invitrogen) and 2.5M Oligo d(T)20 primers, using the
manufacturer’s recommended protocol.
To clone a full length Toxocara canis P-gp gene, the predicted nucleotide sequence was
derived from the T. canis draft genome assembly Scaffold1303 on NCBI GenBank - Accession
number JPKZ01003065.1, and specific primer pairs were designed using the Primer3 software
(version 2.2.3) on the PrimerQuest Tool platform (Integrated DNA technologies, Coralville, IA).
Primers were synthesized at the Iowa State University DNA Facility. Tca-Pgp-11.1 was cloned
as two separate fragments initially using the conserved nematode spliced leader primer SL3 and
95
custom designed primers (Table 4-S 1). Gibson assembly was used to fuse and clone the full-
length sequence into the pCR-XL-TOPO vector (Life Technologies) for sequencing. PCR
reactions consisted of 1x OneTaq HotStart DNA polymerase master mix (New England
BioLabs), 1M of each primer and 2L of cDNA. A touch down PCR cycle of initial
denaturation at 94C for 2 min, followed by 20 cycles of cyclic denaturation at 94C 15 sec,
annealing at 65C for 15 sec with a drop of 1C per cycle, cyclic extension at 68C for 6 min,
and again followed by 20 cycles of cyclic denaturation at 94C 15 sec, annealing at 45C for 15
sec, cyclic extension at 68C for 6 min and final extension at 68C for 10 min was used. PCR
products were visualized on an agarose gel, purified using Wizard SV Gel and PCR Clean-Up
system (Promega), cloned into pCR-XL-TOPO, and transformed into OneShot TOP10
Chemically competent E. coli (Life Technologies). Transformants were analysed by PCR and
sequenced using a primer walking strategy on an Applied Biosystems 3730xl DNA analyzer at
the Iowa State University DNA Facility. The amplicon was double digested using HindIII and
BamHI (Thermo Scientific) after reamplification using primers with restriction sites and His tag,
gel purified and directionally sub-cloned into pcDNA3.1+ Mammalian Expression Vector
(Invitrogen). Transformants were analysed by restriction digestion and sequencing by primer
walking.
2.3. Bioinformatic analyses
Sequences were assembled using GeneStudio Professional Edition version 2.2.0.0, and
conceptually translated to the corresponding peptide sequence using EMBOSS Transeq (Rice et
al., 2000). The BLAST suite was used to align and confirm sequence identities of nucleotide and
translated peptide sequences by comparison to draft Toxocara canis genomes WGS: JPKZ01,
LYYD01 and UYWY01 (NCBI Genome database assemblies GCA_000803305.1,
96
GCA_001680135.1 and GCA_900622545.1 respectively) (Johnson et al., 2008). The 1283
amino acid long conceptually translated protein sequence was analyzed with ScanProsite (de
Castro et al., 2006) and InterPro for residue annotation (Mitchell et al., 2019). Protein secondary
structure was predicted using Porter 5.0 (Torrisi et al., 2019) with secondary structure (SS3, SS8)
output as defined by DSSP (Kabsch and Sander, 1983) with prediction confidence intervals (0 to
9). Protein tertiary structure was predicted using ModWeb using the combined sequence-profile
and PSI-BLAST fold assignment methods (Pieper et al., 2014). Multiple sequence alignments of
nucleotide and translated protein sequences were visualized with Multalin version 5.4.1 (Corpet,
1988).
Translated protein sequence of other nematode P-gp sequences were obtained from NCBI
GenBank protein database, aligned using MAFFT (Katoh and Standley, 2013). Substitution
model was selected using the SMS tool with Bayesian Information Criteria (Lefort et al., 2017).
The model with lowest BIC value was LG+F+I+G with 4 parameter gamma distribution (Le and
Gascuel, 2008) and maximum likelihood phylogenetic analyses performed using PhyML3.0
(Guindon et al., 2010). The tree was visualized using Mega X (Kumar et al., 2018).
2.4. Heterologous expression in MDCK cells
Tca-Pgp-11.1 was heterologously expressed in MDCK cells lacking expression of
endogenous P-gp due to CRISPR/Cas9-mediated deletion of MDR1 (Karlgren et al., 2017). Cells
were maintained in Eagle’s minimum essential medium with 10% heat inactivated fetal bovine
serum (Atlanta biologicals) at 37C with 5% CO2. Chemical transfection was carried out using
Lipofectamine 2000 reagent, according to the manufacturer’s protocol. 5µg of the plasmid
pcDNA3.1+ containing the Tca-Pgp-11.1 gene was transfected into the cells at 90% confluency
97
in 24 well plates. Transfected cells were selected using 400 µg/mL of Geneticin/ G418 sulfate,
and after 2 weeks of selection, stably transfected colonies were transferred to cell culture flasks.
The expression profile of Tca-Pgp11 was quantitated using RT-qPCR. Cells were
removed from cell culture flasks using 0.25% Trypsin-EDTA and used for RNA extraction using
Trizol reagent. cDNA was synthesized using iScript Select cDNA synthesis kit (Bio-rad). The
synthesized cDNA was used as template for qPCR using the primers listed in Table 4-S 1. Tca-
Pgp-11.1 and CanMDR1 expression levels were measured in all cell lines. CanGAPDH was used
as the reference gene. qPCR was carried out in a QuantStudio 3 Real-time PCR system (Applied
Biosystems) using the Sso Advanced Universal SYBR Green Supermix (Bio-rad). qPCR
efficiencies for each reaction were calculated by linear regression analysis of amplification
curves using LinregPCR (Ramakers et al., 2003). Relative fold differences between cells were
calculated using the efficiency corrected Ct method based on individual samples (Pfaffl, 2004).
Cells were harvested at 100% confluency and lysed using sterile beads (0.1mm, 0.5mm
and 2mm Zymo bashing beads). Total protein concentrations were determined using the
Coomassie Plus (Bradford) Assay. 30 g of total protein per well was resolved in a
discontinuous denaturing SDS-polyacrylamide gel with 4% stacking and 8% resolving gel.
Proteins were transferred to a PVDF membrane, blocked with Superblock blocking buffer in
PBS (Thermo Scientific) and incubated with primary antibody (1:250 dilution). Antibodies were
raised in rabbits targeting three 14 amino acid peptides (Table 4-1) predicted to be encoded by
the cloned Tca-Pgp11.1 (GenScript). Binding was detected by a 50:50 mixture of 1:5000 anti-
rabbit IgG and IgM (Jackson Labs) and Super signal picoluminescence (Thermo Fisher). The
same samples were blotted on a nitrocellulose membrane for a dot blot assay. Primary and
98
secondary antibodies were used at the same dilutions as the western blotting experiment with
NBT/BCIP substrate (Thermo Fisher)
2.5. Tca-Pgp-11.1 mediated efflux assays
Tca-Pgp-11.1-mediated efflux of known P-gp substrates was measured using flow
cytometry. WT MDCK cells expressing canine endogenous MDR1 (Pgp) were used as positive
control and are hereafter referred to as WT cells. Non-transfected MDCK KO cells were used as
negative control and are hereafter referred to as KO cells. Fluorescent substrates included
Rhodamine 123 (R123), EffluxIDGreen (Enzo Life Sciences) and Calcein-AM (Invitrogen).
EffluxID Green was tested with specific inhibitors for MDR1/P-gp (Verapamil), MRP1/2 (MK-
571) and BCRP (Novobiocin) respectively. Calcein-AM was used to test the efflux of known
mammalian P-gp inhibitors - Verapamil (Acros Organics), Cyclosporine A, Tariquidar,
Reserpine (SelleckChem), Ivermectin (MP Biomedicals), Milbemycin oxime (US Pharmacopia).
Cells were grown to 90- 100% confluency, trypsinized, triturated to create a single cell
suspension, and washed with 1x D-PBS. Cells were incubated at 37C with dilutions of drugs in
1x D-PBS for 30 min, followed by with Calcein-AM (1M) at 37C for 15 min, washed twice
with D-PBS, and incubated at 37C for 60 mins prior to flow cytometry. Fluorescence was
determined by in a BD Accuri C6 flow cytometer with laser excitation of 488nm and emission
filter 530/30 (FITC channel), acquiring a minimum of 30,000 events per sample.
Pharmacological profile was recorded and normalized median fluorescence intensity (nMFI) was
calculated as a ratio of MFI of cells exposed to inhibitor drugs + dye and MFI of cells exposed to
no drugs or dye as described in (Chan et al., 2013). Additionally, ratio of mean fluorescence
intensities of transfected cells treated with drugs and transfected cells that were not treated with
inhibitors as described in (Mealey et al., 2017).
99
2.6. Chromogenic in situ mRNA hybridization
Multiple nucleic acid hybridization was carried out to determine tissue specific
expression of isoforms of Tca-Pgp-11. Adult male and female worms were formalin fixed for 22
hours and embedded in paraffin for chromogenic hybridization studies.
Probes targeting the nucleotides 421 - 1364 of Tca-Pgp-11.1 were obtained from
Advanced Cell Diagnostics. The probes were also able to bind to putative Tca-Pgp-11.2 mRNA
which has high identity (>90%) with Tca-Pgp-11.1. Positive control probes targeting nucleotides
4 - 1004 of JPKZ01000754.1:68516-75076 of the T. canis β-tubulin component encoded by the
ttb4 gene and negative control probes targeting the nucleotides 414 - 862 of the dapB gene of
Bacillus subtilis (GenBank Accession number EF191515) were obtained. Probes were stored at
4C until use. RNAscope 2.5 HD Assay-Red reagents (Advanced Cell Diagnostics) were used
with Fast Red substrate. Chromogenic in situ mRNA hybridization was carried out on 5m thick
sections according to the protocol optimized for ascarid nematodes (Jesudoss Chelladurai and
Brewer, 2019). Positive mRNA signal after amplification was observed as red-pink dots in
nematode tissue.
2.7. Statistical analysis
Two-way ANOVA with Tukey’s multiple comparison tests was performed for the
analysis of flow cytometry data. All statistical analyses were performed using GraphPad Prism
version 8 .
3. Results
3.1. Bioinformatic analysis of Tca-Pgp-11.1
The full length cloned Tca-Pgp-11.1 gene is 3,849 base pairs in length, and the
conceptually translated protein is 1283 amino acids in length. In BLAST analyses, the cloned
sequence showed 98.88%, 91.88% and 53.84% identity with T.canis draft genome-predicted P-
100
gp sequences KHN73709, KHN87227 and KHN89031. The cloned sequence demonstrated 72%
identity to Pgp11 from Parascaris equorum (72%), Brugia malayi (55%) and Dirofilaria immitis
(55%), consistent with similar comparisons in other nematodes (David et al., 2018).
Structural bioinformatic analyses of translated protein sequence showed tandem
arrangement of ABC transporter type-1 fused domain and ATP-binding domain in tandem in
each half of the protein which is typical of P-glycoproteins (Figure 4-1). The ATP transporter
family signature motif (LSGGQ) as well as the conserved Walker A, Walker B, Q loop/lid, D
loop and H loop/switch motifs were also present. Predicted secondary structures with the SS3 (3
state secondary structure) and SS8 (8 state secondary structure) are also depicted. Multiple
sequence alignments of predicted nucleotide and protein sequences from the T.canis draft
genome (GenBank Accession number JPKZ01003065 and KHN73709) and Parascaris Peq-
Pgp-11 (GenBank Accession numbers JX308320 and AGL08022) and are shown in Figures 4-S1
and S2.
Maximum Likelihood phylogenetic analysis of P-gp sequences revealed that Pgp-11
sequences from C. elegans and other parasitic nematodes formed a distinct clade (Figure 4-2).
Three predicted T. canis Pgps were observed in the Pgp11 clade – KHN73709, KHN87227 and
KHN89031. It is likely that the three are isoforms of Pgp11.
3.2. Expression of Tca-Pgp-11.1 in CRISPR-edited MDCK cells
The cloned sequence of Tca-Pgp-11.1 was ligated into the pcDNA3.1+ vector and stably
transfected into MDCK cells CRISPR-edited to remove endogenous canine MDR1 expression.
Expression of Tca-Pgp-11.1 mRNA was found to be on average 4000 times higher in transfected
cells than in the KO control cells (Figure 4-3). Translation of the protein was demonstrated by
immunoblotting (Figure 4-4). Western blotting revealed several bands, suggesting variations in
glycosylation of translated protein, including one of the expected (140kDa) size.
101
3.3. Functional transport activity by Tca-Pgp-11.1
Functional activity of Tca-Pgp-11.1 was characterized by flow cytometry using the P-gp
substrates EffluxID Green (Figure 4-5), Calcein-AM, and R123 (Figure 4-6).EffluxID Green is a
non-specific dye that can be effluxed by mammalian MDR1, MRP and BCRP (Lebedeva et al.,
2011). Functional assays revealed efflux activity by Tc-Pgp-11.1-transfected cells that was
similar to WT, but significantly higher than KO cells (Figure 4-5). Similarly, R123 efflux was
apparent in both wild type and Tc-Pgp-11.1-transfected cells as compare to KO (Figure 4-6).
Interestingly, Calcein AM efflux was evident in Tca-Pgp-11.1-transfected cells, but not WT or
KO cells (Figure 4-6). Additionally, MK-571 (50 µM) caused marked losses in cell viability
(9.4% - 16% viable) in WT or KO cells compared to nematode P-gp (35% viable) (Data not
shown).
3.4. Unique pharmacology of Tca-Pgp-11.1
Tca-Pgp-11.1 activity was assessed with Calcein-AM in the presence of six drugs – two
macrocyclic lactones and four known mammalian P-gp inhibitors. Mean fluorescence intensities
ratios calculated at various concentrations of the six drugs are presented in Figure 4-9 and Table
4-S 2. A mean fluorescence intensity ratio of <1 represents low levels of efflux and conversely, a
ratio >1 represents higher Calcein-AM retention. An overlay of histograms of different
concentrations of the six drugs in Tca-Pgp-11.1 transfected are presented in Figure 4-S3.
P-gp activity of WT cells expressing mammalian MDR1 was sensitive to verapamil,
cyclosporine A, reserpine, and tariquidar in a dose-dependent manner. Interestingly, Tca-Pgp-
11.1 was insensitive to these inhibitors, exhibiting efflux activity that was similar to KO cells in
the presence of these drugs (p<0.05, Figure 4-8).
P-gp activity was increased in Tca-Pgp-11.1 and WT compared to KO cells, while Tca-
Pgp-11.1 and WT efflux activity were equivalent for all doses of ivermectin and milbemycin
102
oxime studied (p<0.05, Figure 4-8). High dose ivermectin (100 µM) and milbemycin oxime
(≥ 50 µM) caused 50% reduction in viability compared to cells exposed to lower
concentrations of drugs in all three cell lines (Data not shown).
3.5. Tissue specific expression of Tca-Pgp-11
In situ multiple nucleic acid RNA hybridization was used to visualize mRNA transcripts
in tissues of adult male and female worms (Figure 4-10). No signal was detected in any
nematode tissue for the negative control (Bacillus subtilis DapB) (Figure 4-S4). Positive control
for the assay was a β-tubulin component encoded by the ttb4 gene in T. canis, which was
visualized throughout the parasite (Figure 4-S5). Ascarid anatomy for interpreting in situ
hybridization has been outlined in a previous study (Jesudoss Chelladurai and Brewer, 2019).
Red-pink dots indicative of Tca-Pgp-11 mRNA were observed in the hypodermis, but not in the
cuticle of both male and female worms. Increased positive signal was also observed in the single
layer of columnar cells of the intestine in both sexes. A large number of vacuoles were also
observed in the intestine in both sexes. Red-pink dots indicative of Tca-Pgp-11 mRNA was
observed in low numbers in the lateral cords and nerve cords. No hybridization signal was
visualized in either the male or female reproductive tracts at any transverse section measured.
4. Discussion
Toxocara canis somatic larvae in dog tissue are not susceptible to macrocyclic lactone
anthelmintics. Macrocyclic lactone efflux has been associated with P-glycoproteins in other
parasitic nematodes but much is unknown about the role that P-gp orthologs play in mediating a
drug-resistant phenotype (Kaschny et al., 2015). The present study described Toxocara canis
Pgp-11.1, which is an ortholog of Pgp-11 in the related Clade III nematodes Parascaris spp.,
Dirofilaria immitis and Brugia malayi (Bourguinat et al., 2011a; Janssen et al., 2013a; Stitt et al.,
2011) and in the unrelated Clade V nematodes Haemonchus contortus, Cooperia oncophora and
103
Caenorhabditis elegans (De Graef et al., 2013; Kellerová et al., 2019; Ménez et al., 2016). In
these nematodes, resistance has been associated with SNPs in the DNA sequence and/or mRNA
expression changes in Pgp-11. In order to study the role of Pgp-11 in Toxocara canis, we cloned
and heterologously expressed Tca-Pgp-11.1 and assessed the interaction of MLs and known P-gp
inhibitors by flow cytometry. We present bioinformatic and phylogenetic analyses of the cloned
gene, the localization of mRNA expression, and evidence that Tca-Pgp-11.1 has a unique
pharmacological inhibition profile.
The cloned sequence was confirmed to be an ortholog of Pgp-11 by phylogenetic analysis
and was designated Tca-Pgp-11.1 in accordance with gene naming conventions (Beech et al.,
2010). Multiple sequence alignments revealed that the cloned sequence had very close identity to
Pgp-11 of the ascarid nematode Parascaris and slightly lower identity to Pgp-11 of C. elegans.
Phylogenetic analysis revealed that the cloned gene was found in the same clade in the ML tree
as Parascaris Pgp-11 and C. elegans Pgp-11. Orthologs from the spirurid nematode Dirofilaria
immitis, Onchocerca volvulus, Brugia malayi and Acanthocheilonema vitae formed a district
sub-clade that did not contain any ascarid Pgp-11 sequences. Two other protein sequences
encoded in the T. canis draft genome were found in the Pgp-11 clade. It is currently unknown if
these are paralogs or isoforms of Pgp-11. As genome assembly qualities improve, questions
about gene ontology can be resolved by the use of advanced new techniques such as RNA-seq.
Bioinformatic assessment of the Tca-Pgp-11.1 gene revealed that the mRNA transcript in
adult T. canis possessed a trans-spliced nematode leader SL3, which was not found at the 5’ end
of P-gp genes in all three draft genomes. While the spliced leader sequence has been used to
facilitate cloning of full length P-glycoprotein genes (Bourguinat et al., 2016; David et al., 2018),
104
its role in gene regulation remains elusive 23 years after the question was first posed (Blaxter and
Liu, 1996).
Tca-Pgp-11.1 is a classical P-gp with two each of transporter and ATP-binding domains.
The tertiary structure deduced from the crystal structure of C. elegans Pgp-1 (Jin et al., 2012)
revealed that Tca-Pgp-11.1 has two transmembrane domains with 6 transmembrane helices
where drugs may bind. This modelled structure can be used to screen compounds by in silico
methods prior to testing in in vitro models (David et al., 2018) in order to expedite screening of
large libraries of compounds that might be transported by Tca-Pgp-11.1.
Tca-Pgp-11.1 was expressed without codon optimization changes, in order to accurately
assess the function of the nematode gene. In this study, KO cells, altered by CRISPR-Cas9
technology, were used for nematode P-gp expression. This cell line has been a tractable model in
our hands to study nematode P-gps as it expresses no endogenous MDR1 (P-gp) similar to LLC-
PK1 pig kidney cells (which has low endogenous MDR1 levels), with the added advantage of
having increased growth rates. Transfected cells both transcribed and translated Tca-Pgp-11.1
which was detectable by qPCR as well as polyclonal antibodies targeting exposed regions of the
protein. Thus, we developed a novel method for studying nematode P-glycoproteins in the
absence of interference by mammalian MDR1. This system will be highly valuable for studying
the pharmacology of nematode P-gp.
In the functional efflux assays, three fluorescent dyes were tested to determine the best
candidate for use in the MDCK KO model since individual dyes have different transport rates in
various cell lines under different experimental conditions (Lebedeva et al., 2011). The
observation that Tca-Pgp-11.1 mediated efflux of all three substrates reinforced the suitability of
the model. Calcein-AM was chosen for further drug assessments because of light stability and
105
ease of handling. Calcein-AM is a non-fluorescent Pgp substrate that is hydrolyzed
intracellularly to fluorescent Calcein molecules, which cannot be effluxed (Liminga et al., 1994).
Efflux data suggests that Tca-Pgp-11.1 is capable of transporting both avermectin and
milbemycin class drug candidates. Additionally, Tca-Pgp-11.1 mRNA is expressed in hatched
and somatic larvae (Chapter 3 of this thesis). Taken together, these points provide evidence that
Tca-Pgp-11.1 plays some role in the perceived tolerance of somatic larvae to macrocyclic
lactones. Further research to explore the regulation of Pgp-11 is essential to aid in understanding
how modulating/down-regulating the action/expression of P-gps can help overcome tolerance in
clinical situations.
Mammalian P-gp inhibition has been extensively studied because of the role that P-gps
play in the MDR phenotype exhibited by many mammalian tumors (Briz et al., 2019; Zandvliet
and Teske, 2015). Verapamil (also a calcium channel blocker) and Cyclosporine A (also an
immunosuppressive agent) are first generation inhibitors that are themselves substrates of P-gps,
and compete with other substrates for P-gp mediated efflux (Palmeira et al., 2012). Reserpine (an
antihypertensive alkaloid) inhibits mammalian P-gp activity but also affects the catecholamine
pathways (Abdelfatah and Efferth, 2015). Tariquidar is a third generation P-gp inhibitor that was
specifically designed to allosterically inhibit mammalian P-gps but is not itself a substrate
(Weidner et al., 2016).
Interestingly, our studies revealed that Tca-Pgp-11.1 was insensitive to verapamil,
cyclosporine A, reserpine, and tariquidar (Figure 4-8, Figure 4-S3). This is in disagreement with
some studies using first generation inhibitors both in vitro and in vivo with the intention of
nematode P-gp inhibition (AlGusbi et al., 2014; Stitt et al., 2011; Xu et al., 1998). We
hypothesize that whole organism assays are measurements of net P-gp activity that is a result of
106
simultaneous expression of numerous P-gps. It is also possible that past studies have made
observations resulting from these drugs interacting with other cellular targets. Additional
research with other P-gp orthologs, paralogs from T. canis including allelic variations among
individuals, as suggested by (Kaschny et al., 2015) is necessary to understand the fine scale
molecular mechanism of action of these inhibitors.
Localization studies have been conducted in ascarid nematodes to study P-gps using the
multiple nucleotide chromogenic in situ hybridization assay (Jesudoss Chelladurai and Brewer,
2019). The sites of mRNA expression of more than one isoform of Tca-Pgp-11 was determined
in this study as probes used were unable to distinguish between Tca-Pgp-11.1 and Tca-Pgp-11.2
due to their high level of identity. Differential expression of Pgp-11 mRNA was observed with
high levels in the intestines and low levels in the body wall, nerve and lateral cords of adult T.
canis were similar to patterns of Peq-Pgp-11 expression observed in adult Parascaris (Jesudoss
Chelladurai and Brewer, 2019). However, there was no Tca-Pgp-11 mRNA expression in the
reproductive tissues in either sex of T. canis, while Peq-Pgp-11 was expressed in the
reproductive tissues of both sexes. Further research is necessary to understand the localization
patterns of P-gps paralogs in adult tissue and to determine the significance of differential P-gp
gene expression in nematode reproductive tissues.
In this study, we identified an ATP-binding cassette transporter from the nematode
parasite T. canis. Phylogenetic and bioinformatic analysis allowed us to designate this gene Tca-
Pgp-11.1, which is an ortholog of Pgp-11 in related ascarids. Nucleic acid hybridization studies
demonstrated expression of Tca-Pgp-11 in adult parasites. Heterologous expression assays
revealed that Tca-Pgp-11.1 has P-gp activity, measurable by efflux of fluorescent P-gp
substrates. Significantly, we used a gene-edited cell line enabling the study of Tca-Pgp-11.1 in
107
isolation from mammalian P-gp which has the potential to confound such heterologous studies.
Flow cytometric analysis of cells expressing the nematode protein revealed a novel
pharmacological profile, being insensitive to many agents known to cause P-gp inhibition.
Further studies are needed to investigate the repertoire of P-glycoprotein activity in nematodes
and to identify parasite-specific inhibitors that could be used to potentiate anthelmintic activity.
5. References
Abdelfatah, S.A., Efferth, T., 2015. Cytotoxicity of the indole alkaloid reserpine from
Rauwolfia serpentina against drug-resistant tumor cells. Phytomedicine 22, 308-318.
AlGusbi, S., Krücken, J., Ramünke, S., von Samson-Himmelstjerna, G., Demeler, J.,
2014. Analysis of putative inhibitors of anthelmintic resistance mechanisms in cattle
gastrointestinal nematodes. Int J Parasitol 44, 647-658.
Aranda, P.S., LaJoie, D.M., Jorcyk, C.L., 2012. Bleach gel: a simple agarose gel for
analyzing RNA quality. Electrophoresis 33, 366-369.
Beech, R.N., Wolstenholme, A.J., Neveu, C., Dent, J.A., 2010. Nematode parasite genes:
what's in a name? Trends Parasitol 26, 334-340.
Blaxter, M., Liu, L., 1996. Nematode spliced leaders--ubiquity, evolution and utility. Int J
Parasitol 26, 1025-1033.
Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter
genes in Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.
Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011.
Macrocyclic lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.
Briz, O., Perez-Silva, L., Al-Abdulla, R., Abete, L., Reviejo, M., Romero, M.R., Marin,
J.J.G., 2019. What "The Cancer Genome Atlas" database tells us about the role of ATP-binding
cassette (ABC) proteins in chemoresistance to anticancer drugs. Expert Opin Drug Metab
Toxicol 15, 577-593.
Calabrese, E.J., 2008. P-glycoprotein efflux transporter activity often displays biphasic
dose-response relationships. Crit Rev Toxicol 38, 473-487.
Chan, L.Y., Yim, E.K., Choo, A.B., 2013. Normalized median fluorescence: an
alternative flow cytometry analysis method for tracking human embryonic stem cell states during
differentiation. Tissue Eng Part C Methods 19, 156-165.
Corpet, F., 1988. Multiple sequence alignment with hierarchical clustering. Nucleic
Acids Res 16, 10881-10890.
David, M., Lebrun, C., Duguet, T., Talmont, F., Beech, R., Orlowski, S., André, F.,
Prichard, R.K., Lespine, A., 2018. Structural model, functional modulation by ivermectin and
108
tissue localization of Haemonchus contortus P-glycoprotein-13. Int J Parasitol Drugs Drug Resist
8, 145-157.
de Castro, E., Sigrist, C.J., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S.,
Gasteiger, E., Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature
matches and ProRule-associated functional and structural residues in proteins. Nucleic Acids Res
34, W362-365.
De Graef, J., Demeler, J., Skuce, P., Mitreva, M., Von Samson-Himmelstjerna, G.,
Vercruysse, J., Claerebout, E., Geldhof, P., 2013. Gene expression analysis of ABC transporters
in a resistant Cooperia oncophora isolate following in vivo and in vitro exposure to macrocyclic
lactones. Parasitology 140, 499-508.
Figueiredo, L.A., Rebouças, T.F., Ferreira, S.R., Rodrigues-Luiz, G.F., Miranda, R.C.,
Araujo, R.N., Fujiwara, R.T., 2018. Dominance of P-glycoprotein 12 in phenotypic resistance
conversion against ivermectin in Caenorhabditis elegans. PLoS One 13, e0192995.
Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010.
New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the
performance of PhyML 3.0. Syst Biol 59, 307-321.
Issouf, M., Guégnard, F., Koch, C., Le Vern, Y., Blanchard-Letort, A., Che, H., Beech,
R.N., Kerboeuf, D., Neveu, C., 2014. Haemonchus contortus P-glycoproteins interact with host
eosinophil granules: a novel insight into the role of ABC transporters in host-parasite interaction.
PLoS One 9, e87802.
Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-
Himmelstjerna, G., 2013. Genetic variants and increased expression of Parascaris equorum P-
glycoprotein-11 in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.
Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2015.
Transgenically expressed Parascaris P-glycoprotein-11 can modulate ivermectin susceptibility in
Caenorhabditis elegans. Int J Parasitol Drugs Drug Resist 5, 44-47.
Jesudoss Chelladurai, J., Brewer, M.T., 2019. Detection and quantification of Parascaris
P-glycoprotein drug transporter expression with a novel mRNA hybridization technique. Vet
Parasitol 267, 75-83.
Jin, M.S., Oldham, M.L., Zhang, Q., Chen, J., 2012. Crystal structure of the multidrug
transporter P-glycoprotein from Caenorhabditis elegans. Nature 490, 566-569.
Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., Madden, T.L.,
2008. NCBI BLAST: a better web interface. Nucleic Acids Res 36, W5-9.
Kabsch, W., Sander, C., 1983. Dictionary of protein secondary structure: pattern
recognition of hydrogen-bonded and geometrical features. Biopolymers 22, 2577-2637.
Karlgren, M., Simoff, I., Backlund, M., Wegler, C., Keiser, M., Handin, N., Müller, J.,
Lundquist, P., Jareborg, A.C., Oswald, S., Artursson, P., 2017. A CRISPR-Cas9 Generated
MDCK Cell Line Expressing Human MDR1 Without Endogenous Canine MDR1 (cABCB1):
An Improved Tool for Drug Efflux Studies. J Pharm Sci 106, 2909-2913.
109
Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T.,
Kerboeuf, D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in
interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus elongatus
and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.
Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version
7: improvements in performance and usability. Mol Biol Evol 30, 772-780.
Kellerová, P., Matoušková, P., Lamka, J., Vokřál, I., Szotáková, B., Zajíčková, M.,
Pasák, M., Skálová, L., 2019. Ivermectin-induced changes in the expression of cytochromes
P450 and efflux transporters in Haemonchus contortus female and male adults. Vet Parasitol
273, 24-31.
Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: Molecular
Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35, 1547-1549.
Le, S.Q., Gascuel, O., 2008. An improved general amino acid replacement matrix. Mol
Biol Evol 25, 1307-1320.
Lebedeva, I.V., Pande, P., Patton, W.F., 2011. Sensitive and specific fluorescent probes
for functional analysis of the three major types of mammalian ABC transporters. PLoS One 6,
e22429.
Lefort, V., Longueville, J.E., Gascuel, O., 2017. SMS: Smart Model Selection in PhyML.
Mol Biol Evol 34, 2422-2424.
Liminga, G., Nygren, P., Larsson, R., 1994. Microfluorometric evaluation of calcein
acetoxymethyl ester as a probe for P-glycoprotein-mediated resistance: effects of cyclosporin A
and its nonimmunosuppressive analogue SDZ PSC 833. Exp Cell Res 212, 291-296.
Mani, T., Bourguinat, C., Keller, K., Ashraf, S., Blagburn, B., Prichard, R.K., 2016.
Interaction of macrocyclic lactones with a Dirofilaria immitis P-glycoprotein. Int J Parasitol 46,
631-640.
Mealey, K.L., Dassanayake, S., Burke, N.S., 2017. Establishment of a cell line for
assessing drugs as canine P-glycoprotein substrates: proof of principle. J Vet Pharmacol Ther 40,
545-551.
Mitchell, A.L., Attwood, T.K., Babbitt, P.C., Blum, M., Bork, P., Bridge, A., Brown,
S.D., Chang, H.Y., El-Gebali, S., Fraser, M.I., Gough, J., Haft, D.R., Huang, H., Letunic, I.,
Lopez, R., Luciani, A., Madeira, F., Marchler-Bauer, A., Mi, H., Natale, D.A., Necci, M., Nuka,
G., Orengo, C., Pandurangan, A.P., Paysan-Lafosse, T., Pesseat, S., Potter, S.C., Qureshi, M.A.,
Rawlings, N.D., Redaschi, N., Richardson, L.J., Rivoire, C., Salazar, G.A., Sangrador-Vegas, A.,
Sigrist, C.J.A., Sillitoe, I., Sutton, G.G., Thanki, N., Thomas, P.D., Tosatto, S.C.E., Yong, S.Y.,
Finn, R.D., 2019. InterPro in 2019: improving coverage, classification and access to protein
sequence annotations. Nucleic Acids Res 47, D351-D360.
Ménez, C., Alberich, M., Kansoh, D., Blanchard, A., Lespine, A., 2016. Acquired
Tolerance to Ivermectin and Moxidectin after Drug Selection Pressure in the Nematode
Caenorhabditis elegans. Antimicrob Agents Chemother 60, 4809-4819.
110
Palmeira, A., Sousa, E., Vasconcelos, M.H., Pinto, M.M., 2012. Three decades of P-gp
inhibitors: skimming through several generations and scaffolds. Curr Med Chem 19, 1946-2025.
Pfaffl, M.W., 2004. A–Z of Quantitative PCR, 1 Edition. International University Line,
La Jolla, CA.
Pieper, U., Webb, B.M., Dong, G.Q., Schneidman-Duhovny, D., Fan, H., Kim, S.J.,
Khuri, N., Spill, Y.G., Weinkam, P., Hammel, M., Tainer, J.A., Nilges, M., Sali, A., 2014.
ModBase, a database of annotated comparative protein structure models and associated
resources. Nucleic Acids Res 42, D336-346.
Ramakers, C., Ruijter, J.M., Deprez, R.H., Moorman, A.F., 2003. Assumption-free
analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62-
66.
Rice, P., Longden, I., Bleasby, A., 2000. EMBOSS: the European Molecular Biology
Open Software Suite. Trends Genet 16, 276-277.
Schnieder, T., Laabs, E.M., Welz, C., 2011. Larval development of Toxocara canis in
dogs. Vet Parasitol 175, 193-206.
Stitt, L.E., Tompkins, J.B., Dooley, L.A., Ardelli, B.F., 2011. ABC transporters influence
sensitivity of Brugia malayi to moxidectin and have potential roles in drug resistance. Exp
Parasitol 129, 137-144.
Torrisi, M., Kaleel, M., Pollastri, G., 2019. Deeper Profiles and Cascaded Recurrent and
Convolutional Neural Networks for state-of-the-art Protein Secondary Structure Prediction. Sci
Rep 9, 12374.
Weidner, L.D., Fung, K.L., Kannan, P., Moen, J.K., Kumar, J.S., Mulder, J., Innis, R.B.,
Gottesman, M.M., Hall, M.D., 2016. Tariquidar Is an Inhibitor and Not a Substrate of Human
and Mouse P-glycoprotein. Drug Metab Dispos 44, 275-282.
Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998.
Ivermectin resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol
Biochem Parasitol 91, 327-335.
Zandvliet, M., Teske, E., 2015. Mechanisms of Drug Resistance in Veterinary Oncology-
A Review with an Emphasis on Canine Lymphoma. Vet Sci 2, 150-184.
111
Figures and tables
Figure 4-1. Bioinformatic analysis of conceptually translated protein sequence of Tca-Pgp-11.1. (A) ScanProsite predicted domain
arrangements in conceptually translated protein sequence of Tca-Pgp-11.1. (B) ModWeb predicted tertiary structure modelled after C.
elegans Pgp-1 crystal structure (PDB: 4f4c). (C) Porter 5.0 predicted secondary structure of conceptually translated protein sequence
112
of Tca-Pgp-11.1 with domain architecture annotations from ScanProsite and residue level annotation from InterPro. Line 1 denotes
conceptually translated Tca-Pgp-11.1 protein sequence (SEQ). Line 2 denotes SS3, the 3-class secondary structure prediction where H
= helix (alpha helix, 3-10 helix, pi-helix) classes, E = strand (extended strand, beta-bridge classes) and C = the rest (turn, bend etc.).
Line 3 denotes 3 class Secondary structure prediction confidence: a number between 0 and 9, with 9 signifying maximal confidence.
Line 4 denotes SS8, the 8-class secondary structure prediction where H = alpha helix, G = 3-10 helix, I = pi-helix, E = extended
strand, B = beta-bridge, T = turn, S = bend and C = the rest. Line 5 denotes 8 class Secondary structure prediction confidence: a
number between 0 and 9, with 9 signifying maximal confidence. Helices are colored red and coils are colored blue.
113
Figure 4-2. Maximum likelihood phylogenetic tree of cloned and predicted T. canis Pgp genes in
comparison with those from other nematodes. Mouse, human and dog Pgp (MDR1) protein
sequences were used as outgroup. The cloned Tca-Pgp-11 is highlighted with a black bullet ().
114
Figure 4-3. Expression of Tca-Pgp-11.1 in transfected MDCK-ΔMDR cells. Relative fold
change was calculated with the efficiency corrected Ct method based on single samples using
transfected cells as samples, KO cells as calibrators, and canine GAPDH as the reference gene.
Figure 4-4. Western blot and dot blot using anti-Tca-Pgp-11 polyclonal antibodies raised in
rabbits against (A) whole cell lysate of Tca-Pgp-11.1 transfected cells, (B) whole cell lysate of
115
KO cells and (C) protein marker (PageRuler Plus, ThermoScientific). Each lane was loaded with
30 µg of total protein. Expected 140 KDa band is indicated by a green arrow.
Figure 4-5. Flow cytometry histograms of EffluxID dye transport activity in WT cells, Tca-Pgp-
11 transfected, and KO cells with (A) EffluxID Green with no drugs (B) EffluxID Green + 20µM
Verapamil, (C) EffluxID Green + 50µM MK-571, (D) EffluxID Green + 100µM Novobiocin. A
116
minimum of 10,000 gated cells are represented in each histogram, except where indicated in
the text. Normalized mean fluorescence obtained with Calcein-AM (B) and Rhodamine 123 (D)
as fluorophores. Significant differences in a two-way ANOVA are depicted (*) (p<0.05).
Figure 4-6.Flow cytometry histograms of Calcein-AM (A) and Rhodamine 123 (C) dye transport
activity in WT cells, Tca-Pgp-11 transfected, and KO cells with no drugs.A minimum of 10,000
gated cells are represented in each histogram, except where indicated in the text. Normalized
mean fluorescence obtained with Calcein-AM (B) and Rhodamine 123 (D) as fluorophores.
117
Figure 4-7. Flow cytometry histograms of Calcein-AM dye transport activity in WT cells, Tca-
Pgp-11 transfected, and KO cells.Flow plots of the three cell lines with dilutions of ivermectin
(A-G), milbemycin oxime (I-O), verapamil, (P-V), cyclosporine A (W-AC), reserpine (AD-AJ)
and tariquidar (AK-AQ). A minimum of 10,000 gated cells are represented in each histogram,
except where indicated in the text.
118
Figure 4-8. Normalized mean fluorescence obtained with Calcein-AM in the presence of
ivermectin, milbemycin oxime, verapamil, cyclosporine A, reserpine and tariquidar.
119
Figure 4-9. Mean fluorescence intensity ratios in Tca-Ppg-11 transfected cells co-incubated with
Calcein-AM and inhibitors.
0.00
0.01
0.10
1.00
5.00
10.0
0
50.0
0
100.
00
0
1
2
3
4
Drug, mM
Mean
flu
ore
scen
ce in
ten
sti
y
rati
o
Ivermectin
Milbemycin oxime
Verapamil
Cyclosporine A
Reserpine
Tariquidar
120
Figure 4-10. Representative images of multiple nucleic acid in situ hybridization in adult female
and male Toxocara canis. Positive signal resulting from hybridization of Tca-Pgp-11 probes
121
appeared as red punctate dots in all tissues except the reproductive tract. Black boxes indicate
the location of high magnification insets. Black arrows point to red dots in locations where
signal was low.
Table 4-1. Peptide sequences used as antigens for antibody production in rabbits.
Antigen Length Antigenicity/Surface/ Hydrophilicity
VDAASSKQMKGNAEC 14 aa 1.51/0.86/0.48
CGQKQRIAIARTIAR 14 aa 1.20/0.57/0.29
IKSEGSIQFSDVHFC 14 aa 0.99/0.64/-0.00
122
Supplementary data
The following is supplementary data to this article:
Figure 4-S 1. Multiple sequence alignments of nucleotide sequences of cloned Tca-Pgp-11.1,
Parascaris gene Peq-Pgp-11 (GenBank Accession number JX308320) and predicted P-gp from
draft genome of T. canis (GenBank Accession number JPKZ01003065).
123
Figure 4-S 2. Multiple sequence alignments of conceptually translated protein sequences of
cloned Tca-Pgp-11.1, Parascaris Peq-Pgp-11 (GenBank Accession number AGL08022) and
predicted P-gp from draft genome of T. canis (GenBank Accession number KHN73709).
124
Figure 4-S 3. Flow cytometric analysis of transport activity of ABC transporters exposed to (A)
Ivermectin, (B) Milbemycin oxime, (C) Verapamil, (D) Cyclosporine A, (E) Reserpine and (F)
Tariquidar.
125
Figure 4-S 4. Representative images of adult female and male Toxocara canis. No positive signal
resulting from hybridization of B. subtilis DapB probes appeared in any nematode tissue studied
in either sex.
126
Figure 4-S 5. Representative images of adult female and male Toxocara canis. Positive signal
resulting from hybridization of Toxocara canis tubulin gene ttb4 probes appeared as red punctate
dots in all tissues studied in both sexes.
127
Table 4-S 1. Primers used to clone Tca-Pgp-11.1 and in qPCR
Primer name Sequence Reference
SL3 5'- GGT TTA ATT ACC CAA GTT TGA G -3' (Gems et al., 1995)
Pgp11R 5’- GTA TGA GTT CGG CGT AT -3’ Custom designed
Pgp11 forward-
HindIII
5’- ACT GAA AAC CCC TTT TGG GGA AGC
TTG CCG CCA CCA TGG ATG ACA ATC GCA
AGG ACT C -3’
Custom designed
Pgp11 reverse-
BamH1
5’- ACT GAA AAC CCC TTT TGG GGG GAT
CCT TAA TGG TGA TGG TGA TGG TGG CTG
CGC AGA TCC TGT TTG CGT ATG AGT TCG
GCG TAT -3’
Custom designed
qTcPgp11-2F TGCAACGGTCAGGAAACGAT Custom designed
qTcPg11-2R AATATCGCCCGGCTCTTTGA Custom designed
Table 4-S 2. Ratio of Mean fluorescence Intensities in Tca-Pgp-11.1 transfected cells with
Calcein-AM with the experimental drugs at various concentrations
Ivermectin Milbemycin
oxime
Verapamil Cyclosporine
A
Reserpine Tariquidar
100 µM 0.65248 0.56614 1.10767 1.21652 0.64602 1.63992
50 µM 0.99269 0.84915 1.20057 1.20963 0.96822 2.23853
10 µM 1.21566 1.00715 1.06833 1.18814 1.06587 3.58703
5 µM 0.96961 0.85356
1 µM 1.31677 1.22984 0.99923 0.95178 1.05937 1.92403
0.1 µM 0.49697 0.89788 0.98064 0.92345 0.99778 1.00113
0.01 µM 1.06221 0.97367 0.95830 1.34620
0 µM 1 1 1 1 1 1
128
CHAPTER 5. DETECTION AND QUANTIFICATION OF PARASCARIS P-
GLYCOPROTEIN DRUG TRANSPORTER EXPRESSION WITH A NOVEL MRNA
HYBRIDIZATION TECHNIQUE
Jeba R J Jesudoss Chelladurai, Matt T Brewer
Modified from a manuscript published in Veterinary Parasitology
https://doi.org/10.1016/j.vetpar.2019.02.002
Abstract
Macrocyclic lactone-resistant Parascaris have been reported throughout the world. In
part, the drug resistant phenotype is hypothesized to be associated with ATP-binding cassette
transporters known as P-glycoproteins. In many systems, P-glycoproteins efflux drugs out of
cells thereby precluding drug binding to target receptors. Parascaris may evade macrocyclic
lactone-mediated death by effluxing drugs away from target receptors in the nervous system.
Alternatively, P-glycoprotein expression in the gut or body wall could prevent penetration of
drugs into the body of the parasite altogether. In the present study, we evaluate expression of
Peq-pgp-11 and Peq-pgp-16 using a novel multiple nucleic acid hybridization method. This
method allowed for visualization of individual mRNA transcripts within fixed tissue sections of
Parascaris adults. Our investigation revealed expression of Peq-pgp-11 and Peq-pgp-16 in the
intestine, body wall, nerves, lateral cords, and reproductive tissues of male and female parasites.
These results suggest that P-gp could efflux drugs locally at the level of parasite neuronal tissue
as well as at sites of entry for drugs such as the hypodermis and intestine. The multiple nucleic
acid hybridization method could be useful for providing tissue context for gene expression in a
variety of nematode parasites.
129
1. Introduction
Parascaris spp. is a cosmopolitan ascarid nematode that inhabits the small intestine of
equids. These large nematodes reach up to 30 cm in length and are known to cause malnutrition
and intestinal impaction when present in large numbers. Unfortunately, this parasite has
developed resistance to macrocyclic lactone (ML) anthelmintics including ivermectin and
moxidectin (Boersema et al., 2002). The first report of drug resistance in the United States was
published in 2007 (Craig et al., 2007). Resistance is now considered to be relatively widespread
in Europe and North America (Peregrine et al., 2014). Drug resistance has also been reported in
Parascaris in South America (Molento et al., 2008), Oceania (Beasley et al., 2015; Bishop et al.,
2014) and Asia (Shah et al., 2016). These findings have prompted the implementation of
measures designed to delay the development of resistance in susceptible populations (Nielsen,
2016).
The ML group of anthelmintics includes the avermectins and milbemycins. These agents
selectively act on glutamate-gated chloride channels of invertebrates causing a slow and
permanent state of hyperpolarization due to excessive chloride ion influx leading to paralysis
(Wolstenholme, 2012). The effects are concentration-dependent, but species-specific differences
in potency due to biochemical and pharmacological differences have been demonstrated (Geary
and Moreno, 2012). Resistance to the ML anthelmintics has often been attributed to mutations
and decreased expression of glutamate-gated chloride channels (Whittaker et al., 2017).
However, an understanding of other mechanisms of resistance is beginning to emerge, and
includes metabolism by cytochrome P450 (Riga et al., 2014), and efflux due to overexpression
by ABCB1 transporter family (James and Davey, 2009; Xu et al., 1998).
For several parasites of veterinary importance, there is a growing body of evidence that
resistance to ML is, at least in part, mediated by ABC transporters (P-glycoproteins) (Whittaker
130
et al., 2017). P-glycoproteins (Pgps) are members of the ATP-binding cassette transporter family
that are well known to modulate drug resistance in bacteria and neoplastic tissues (Davidson and
Chen, 2004; Licht et al., 1994). In helminths, P-gps are thought to contribute to drug resistance
by effluxing anthelmintics away from their molecular target. P-gps associated with ML
resistance have been characterized in several nematode parasites including the trichostrongyle
Haemonchus contortus (Godoy et al., 2015a, 2016; Godoy et al., 2015b; Xu et al., 1998),
cyathostomins (Drogemuller et al., 2004; Kaschny et al., 2015), and the filarid Dirofilaria
immitis (Bourguinat et al., 2016; Mani et al., 2016).
Recent evidence suggests that increased levels of P-gp expression are highly correlated
with reduced susceptibility of Parascaris to MLs (Janssen et al., 2013a). Two P-gp genes, Peq-
pgp-11 and Peq-pgp-16, have been identified. Of these two P-gp genes, it appears that Peq-pgp-
11 is more strongly associated with resistance (Janssen et al., 2013a).Decreased susceptibility to
MLs has been demonstrated with transgenically expressed Peq-pgp-11 in C. elegans (Janssen et
al., 2015). It is thought that the ML resistant phenotype occurs when expression of Peq-pgp-11 is
high, however, the factors regulating this expression are not well characterized (Nielsen et al.,
2014).
Pgp-11 orthologs that alter susceptibility to MLs have been shown to occur in other
parasitic nematodes including D. immitis (Mani et al., 2016), Cooperia oncophora (De Graef et
al., 2013), H. contortus (Raza et al., 2016b) and non-parasitic Caenorhabditis elegans (Bygarski
et al., 2014). Pgp-16 orthologs occur in H. contortus (Godoy et al., 2015a) and in C. oncophora
(Demeler et al., 2013; Tydén et al., 2014) with expression levels increased after ML exposure in
the latter. In contrast Pgp-16 orthologs were not found in C. elegans (Issouf et al., 2014).
131
In Parascaris, tissue-specific expression of P-gp has been investigated by dissecting
worm tissues and amplifying expressed genes by PCR (Janssen et al., 2013a). However, this
preparation method precludes making clean preparations of tortuous linear organs such as the
testes (Janssen et al., 2013a), and makes studying localization in nerve cords, and lateral cords
impossible due to their small size. To overcome these obstacles, expression of P-gps can be
studied in situ in sections of worm tissue that allow the preservation of anatomy and tissue
architecture.
We examined P-gp expression using an in situ multiple nucleic acid RNA hybridization
method that allowed visualization of individual mRNA transcripts through a novel signal
amplification technique (Wang et al., 2012a). This method utilizes a double Z probe design
based on a target mRNA with the base of the Z having a complementary binding sequence. The
18- to 25- nucleotide base and the 14- nucleotide tail of the Z are connected by a spacer. Binding
of two adjacent Z probes allows the formation of a 28 nucleotide binding site made of two tails
of the Z probes. A preamplifier binds to the site, and is turn bound by an amplifier, which is
bound by an alkaline phosphatase labeled signal amplifying probe. A chromogenic substrate is
added that allows visualization. The chromogenic signal, indicating an individual mRNA
transcript, can be viewed as a punctate dot by light microscopy. The aim of this present study
was to determine the tissue distribution of Peq-pgp-11 and Peq-pgp-16 as determined by
multiple nucleic acid RNA hybridization.
2. Materials and methods
2.1. Parasites
Adult male and female Parascaris were obtained opportunistically from foals necropsied
at the College of Veterinary Medicine, Iowa State University. All procedures were conducted in
accordance with applicable institutional animal care and use committee protocols and guidelines.
132
Adult worms were fixed in 10% neutral buffered formalin (NBF) (Fisher Scientific, NJ)
for 22 h. Ten percent NBF was injected into the worms to fix internal organs, and the whole
worms were placed in 10% NBF. Four segments from each of three body regions (anterior,
middle, posterior) were excised from a male and female worm and embedded in paraffin blocks.
Five μm tissue sections were prepared on microscope slides by standard histological procedures
in the Department of Veterinary Pathology at Iowa State University.
2.2. Probe targets
Probes for chromogenic multiple nucleic acid in situ mRNA hybridization were obtained
from Advanced Cell Diagnostics (Hayward, CA). Multiple nucleic acid probes targeting the
nucleotides 687–2489 of Peq-pgp-11 (GenBank Accession number JX308230.1) and nucleotides
2592–3541 of Peq-pgp-16 (GenBank Accession number JX308231.1) were used. A positive
control probe targeted the nucleotides 5–1305 of Peq-beta-tubulin (GenBank Accession number
JN034256.1), a component of the eukaryotic cytoskeleton. This probe could also weakly bind
isotype 2 of P. equorum β-tubulin (GenBank Accession number KC713798.1). A negative
control probe was designed to target the nucleotides 414–862 of the dapB sequence of Bacillus
subtilis (GenBank Accession number EF191515), encoding the bacterial enzyme
dihydrodipicolinate reductase. Proprietary programs were used to assure target probe specificity.
Probes were stored at 4 °C and used according to the manufacturer's protocol.
Chromogenic in situ mRNA hybridization was performed using RNAscope 2.5 HD
Assay - Red reagents (Advanced Cell Diagnostics, Hayward, CA) on 5 μm thick sections of the
adult worms and mounted according to the manufacturer's protocol. Fast Red was used as
substrate for alkaline phosphatase in the chromogenic reaction.
133
2.3. Analysis
Photomicrographs were obtained on Olympus BX40 and BX60 microscopes with an
Olympus DP70 camera using CellSens software (Olympus, Waltham, MA). The intestine, body
wall, lateral cords with excretory canals, dorsal, and ventral nerve cords were examined. The
ovaries, uteri, and testes were examined when present. Signal was measured from n = 5 images
from each of 3 tissue sections obtained from each body region (anterior, middle, posterior).
Hybridization signal was resolved as punctate, stained spots located within parasite tissues.
Areas of positive signal were measured using the ISH 2.2/RNAscope module of HALO image
analysis software (Indica Labs, Advanced Cell Diagnostics, Hayward, CA). Ratio of probe
hybridization area to total tissue area was calculated and used for data analysis. Differences in
expression levels were compared among tissues as well as within individual tissues across
anterior, middle and posterior of the worms by one-way ANOVA with Tukey-Kramer HSD
(Honestly Significant Difference) post-hoc test on SAS JMP Pro 12.
3. Results
3.1. Multiple nucleic acid hybridization is sensitive and specific for Parascaris P-gp
To characterize the tissue-specific expression of Peq-pgp-11 and Peq-pgp-16, adult worm
tissues were analyzed with a multiple nucleic acid hybridization technique. Multiple nucleic acid
hybridization allows for specific signal amplification, with low background, resulting in
individual mRNA transcripts appearing as distinct spots in tissue sections. Probes binding
Bacillus subtilis DapB was used as the negative control for the assay. No positive signal
indicative of DapB mRNA was found in any of the organs examined (Figure 5-S1). Parascaris
β-tubulin was used as the positive control for the assay. Positive signal indicative of β-tubulin
mRNA was found to be highly expressed in all the organs examined (Figure 5-S1).
134
3.2. Qualitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in Parascaris
Positive signal indicative of Peq-pgp-11 mRNA and Peq-pgp-16 mRNA visualized as
red-pink dots were found in a variety of parasite tissues. Histologic features and location of
mRNA hybridization are presented in Figure 5-1 (male) and Figure 5-2 (female) and described
below.
3.2.1. Body wall
The ascarid body wall is typically composed of three distinct layers - a cuticle,
hypodermis and a single layer of coelomyarian muscle cells (Watson, 1965). Red-pink dots
indicative of Peq-pgp-11 and Peq-pgp-16 mRNA were visualized in the hypodermis and in the
muscle cells, but not in the cuticle in sections of male and female worms.
3.2.2. Intestine
Intestines of ascarids consist of a single layer of epithelial cells with an apical microvilli/
bacillary layer and a layer of dense cytoplasm on the luminal side called a plasma cap. The basal
part has a basal lamella and an outer mesenteric membrane. Brown granular inclusions were
present in sections of the intestines, typical of the ascarid gut (Kessel et al., 1961). These features
are of note so as not to confuse them with nucleic acid hybridization signal. Peq-pgp-11 and
Peq-pgp-16 mRNA was visualized in moderate numbers throughout the cell including around the
nuclear envelope, but was absent at the microvilli, plasma cap, basal lamella and mesenteric
membrane in both male and female worms.
3.2.3. Lateral cords
Ascarids have a H-shaped excretory system that is embedded in the lateral lines and
extend from the nerve ring to about the middle of the body as a continuous canal with a lumen,
after which the canal appears to degenerate. The lateral line tissue also contributes to this
drainage through the many intercellular spaces that it contains (Dankwarth, 1971). Peq-pgp-11
135
mRNA and Peq-pgp-16 mRNA were noted in the central excretory canal and in the tissue of the
lateral lines in both male and female worms in very low numbers.
3.2.4. Nerve cords
The dorsal and ventral nerve cords, which are the major components of the ascarid
nervous system, originate at the nerve ring and run along the length of the body (del Castillo et
al., 1989). Peq-pgp-11 mRNA and Peq-pgp-16 mRNA were visualized in the dorsal and ventral
nerve cords in very low numbers in male and female worms.
3.2.5. Male reproductive tissue
The male ascarid reproductive tissue consists of a single convoluted, tubular testis,
seminal vesicle and a terminal vas deferens (Foor, 1976). Peq-pgp-11 mRNA and Peq-pgp-16
mRNA were seen in all parts of the male reproductive tissue in low numbers.
3.2.6. Female reproductive tissue
The female reproductive tissue consists of convoluted tubular ovaries lined by a single
layer of simple cuboidal epithelium, that eventually become two tubular uteri proceeding
anteriorly, and which terminate in a single uterus with simple cuboidal to columnar epithelium
with the presence of some free intercellular space, depending on their location in the body
(Lýsek and Ondrus, 1992). Peq-pgp-11 mRNA and Peq-pgp-16 mRNA were visualized in low
numbers in the ovaries and uterus.
Our results demonstrate that Peq-pgp-11 and Peq-pgp-16 mRNA expression could be
qualitatively visualized using multiple nucleic acid hybridization in situ in the enterocytes of the
intestines, hypodermis and coelomyarian muscles of the body wall, epithelia of the ovaries and
uteri in the female, cells of the reproductive tract in the male, excretory canal, lateral line, and
nerve cords. These findings are generally in agreement with P-gp expression data assessed by
qPCR (Janssen et al., 2013a).
136
3.3. Quantitative analysis of Peq-pgp-11 and Peq-pgp-16 mRNA expressed in Parascaris
In order to make comparisons of signal among tissues, positive signal was quantified as
dots per μm2 for each probe. Expression levels of Peq-pgp-11 mRNA and Peq-pgp-16 mRNA
relative to beta tubulin mRNA (positive control probe) were analyzed (Figure 5-3, Figure 5-4).
Expression levels were also analyzed in each organ in sections from the anterior, middle and
posterior of the worms (Figure 5-5 and Figure 5-6 ).
In male parasites, overall expression of Peq-pgp-11 was significantly higher in the
intestine and reproductive tissue (which were not significantly different from each other) than in
the body wall, nerve cords and lateral cords (Figure 5-3A). In contrast, expression of Peq-pgp-16
mRNA was not significantly different among the tissues studied (Figure 5-3B). However,
significant differences in the relative expression levels of Peq-pgp-11 and Peq-pgp-16 mRNA
were observed in body wall, intestine, nerve cord and reproductive tissue when comparing the
anterior, middle and posterior regions of the parasite. (Figure 5-5).
In female parasites, overall expression of Peq-pgp-11 was significantly higher in the
intestine when compared with the body wall, ovaries, uterus, lateral and nerve cords (Figure 5-
4A). Similarly, expression of Peq-pgp-16 was significantly higher in the intestine when
compared to all other tissues studied (Figure 5-4B). Significant differences of relative expression
of Peq-pgp-11 and Peq-pgp-16 were observed in the body wall, intestine, nerve cords and uterus
when comparing the anterior, middle and posterior regions of the parasite (Figure 5-6).
Thus, Peq-pgp-11 and Peq-pgp-16 mRNA expression could be quantitatively analyzed
using multiple nucleic acid hybridization in the tissues of male and female worms, and this was
in agreement with the previously published report for Peq-pgp-11 (Janssen et al., 2013).
Comparisons between expression levels in the same organs in different sections of the worms
were also possible with this technique.
137
4. Discussion
P-glycoproteins have been associated with macrocyclic lactone resistance in nematode
parasites, including Parascaris. This is the first study to examine in situ P-glycoprotein mRNA
localization in an ascarid or equine nematode parasite. More broadly, our results suggest the
multiple nucleic acid hybridization technique can be used as a quantitative measure of mRNA
transcripts in parasitic nematodes.
Previously, localization studies have been conducted using antibody-based detection of
P-gp protein in tissues of Clade V nematodes. In transgenic C. elegans, Cel-Pgp-3 and Cel-Pgp-
1 proteins localized to the apical membranes of the excretory and intestinal cells and the anterior
pharynx (Broeks et al., 1995). In Haemonchus contortus, antibodies developed by immunization
with synthesized peptides detected Hco-Pgp-2 in the pharynx, lateral nerve cords, deirids and
mid-intestine (Godoy et al., 2015b). A monoclonal antibody targeting human P-gp bound to the
cuticle, eggs, and intestinal cells of H. contortus (Riou et al., 2005). Fewer studies have assessed
the localization of P-gp mRNA transcripts in situ. In H. contortus, in situ hybridization revealed
that mRNA of Pgp-A (Hco-Pgp-2) was present in the worm gut, anterior to the pharyngeal
intestinal junction, lateral cords, vas deferens and spicules, with no significant differences being
observed in males or females (Smith and Prichard, 2002).
In the present study, multiple nucleic acid hybridization revealed significant levels of
Peq-pgp-11 transcripts in the intestines of both sexes and in the reproductive tissue of the male
and significant levels of Peq-pgp-16 mRNA transcripts in the intestines of male and female
Parascaris. This technique has a significant advantage over worm dissection and qPCR, as
tubular organs such as the testes that take significant skill to isolate without contamination. In
addition, small organs such as nerve cords can be studied in the context of the surrounding
tissues.
138
P-glycoproteins are thought to efflux MLs out of cells and prevent drug binding to
nematode glutamate-gated chloride channels. It is unclear if Pgp-mediated drug efflux acts at a
local level, near nematode nervous tissues expressing ion channels. Another possibility is that P-
gp eliminates anthelmintics at the level of the nematode body wall or intestine, which may
initially encounter the drug. Alternatively, P-gp efflux could trap anthelmintics in specific tissue
compartments thereby sequestering them away from target receptors. In order to develop a model
for understanding Pgp-mediated ML resistance, it is important to determine the location and
expression patterns of Pgps.
Detection of P-gp transcripts in some cell types suggests that P-gps could prevent entry of
ML into the body of the nematode. P-gp mRNA was visualized in the hypodermis and in the
coelomyarian musculature. Since transcuticular diffusion of anthelmintics has been demonstrated
in ascarids (Alvarez et al., 2001; Martin et al., 1992), anthelmintic efflux could be relevant at the
level of the body wall. High levels of P-gp were also observed within intestinal cells. In
mammals, the intestinal epithelium is the first line of defense and effluxes many foreign
substances. There is a possibility that ingested anthelmintics are effluxed at the level of the
intestine, thereby preventing their entry into the body of the nematode.
P-gp transcripts were also visualized, albeit in lower numbers, in the lateral cords through
which the excretory canal passes (Martin et al., 1992; Sanglas et al., 2009). It has been postulated
that since nematodes lack a liver or kidneys, drug and xenobiotic clearance occurs through the
excretory canal by P-glycoproteins on the surface of cell membranes (Broeks et al., 1995). In
Ascaris, vacuolated cells of the lateral cords absorb ML from the peri-enteric fluid (Martin et al.,
1992). Thus, the presence of P-gps in the lateral cords may enable drug efflux into the excretory
139
canal causing a reduction in effective concentration of the drug at other active sites in the
parasite.
In mammals, nervous system P-gps exclude xenobiotics at the level of the blood brain
barrier (de Boer et al., 2003). In the present study, P-gp mRNA was visualized in low numbers in
the dorsal and ventral nerve cords. One binding site for MLs is in the outer monolayer of the
plasma membrane of muscle cells and nerve-cords (Martin et al., 1992), therefore, efflux of
anthelmintics could also be relevant at the level of the nerves bearing ligand-gated ion channels.
Thus, although the mammalian body components are different structurally, the function of Pgp-
mediated neuroprotection could be similar.
P-gp mRNA was visualized in the reproductive tissues of both the male and female
worms. Increased uterine expression of Peq-pgp-11 and Peq-pgp-16 has also been detected by
PCR for Parascaris (Janssen et al., 2013a). Uterine muscles are sites of action of for MLs and
the presence of P-gps in the uterus and uterine muscles has been proposed (Godoy et al., 2015a;
Prichard, 2001). However, the potential function of P-gps in the male reproductive organs such
as the testis, vas deferens, and seminal vesicles are largely unknown.
Overall, the multiple nucleic acid hybridization method is useful for detecting specific
transcripts within tissues of nematodes. The present study suggests that Peq-pgp-11 and Peq-
pgp-16 mRNAs are expressed in many tissues of Parascaris. Our results indicate that P-gps
could protect nematodes from anthelmintics locally, at the level of the neuron, but also at sites of
entry such as the hypodermis and intestine. The parasites studied in this report were not known
to be drug-resistant, so it appears these P-gps are expressed constitutively in a variety of tissues.
Therefore, ML-induced hyperexpression or post-translational changes in P-gps require additional
investigation. The multiple nucleic acid hybridization approach can be used in combination with
140
protein-detection techniques to enable future studies comparing drug-resistant and -susceptible
nematodes.
Acknowledgement
This research was supported by start-up funds from the Iowa State University College of
Veterinary Medicine provided to MTB.
5. References
Abdelfatah, S.A., Efferth, T., 2015. Cytotoxicity of the indole alkaloid reserpine from Rauwolfia
serpentina against drug-resistant tumor cells. Phytomedicine 22, 308-318.
Abo-Shehada, M.N., Herbert, I.V., 1984. Anthelmintic effect of levamisole, ivermectin,
albendazole and fenbendazole on larval Toxocara canis infection in mice. Res Vet Sci 36,
87-91.
Albrecht, C., Viturro, E., 2007. The ABCA subfamily--gene and protein structures, functions and
associated hereditary diseases. Pflugers Arch 453, 581-589.
AlGusbi, S., Krücken, J., Ramünke, S., von Samson-Himmelstjerna, G., Demeler, J., 2014.
Analysis of putative inhibitors of anthelmintic resistance mechanisms in cattle
gastrointestinal nematodes. Int J Parasitol 44, 647-658.
Ali, M.Y., Siddiqui, S.S., 2000. cDNA cloning and expression of a C-terminus motor kinesin-
like protein KLP-17, involved in chromosomal movement in Caenorhabditis elegans.
Biochem Biophys Res Commun 267, 643-650.
Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M., Trinh, Y.T.,
Zhang, Q., Urbatsch, I.L., Chang, G., 2009. Structure of P-glycoprotein reveals a
molecular basis for poly-specific drug binding. Science 323, 1718-1722.
Alvarez, L., Lifschitz, A., Entrocasso, C., Manazza, J., Mottier, L., Borda, B., Virkel, G.,
Lanusse, C., 2008. Evaluation of the interaction between ivermectin and albendazole
following their combined use in lambs. J Vet Pharmacol Ther 31, 230-239.
Alvarez, L., Suarez, G., Ceballos, L., Moreno, L., Canton, C., Lifschitz, A., Maté, L., Ballent,
M., Virkel, G., Lanusse, C., 2015. Integrated assessment of ivermectin pharmacokinetics,
efficacy against resistant Haemonchus contortus and P-glycoprotein expression in lambs
treated at three different dosage levels. Vet Parasitol 210, 53-63.
Alvarez, L.I., Mottier, M.L., Sánchez, S.F., Lanusse, C.E., 2001. Ex vivo diffusion of
albendazole and its sulfoxide metabolite into ascaris suum and Fasciola hepatica.
Parasitol Res 87, 929-934.
141
Alvarez-Sánchez, M.A., Pérez García, J., Bartley, D., Jackson, F., Rojo-Vázquez, F.A., 2005.
The larval feeding inhibition assay for the diagnosis of nematode anthelmintic resistance.
Exp Parasitol 110, 56-61.
Alvinerie, M., Dupuy, J., Kiki-Mvouaka, S., Sutra, J.F., Lespine, A., 2008. Ketoconazole
increases the plasma levels of ivermectin in sheep. Vet Parasitol 157, 117-122.
Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M., Pastan, I., Gottesman, M.M., 1999.
Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu
Rev Pharmacol Toxicol 39, 361-398.
Aranda, P.S., LaJoie, D.M., Jorcyk, C.L., 2012. Bleach gel: a simple agarose gel for analyzing
RNA quality. Electrophoresis 33, 366-369.
Ardelli, B.F., Stitt, L.E., Tompkins, J.B., 2010. Inventory and analysis of ATP-binding cassette
(ABC) systems in Brugia malayi. Parasitology 137, 1195-1212.
Areskog, M., Engström, A., Tallkvist, J., von Samson-Himmelstjerna, G., Höglund, J., 2013.
PGP expression in Cooperia oncophora before and after ivermectin selection. Parasitol
Res 112, 3005-3012.
Ballent, M., Lifschitz, A., Virkel, G., Sallovitz, J., Lanusse, C., 2007. Involvement of P-
glycoprotein on ivermectin kinetic behaviour in sheep: itraconazole-mediated changes on
gastrointestinal disposition. J Vet Pharmacol Ther 30, 242-248.
Barclay, J.W., Morgan, A., Burgoyne, R.D., 2012. Neurotransmitter release mechanisms studied
in Caenorhabditis elegans. Cell Calcium 52, 289-295.
Bartley, D.J., McAllister, H., Bartley, Y., Dupuy, J., Ménez, C., Alvinerie, M., Jackson, F.,
Lespine, A., 2009. P-glycoprotein interfering agents potentiate ivermectin susceptibility
in ivermectin sensitive and resistant isolates of Teladorsagia circumcincta and
Haemonchus contortus. Parasitology 136, 1081-1088.
Bartley, D.J., Morrison, A.A., Dupuy, J., Bartley, Y., Sutra, J.F., Menez, C., Alvinerie, M.,
Jackson, F., Devin, L., Lespine, A., 2012. Influence of Pluronic 85 and ketoconazole on
disposition and efficacy of ivermectin in sheep infected with a multiple resistant
Haemonchus contortus isolate. Vet Parasitol 187, 464-472.
Bazzocchi, C., Mortarino, M., Grandi, G., Kramer, L.H., Genchi, C., Bandi, C., Genchi, M.,
Sacchi, L., McCall, J.W., 2008. Combined ivermectin and doxycycline treatment has
microfilaricidal and adulticidal activity against Dirofilaria immitis in experimentally
infected dogs. Int J Parasitol 38, 1401-1410.
Beasley, A., Coleman, G., Kotze, A.C., 2015. Suspected ivermectin resistance in a south-east
Queensland Parascaris equorum population. Aust Vet J 93, 305-307.
Beech, R.N., Skuce, P., Bartley, D.J., Martin, R.J., Prichard, R.K., Gilleard, J.S., 2011.
Anthelmintic resistance: markers for resistance, or susceptibility? Parasitology 138, 160-
174.
Beech, R.N., Wolstenholme, A.J., Neveu, C., Dent, J.A., 2010. Nematode parasite genes: what's
in a name? Trends Parasitol 26, 334-340.
142
Beugnet, F., Gauthey, M., Kerboeuf, D., 1997. Partial in vitro reversal of benzimidazole
resistance by the free-living stages of Haemonchus contortus with verapamil. Vet Rec
141, 575-576.
Bishop, R.M., Scott, I., Gee, E.K., Rogers, C.W., Pomroy, W.E., Mayhew, I.G., 2014. Sub-
optimal efficacy of ivermectin against Parascaris equorum in foals on three
Thoroughbred stud farms in the Manawatu region of New Zealand. N Z Vet J 62, 91-95.
Blackhall, W.J., Liu, H.Y., Xu, M., Prichard, R.K., Beech, R.N., 1998a. Selection at a P-
glycoprotein gene in ivermectin- and moxidectin-selected strains of Haemonchus
contortus. Mol Biochem Parasitol 95, 193-201.
Blackhall, W.J., Pouliot, J.F., Prichard, R.K., Beech, R.N., 1998b. Haemonchus contortus:
selection at a glutamate-gated chloride channel gene in ivermectin- and moxidectin-
selected strains. Exp Parasitol 90, 42-48.
Blackhall, W.J., Prichard, R.K., Beech, R.N., 2008. P-glycoprotein selection in strains of
Haemonchus contortus resistant to benzimidazoles. Vet Parasitol 152, 101-107.
Blanchard, A., Guégnard, F., Charvet, C.L., Crisford, A., Courtot, E., Sauvé, C., Harmache, A.,
Duguet, T., O'Connor, V., Castagnone-Sereno, P., Reaves, B., Wolstenholme, A.J.,
Beech, R.N., Holden-Dye, L., Neveu, C., 2018. Deciphering the molecular determinants
of cholinergic anthelmintic sensitivity in nematodes: When novel functional validation
approaches highlight major differences between the model Caenorhabditis elegans and
parasitic species. PLoS Pathog 14, e1006996.
Blaxter, M., Liu, L., 1996. Nematode spliced leaders--ubiquity, evolution and utility. Int J
Parasitol 26, 1025-1033.
Blaxter, M.L., De Ley, P., Garey, J.R., Liu, L.X., Scheldeman, P., Vierstraete, A., Vanfleteren,
J.R., Mackey, L.Y., Dorris, M., Frisse, L.M., Vida, J.T., Thomas, W.K., 1998. A
molecular evolutionary framework for the phylum Nematoda. Nature 392, 71-75.
Boersema, J.H., Eysker, M., Nas, J.W., 2002. Apparent resistance of Parascaris equorum to
macrocylic lactones. Vet Rec 150, 279-281.
Bourguinat, C., Che, H., Mani, T., Keller, K., Prichard, R.K., 2016. ABC-B transporter genes in
Dirofilaria immitis. Int J Parasitol Drugs Drug Resist 6, 116-124.
Bourguinat, C., Keller, K., Bhan, A., Peregrine, A., Geary, T., Prichard, R., 2011a. Macrocyclic
lactone resistance in Dirofilaria immitis. Vet Parasitol 181, 388-392.
Bourguinat, C., Keller, K., Blagburn, B., Schenker, R., Geary, T.G., Prichard, R.K., 2011b.
Correlation between loss of efficacy of macrocyclic lactone heartworm anthelmintics and
P-glycoprotein genotype. Vet Parasitol 176, 374-381.
Briz, O., Perez-Silva, L., Al-Abdulla, R., Abete, L., Reviejo, M., Romero, M.R., Marin, J.J.G.,
2019. What "The Cancer Genome Atlas" database tells us about the role of ATP-binding
cassette (ABC) proteins in chemoresistance to anticancer drugs. Expert Opin Drug Metab
Toxicol 15, 577-593.
143
Broeks, A., Gerrard, B., Allikmets, R., Dean, M., Plasterk, R.H., 1996. Homologues of the
human multidrug resistance genes MRP and MDR contribute to heavy metal resistance in
the soil nematode Caenorhabditis elegans. EMBO J 15, 6132-6143.
Broeks, A., Janssen, H.W., Calafat, J., Plasterk, R.H., 1995. A P-glycoprotein protects
Caenorhabditis elegans against natural toxins. EMBO J 14, 1858-1866.
Burke, T.M., Roberson, E.L., 1983. Fenbendazole treatment of pregnant bitches to reduce
prenatal and lactogenic infections of Toxocara canis and Ancylostoma caninum in pups. J
Am Vet Med Assoc 183, 987-990.
Bygarski, E.E., Prichard, R.K., Ardelli, B.F., 2014. Resistance to the macrocyclic lactone
moxidectin is mediated in part by membrane transporter P-glycoproteins: Implications for
control of drug resistant parasitic nematodes. Int J Parasitol Drugs Drug Resist 4, 143-
151.
Bártíková, H., Vokřál, I., Kubíček, V., Szotáková, B., Prchal, L., Lamka, J., Várady, M.,
Skálová, L., 2012. Import and efflux of flubendazole in Haemonchus contortus strains
susceptible and resistant to anthelmintics. Vet Parasitol 187, 473-479.
Carrillo, M., Barriga, O.O., 1987. Anthelmintic effect of levamisole hydrochloride or ivermectin
on tissue toxocariasis of mice. Am J Vet Res 48, 281-283.
Chan, L.Y., Yim, E.K., Choo, A.B., 2013. Normalized median fluorescence: an alternative flow
cytometry analysis method for tracking human embryonic stem cell states during
differentiation. Tissue Eng Part C Methods 19, 156-165.
Churcher, T.S., Pion, S.D., Osei-Atweneboana, M.Y., Prichard, R.K., Awadzi, K., Boussinesq,
M., Collins, R.C., Whitworth, J.A., Basáñez, M.G., 2009. Identifying sub-optimal
responses to ivermectin in the treatment of River Blindness. Proc Natl Acad Sci U S A
106, 16716-16721.
Conrad, S., Viertelhaus, A., Orzechowski, A., Hoogstraate, J., Gjellan, K., Schrenk, D.,
Kauffmann, H.M., 2001. Sequencing and tissue distribution of the canine MRP2 gene
compared with MRP1 and MDR1. Toxicology 156, 81-91.
Consortium, I.H.G., 2019. Comparative genomics of the major parasitic worms. Nat Genet 51,
163-174.
Corpet, F., 1988. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res
16, 10881-10890.
Craig, T.M., Diamond, P.L., Ferwerda, N.S., Thompson, J.A., 2007. Evidence of ivermectin
resistance by Parascaris equorum on a Texas horse farm. Journal of Equine Veterinary
Science 27, 67-71.
Cromie, L., Ferry, M., Couper, A., Fields, C., Taylor, S.M., 2006. Pharmacokinetics of a novel
closantel/ivermectin injection in cattle. J Vet Pharmacol Ther 29, 205-211.
Dankwarth, L., 1971. [Ultrastructure and function of the excretory organ of Ascaris lumbricoides
L. (Nematoda)]. Z Zellforsch Mikrosk Anat 113, 581-608.
144
Dassa, E., 2011. Natural history of ABC systems: not only transporters. Essays Biochem 50, 19-
42.
Dassa, E., Bouige, P., 2001. The ABC of ABCS: a phylogenetic and functional classification of
ABC systems in living organisms. Res Microbiol 152, 211-229.
David, M., Lebrun, C., Duguet, T., Talmont, F., Beech, R., Orlowski, S., André, F., Prichard,
R.K., Lespine, A., 2018. Structural model, functional modulation by ivermectin and
tissue localization of Haemonchus contortus P-glycoprotein-13. Int J Parasitol Drugs
Drug Resist 8, 145-157.
Davidson, A.L., Chen, J., 2004. ATP-binding cassette transporters in bacteria. Annu Rev
Biochem 73, 241-268.
Davidson, A.L., Dassa, E., Orelle, C., Chen, J., 2008. Structure, function, and evolution of
bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev 72, 317-364, table of
contents.
de Boer, A.G., van der Sandt, I.C., Gaillard, P.J., 2003. The role of drug transporters at the
blood-brain barrier. Annu Rev Pharmacol Toxicol 43, 629-656.
de Castro, E., Sigrist, C.J., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Gasteiger, E.,
Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature matches and
ProRule-associated functional and structural residues in proteins. Nucleic Acids Res 34,
W362-365.
De Graef, J., Demeler, J., Skuce, P., Mitreva, M., Von Samson-Himmelstjerna, G., Vercruysse,
J., Claerebout, E., Geldhof, P., 2013. Gene expression analysis of ABC transporters in a
resistant Cooperia oncophora isolate following in vivo and in vitro exposure to
macrocyclic lactones. Parasitology 140, 499-508.
del Castillo, J., Rivera, A., Solórzano, S., Serrato, J., 1989. Some aspects of the neuromuscular
system of Ascaris. Quarterly Journal of Experimental Physiology 74, 1071-1087.
Demeler, J., Kleinschmidt, N., Küttler, U., Koopmann, R., von Samson-Himmelstjerna, G.,
2012. Evaluation of the Egg Hatch Assay and the Larval Migration Inhibition Assay to
detect anthelmintic resistance in cattle parasitic nematodes on farms. Parasitol Int 61,
614-618.
Demeler, J., Krücken, J., AlGusbi, S., Ramünke, S., De Graef, J., Kerboeuf, D., Geldhof, P.,
Pomroy, W.E., von Samson-Himmelstjerna, G., 2013. Potential contribution of P-
glycoproteins to macrocyclic lactone resistance in the cattle parasitic nematode Cooperia
oncophora. Mol Biochem Parasitol 188, 10-19.
Demeler, J., Küttler, U., von Samson-Himmelstjerna, G., 2010. Adaptation and evaluation of
three different in vitro tests for the detection of resistance to anthelmintics in gastro
intestinal nematodes of cattle. Vet Parasitol 170, 61-70.
Dicker, A.J., Nath, M., Yaga, R., Nisbet, A.J., Lainson, F.A., Gilleard, J.S., Skuce, P.J., 2011a.
Teladorsagia circumcincta: the transcriptomic response of a multi-drug-resistant isolate to
ivermectin exposure in vitro. Exp Parasitol 127, 351-356.
145
Dicker, A.J., Nisbet, A.J., Skuce, P.J., 2011b. Gene expression changes in a P-glycoprotein (Tci-
pgp-9) putatively associated with ivermectin resistance in Teladorsagia circumcincta. Int
J Parasitol 41, 935-942.
Doligalska, M., Jóźwicka, K., Kiersnowska, M., Mroczek, A., Pączkowski, C., Janiszowska, W.,
2011. Triterpenoid saponins affect the function of P-glycoprotein and reduce the survival
of the free-living stages of Heligmosomoides bakeri. Vet Parasitol 179, 144-151.
Dolinská, M., Königová, A., Letková, V., Molnár, L., Várady, M., 2013. Detection of ivermectin
resistance by a larval development test--back to the past or a step forward? Vet Parasitol
198, 154-158.
Dong, M., Ladavière, L., Penin, F., Deléage, G., Baggetto, L.G., 1998. Secondary structure of P-
glycoprotein investigated by circular dichroism and amino acid sequence analysis.
Biochim Biophys Acta 1371, 317-334.
Dowling, P., 2006. Pharmacogenetics: it's not just about ivermectin in collies. Can Vet J 47,
1165-1168.
Doyle, S.R., Cotton, J.A., 2019. Genome-wide Approaches to Investigate Anthelmintic
Resistance. Trends Parasitol 35, 289-301.
Drogemuller, M., Schnieder, T., von Samson-Himmelstjerna, G., 2004. Evidence of p-
glycoprotein sequence diversity in cyathostomins. J Parasitol 90, 998-1003.
Dupuy, J., Alvinerie, M., Ménez, C., Lespine, A., 2010. Interaction of anthelmintic drugs with P-
glycoprotein in recombinant LLC-PK1-mdr1a cells. Chem Biol Interact 186, 280-286.
Dupuy, J., Larrieu, G., Sutra, J.F., Lespine, A., Alvinerie, M., 2003. Enhancement of moxidectin
bioavailability in lamb by a natural flavonoid: quercetin. Vet Parasitol 112, 337-347.
Durant, J.F., Irenge, L.M., Fogt-Wyrwas, R., Dumont, C., Doucet, J.P., Mignon, B., Losson, B.,
Gala, J.L., 2012. Duplex quantitative real-time PCR assay for the detection and
discrimination of the eggs of Toxocara canis and Toxocara cati (Nematoda,
Ascaridoidea) in soil and fecal samples. Parasit Vectors 5, 288.
Eckford, P.D., Sharom, F.J., 2005. The reconstituted P-glycoprotein multidrug transporter is a
flippase for glucosylceramide and other simple glycosphingolipids. Biochem J 389, 517-
526.
Evans, G.L., Ni, B., Hrycyna, C.A., Chen, D., Ambudkar, S.V., Pastan, I., Germann, U.A.,
Gottesman, M.M., 1995. Heterologous expression systems for P-glycoprotein: E. coli,
yeast, and baculovirus. J Bioenerg Biomembr 27, 43-52.
Fiel, C.A., Saumell, C.A., Steffan, P.E., Rodriguez, E.M., 2001. Resistance of Cooperia to
ivermectin treatments in grazing cattle of the Humid Pampa, Argentina. Vet Parasitol 97,
211-217.
Figueiredo, L.A., Rebouças, T.F., Ferreira, S.R., Rodrigues-Luiz, G.F., Miranda, R.C., Araujo,
R.N., Fujiwara, R.T., 2018. Dominance of P-glycoprotein 12 in phenotypic resistance
conversion against ivermectin in Caenorhabditis elegans. PLoS One 13, e0192995.
146
Fok, E., Kassai, T., 1998. Toxocara canis infection in the paratenic host: a study on the
chemosusceptibility of the somatic larvae in mice. Vet Parasitol 74, 243-259.
Foor, W.E., 1976. Structure and function of the glandular vas deferens in Ascaris suum
(Nematoda). J Parasitol 62, 849-864.
Garavelli, J.S., 2004. The RESID Database of Protein Modifications as a resource and annotation
tool. Proteomics 4, 1527-1533.
Gasbarre, L.C., Smith, L.L., Lichtenfels, J.R., Pilitt, P.A., 2009. The identification of cattle
nematode parasites resistant to multiple classes of anthelmintics in a commercial cattle
population in the US. Vet Parasitol 166, 281-285.
Geary, T.G., Moreno, Y., 2012. Macrocyclic lactone anthelmintics: spectrum of activity and
mechanism of action. Curr Pharm Biotechnol 13, 866-872.
Geary, T.G., Sims, S.M., Thomas, E.M., Vanover, L., Davis, J.P., Winterrowd, C.A., Klein,
R.D., Ho, N.F., Thompson, D.P., 1993. Haemonchus contortus: ivermectin-induced
paralysis of the pharynx. Exp Parasitol 77, 88-96.
Geary, T.G., Thompson, D.P., 2001. Caenorhabditis elegans: how good a model for veterinary
parasites? Vet Parasitol 101, 371-386.
Gems, D., Ferguson, C.J., Robertson, B.D., Nieves, R., Page, A.P., Blaxter, M.L., Maizels, R.M.,
1995. An abundant, trans-spliced mRNA from Toxocara canis infective larvae encodes a
26-kDa protein with homology to phosphatidylethanolamine-binding proteins. J Biol
Chem 270, 18517-18522.
Gill, J.H., Kerr, C.A., Shoop, W.L., Lacey, E., 1998. Evidence of multiple mechanisms of
avermectin resistance in haemonchus contortus--comparison of selection protocols. Int J
Parasitol 28, 783-789.
Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1991. Detection of resistance to ivermectin in
Haemonchus contortus. Int J Parasitol 21, 771-776.
Gill, J.H., Redwin, J.M., van Wyk, J.A., Lacey, E., 1995. Avermectin inhibition of larval
development in Haemonchus contortus--effects of ivermectin resistance. Int J Parasitol
25, 463-470.
Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2015a. Characterization of Haemonchus
contortus P-glycoprotein-16 and its interaction with the macrocyclic lactone
anthelmintics. Mol Biochem Parasitol 204, 11-15.
Godoy, P., Che, H., Beech, R.N., Prichard, R.K., 2016. Characterisation of P-glycoprotein-9.1 in
Haemonchus contortus. Parasit Vectors 9, 52.
Godoy, P., Lian, J., Beech, R.N., Prichard, R.K., 2015b. Haemonchus contortus P-glycoprotein-
2: in situ localisation and characterisation of macrocyclic lactone transport. Int J Parasitol
45, 85-93.
147
Goh, L.B., Spears, K.J., Yao, D., Ayrton, A., Morgan, P., Roland Wolf, C., Friedberg, T., 2002.
Endogenous drug transporters in in vitro and in vivo models for the prediction of drug
disposition in man. Biochem Pharmacol 64, 1569-1578.
Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New
algorithms and methods to estimate maximum-likelihood phylogenies: assessing the
performance of PhyML 3.0. Syst Biol 59, 307-321.
Guo, T., Huang, J., Zhang, H., Dong, L., Guo, D., Guo, L., He, F., Bhutto, Z.A., Wang, L., 2016.
Abcb1 in Pigs: Molecular cloning, tissues distribution, functional analysis, and its effect
on pharmacokinetics of enrofloxacin. Sci Rep 6, 32244.
Haslam, I.S., Simmons, N.L., 2014. Expression of the ABC transport proteins MDR1 (ABCB1)
and BCRP (ABCG2) in bovine rumen. J Comp Physiol B 184, 673-681.
Heckler, R.P., Almeida, G.D., Santos, L.B., Borges, D.G., Neves, J.P., Onizuka, M.K., Borges,
F.A., 2014. P-gp modulating drugs greatly potentiate the in vitro effect of ivermectin
against resistant larvae of Haemonchus placei. Vet Parasitol 205, 638-645.
Hibbs, R.E., Gouaux, E., 2011. Principles of activation and permeation in an anion-selective
Cys-loop receptor. Nature 474, 54-60.
Hirose, T., Horvitz, H.R., 2014. The translational regulators GCN-1 and ABCF-3 act together to
promote apoptosis in C. elegans. PLoS Genet 10, e1004512.
Howard, J.T., O'Nan, A.T., Maltecca, C., Baynes, R.E., Ashwell, M.S., 2015. Differential Gene
Expression across Breed and Sex in Commercial Pigs Administered Fenbendazole and
Flunixin Meglumine. PLoS One 10, e0137830.
Ince, T.A., Scotto, K.W., 1995. Differential utilization of multiple transcription start points
accompanies the overexpression of the P-glycoprotein-encoding gene in Chinese hamster
lung cells. Gene 156, 287-290.
Issouf, M., Guégnard, F., Koch, C., Le Vern, Y., Blanchard-Letort, A., Che, H., Beech, R.N.,
Kerboeuf, D., Neveu, C., 2014. Haemonchus contortus P-glycoproteins interact with host
eosinophil granules: a novel insight into the role of ABC transporters in host-parasite
interaction. PLoS One 9, e87802.
Jagodinsky, J.C., Akgun, U., 2015. Characterizing the binding interactions between P-
glycoprotein and eight known cardiovascular transport substrates. Pharmacol Res
Perspect 3, e00114.
James, C.E., Davey, M.W., 2009. Increased expression of ABC transport proteins is associated
with ivermectin resistance in the model nematode Caenorhabditis elegans. Int J Parasitol
39, 213-220.
Janssen, I.J., Krücken, J., Demeler, J., Basiaga, M., Kornaś, S., von Samson-Himmelstjerna, G.,
2013a. Genetic variants and increased expression of Parascaris equorum P-glycoprotein-
11 in populations with decreased ivermectin susceptibility. PLoS One 8, e61635.
148
Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2013b. Caenorhabditis
elegans: modest increase of susceptibility to ivermectin in individual P-glycoprotein loss-
of-function strains. Exp Parasitol 134, 171-177.
Janssen, I.J., Krücken, J., Demeler, J., von Samson-Himmelstjerna, G., 2015. Transgenically
expressed Parascaris P-glycoprotein-11 can modulate ivermectin susceptibility in
Caenorhabditis elegans. Int J Parasitol Drugs Drug Resist 5, 44-47.
Jesudoss Chelladurai, J., Brewer, M.T., 2019. Detection and quantification of Parascaris P-
glycoprotein drug transporter expression with a novel mRNA hybridization technique.
Vet Parasitol 267, 75-83.
Jex, A.R., Liu, S., Li, B., Young, N.D., Hall, R.S., Li, Y., Yang, L., Zeng, N., Xu, X., Xiong, Z.,
Chen, F., Wu, X., Zhang, G., Fang, X., Kang, Y., Anderson, G.A., Harris, T.W.,
Campbell, B.E., Vlaminck, J., Wang, T., Cantacessi, C., Schwarz, E.M., Ranganathan, S.,
Geldhof, P., Nejsum, P., Sternberg, P.W., Yang, H., Wang, J., Gasser, R.B., 2011.
Ascaris suum draft genome. Nature 479, 529-533.
Jin, M.S., Oldham, M.L., Zhang, Q., Chen, J., 2012. Crystal structure of the multidrug
transporter P-glycoprotein from Caenorhabditis elegans. Nature 490, 566-569.
Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., Madden, T.L., 2008.
NCBI BLAST: a better web interface. Nucleic Acids Res 36, W5-9.
Juliano, R.L., Ling, V., 1976. A surface glycoprotein modulating drug permeability in Chinese
hamster ovary cell mutants. Biochim Biophys Acta 455, 152-162.
Kabsch, W., Sander, C., 1983. Dictionary of protein secondary structure: pattern recognition of
hydrogen-bonded and geometrical features. Biopolymers 22, 2577-2637.
Karlgren, M., Simoff, I., Backlund, M., Wegler, C., Keiser, M., Handin, N., Müller, J.,
Lundquist, P., Jareborg, A.C., Oswald, S., Artursson, P., 2017. A CRISPR-Cas9
Generated MDCK Cell Line Expressing Human MDR1 Without Endogenous Canine
MDR1 (cABCB1): An Improved Tool for Drug Efflux Studies. J Pharm Sci 106, 2909-
2913.
Kaschny, M., Demeler, J., Janssen, I.J., Kuzmina, T.A., Besognet, B., Kanellos, T., Kerboeuf,
D., von Samson-Himmelstjerna, G., Krücken, J., 2015. Macrocyclic lactones differ in
interaction with recombinant P-glycoprotein 9 of the parasitic nematode Cylicocylus
elongatus and ketoconazole in a yeast growth assay. PLoS Pathog 11, e1004781.
Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Mol Biol Evol 30, 772-780.
Kellerová, P., Matoušková, P., Lamka, J., Vokřál, I., Szotáková, B., Zajíčková, M., Pasák, M.,
Skálová, L., 2019. Ivermectin-induced changes in the expression of cytochromes P450
and efflux transporters in Haemonchus contortus female and male adults. Vet Parasitol
273, 24-31.
Kenealy, J.S., 2019. Anthelmintic resistance in equine parasites: mechanisms and treatment
approaches. University of Kentucky, Lexington, KY.
149
Kerboeuf, D., Aycardi, J., Soubieux, D., 1996. Flow-cytometry analysis of sheep-nematode egg
populations. Parasitol Res 82, 358-363.
Kerboeuf, D., Chambrier, P., Le Vern, Y., Aycardi, J., 1999. Flow cytometry analysis of drug
transport mechanisms in Haemonchus contortus susceptible or resistant to anthelmintics.
Parasitol Res 85, 118-123.
Kerboeuf, D., Guégnard, F., 2011. Anthelmintics are substrates and activators of nematode P
glycoprotein. Antimicrob Agents Chemother 55, 2224-2232.
Kerboeuf, D., Guégnard, F., Vern, Y.L., 2003. Detection of P-glycoprotein-mediated multidrug
resistance against anthelmintics in Haemonchus contortus using anti-human mdr1
monoclonal antibodies. Parasitol Res 91, 79-85.
Kessel, R.G., Prestage, J.J., Sekhon, S.S., Smalley, R.L., Beams, H.W.C.F.p.d.J., 1961.
Cytological Studies on the Intestinal Epithelial Cells of Ascaris lumbricoides suum.
Transactions of the American Microscopical Society 80, 103-118.
Kim, Y., Chen, J., 2018. Molecular structure of human P-glycoprotein in the ATP-bound,
outward-facing conformation. Science 359, 915-919.
Kimchi-Sarfaty, C., Oh, J.M., Kim, I.W., Sauna, Z.E., Calcagno, A.M., Ambudkar, S.V.,
Gottesman, M.M., 2007. A "silent" polymorphism in the MDR1 gene changes substrate
specificity. Science 315, 525-528.
Korolnek, T., Zhang, J., Beardsley, S., Scheffer, G.L., Hamza, I., 2014. Control of metazoan
heme homeostasis by a conserved multidrug resistance protein. Cell Metab 19, 1008-
1019.
Kotze, A.C., Clifford, S., O'Grady, J., Behnke, J.M., McCarthy, J.S., 2004. An in vitro larval
motility assay to determine anthelmintic sensitivity for human hookworm and
Strongyloides species. Am J Trop Med Hyg 71, 608-616.
Kotze, A.C., Ruffell, A.P., Knox, M.R., Kelly, G.A., 2014. Relative potency of macrocyclic
lactones in in vitro assays with larvae of susceptible and drug-resistant Australian isolates
of Haemonchus contortus and H. placei. Vet Parasitol 203, 294-302.
Krämer, F., Hammerstein, R., Stoye, M., Epe, C., 2006. Investigations into the prevention of
prenatal and lactogenic Toxocara canis infections in puppies by application of moxidectin
to the pregnant dog. J Vet Med B Infect Dis Vet Public Health 53, 218-223.
Krücken, J., Fraundorfer, K., Mugisha, J.C., Ramünke, S., Sifft, K.C., Geus, D., Habarugira, F.,
Ndoli, J., Sendegeya, A., Mukampunga, C., Bayingana, C., Aebischer, T., Demeler, J.,
Gahutu, J.B., Mockenhaupt, F.P., von Samson-Himmelstjerna, G., 2017. Reduced
efficacy of albendazole against Ascaris lumbricoides in Rwandan schoolchildren. Int J
Parasitol Drugs Drug Resist 7, 262-271.
Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: Molecular Evolutionary
Genetics Analysis across Computing Platforms. Mol Biol Evol 35, 1547-1549.
150
Kuteykin-Teplyakov, K., Luna-Tortós, C., Ambroziak, K., Löscher, W., 2010. Differences in the
expression of endogenous efflux transporters in MDR1-transfected versus wildtype cell
lines affect P-glycoprotein mediated drug transport. Br J Pharmacol 160, 1453-1463.
Kwa, M.S., Okoli, M.N., Schulz-Key, H., Okongkwo, P.O., Roos, M.H., 1998. Use of P-
glycoprotein gene probes to investigate anthelmintic resistance in Haemonchus contortus
and comparison with Onchocerca volvulus. Int J Parasitol 28, 1235-1240.
Laing, R., Martinelli, A., Tracey, A., Holroyd, N., Gilleard, J.S., Cotton, J.A., 2016.
Haemonchus contortus: Genome Structure, Organization and Comparative Genomics.
Adv Parasitol 93, 569-598.
Le Jambre, L.F., Lenane, I.J., Wardrop, A.J., 1999. A hybridisation technique to identify
anthelmintic resistance genes in Haemonchus. Int J Parasitol 29, 1979-1985.
Le, S.Q., Gascuel, O., 2008. An improved general amino acid replacement matrix. Mol Biol Evol
25, 1307-1320.
Lebedeva, I.V., Pande, P., Patton, W.F., 2011. Sensitive and specific fluorescent probes for
functional analysis of the three major types of mammalian ABC transporters. PLoS One
6, e22429.
Lefort, V., Longueville, J.E., Gascuel, O., 2017. SMS: Smart Model Selection in PhyML. Mol
Biol Evol 34, 2422-2424.
Lespine, A., Dupuy, J., Orlowski, S., Nagy, T., Glavinas, H., Krajcsi, P., Alvinerie, M., 2006.
Interaction of ivermectin with multidrug resistance proteins (MRP1, 2 and 3). Chem Biol
Interact 159, 169-179.
Lespine, A., Martin, S., Dupuy, J., Roulet, A., Pineau, T., Orlowski, S., Alvinerie, M., 2007.
Interaction of macrocyclic lactones with P-glycoprotein: structure-affinity relationship.
Eur J Pharm Sci 30, 84-94.
Lespine, A., Ménez, C., Bourguinat, C., Prichard, R.K., 2012. P-glycoproteins and other
multidrug resistance transporters in the pharmacology of anthelmintics: Prospects for
reversing transport-dependent anthelmintic resistance. Int J Parasitol Drugs Drug Resist
2, 58-75.
Licht, T., Pastan, I., Gottesman, M., Herrmann, F., 1994. P-glycoprotein-mediated multidrug
resistance in normal and neoplastic hematopoietic cells. Ann Hematol 69, 159-171.
Lifschitz, A., Entrocasso, C., Alvarez, L., Lloberas, M., Ballent, M., Manazza, G., Virkel, G.,
Borda, B., Lanusse, C., 2010a. Interference with P-glycoprotein improves ivermectin
activity against adult resistant nematodes in sheep. Vet Parasitol 172, 291-298.
Lifschitz, A., Suarez, V.H., Sallovitz, J., Cristel, S.L., Imperiale, F., Ahoussou, S., Schiavi, C.,
Lanusse, C., 2010b. Cattle nematodes resistant to macrocyclic lactones: comparative
effects of P-glycoprotein modulation on the efficacy and disposition kinetics of
ivermectin and moxidectin. Exp Parasitol 125, 172-178.
151
Lifschitz, A., Virkel, G., Ballent, M., Sallovitz, J., Lanusse, C., 2009. Combined use of
ivermectin and triclabendazole in sheep: in vitro and in vivo characterisation of their
pharmacological interaction. Vet J 182, 261-268.
Lifschitz, A., Virkel, G., Sallovitz, J., Imperiale, F., Pis, A., Lanusse, C., 2002. Loperamide-
induced enhancement of moxidectin availability in cattle. J Vet Pharmacol Ther 25, 111-
120.
Liminga, G., Nygren, P., Larsson, R., 1994. Microfluorometric evaluation of calcein
acetoxymethyl ester as a probe for P-glycoprotein-mediated resistance: effects of
cyclosporin A and its nonimmunosuppressive analogue SDZ PSC 833. Exp Cell Res 212,
291-296.
Lindblom, T.H., Dodd, A.K., 2006. Xenobiotic detoxification in the nematode Caenorhabditis
elegans. J Exp Zool A Comp Exp Biol 305, 720-730.
Lloberas, M., Alvarez, L., Entrocasso, C., Virkel, G., Ballent, M., Mate, L., Lanusse, C.,
Lifschitz, A., 2013. Comparative tissue pharmacokinetics and efficacy of moxidectin,
abamectin and ivermectin in lambs infected with resistant nematodes: Impact of drug
treatments on parasite P-glycoprotein expression. Int J Parasitol Drugs Drug Resist 3, 20-
27.
Lucchetti, C., Genchi, M., Venco, L., Menozzi, A., Serventi, P., Bertini, S., Bazzocchi, C.,
Kramer, L.H., Vismarra, A., 2019. Differential ABC transporter gene expression in adult
Dirofilaria immitis males and females following in vitro treatment with ivermectin,
doxycycline or a combination of both. Parasit Vectors 12, 401.
Luo, X., Shi, X., Yuan, C., Ai, M., Ge, C., Hu, M., Feng, X., Yang, X., 2017. Genome-wide SNP
analysis using 2b-RAD sequencing identifies the candidate genes putatively associated
with resistance to ivermectin in Haemonchus contortus. Parasit Vectors 10, 31.
Lynagh, T., Lynch, J.W., 2010. A glycine residue essential for high ivermectin sensitivity in
Cys-loop ion channel receptors. Int J Parasitol 40, 1477-1481.
Lynagh, T., Lynch, J.W., 2012. Ivermectin binding sites in human and invertebrate Cys-loop
receptors. Trends Pharmacol Sci 33, 432-441.
Lýsek, H., Ondrus, J., 1992. Morphology of the uterus of Ascaris lumbricoides in the region
where fertilization and formation of egg-shell occur. Folia Parasitol (Praha) 39, 41-50.
Mani, T., Bourguinat, C., Keller, K., Ashraf, S., Blagburn, B., Prichard, R.K., 2016. Interaction
of macrocyclic lactones with a Dirofilaria immitis P-glycoprotein. Int J Parasitol 46, 631-
640.
Martin, R.J., Kusel, J.R., Robertson, S.J., Minta, A., Haugland, R.P., 1992. Distribution of a
fluorescent ivermectin probe, bodipy ivermectin, in tissues of the nematode parasite
Ascaris suum. Parasitol Res 78, 341-348.
Maté, L., Ballent, M., Cantón, C., Ceballos, L., Lifschitz, A., Lanusse, C., Alvarez, L., Liron,
J.P., 2018. Assessment of P-glycoprotein gene expression in adult stage of Haemonchus
contortus in vivo exposed to ivermectin. Vet Parasitol 264, 1-7.
152
McCall, J.W., 2005. The safety-net story about macrocyclic lactone heartworm preventives: a
review, an update, and recommendations. Vet Parasitol 133, 197-206.
McCall, J.W., Genchi, C., Kramer, L., Guerrero, J., Dzimianski, M.T., Supakorndej, P.,
Mansour, A.M., McCall, S.D., Supakorndej, N., Grandi, G., Carson, B., 2008.
Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 158, 204-214.
McDonald, M.K., Fritz, J.A., Jia, D., Scheuchner, D., Snyder, F.F., Stanislaus, A., Curle, J., Li,
L., Stabler, S.P., Allen, R.H., Mains, P.E., Gravel, R.A., 2017. Identification of ABC
transporters acting in vitamin B. Mol Genet Metab 122, 160-171.
Mealey, K.L., 2013. Adverse drug reactions in veterinary patients associated with drug
transporters. Vet Clin North Am Small Anim Pract 43, 1067-1078.
Mealey, K.L., Bentjen, S.A., Gay, J.M., Cantor, G.H., 2001. Ivermectin sensitivity in collies is
associated with a deletion mutation of the mdr1 gene. Pharmacogenetics 11, 727-733.
Mealey, K.L., Burke, N.S., 2015. Identification of a nonsense mutation in feline ABCB1. J Vet
Pharmacol Ther 38, 429-433.
Mealey, K.L., Dassanayake, S., Burke, N.S., 2017. Establishment of a cell line for assessing
drugs as canine P-glycoprotein substrates: proof of principle. J Vet Pharmacol Ther 40,
545-551.
Mealey, K.L., Fidel, J., 2015. P-glycoprotein mediated drug interactions in animals and humans
with cancer. J Vet Intern Med 29, 1-6.
Meli, V.S., Osuna, B., Ruvkun, G., Frand, A.R., 2010. MLT-10 defines a family of DUF644 and
proline-rich repeat proteins involved in the molting cycle of Caenorhabditis elegans. Mol
Biol Cell 21, 1648-1661.
Merola, V.M., Eubig, P.A., 2012. Toxicology of avermectins and milbemycins (macrocylic
lactones) and the role of P-glycoprotein in dogs and cats. Vet Clin North Am Small Anim
Pract 42, 313-333, vii.
Mitchell, A.L., Attwood, T.K., Babbitt, P.C., Blum, M., Bork, P., Bridge, A., Brown, S.D.,
Chang, H.Y., El-Gebali, S., Fraser, M.I., Gough, J., Haft, D.R., Huang, H., Letunic, I.,
Lopez, R., Luciani, A., Madeira, F., Marchler-Bauer, A., Mi, H., Natale, D.A., Necci, M.,
Nuka, G., Orengo, C., Pandurangan, A.P., Paysan-Lafosse, T., Pesseat, S., Potter, S.C.,
Qureshi, M.A., Rawlings, N.D., Redaschi, N., Richardson, L.J., Rivoire, C., Salazar,
G.A., Sangrador-Vegas, A., Sigrist, C.J.A., Sillitoe, I., Sutton, G.G., Thanki, N., Thomas,
P.D., Tosatto, S.C.E., Yong, S.Y., Finn, R.D., 2019. InterPro in 2019: improving
coverage, classification and access to protein sequence annotations. Nucleic Acids Res
47, D351-D360.
Molento, M.B., Antunes, J., Bentes, R.N., Coles, G.C., 2008. Anthelmintic resistant nematodes
in Brazilian horses. Vet Rec 162, 384-385.
Molento, M.B., Lifschitz, A., Sallovitz, J., Lanusse, C., Prichard, R., 2004. Influence of
verapamil on the pharmacokinetics of the antiparasitic drugs ivermectin and moxidectin
in sheep. Parasitol Res 92, 121-127.
153
Montecchi-Palazzi, L., Beavis, R., Binz, P.A., Chalkley, R.J., Cottrell, J., Creasy, D., Shofstahl,
J., Seymour, S.L., Garavelli, J.S., 2008. The PSI-MOD community standard for
representation of protein modification data. Nat Biotechnol 26, 864-866.
Moreno, Y., Nabhan, J.F., Solomon, J., Mackenzie, C.D., Geary, T.G., 2010. Ivermectin disrupts
the function of the excretory-secretory apparatus in microfilariae of Brugia malayi. Proc
Natl Acad Sci U S A 107, 20120-20125.
Morita, M., Imanaka, T., 2012. Peroxisomal ABC transporters: structure, function and role in
disease. Biochim Biophys Acta 1822, 1387-1396.
Ménez, C., Alberich, M., Courtot, E., Guegnard, F., Blanchard, A., Aguilaniu, H., Lespine, A.,
2019. The transcription factor NHR-8: A new target to increase ivermectin efficacy in
nematodes. PLoS Pathog 15, e1007598.
Ménez, C., Alberich, M., Kansoh, D., Blanchard, A., Lespine, A., 2016. Acquired Tolerance to
Ivermectin and Moxidectin after Drug Selection Pressure in the Nematode
Caenorhabditis elegans. Antimicrob Agents Chemother 60, 4809-4819.
Na, H., Ponomarova, O., Giese, G.E., Walhout, A.J.M., 2018. C. elegans MRP-5 Exports
Vitamin B12 from Mother to Offspring to Support Embryonic Development. Cell Rep
22, 3126-3133.
Nanayakkara, A.K., Follit, C.A., Chen, G., Williams, N.S., Vogel, P.D., Wise, J.G., 2018.
Targeted inhibitors of P-glycoprotein increase chemotherapeutic-induced mortality of
multidrug resistant tumor cells. Sci Rep 8, 967.
Nielsen, M.K., 2016. Evidence-based considerations for control of Parascaris spp. infections in
horses. Equine Veterinary Education 28, 224-231.
Nielsen, M.K., Reinemeyer, C.R., Donecker, J.M., Leathwick, D.M., Marchiondo, A.A., Kaplan,
R.M., 2014. Anthelmintic resistance in equine parasites—Current evidence and
knowledge gaps. Veterinary Parasitology 204, 55-63.
Njue, A.I., Hayashi, J., Kinne, L., Feng, X.P., Prichard, R.K., 2004. Mutations in the
extracellular domains of glutamate-gated chloride channel alpha3 and beta subunits from
ivermectin-resistant Cooperia oncophora affect agonist sensitivity. J Neurochem 89,
1137-1147.
Oshlack, A., Wakefield, M.J., 2009. Transcript length bias in RNA-seq data confounds systems
biology. Biol Direct 4, 14.
Palevich, N., Britton, C., Kamenetzky, L., Mitreva, M., de Moraes Mourão, M., Bennuru, S.,
Quack, T., Scholte, L.L.S., Tyagi, R., Slatko, B.E., (IMHAN), I.M.H.A.N., include, I.c.a.,
2018. Tackling Hypotheticals in Helminth Genomes. Trends Parasitol 34, 179-183.
Palmeira, A., Sousa, E., Vasconcelos, M.H., Pinto, M.M., 2012. Three decades of P-gp
inhibitors: skimming through several generations and scaffolds. Curr Med Chem 19,
1946-2025.
Payne, P.A., Ridley, R.K., 1999. Strategic use of ivermectin during pregnancy to control
toxocara canis in greyhound puppies. Vet Parasitol 85, 305-312.
154
Peachey, L.E., Pinchbeck, G.L., Matthews, J.B., Burden, F.A., Lespine, A., von Samson-
Himmelstjerna, G., Krücken, J., Hodgkinson, J.E., 2017. P-glycoproteins play a role in
ivermectin resistance in cyathostomins. Int J Parasitol Drugs Drug Resist 7, 388-398.
Peregrine, A.S., Molento, M.B., Kaplan, R.M., Nielsen, M.K., 2014. Anthelmintic resistance in
important parasites of horses: does it really matter? Vet Parasitol 201, 1-8.
Pfaffl, M.W., 2004. A–Z of Quantitative PCR, 1 Edition. International University Line, La Jolla,
CA.
Pieper, U., Webb, B.M., Dong, G.Q., Schneidman-Duhovny, D., Fan, H., Kim, S.J., Khuri, N.,
Spill, Y.G., Weinkam, P., Hammel, M., Tainer, J.A., Nilges, M., Sali, A., 2014.
ModBase, a database of annotated comparative protein structure models and associated
resources. Nucleic Acids Res 42, D336-346.
Ponce-Macotela, M., Rodríguez-Caballero, A., Peralta-Abarca, G.E., Martínez-Gordillo, M.N.,
2011. A simplified method for hatching and isolating Toxocara canis larvae to facilitate
excretory-secretory antigen collection in vitro. Vet Parasitol 175, 382-385.
Prichard, R., 2001. Genetic variability following selection of Haemonchus contortus with
anthelmintics. Trends Parasitol 17, 445-453.
Prichard, R., Ménez, C., Lespine, A., 2012. Moxidectin and the avermectins: Consanguinity but
not identity. Int J Parasitol Drugs Drug Resist 2, 134-153.
Prichard, R.K., Roulet, A., 2007. ABC transporters and beta-tubulin in macrocyclic lactone
resistance: prospects for marker development. Parasitology 134, 1123-1132.
Ramakers, C., Ruijter, J.M., Deprez, R.H., Moorman, A.F., 2003. Assumption-free analysis of
quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62-66.
Raza, A., Bagnall, N.H., Jabbar, A., Kopp, S.R., Kotze, A.C., 2016a. Increased expression of
ATP binding cassette transporter genes following exposure of Haemonchus contortus
larvae to a high concentration of monepantel in vitro. Parasit Vectors 9, 522.
Raza, A., Kopp, S.R., Bagnall, N.H., Jabbar, A., Kotze, A.C., 2016b. Effects of in vitro exposure
to ivermectin and levamisole on the expression patterns of ABC transporters in
Haemonchus contortus larvae. Int J Parasitol Drugs Drug Resist 6, 103-115.
Raza, A., Kopp, S.R., Jabbar, A., Kotze, A.C., 2015. Effects of third generation P-glycoprotein
inhibitors on the sensitivity of drug-resistant and -susceptible isolates of Haemonchus
contortus to anthelmintics in vitro. Vet Parasitol 211, 80-88.
Raza, A., Kopp, S.R., Kotze, A.C., 2016c. Synergism between ivermectin and the tyrosine
kinase/P-glycoprotein inhibitor crizotinib against Haemonchus contortus larvae in vitro.
Vet Parasitol 227, 64-68.
Rice, P., Longden, I., Bleasby, A., 2000. EMBOSS: the European Molecular Biology Open
Software Suite. Trends Genet 16, 276-277.
Riga, M., Tsakireli, D., Ilias, A., Morou, E., Myridakis, A., Stephanou, E.G., Nauen, R.,
Dermauw, W., Van Leeuwen, T., Paine, M., Vontas, J., 2014. Abamectin is metabolized
155
by CYP392A16, a cytochrome P450 associated with high levels of acaricide resistance in
Tetranychus urticae. Insect Biochem Mol Biol 46, 43-53.
Riou, M., Guégnard, F., Sizaret, P.Y., Le Vern, Y., Kerboeuf, D., 2010. Drug resistance is
affected by colocalization of P-glycoproteins in raft-like structures unexpected in
eggshells of the nematode Haemonchus contortus. Biochem Cell Biol 88, 459-467.
Riou, M., Koch, C., Delaleu, B., Berthon, P., Kerboeuf, D., 2005. Immunolocalisation of an
ABC transporter, P-glycoprotein, in the eggshells and cuticles of free-living and parasitic
stages of Haemonchus contortus. Parasitol Res 96, 142-148.
Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L., Pachter, L., 2011. Improving RNA-Seq
expression estimates by correcting for fragment bias. Genome Biol 12, R22.
Romsicki, Y., Sharom, F.J., 2001. Phospholipid flippase activity of the reconstituted P-
glycoprotein multidrug transporter. Biochemistry 40, 6937-6947.
Rothwell, J.T., Sangster, N.C., 1993. An in vitro assay utilising parasitic larval Haemonchus
contortus to detect resistance to closantel and other anthelmintics. Int J Parasitol 23, 573-
578.
Sanglas, L., Aviles, F.X., Huber, R., Gomis-Rüth, F.X., Arolas, J.L., 2009. Mammalian
metallopeptidase inhibition at the defense barrier of Ascaris parasite. Proc Natl Acad Sci
U S A 106, 1743-1747.
Sangster, N.C., 1994. P-glycoproteins in nematodes. Parasitol Today 10, 319-322.
Sangster, N.C., Bannan, S.C., Weiss, A.S., Nulf, S.C., Klein, R.D., Geary, T.G., 1999.
Haemonchus contortus: sequence heterogeneity of internucleotide binding domains from
P-glycoproteins. Exp Parasitol 91, 250-257.
Sarai, R.S., Kopp, S.R., Coleman, G.T., Kotze, A.C., 2013. Acetylcholine receptor subunit and
P-glycoprotein transcription patterns in levamisole-susceptible and -resistant
Haemonchus contortus. Int J Parasitol Drugs Drug Resist 3, 51-58.
Schnieder, T., Laabs, E.M., Welz, C., 2011. Larval development of Toxocara canis in dogs. Vet
Parasitol 175, 193-206.
Schwartz, M.S., Benci, J.L., Selote, D.S., Sharma, A.K., Chen, A.G., Dang, H., Fares, H.,
Vatamaniuk, O.K., 2010. Detoxification of multiple heavy metals by a half-molecule
ABC transporter, HMT-1, and coelomocytes of Caenorhabditis elegans. PLoS One 5,
e9564.
Scotto, K.W., Egan, D.A., 1998. Transcriptional regulation of MDR genes. Cytotechnology 27,
257-269.
Shah, S.Z.A., Khan, S., Compston, P., Upjohn, M., Jobling, R., 2016. Gastrointestinal parasite
infestation and the efficacy of Fenbendazole and Ivermectin in working equids in selected
areas of Pakistan. Journal of Equine Veterinary Science 39, Supplement, S103.
Shapiro, A.B., Corder, A.B., Ling, V., 1997. P-glycoprotein-mediated Hoechst 33342 transport
out of the lipid bilayer. Eur J Biochem 250, 115-121.
156
Shapiro, A.B., Ling, V., 1997. Extraction of Hoechst 33342 from the cytoplasmic leaflet of the
plasma membrane by P-glycoprotein. Eur J Biochem 250, 122-129.
Sharom, F.J., 2014. Complex Interplay between the P-Glycoprotein Multidrug Efflux Pump and
the Membrane: Its Role in Modulating Protein Function. Front Oncol 4, 41.
Sheps, J.A., Ralph, S., Zhao, Z., Baillie, D.L., Ling, V., 2004. The ABC transporter gene family
of Caenorhabditis elegans has implications for the evolutionary dynamics of multidrug
resistance in eukaryotes. Genome Biol 5, R15.
Shtil, A.A., Azare, J., 2005. Redundancy of biological regulation as the basis of emergence of
multidrug resistance. Int Rev Cytol 246, 1-29.
Silva, R., Vilas-Boas, V., Carmo, H., Dinis-Oliveira, R.J., Carvalho, F., de Lourdes Bastos, M.,
Remião, F., 2015. Modulation of P-glycoprotein efflux pump: induction and activation as
a therapeutic strategy. Pharmacol Ther 149, 1-123.
Slocombe, J.O., de Gannes, R.V., Lake, M.C., 2007. Macrocyclic lactone-resistant Parascaris
equorum on stud farms in Canada and effectiveness of fenbendazole and pyrantel
pamoate. Vet Parasitol 145, 371-376.
Smith, J.M., Prichard, R.K., 2002. Localization of p-glycoprotein mRNA in the tissues of
Haemonchus contortus adult worms and its relative abundance in drug-selected and
susceptible strains. J Parasitol 88, 612-620.
Soulsby, E.J., 1983. Toxocariasis. Br Vet J 139, 471-475.
Srinivasan, D.G., Fisk, R.M., Xu, H., van den Heuvel, S., 2003. A complex of LIN-5 and GPR
proteins regulates G protein signaling and spindle function in C elegans. Genes Dev 17,
1225-1239.
Stergiou, L., Hengartner, M.O., 2004. Death and more: DNA damage response pathways in the
nematode C. elegans. Cell Death Differ 11, 21-28.
Stitt, L.E., Tompkins, J.B., Dooley, L.A., Ardelli, B.F., 2011. ABC transporters influence
sensitivity of Brugia malayi to moxidectin and have potential roles in drug resistance.
Exp Parasitol 129, 137-144.
Storey, B., Marcellino, C., Miller, M., Maclean, M., Mostafa, E., Howell, S., Sakanari, J.,
Wolstenholme, A., Kaplan, R., 2014. Utilization of computer processed high definition
video imaging for measuring motility of microscopic nematode stages on a quantitative
scale: "The Worminator". Int J Parasitol Drugs Drug Resist 4, 233-243.
Stouch, T.R., Gudmundsson, O., 2002. Progress in understanding the structure-activity
relationships of P-glycoprotein. Adv Drug Deliv Rev 54, 315-328.
Stringham, E., Pujol, N., Vandekerckhove, J., Bogaert, T., 2002. unc-53 controls longitudinal
migration in C. elegans. Development 129, 3367-3379.
Sutherland, I.A., Leathwick, D.M., 2011. Anthelmintic resistance in nematode parasites of cattle:
a global issue? Trends Parasitol 27, 176-181.
157
Tandon, R., Kaplan, R.M., 2004. Evaluation of a larval development assay (DrenchRite) for the
detection of anthelmintic resistance in cyathostomin nematodes of horses. Vet Parasitol
121, 125-142.
Tang, F., Horie, K., Borchardt, R.T., 2002. Are MDCK cells transfected with the human MDR1
gene a good model of the human intestinal mucosa? Pharm Res 19, 765-772.
Tompkins, J.B., Stitt, L.E., Ardelli, B.F., 2010. Brugia malayi: in vitro effects of ivermectin and
moxidectin on adults and microfilariae. Exp Parasitol 124, 394-402.
Tompkins, J.B., Stitt, L.E., Morrissette, A.M., Ardelli, B.F., 2011. The role of Brugia malayi
ATP-binding cassette (ABC) transporters in potentiating drug sensitivity. Parasitol Res
109, 1311-1322.
Torrisi, M., Kaleel, M., Pollastri, G., 2019. Deeper Profiles and Cascaded Recurrent and
Convolutional Neural Networks for state-of-the-art Protein Secondary Structure
Prediction. Sci Rep 9, 12374.
Turnbull, F., Jonsson, N.N., Kenyon, F., Skuce, P.J., Bisset, S.A., 2018. P-glycoprotein-9 and
macrocyclic lactone resistance status in selected strains of the ovine gastrointestinal
nematode, Teladorsagia circumcincta. Int J Parasitol Drugs Drug Resist 8, 70-80.
Tydén, E., Skarin, M., Höglund, J., 2014. Gene expression of ABC transporters in Cooperia
oncophora after field and laboratory selection with macrocyclic lactones. Mol Biochem
Parasitol 198, 66-70.
Tydén, E., Tallkvist, J., Tjälve, H., Larsson, P., 2009. P-glycoprotein in intestines, liver, kidney
and lymphocytes in horse. J Vet Pharmacol Ther 32, 167-176.
Tyrrell, K.L., Dobson, R.J., Stein, P.A., Walkden-Brown, S.W., 2002. The effects of ivermectin
and moxidectin on egg viability and larval development of ivermectin-resistant
Haemonchus contortus. Vet Parasitol 107, 85-93.
Vahedi, S., Lusvarghi, S., Pluchino, K., Shafrir, Y., Durell, S.R., Gottesman, M.M., Ambudkar,
S.V., 2018. Mapping discontinuous epitopes for MRK-16, UIC2 and 4E3 antibodies to
extracellular loops 1 and 4 of human P-glycoprotein. Sci Rep 8, 12716.
Van Der Heyden, S., Chiers, K., Ducatelle, R., 2009. Tissue distribution of p-glycoprotein in
cats. Anat Histol Embryol 38, 455-460.
VanDuyn, N., Nass, R., 2014. The putative multidrug resistance protein MRP-7 inhibits
methylmercury-associated animal toxicity and dopaminergic neurodegeneration in
Caenorhabditis elegans. J Neurochem 128, 962-974.
Vatta, A.F., Dzimianski, M., Storey, B.E., Camus, M.S., Moorhead, A.R., Kaplan, R.M.,
Wolstenholme, A.J., 2014. Ivermectin-dependent attachment of neutrophils and
peripheral blood mononuclear cells to Dirofilaria immitis microfilariae in vitro. Vet
Parasitol 206, 38-42.
Virkel, G., Ballent, M., Lanusse, C., Lifschitz, A., 2019. Role of ABC Transporters in Veterinary
Medicine: Pharmaco- Toxicological Implications. Curr Med Chem 26, 1251-1269.
158
Várady, M., Corba, J., Letková, V., Kovác, G., 2009. Comparison of two versions of larval
development test to detect anthelmintic resistance in Haemonchus contortus. Vet
Parasitol 160, 267-271.
Wang, F., Flanagan, J., Su, N., Wang, L.C., Bui, S., Nielson, A., Wu, X., Vo, H.T., Ma, X.J.,
Luo, Y., 2012a. RNAscope: a novel in situ RNA analysis platform for formalin-fixed,
paraffin-embedded tissues. J Mol Diagn 14, 22-29.
Wang, J., Gao, S., Mostovoy, Y., Kang, Y., Zagoskin, M., Sun, Y., Zhang, B., White, L.K.,
Easton, A., Nutman, T.B., Kwok, P.Y., Hu, S., Nielsen, M.K., Davis, R.E., 2017.
Comparative genome analysis of programmed DNA elimination in nematodes. Genome
Res 27, 2001-2014.
Wang, J., Mitreva, M., Berriman, M., Thorne, A., Magrini, V., Koutsovoulos, G., Kumar, S.,
Blaxter, M.L., Davis, R.E., 2012b. Silencing of germline-expressed genes by DNA
elimination in somatic cells. Dev Cell 23, 1072-1080.
Ward, A.B., Szewczyk, P., Grimard, V., Lee, C.W., Martinez, L., Doshi, R., Caya, A., Villaluz,
M., Pardon, E., Cregger, C., Swartz, D.J., Falson, P.G., Urbatsch, I.L., Govaerts, C.,
Steyaert, J., Chang, G., 2013. Structures of P-glycoprotein reveal its conformational
flexibility and an epitope on the nucleotide-binding domain. Proc Natl Acad Sci U S A
110, 13386-13391.
Watson, B.D., 1965. The fine structure of the body-wall and the growth of the cuticle in the adult
nematode Ascaris lumbricoides. Journal of Cell Science 3, 83-91.
Weidner, L.D., Fung, K.L., Kannan, P., Moen, J.K., Kumar, J.S., Mulder, J., Innis, R.B.,
Gottesman, M.M., Hall, M.D., 2016. Tariquidar Is an Inhibitor and Not a Substrate of
Human and Mouse P-glycoprotein. Drug Metab Dispos 44, 275-282.
Wen, P.C., Verhalen, B., Wilkens, S., Mchaourab, H.S., Tajkhorshid, E., 2013. On the origin of
large flexibility of P-glycoprotein in the inward-facing state. J Biol Chem 288, 19211-
19220.
Whittaker, J.H., Carlson, S.A., Jones, D.E., Brewer, M.T., 2017. Molecular mechanisms for
anthelmintic resistance in strongyle nematode parasites of veterinary importance. J Vet
Pharmacol Ther 40, 105-115.
Williamson, S.M., Storey, B., Howell, S., Harper, K.M., Kaplan, R.M., Wolstenholme, A.J.,
2011. Candidate anthelmintic resistance-associated gene expression and sequence
polymorphisms in a triple-resistant field isolate of Haemonchus contortus. Mol Biochem
Parasitol 180, 99-105.
Williamson, S.M., Wolstenholme, A.J., 2012. P-glycoproteins of Haemonchus contortus:
development of real-time PCR assays for gene expression studies. J Helminthol 86, 202-
208.
Wolstenholme, A.J., 2012. Glutamate-gated chloride channels. J Biol Chem 287, 40232-40238.
Wolstenholme, A.J., Rogers, A.T., 2005. Glutamate-gated chloride channels and the mode of
action of the avermectin/milbemycin anthelmintics. Parasitology 131 Suppl, S85-95.
159
Wu, Y.C., Horvitz, H.R., 1998. The C. elegans cell corpse engulfment gene ced-7 encodes a
protein similar to ABC transporters. Cell 93, 951-960.
Xu, M., Molento, M., Blackhall, W., Ribeiro, P., Beech, R., Prichard, R., 1998. Ivermectin
resistance in nematodes may be caused by alteration of P-glycoprotein homolog. Mol
Biochem Parasitol 91, 327-335.
Yabe, T., Suzuki, N., Furukawa, T., Ishihara, T., Katsura, I., 2005. Multidrug resistance-
associated protein MRP-1 regulates dauer diapause by its export activity in
Caenorhabditis elegans. Development 132, 3197-3207.
Yagdiran, Y., Oskarsson, A., Knight, C.H., Tallkvist, J., 2016. ABC- and SLC-Transporters in
Murine and Bovine Mammary Epithelium--Effects of Prochloraz. PLoS One 11,
e0151904.
Yan, C., Bi, Y., Yin, D., Zhao, Z., 2012a. A method for rapid and simultaneous mapping of
genetic loci and introgression sizes in nematode species. PLoS One 7, e43770.
Yan, R., Urdaneta-Marquez, L., Keller, K., James, C.E., Davey, M.W., Prichard, R.K., 2012b.
The role of several ABC transporter genes in ivermectin resistance in Caenorhabditis
elegans. Vet Parasitol 190, 519-529.
Young, M.D., Wakefield, M.J., Smyth, G.K., Oshlack, A., 2010. Gene ontology analysis for
RNA-seq: accounting for selection bias. Genome Biol 11, R14.
Zandvliet, M., Teske, E., 2015. Mechanisms of Drug Resistance in Veterinary Oncology- A
Review with an Emphasis on Canine Lymphoma. Vet Sci 2, 150-184.
Zhao, Z., Fang, L.L., Johnsen, R., Baillie, D.L., 2004. ATP-binding cassette protein E is
involved in gene transcription and translation in Caenorhabditis elegans. Biochem
Biophys Res Commun 323, 104-111.
Zhao, Z., Thomas, J.H., Chen, N., Sheps, J.A., Baillie, D.L., 2007. Comparative genomics and
adaptive selection of the ATP-binding-cassette gene family in caenorhabditis species.
Genetics 175, 1407-1418.
Zhu, X.Q., Korhonen, P.K., Cai, H., Young, N.D., Nejsum, P., von Samson-Himmelstjerna, G.,
Boag, P.R., Tan, P., Li, Q., Min, J., Yang, Y., Wang, X., Fang, X., Hall, R.S., Hofmann,
A., Sternberg, P.W., Jex, A.R., Gasser, R.B., 2015. Genetic blueprint of the zoonotic
pathogen Toxocara canis. Nat Commun 6, 6145.
160
Figures and tables
Figure 5-1. Representative images of adult male Parascaris. Positive signal resulting from probe
hybridization appeared as red punctate dots. Black boxes indicate the location of high
magnification insets. A description of staining in specific tissues is given in Section 3.2.
161
Figure 5-2. Representative images of adult female Parascaris. Positive signal resulting from
probe hybridization appeared as red punctate dots. Black boxes indicate the location of high
magnification insets. A description of staining in specific tissues is given in Section 3.2.
162
Figure 5-3. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult male Parascaris. Values
represent percent area of the tissue with positive staining relative to beta-tubulin ± S.E.M.
Columns with different symbols are significantly different (p < 0.05).
163
Figure 5-4. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in adult female Parascaris.
Values represent percent area of the tissue with positive staining relative to beta-tubulin ± S.E.M.
Columns with different symbols are significantly different (p < 0.05).
164
Figure 5-5. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of adult
male Parascaris. Values represent percent area of the tissue with positive staining relative to
beta-tubulin ± S.E.M. Columns with different symbols are significantly different from other
regions of a specific tissue (p < 0.05).
165
Figure 5-6. Expression of (A) Peq-pgp-11 and (B) Peq-pgp-16 in different body regions of adult
female Parascaris. Values represent percent area of the tissue with positive staining relative to
beta-tubulin ± S.E.M. Columns with different symbols are significantly different from other
regions of a specific tissue (p < 0.05).
166
Supplementary data
The following is supplementary data to this article:
Figure 5-S 1. Representative images of adult Parascaris. Positive signal resulting from positive
and negative control probe hybridization appeared as red punctate dots.
167
CHAPTER 6. GENERAL CONCLUSIONS
In order to understand the function of P-glycoproteins in ascarid worms, a series of
studies were conducted in Toxocara canis and Parascaris. The principle findings of these
experiments were:
P-gp genes are expressed in T. canis
Phylogenetic analysis and molecular cloning revealed 13 P-gp encoding genes present in
T. canis, with several isoforms predicted. 10 of these were constitutively expressed in adults and
infective larvae, while 6 were expressed in somatic larvae. Tca-Pgp-10 expression was
upregulated in somatic larvae derived from mice treated with moxidectin. Larval inhibition
assays provided phenotypic evidence of functional P-gp activity with a unique pharmacological
profile. Further work is required to study the function of these genes and discover nematode
specific P-gp inhibitors.
Tca-Pgp-11 has unique pharmacology and localization
A full length was cloned and designated Tca-Pgp-11. Tca-Pgp-11 was stably
expressed in a cell line lacking endogenous P-gp expression, and the pharmacological profile
was studied using flow cytometry. These experiments revealed that macrocyclic lactones are
transported by Tca-Pgp-11 and that this transporter has a inhibition profile that differs from
mammalian P-gps. Notably, Tca-Pgp-11 was insensitive to the P-gp inhibitors verapamil,
cyclosporine A, reserpine and tariquidar. Tca-Pgp-11 expression was restricted to intestines,
body wall, nerve and lateral cords and was completely absent from the reproductive tissue in
adult worms.
Peq-pgp-11 and Peq-pgp-16 are expressed by several cell types in adult parasites
Macrocyclic lactone resistance is a clinical problem in Parascaris and has been
168
associated with Peq-pgp-11. This research demonstrated that P-gp mRNA localization could be
quantitatively measured using a multiple nucleic acid hybridization technique in formalin-fixed
paraffin embedded nematode tissue sections. Peq-pgp-11 and Peq-pgp-16 transcripts were
detected in several tissues in male and female worms indicating that P-gps could protect the
worm from MLs locally in the intestines, neurons, reproductive tissue and hypodermis. Further
work is necessary to understand if tissue localization of P-gp mRNA changes with ML-induced
hyperexpression in resistant isolates of Parascaris. mRNA in situ hybridization in combination
with immunohistochemistry would provide a snap-shot of mRNA and protein expression to
understand drug resistance mechanisms better.