The EMBO Journal vol.5 no.5 pp. 1071 - 1076, 1986

Conserved TAAAT motif in vaccinia virus late promoters:overlapping TATA box and site of transcription initiation

M.HHanggi, W.Bannwarth and H.G.Stunnenberg1Zentrale Forschungseinheiten, Hoffmann-La Roche and Co., Basel,Switzerland and 'European Molecular Biology Laboratory, Meyerhofstrasse1, 6900 Heidelberg, FRG

Communicated by R.Cortese

We have characterized the vaccinia virus 11-kd late promoterthrough 5' and 3' deletions and site-directed mutagenesis. Thepromoter function appears to be contained within an 30-bpfragment, which after translocation is able to direct RNA syn-thesis late in infection at a reduced level. We demonstratethat a TAAAT sequence in the proximal part of the promoteris essential for its function. This cis-acting element is highlyconserved within vaccinia virus late promoters and overlapsthe site of transcription initiation. Deletions or mutationswithin this conserved element completely inactivate the pro-moter. The evidence indicates that the TAAAT motif func-tions as a TATA box. The region immediately upstream ofthe TAAAT motif determines the promoter strength.Key words: vaccinia virus/late promoter/gene regulation

IntroductionVaccinia virus, widely known for its role in the eradication ofsmallpox, became of general interest again because of thepossibility of using the virus as an expression vector and as alive vaccine. Through homologous recombination it appeared tobe possible to introduce foreign genetic information into the viralgenome (Panicali and Paoletti, 1982; Mackett et al., 1982). Theintroduced foreign genes could be accurately transcribed andtranslated if they were under the control of a viral promoter. Thelarge viral genome of - 180 kb was able to integrate stably andpackage into an infectious virion 25 kb or more of foreign DNA(Smith and Moss, 1983).Although many different genes have been introduced and ac-

curately expressed in vaccinia virus (Smith et al., 1984), verylittle is known about the regulation of the viral gene expression.Early viral genes are expressed immediately after infection upto the replication stage of the virus (2-5 h post-infection). Lategenes are expressed upon the onset of, or immediately follow-ing DNA replication. The expression of late genes can beprevented by inhibitors of DNA or protein synthesis. Typically,late transcripts are heterogeneous in size due to the lack of a ter-mination signal resulting in a readthrough of the viral RNApolymerase (Mahr and Roberts, 1984; Weir and Moss, 1984).The molecular mechanisms underlying the switching from early

to late transcription are unknown. A first step towards theunderstanding of switching could be the analysis of viral pro-moters and the identification of cis-acting DNA sequences whichmight determine their early or late character. The vaccinia viruspromoter does not resemble either its prokaryotic or eukaryoticcounterparts. Conserved elements such as a TATA-box or CAATsequence are not present as such (Nevins, 1983). The early as

well as late promoters are contained within short AT-rich

IRL Press Limited, Oxford, England

fragments located immediately upstream of the site of transcrip-tion initiation (Cochran et al., 1985; Rosel and Moss, 1985).The existence of conserved promoter elements present in earlyas well as late promoters was postulated by Plucienniczak et al.(1985) based on sequence comparisons; the biological significanceof these postulated promoter elements has not been demonstrated.Here we describe the mutagenesis of the promoter of a gene

coding for a major late polypeptide of 11 kd (Wittek et al., 1984;Bertholet et al., 1985). We have determined the borders of thislate promoter using 5' and 3' deletions. Several mutations in theregion of the site of transcription initiation were tested for theireffect on the promoter strength. We present evidence that a con-served -TAAAT- motif, representing the site of transcription in-itiation of late promoters, is essential for the promoter activity.The possible function of this element is discussed.

ResultsThe possibility of introducing foreign DNA into the vaccinia virusgenome through a process of homologous recombination wasdemonstrated by Panicalli and Paoletti (1982) and by Mackettet al. (1982). Both groups exploited the possibility of selectingfor the presence or absence of thymidine kinase (TK) activityin the recombinant virus either by introducing a herpes virus TKgenes into a tk- vaccinia virus or through the insertion of foreignDNA into the vaccinia virus TK locus. We have used the lattersystem for the insertion and selection of chimeric genes consistingof 11-kd promoter mutants and a test gene. We used either agene coding for a merozoite antigen of Plasmodium falciparum(Ag 5.1) (Hope et al., 1985) or the dihydrofolate reductase(DHFR) gene of mouse (Chang et al., 1978). The basic inser-tion vector (pUC-TK) consisted of the plasmid pUC-8 (Vieiraand Messing, 1982), and part of the vaccinia virus 'HindIII-J'fragment (HindIII-Hpall) containing the virus TK gene andflanking sequences (Hruby and Ball, 1982; Weir and Moss,1983).5' Deletion mutantsWittek and his collaborators showed that the 1 1-kd late promoterfunction was contained within a 1 10-bp fragment ranging froma XbaI site at -100 to an EcoRI site at + 10 (Bertholet et al.,1985). To determine the 5' border of this late promoter moreprecisely, we synthesized oligonucleotides of 32-111 nucleo-tides, which were cloned into pUC-TK and subsequently sequenc-ed (Figure 1). Using this approach we artificially constructed 5'deletion mutants of the promoter with pre-determined end-points,avoiding time-consuming screening. A mouse DHFR gene,isolated as an EcoRI fragment, was cloned into the EcoRI siteof the different 5' deletion constructs. The mouse DHFR genewas cloned in-frame with the AUG of the inserted promoterfragments. Recombinant vaccinia viruses were made as describedusing the temperature-sensitive vaccinia virus mutant ts7 (Drillienand Spehner, 1983) and a calcium phosphate co-precipitate ofwild-type vaccinia virus DNA and the insertion vectors with thedifferent promoter constructs. After selection and plaque purifica-tion, monolayers of RK- 13 cells were infected with a multiplici-

1071

M.Hanggi, W.Bannwarth and H.G.Stunnenberg

ty of 5 p.f.u. of the different recombinant viruses. RNA wasprepared 8 h after infection and transcripts were mapped usingnuclease SI. Transcripts from the 1 1-kd promoter at its originallocation (HindIII-F fragment) and from the translocated 11-kdpromoter deletion mutants inserted into the TK gene were map-ped simultaneously (Figure 2). The promoter activities of thetranslocated 1 1-kd promoter fragments (32-mer up to 11 1-mer)

Clal EcoRI

TgeneHindlll HpaII

pUC-TK

0

pUC-8

EcoRI jClaI/klenow

Clal 32-to 111-mer EcoRI= _-primer

111

1049667

'*- 66'* 52

42-+ 32DHFR

EcoRI

insertion of EcoRI

DHFR ClaI0 Hpall

HindIlI Hp.

Fig. 1. Schematic presentation of the cloning of the 5' deletion mutants ofthe 11 -kd late promoter into the pUC-TK vector. The synthetic oligomersranging from 32 to 111 nucleotides were cloned between the ClaI andEcoRI restriction sites of the vaccinia virus TK gene. The complementarystrand was synthesized using reverse transcriptase and a synthetic primeroverlapping the EcoRI site.

inserted into the TK gene were 3- to 4-fold reduced comparedwith the authentic 1 l-kd promoter at its original location in theviral genome (Figure 2A). This indicates that the 111 -nucleotidefragment does not contain all the information required for op-timal 11-kd expression, and that sequences either upstream ordownstream are required for full promoter activity (see Discus-sion). We could not, however, measure a significant differencein activity between the promoter strength of the 32-bp up to11 1-bp promoter fragments (Figure 2A). The start of the RNAtranscripts could be mapped within the first three A residues im-mediately upstream of the AUG. To test whether the 32-bp frag-ment had retained the characteristics of a late promoter, RNAwas prepared at different time points after infection with recom-binant virus containing either the 32-bp or the 11 l-bp promoterconstructs or wild-type virus. Transcripts from the early vac-cinia virus TK promoter and from the translocated 1 l-kd pro-moter fragments were mapped simultaneously. TK transcriptswere detectable at 3 h post-infection, but were no longer pre-sent at 12 or 24 h post-infection (Figure 2B). Low levels ofRNAtranscripts from the translocated 1 1-kd promoter were detectableas early as 3 h post-infection and reached a maximum after DNAreplication (12 and 24 h post-infection). Again no difference wasdetectable between promoter strength of the 32-bp and the 11 1-bppromoter fragments. Incubation of the infected cells in thepresence of 100 Ag/ml of cycloheximide abolished the activityof the 1 1-kd promoter (not shown). This indicates that the pro-moters are only active after DNA replication, confirming theirlate character.

A

M 32- 42-

B5'promoter deletions

50- 56- 67-wt 32-bp 111-bp

3 12 24 3 12 24 3 12 24 MOF

96- 104- 111-bp

_ _ - __

4-. 41- :..It

transcripts of--- translocated

11K mutants- d-__ - transcripts of

authentic 11K

transcripts oftranslocated -_11K mutants

TK transcripts- -

S1 mappingAuthentic 11K

11KHidlll "F" F-^ HindIII lll

HindIII "E"

TaqI291p P32291bp P

Translocated 11K promoter-DHFR in TK locus

1TK-----+11K -c

OHFR

'IAccI350bp P

Fig. 2. S1 analysis of the 5' deletion mutant of the 1 I-kd late promoter. (A) Mapping of the 5' ends of transcripts from the authentic I l-kd promoter andfrom translocated I l-kd deletion mutants (32- to 11 l-bp). The RNA was isolated 8 h after infection. The Sl mapping was performed as indicated usingasymmetically labelled S1 probes. Lane M represents labelled HpaII fragments of pBR322. (B) Mapping of RNA transcripts at different times after infection.Monolayers of RK-13 cells were infected with 5 p.f.u./cell of wild-type vaccinia virus (wt) or recombinant virus containing the 32-bp or 11ll-bppromoter-DHFR construct. RNA was prepared 3, 12 and 24 h post-infection. Transcripts from the early TK promoter were mapped from the ClaI restrictionsite resulting in a S1-protected fragment of -247 bases.

1072

_ _ _ -

1TKL I I e

Vaccinia virus late promoter

3' Deletion mutantsTo determine the 3' border of the 1 l-kd late promoter we made3' deletions starting at the EcoRI site (+3) using T4 DNApolymerase in the presence of limiting amounts of dTTP as theonly nucleotide. The T4 DNA polymerase will degrade thedouble-stranded DNA from the free 3'-OH end by 3'-5' ex-onuclease activity until a base is exposed complementary to dTTP(Maniatis et al., 1982). After removal of single-stranded DNAtails with nuclease S1, a BamHI linker -AAAGGATCCTlT'T- wasadded. The resulting plasmids were analyzed for the presenceof the Bam linker and were sequenced to determine the end-pointsof the deletions. Two different deletions were selected for fur-ther analysis: the promoter mutant (A6) having a 6-bp deletionremoving the EcoRI site and thereby disrupting the AUG startcodon, and A20, which had a deletion up to position -10 remov-ing the site of transcription initiation (Figure 3A). Subfragmentscontaining the A6 and A20 promoter mutants were isolated andsubcloned into pUC-TK using a BamHI-SmaI-EcoRI adaptor.Subsequently, a malarial cDNA clone of P. falciparum, codingfor the merozoite stage Ag 5.1, was cloned into the EcoRI site.Recombinant viruses were prepared and plaque-purified asdescribed. Monolayers of RK- 13 cells were infected with recom-binant virus and RNA was prepared 2 and 5 h post-infection.Transcripts from the early TK promoter and from the translocated1 -kd promoter mutants A6 and A20 were mapped simultaneously(Figure 3B). Transcripts from the TK promoter were detectable2 h post-infection and were still present after 5 h (Figure 3C).Transcripts from the translocated promoter mutants were alsodetectable S h post-infection using the A6 promoter mutant(Figure 3C, zA6). The 5' end of the transcript was mapped withinthe three A residues upstream of the introduced BamHI restric-tion site (Figure 3A). The deletion of the protein- as well as RNA-start site within the A20 promoter mutant resulted in a completeinactivation of the promoter (Figure 3C, A20).Mutations in the proximal promoter regionThe A6 promoter with the intact site of transcription initiationstill functioned as a late promoter, whereas deletion of this partof the promoter in the A20 mutant resulted in its complete inac-tivation. To address the question of which nucleotides in this areaare essential for the promoter function we synthesized differentoligomers covering the 3' part of the promoter. Different pro-

moter mutants were obtained through the insertion of synthesiz-ed oligomers downstream from the A20 promoter; the sequencesof the different mutants are listed in Figure 4. Chimeric geneswere constructed using the different promoter mutants and themouse DHFR gene. Recombinant viruses were prepared and ear-ly RNA was isolated 6 h after infection in the presence of 100 itgof cycloheximide per ml; late RNA was isolated 8 and 24 h afterinfection in the absence of the drug. Transcripts from the dif-ferent translocated promoter mutants and transcripts from theauthentic 11-kd promoter within the HindHI-F fragment of theviral genome were mapped simultaneously. The A6 promoterwhich was regarded as the 'wild-type' translocated promoter was3- to 4-fold reduced in strength compared with the authentic 11-kdpromoter (Figure 4, A6). The substitution of the nucleotides fromposition -10 to -5 in the promoter mutant AI resulted in a in-crease of the promoter activity to a level 2-fold higher than theauthentic 11-kd promoter. Two sites of transcription initiationwere detectable mapping in the proximal TAAAT motif and fur-ther upstream within the sequence TAAAG. The conversion ofthe nucleotides between -5 and -2 into their complement (CG and A T) in promoter mutant F also resulted in an increasein promoter strength to the level of the authentic 1 Lkd promoter.Mutation or deletion of the site of transcription initiation fromposition -1 to +4 resulted in an inactivation oLthe promoter(mutants E and G). Early RNA purified from infected cells in-cubated in the presence of cycloheximide did not contain detec-table levels of transcripts originating from the authentic ortranslocated 11-kd promoter mutants.

DiscussionThe present investigation was undertaken to characterize the struc-ture of a late vaccinia virus promoter and to identify cis-actingelements within the promoter. The strategy we used involved5' and 3' deletions and site-directed mutagenesis of parts of thepromoter mainly around the site of transcription initiation.The promoter of the major late polypeptide of 11 kd was

postulated to be contained within a 1 10-bp fragment, which stillfunctioned as a late promoter upon translocation (Bertholet etal., 1985). We have chemically synthesized this promoter frag-ment and 5' deletion mutations thereof; nuclease SI mappingshowed that the translocated 11-kd promoter inserted into the

A Proximal promoter sequences: C-20 -10

wt ATTTCATTTTGTTTTTTTCTATGCTATAAATGA6 ATTTCATTTTGTTTTTTTCTATGCTATAAATAAAAGG --4Obp--ATGA20ATTTCATTTTGTTTTTTAAAGGATCC-36bp-ATG

B S1 mapping

TK Ag 5.111K

Clal BclI2L7b 217247bp 217bp

TK transcriptsip.-ts-4_fran-urint-, nf _an11 'dilbLI" ul

translocated11K mutants

Fig. 3. Analysis of the 3' deletion mutants by SI mapping. (A) The nucleotide sequence of the proximal part of the wild-type 1 I-kd promoter (wt), and the 3'deletion mutants A6 and A20. The 5' ends of the transcripts are indicated (V). (B) Outline of the SI mapping of RNA transcripts from the early TKpromoter and from the promoter mutants-Ag 5.1 constructs. (C) Autoradiograph of a sequencing gel of the SI-protected fragments. Monolayers of RK-13cells were infected with 5 p.f.u./cell of recombinant virus containing the A6 or A20 promoter mutant-Ag 5.1 construct. RNA was isolated 2 and 5 h post-infection. Lane M represents labelled HpaIl fragments of pBR322.

1073

A6 A202 5 2 5 M

isof

mgo

Proximal promoter sequence:- 20 -10

wtllK ATTTCATTTTGTTTTTTTCTATGCTATAAATGA6 ATTT[ATTTTGTTTTTTTCTATGCTATAAATaaag--- 12bp-- -1IGA20 ATTT[ATITTGTTTTTTaaag.- --12bp---AIG2

A ATTTCATTTTGTTTTTTaaagga t[TATAAATaaat----15bp1--iRgF ATTTCATTTTGTTTTTTTCTATcgatTAAATaaag---l0bp---jYE ATTTCATTTTGTTTTTTTCTATGCTAa t t taaag-----lObp--G ATTTCATTTTGTTTTTTTCTATGCTTAAAg-- lObp---

A6 A E F

M + 8 24 + 8 24 + 8 24 + 8 24

a

relativepromoterstrength

0 2-0.3<0.01

3-41-2

<0.01

<0.01

GI]+ 8 24

transcripts oftranslocated 11K mutants

_40 -4transcripts ofauthentic 11K

Fig. 4. SI analysis of the proximal I-kd promoter mutants. The nucleotide sequences of the 3' part of the different promoter mutants and the relativepromoter strength are listed; the sites of transcription initiation are indicated (V). The SI mapping of the promoter mutant -DHFR transcripts and of theauthentic 1 -kd transcripts was performed as described in Figure 2. Early RNA was isolated from infected cells incubated for 6 h in the presence of100 jAg/mnl of cycloheximide (+); late RNA was prepared 8 and 24 h post-infection.

TK locus was significantly weaker than the 11-kd promoter atits original location within the viral genome (Figure 2). Thisresult is in contrast to the observation of Bertholet et al. (1985),who did not find any difference in activity upon translocationof the 110-bp promoter fragment. Their method, however, in-volved the separate mapping of the different RNA transcripts;with this procedure accurate quantifications are more difficult.We cannot rule out the possibility that the RNA levels that wemeasure reflect a difference in the stability of the transcripts.We have observed, however, a reduced activity of thetranslocated promoter independent of the structure of thetranscribed gene, whether this is the mouse DHFR or the Ag 5.1of P. falciparum (not shown). It seems probable that the reduc-tion of the promoter activity is due to the translocation itself.This implies either the existence of (far) upstream enhancer orsilencer type elements or the presence of viral domains whichdiffer in their overall transcriptional activity. The second possibili-ty seems more likely if one considers the densely packed viralgenome (Plucienniczak et al., 1985). Cis-acting positive or

negative elements might still be present affecting the transcrip-tion rate of a given viral domain rather than of single genes. Weare currently investigating this possibility.

Deletions of upstream promoter sequences up to 32 bp 5' ofthe AUG affected neither the promoter strength nor the latecharacter of the promoter (Figure 2A and B). A similar resultwas found by Cochran et al. (1985), who showed that the early

and late promoter functions of the constitutive 7.5-kd promoterwere contained within short fragments of - 30 bp. We have nottested shorter 1 1-kd promoter fragments, so the 5' boundary ofthe promoter could be even closer to the site of transcription in-itiation which was mapped within the three A residues immediate-ly upstream of the EcoRI site. The deletion of the EcoRI siteat the 3' end of the 1 10-bp promoter fragment had no effect onthe promoter strength (Figure 3C, A6). This indicates that thesite of transcription initiation does not have to be in close prox-imity to the translocation start codon as is the case with the 1 1-kd,28-kd and 4b promoters (Table I). The insertion of an un-translated leader sequence does not affect either the promoterstrength or its late phenotype. The additional deletion of 10-bpfrom the 3' end of the promoter resulted in a strong down muta-tion indicating that an essential control element is deleted or in-activated (Figure 3C, A20). To determine which nucleotides areessential in this proximal promoter region, we synthesizedoligomers which could sequentially reconstitute wild-type pro-moter sequences when inserted downstream of the inactive A20promoter mutant. The insertion of sequences corresponding tothe site of transcription initiation (position -3 to +4) downstreamof the BamHI site in the mutant A20 resulted in a reconstitutionof the promoter activity to a level at least 10-fold higher thanthat of the A6 mutant and even 2- to 3-fold higher than the authen-tic 1 1-kd promoter at its original location (Figure 4, mutant A).Two late mRNAs were detectable with different 5' ends mapp-

1074

M.Hanggi, W.Bannwarth and H.G.Stunnenberg

Vaccinia virus late promoter

Table I. Early and late vaccinia virus promoter sequences

Late promoters

I 1-kd ATTTCATTTIG1TITTFCTATGCTATAAATGAAT'v

7.5-kd CCCGCTTTTTATAGTAAGTTTTTCACCCATAAATAATAlate

'V28-kd GTATTCATTTATCACAAAAAAAACTTCTCTAAATGAGT

4b ATCACGCTTTCGAGTAAAAACTACGAATATAAATAATG

F2 (27-kdlate)

F4 (38-kdlate)

F6 (?)

TGGTAATATGGATACTAATTGTAGCTATTTAAATGGGT

GTAGACTCATTTAGAAGTTTTTTTGTGATAAATGAAT

CAGATATTCCGACAAAGGATTGATTACTATAAATGGAG

F7 (?) TAAAGATTGTGCAAAGCTITrGCGATCAATAAATGGAT

consensus TTTAAATAATT ~AA

Early promotersV

TK GAATAAAGTGAACAATAATTAATTCTTTATT G TCATCATG

42-kd TAAAACACATAAAAATAAGCGTAACTAATAAGACAATG

19-kd TATATTACTGAATTATAATATAAAAT7CCCAATCT

7.5-kdearly

V

CGTAAAAGTAGAAAATATATTCTAATFF7ATTGCAC

The consensus sequence represents the conserved promoter element of latepromoters. The sites of transcription initiation are indicated (V).

ing within the TAAAG sequence (-12 to -8) and within themost proximal TAAAT motif. The conversion of four nucleotidesimmediately upstream of the TAAAT element into their com-plement also resulted in a up mutation, raising the promoterstrength to a level equivalent to that of the authentic 1 l-kd pro-moter within the HindIII-F fragment (Figure 4, mutant F). Thereconstitution of wild-type promoter sequences upstream of posi-tion -2 and a mutated TAAAT motif did result in an inactivepromoter (Figure 4, mutants E and G). The main differencesbetween the mutants E and G and the wild-type 1 1-kd promoterare the conversion of an A into a T residue at position -2 andthe deletion of a T residue at position +4 (Figure 4). We couldalready show that the conversion of an A into T residue at posi-tion -2 does not affect the promoter strength; a T residue ispresent at this position within the active promoter mutant F. Wetherefore conclude that the strong down mutation is caused bythe deletion of the proximal T residue (position +4) of theTAAAT motif. The results obtained cannot be explained bymessenger instability due to the deletion of a specific sequenceat the Cap site. The sequence TAAAG at the putative Cap siteof the mutants E and G is used as the site of transcription initia-tion with the promoter mutants A6 and A. These RNA transcriptsare stable and accumulate during the late phase of the viral in-fection (Figures 3 and 4). Taken together, the circumstantialevidence suggests that the TAAAT motif represents a cis-actingpromoter element rather than a signal for RNA processing. Thisconclusion is supported by the fact that the TAAAT motif is con-served in all vaccinia virus late promoter sequences and is veryclose to, but not necessarily overlapping, the site of transcrip-tion initiation (Table I). The TAAAT element is not present inthe early promoters known so far. The putative promoter se-quences F2, F4, F6 and F7 represent upstream sequences in frontof open reading frames as found by Plucienniczak et al. (1985).

The open reading frames of F2 and F4 have been shown to overlapwith the physically mapped late gene products 27 kd and 28 kd(Weir and Moss, 1984). The nucleotides surrounding the TAAATmotif seem to be conserved to a certain extent: upstream twoA or T residues are found and downstream two purines. We pro-pose a consensus sequence A-ATAAATAA for this promoter ele-TT GGment. From the fact that the -TAAAT- sequence is completelyconserved and that a single deletion or mutation within this se-quence inactivates the promoter we postulate that the TAAATmotif present in late promoters functions as a TATA box-likeelement, which overlaps to a certain extent with the site oftranscription initiation. Detailed analysis of late as well as earlypromoters will be needed to answer the question whether thisTAAAT element determines the late character of the vacciniavirus promoter.

Materials and methodsCellsHuman TK-143 cells were obtained from the Human Genetic Mutant CellRepository, Institute for Medical Research, Camden,NJ (No. GM 5887). Rabbitkidney (RK-13), mouse L tk- cells and human TK-143 cells were grown inEagle's minimal essential medium supplemented with 10% fetal calf serum andcontaining vitamins and non-essential amino acids.DNA synthesisThe synthetic DNA fragments were prepared on a 0.5-1.0 iemol scale usingcontrolled pore glass (CPG) as a solid support and phosphoamidite chemistry(Adams et al., 1983; McBride and Caruthers, 1983). The synthesis of oligomersfor the 5' deletion mutants was started on a 5 Amol scale and aliquots of supportcarrying the corresponding protected DNA fragment were removed in the courseof the synthesis, worked up and isolated individually. All the fragments werethus obtained from the same synthetic run (32- up to 11 1-mer) and the same primercould be used for the formation of the duplex of the individual 5' deletionfragments.RNA preparation and SI mappingRNA was purified from infected cell monolayers using guanidinium hydrochlorideas described by Wittek et al. (1984). RNA transcripts were mapped by SI analysis(Berk and Sharp, 1977) using DNA fragments asymmetrically labelled at the 5'end. The hybridization in 80% formamide was carried out overnight at 44°Cand SI nuclease digestion was performed at room temperature.Preparation of recombinant virusesHuman TK-143 cells were infected with 0.1 p.f.u./cell of the vaccinia virustemperature-sensitive mutant ts7 (Drillien and Spehner, 1983). After 2 h at thepermissive temperature of 33°C, the cells were transfected with a calciumphosphate DNA precipitate as described (Drillien and Spehner, 1983). 60 ng ofvaccinia wild-type DNA (WR strain) co-precipitated with 60 ng of the appropriaterecombinant plasmid were used per 2 x 106 cells. After 6 h incubation at 39.5°C,the cells were washed and incubated further at 39.5°C for 2 days. Viruses wereharvested and selected for the absence of TK activity on human TK-143 cellsin the presence of 100 ug/ml of bromodeoxyuridine. The amount of tk- virusesin the progeny was determined by titration and single plaques were isolated usinga overlay of low melting agarose. The plaque-purified recombinant virus wasanalysed for the presence of the inserted chimeric gene by Southern blotting.Sources of materialsRestriction endonucleases and the Klenow fragment of DNA polymerase wereobtained from Boehringer, Mannheim. Polynucleotide kinase and nuclease S1were from P.L.Biochemicals. Bacterial alkaline phosphatase was purchased fromBRL, reverse transcription from Genofit (Geneva). Radioactive nucleotides werefrom Amersham. All the solutions for cell culture were obtained from Gibco.

AcknowledgementsWe are very grateful to Ricco Wittek for helping us to start the vaccinia viruswork and for the generous gifts of vaccinia virus subfragments and different celllines. We would like to thank various people at the EMBL, Heidelberg, in par-ticular Heide Seifert for preparing the manuscript.

ReferencesAdams,S.I., Kavka,K.S., Wykes,E.J., Holder,S.B. and Galluppi,G.R. (1983) J.Am. Chem. Soc., 105, 661-663.

1075

M.Hanggi, W.Bannwarth and H.G.Stunnenberg

Berk,A.J. and Sharp,P.A. (1977) Cell, 12, 721-732.Bertholet,C., Drillien,R. and Wittek,R. (1985) Proc. Natl. Acad. Sci. USA, 82,2096-2100.

Chang,A.C.Y., Nunberg,J.H., Kaufman,R.J., Erlich,H.A., Schimke,R.T. andCohen,S.N. (1978) Nature, 275, 617-624.

Cochran,M.A., Puckett,C. and Moss,B. (1985) J. Virol., 53, 30-37.Drillien,R. and Spehner,D. (1983) Virology, 131, 385-393.Hope,I.A., Mackay,M., Hyde,J.E., Goman,M. and Scaife,J.G. (1985) Nucleic

Acids Res., 13, 369-379.Hruby,D. and Ball,L.A. (1982) J. Virol., 43, 403-409.Mackett,M., Smith,G.L. and Moss,B. (1982) Proc. Natl. Acad. Sci. USA, 79,7415-7419.

Mahr,A. and Roberts,B.E. (1984) J. Virol., 49, 510-520.Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) Molecular Cloning. A

Laboratory Manual. Cold Spring Harbor Laboratory Press, NY.McBride,L.J. and Caruthers,M.H. (1983) Tetrahedron Lett., 24, 245-248.Nevins,J.R. (1983) Annu. Rev. Biochem., 52, 441-466.Panicali,D. and Paoletti,E. (1982) Proc. Natl. Acad. Sci. USA, 79, 4927-4931.Plucienniczak,A., Schroeder,E., Zettlmeisl,G. and Streeck,R.E. (1985) Nucleic

Acids Res., 13, 985-998.Rosel,J. and Moss,B. (1985) J. Virol., 56, 830-838.Smith,G.L. and Moss,B. (1983) Gene, 25, 21-28.Smith,G.L., Mackett,M. and Moss,B. (1984) Biotechnol. Genet. Eng. Rev., 2,

383-407.Vieira,J. and Messing,J. (1982) Gene, 19, 259-268.Weir,J.P. and Moss,B. (1983) J. Virol., 46, 530-537.Weir,J.P. and Moss,B. (1984) J. Virol., 51, 662-669.Wittek,R., Hanggi,M. and Hiller,G. (1984) J. Virol., 49, 371-378.

Received on 14 February 1986

1076