ORIGINAL ARTICLE - Ruđer Bošković Institute · Web viewInsulin receptor (IR) mRNA expression...

J. Neurochem. JNC-E-2006-0589.R1 Grünblatt et al.

ORIGINAL ARTICLE

Brain insulin system dysfunction in streptozotocin intracerebroventricularly treated rats

generates hyperphosphorylated tau protein

Grünblatt Edna1, Salkovic-Petrisic Melita2, Jelena Osmanovic2, Riederer Peter1, Hoyer

Siegfried3

1 Institute of Clinical Neurochemistry and National Parkinson Foundation Centre of Excellence

Laboratory, Clinic for Psychiatry and Psychotherapy, Bayrische Julius-Maximilian-University of

Würzburg, Würzburg, Germany.

2 Department of Pharmacology and Croatian Institute for Brain Research, Medical School,

University of Zagreb, Zagreb, Croatia

3 Department of Pathology, University of Heidelberg, Heidelberg, Germany.

Running title: Alzheimer’s disease is an insulin resistant brain state

Keywords: Alzheimer’s disease, Brain, Gene expression, GLUT2, Insulin, Insulin receptor,

Learning / Memory, Protein tyrosine kinase, Streptozotocin, Tau protein.

Word No. Abstract: 200 Word No. Text: 6628 No. Figures: 4

No. Tables: 5 Suppl. Material: 0

Submission date: Saturday, 27 May 2023

All correspondence to Dr. Edna Grünblatt:

Bayerische Julius-Maximilians- University Würzburg

Clinic and Policlinic for Psychiatry and Psychotherapy / Neurochemistry Laboratory

Füchsleinstr. 15

D-97080 Würzburg / Germany

Tel: +49-931-20177300

Fax: +49-931-20177220

E-mail: [email protected]

1

mailto:[email protected]


Abstract

The intracerebroventricular (icv) application of streptozotocin (STZ) in low dosage was used in 3-

month-old rats to explore brain insulin system dysfunction. Three months following STZ-icv

treatment, the expression of insulin-1 and -2 mRNA was significantly reduced to 11% in hippocampus

and to 28% in frontoparietal cerebral cortex, respectively. Insulin receptor (IR) mRNA expression

decreased significantly in frontoparietal cerebral cortex and hippocampus (16% and 33% of control).

At the protein/activity level, different abnormalities of protein tyrosine kinase activity (increase in

hippocampus), total IR -subunit (decrease in hypothalamus), and phosphorylated IR tyrosine residues

(increase) became apparent. The STZ-induced disturbance in learning and memory capacities was not

abolished by icv application of glucose transport inhibitors known to prevent STZ induced diabetes

mellitus. The discrepancy between reduced IR gene expression and increase in both phosphorylated IR

tyrosine residues / protein tyrosine kinase activity may indicate imbalance between

phosphorylation/dephosphorylation of the IR -subunit causing its dysfunction. These abnormalities

may point to a complex brain insulin system dysfunction after STZ-icv application which may lead to

an increase in hyperphosphorylated tau-protein concentration. Brain insulin system dysfunction is

discussed as possible pathological core in the generation of hyperphosphorylated tau protein as a

morphological marker of sporadic Alzheimer’s disease.

2


Introduction

Substantial evidence has been gathered in support of the presence of both insulin and insulin

receptors in the brain. The main source of brain insulin is pancreatic beta cells. Insulin is

known to cross the blood brain barrier (BBB) by a saturation transport mechanism. The

transporter is unevenly distributed throughout the brain, with the olfactory bulb having the

fastest transport rate of any brain region (Banks 2004), demonstrating, in addition, regional

differences in transport kinetics. A smaller proportion of insulin is produced in the brain itself

(Plata-Salaman 1991). Insulin gene expression and insulin synthesis have been demonstrated

in both immature and mature mammalian neuronal cells (Schechter et al. 1992; Schechter et

al. 1996; Schechter and Abboud 2001). Insulin mRNA was found to be distributed in a highly

specific pattern with the highest density in pyramidal cells of the hippocampus and high

densities in medial prefrontal cortex, the entorhinal and perihinal cortices, the thalamus and

the granule layer of the olfactory bulb, as well as in hypothalamus. Neither insulin mRNA nor

synthesis of the hormone were observed in glial cells (Devaskar et al. 1994). The release of

insulin from brain synaptosomes is stimulated by glucose (Santos et al. 1999).

It has been demonstrated that insulin receptors are dispersed throughout the brain and also

follow a highly specific pattern with the highest density detected in olfactory bulb,

hypothalamus, cerebral cortex and hippocampus (van Houten et al. 1979; Unger et al. 1989).

Nerve terminals show enriched densities of insulin receptors (van Houten et al. 1980; Abbott

et al. 1999) which bind insulin in a highly specific and rapid manner (Raizada et al. 1988).

Two different types of insulin receptors have been found in the adult mammalian brain: a

peripheral type on glial cells (-subunit 130kDa, -subunit 95 kDa) which is down-regulated

by insulin, and a neuron-specific brain type with high concentration on neurons (-subunit

118kDa, -subunit 91 kDa) which is not down-regulated by insulin (Adamo et al. 1989). The

location of phosphotyrosine-containing proteins corresponds to the distribution of the insulin

receptor (Moss et al. 1990). Insulin receptor mRNA is abundantly present in neuronal somata

3


(Schwartz et al. 1992) but the protein shows the highest density in the synaptic neuropil

(Baskin et al. 1994). Besides these brain-related data, detailed effects of insulin on its

peripheral receptor in adipocytes and muscle cells were summarized in several review articles,

as presented below. Binding of insulin to the extracellular -subunit of its receptor induces

autophosphorylation of the intracellular -subunit by phosphorylation of the intrinsic tyrosine

residues 1158, 1162 and 1163 for activation (Combettes-Souverain and Issad 1998). The

receptor’s activation state is regulated by its phosphorylation state. Deactivation may be

induced by the action of both phosphotryosine phosphatase causing dephosphorylation

(Goldstein 1993) and by serine/threonine kinases causing phosphorylation at serine residues

1305 and 1306, and threonine residue 1348 (Häring 1991; Avruch 1998). Interestingly, the

activity of protein tyrosine phosphatase was found to be regulated by insulin (Kenner et al.

1993). Thus, as a general phenomenon insulin receptor signaling dysfunction may be caused

when tyrosine phosphorylation, and/or when tyrosine dephosphorylation fails, and/or when

serine/threonine phosphorylation is increased and maintained at a higher level.

Evidence has been provided that the neuronal glucose metabolism is pre-eminent for

neuronal/brain function. Under normal conditions, this metabolic pathway is the only source

of ATP, and contributes to the formation of acetylcholine, cholesterol and neurosteroids via

the metabolite acetyl CoA, and to UDP-N-glucosamine via the metabolite fructose-6-

phosphate. It may be assumed that the neuronal glucose metabolism is under control of the

neuronal insulin signal transduction system (for review (Hoyer and Frölich 2006). Through

this mediate the insulin signal may effect on neurotrophic and neuromodulatory functions,

synaptic plasticity, and learning and memory capacities (Zhao et al. 1999; Park et al. 2000).

Predominant abnormalities in cerebral glucose metabolism and its control by the neuronal

insulin signal transduction system have been found in sporadic Alzheimer’s disease (SAD)

(Hoyer et al. 1991; Frölich et al. 1998; Hoyer 2002, 2004), putting forward the hypothesis that

SAD is the brain type of diabetes mellitus II (Hoyer 1998). A mismatch of both the insulin

4


action and IR function itself, including downstream signaling pathways has been proposed to

be involved in brain insulin system dysfunction in SAD (Salkovic-Petrisic and Lackovic

2005).

Considering the presence of insulin (originating from both periphery and brain) and insulin

receptors in the brain, an experimental rat model was developed by using streptozotocin

(STZ) to induce the brain insulin system dysfunction. In general, STZ is a drug selectively

toxic for insulin producing/secreting cells, as following systemically application STZ enters

the cells via the glucose GLUT2 transporter, mainly localized in pancreatic -cells (to a

certain extent also in hepatocytes and absorptive epithelial cells of the intestine and kidney).

Coupled with glucokinase, GLUT2 participates in a glucose-sensing mechanism in -cells

important for insulin production/secretion. STZ exerts betacytotoxic effects mostly by causing

alkylation of DNA which triggers activation of poly ADP-ribosylation consequently leading

to depletion of cellular NAD+ and ATP, and finally to a permanent diabetes mellitus when

applied in a higher dosage (Szkudelski 2001). In contrast, in moderate to low dosage and in

short-term experiments, STZ caused insulin resistance (Blondel and Portha 1989) by a

decreased autophosphorylation of the insulin receptor (Kadowaki et al. 1984), increased total

insulin receptor number but with little change in phosphorylated IR- subunit one (Giorgino

et al. 1992), and maintained insulin-immunoreactive cells in the pancreas generating a

transient diabetes mellitus (Rajab et al. 1989; Ar'Rajab and Ahren 1993). In this study STZ

was applied intracerebroventricularly (icv) in a dosage up to 100 times lower (per kg b.w.)

than used for systemic application. STZ icv did not cause a systemic diabetes mellitus (Nitsch

and Hoyer 1991; Duelli et al. 1994; Lannert and Hoyer 1998). The pancreatic STZ-transporter

GLUT2 has also been found in mammalian brain (Brant et al. 1993; Leloup et al. 1994;

Ngarmukos et al. 2001). GLUT2 is regionally specifically distributed throughout the rat brain,

especially in the limbic areas and related nuclei, most concentrated in the ventral and medial

regions close to the midline (Arluison et al. 2004b; Arluison et al. 2004a). Localization of

5


GLUT2 labeling is more numerous in the vicinity of nerve terminals and/or dendrites or

dendritic spines forming synaptic contacts, which together with neuronal localization

relatively similar to that of glucokinase, support the idea that GLUT2 may be expressed by

some cerebral neurons possibly involved in glucose sensing (Arluison et al. 2004b; Arluison

et al. 2004a). However, other studies have demonstrated that GLUT2 mRNA distribution in

the adult rat brain is not entirely parallel to that of glucokinase at the quantitative level; being

lower, similar or higher than glucokinase in different brain regions, respectively (Li et al.

2003). This may suggest different roles of particular regions in terms of glucose sensing, but

also participation of brain GLUT2 in functions other than glucose sensing, like regulation of

neurotransmitter release and perhaps, in the release of glucose by glial cells (Arluison et al.

2004b; Arluison et al. 2004a). However, direct evidence of STZ entering into particular brain

cells through GLUT2 is still lacking.

After STZ icv administration, severe abnormalities in brain glucose/energy metabolism have

been found; glucose utilization was reduced in 17 of 35 brain areas (Duelli et al. 1994), the

activities of glycolytic key enzymes decreased markedly (Plaschke and Hoyer 1993) finally

causing diminished concentrations of the energy-rich compounds ATP and creatine phosphate

(Nitsch and Hoyer 1991; Lannert and Hoyer 1998). Both energy deficit and reduced activity

of choline acetyltransferase (cholinergic deafferentiation) (Hellweg et al. 1992; Blokland and

Jolles 1993) may form the biological basis for the marked reduction in learning and memory

capacities (Lannert and Hoyer 1998). Furthermore, a direct histopathological evidence of

specific neurotoxic damage caused by STZ icv administration to axons and myelin in the

fornix, anterior hippocampus and periventricular structures that are essential for learning and

spatial memory, have been reported (Shoham et al. 2003; Weinstock and Shoham 2004).

Regarding the brain IR signaling, a recent investigation focusing on the downstream

phosphatidylinositol-3 (PI3)-kinase signaling pathway showed abnormalities of Akt/protein

kinase B level and of both phosphorylated and non-phosphorylated glycogen synthase kinase-

6


3/ protein 1 month and 3 months after STZ icv administration (Salkovic-Petrisic et al.

2006). In the latter study, an increase in total tau-protein in the brain and amyloid formation in

leptomeningeal vessels were found.

The data available so far point to different aspects: 1. STZ icv administration causes severe

abnormalities in metabolic pathways being under control of the insulin/insulin receptor

signaling cascade in the rat brain. 2. Observed changes seem to demonstrate great similarities

to cellular and intracellular abnormalities found in the SAD brain. 3. The mechanism of STZ

icv action is not known, however it could be hypothesized that in general it is similar to the

mechanism of STZ peripheral action. Therefore, we were interested in studying abnormalities

of the brain insulin signal transduction cascade at the gene expression and protein

expression/activity levels, which may be induced by STZ icv application. The abnormalities

found served for tentative comparison with changes characteristic for SAD. Using learning

and memory capacities as sensitive markers, the interaction of glucose transporter and STZ

for elucidating possible mechanism of STZ icv action was studied in an additional approach.

Material and Methods

Material

Streptozotocin was purchased from Sigma-Aldrich (Munich, Germany). Protein Tyrosine

Kinase Activity assay kit was purchased from Chemicon International (Hampshire, United

Kingdom; Cat. No. SGT410). For buffer preparations EGTA (Cat. No. E4378), Tris buffer,

Na3VO4 (Cat. No. S6508), EDTA 0.5 M (Cat. No. E7889), Protease Inhibitor mix (Cat. No.

P8340), Sodium Deoxychlorate (Cat. No. D6750), BSA, β-mercaptoethanol (Cat. No. M7154)

and the Insulin Receptor Subunit ELISA (Cat. No. CS00090) were purchased from Sigma-

Aldrich (Munich, Germany). DTT (Cat. No. 43817) was purchased from Fluka (Germany). 5-

thio-D-glucose and 3-0 methyl glucose were purchased from Sigma-Aldrich Chemie (Munich,

Germany). The polyclonal rabbit anti-human tau (K9JA) antibody (recognizes total tau at C-

7


terminal part, amino acids 243-441) and monoclonal PHF-1 anti-tau antibody (recognizes tau

phoshorylated at serine S-396 and S-404) were received as a gift from Dr. E-M Mandelkow

(Max-Planck-Gesellschaft, Hamburg, Germany), although the first commercially originated

from DAKOCytomation (Glostrup, Denmark) and the latter was from Dr. Peter Davies

(Albert Einstein College of Medicine, Bronx, New York). Anti-rabbit IgG, HRP-linked

antibody and anti-mouse IgG, HRP-linked antibody were purchased from Cell Signalling

(Beverly, MA, USA). Chemiluminiscent Western blot detection kit was from Amersham

Biosciences (Freiburg, Germany). Gels were from Novex (San Diego, CA, USA), and

nitrocellulose membranes were from Invitrogen (Invitrogen GmbH, Karlsruhe, Germany).

Animals

Three to four-month old male Wistar rats weighing 280-330 g (Department of Pharmacology,

School of Medicine, University of Zagreb) were used throughout the studies. Animals were

kept on standardized food pellets and water ad libitum.

Drug treatments

Rats were randomly divided into groups (5-6 per group) and given general anaesthesia

(chloralhydrate 300 mg/kg, ip), followed by injection of different drugs administered

bilaterally into the left and right lateral ventricle according to the procedure described by

Noble et al. (Noble et al. 1967). Drug concentration and solution volume was adjusted

according to the animal body weight, and a volume of 4 μL per 300 g body weight was

administered (2 μL/ventricle). Control animals received bilaterally an equal volume of vehicle

into the lateral ventricles.

For the IR and tau protein analyses, rats were treated icv with a single STZ injection (1

mg/kg, dissolved in 0.05M citrate buffer pH 4.5). STZ-treated and respective control animals

were sacrificed 3 months following the drug treatment.

In the behavioural experiment, rats were randomly divided in 5 groups and the following drug

icv treatments were applied:

8


group I: 0.05M citrate buffer pH 4.5, applied 3 times, on day 1, 3 and 21 (control group,

CTRL)

group II: STZ 1 mg/kg, dissolved in 0.05M citrate buffer pH 4.5; applied once - on day 1, and

citrate buffer applied icv on day 3 and 21 (STZ 1x)

group III: STZ 1 mg/kg, dissolved in 0.05M citrate buffer pH 4.5; applied 3 times – on day 1,

3 and 21 (STZ 3x)

group IV: 3-0-methyl-glucose (30MG) 1 mg/kg followed by STZ 1 mg/kg, both dissolved in

0.05M citrate buffer pH 4.5; applied 3 times by separate consecutive injections – on day 1, 3

and 21 (STZ 3x +30MG 3x)

group V: 5-thio-D-glucose (TG) 375 μg/kg followed by STZ 1 mg/kg, both dissolved in

0.05M citrate buffer pH 4.5; applied 3 times by separate consecutive injections – on day 1, 3

and 21 (STZ 3x + TG 3x)

For the IR and tau protein analyses, brains were quickly removed, and cut into left and right

half. Frontoparietal cortex (IR analysis), hippocampus (IR and tau analyses) and

hypothalamus (IR analysis) were cut out from the brain, immediately frozen and stored at -80

oC. The proportions of the right half of the brain were homogenized as described further.

STZ-icv-treated animals had no symptoms of systemic diabetes and steady-state blood

glucose level did not differ in comparison with control animals.

Young-adult animals were chosen for the study to evaluate also the effect of compensation

after damage. Compensation may be assumed to be facilitated in the young-adult brain (Hoyer

1985). Otherwise, a long-term maintenance of the brain damage starting early in life may

point to abnormalities characteristic of chronic disorders developing later in life (Holness et

al. 2000)

Quantitative real-time RT-PCR

Total-RNA extraction

9


Isolation of total RNA was performed using RNeasy Mini Kit (Qiagen GmbH, Germany) for

each animal and brain region separately. An additional step was added to the original protocol

in order to receive a pure DNA free total-RNA. The total RNA was on column pre-treated

with DNase-I and the original protocol was then continued in order to have total RNA

extraction. The RNA quality and quantity was assessed using the Experion electrophoresis

(BioRad Laboratories, Hercules, CA, USA) which analyses the concentration of the total

RNA and quality via the ratio of the 28S / 18S ribosomal RNA. Only intact total RNA

samples (with at least 28S/18S ration of 1.7) were used for the gene expression analysis.

Q-PCR

In order to measure the gene expression profile of insulin-1, insulin-2, and insulin-receptor,

quantitative real-time RT-PCR for mRNA samples isolated from rats' frontal cortex,

hippocampus and hypothalamus were performed. Total RNA (1-0.4 mg) from each sample

was reverse transcribed with random hexamer and oligo-dT primers using iScriptTM cDNA

Synthesis Kit (BioRad Laboratories, Hercules, CA, USA, Cat. No. 170-8890). The genes

measured are listed in Table 1. These were normalized to the house-keeping genes: beta-actin

(ActX), ribosomal 18S (Rnr1), and glyceraldehydes-3-phosphate dehydrogenase (GAPDH)

(Table 1). The house keeping genes were tested for their stability using the geNorm program

(http://medgen.ugent.be/~jvdesomp/genorm/) (Vandesompele et al. 2002). After analysis for

the most stable house-keeping genes, a normalization factor was calculated according to the

program. Absence of DNA contamination was verified by amplifying the house-keeping gene,

ribosomal 18S, and run on gel to observe no product. Minus RT samples were tested

simultaneously with experimental samples by quantitative RT-PCR in order to see whether

the reaction did not yield any amplification below 35 cycles using the PCR protocol. Real-

time PCR was performed in the iCycler iQ system (BioRad Co., Hercules, CA, USA) as

described previously (Svaren et al. 2000; Ugozzoli et al. 2002). Briefly, 30-100 ng of cDNA

and gene specific primers (200nM final concentration) and probes (500nM final

10

http://medgen.ugent.be/~jvdesomp/genorm/


concentration; when the assay consist probes) (indicated in Table 1) were added to either

QuantiTect SYBR Green PCR Kit (Qiagen Inc., Valencia, CA, USA, Cat. No. 204143) or to

iQ Supermix (BioRad Co., Hercules, CA, USA, Cat. No. 170-8862; in case of the probe

assays). Real-time PCR were subjected to PCR amplification (in general 1 cycle at 950 C for

15 min, 30-45 cycles at 940 C for 15 s, annealing and detecting of specific fluorescent colour

at 550C for 30 s and extension at 760C for 30 s). All PCR reactions were run in triplicate. The

amplified transcripts were quantified using the comparative CT method analyzed with the

BioRad iCycler iQ system program. Standard curves for each amplification product were

generated from 10-fold dilutions of pooled cDNA amplicons, isolated from agarose gel using

MinEluteTM Gel Extraction Kit (Qiagen Inc., Valencia, CA, USA), to determine primer

efficiency and quantization.

Total Insulin-receptor (IR-) subunit & the phosphorylated forms ELISA

Homogenates preparation

Fresh tissue was homogenized one to four volumes of a pre-chilled lysis buffer containing

50mM Tris, pH 8.0, 150 mM NaCl, 0.5 mM EDTA, 1 mM DTT, 1% NP-40, 0.5% Sodium

Deoxychlorate, 0.1% SDS protease inhibitors cocktail and 100 µM Sodium Vanadate. The

homogenate were centrifuged at 12,000 x g for 10 minutes at 40C to pellet the fraction. The

supernatant was than stored at -700C till further analysis in aliquots.

Total protein concentration determination

The amount of protein was assayed according to the method of Bradford (Bradford 1976)

(Sigma, Cat. No. B6916). For calibration curve BSA standard was used (Sigma, Munich,

Germany). The concentration was determined by measurement of the absorbance at 595 nm.

ELISA

The measurement of the phosphorylated and non-phosphorylated IR-β subunit was conducted

according to the kit manual (Sigma, Cat. No. CS0090 for IR-β subunit; Cat. No. PI0100 for

Phospho-IR-β subunit pTyr1158; Cat. No. PI0200 for Phospho-IR-β subunit pTyr1162/1163).

11


Homogenates were diluted with buffer diluents one to ten volumes. Standard curve analysis

was run in parallel on each plate. The absorbance was measured in the Multiskan Spectrum

spectrophotometer at OD 450 nm (Thermo Labsystems, Finland). Further analyses of the

results were performed on a PC Excel windows program.

Protein Tyrosine kinase activity assay

The activity of the IR protein Tyrosine Kinase (PTK) was conducted according to the kit

manual (Chemicon, Cat. No. SGT410). Tyrosine Kinase Activity Assay Kit measures the total

activity of the protein tyrosine kinase residues on the insulin receptor. The buffer assay used

in this PTK activity was as recommended in the manual from Upstate Ltd (Dundee, UK,

Kinase Profiler Assay Protocols). The assay buffer contained 50mM Tris, pH 7.5, 0.1 mM

EGTA, 0.1 mM Na3VO4, 0.1% β-mercaptoethanol and 1mg/ml BSA. The homogenate was

used in a one volume to 5.7 volumes of total reaction mix for the reaction. Standard curve

analysis was run in parallel on each plate. The absorbance was measured in the Multiskan

Spectrum spectrophotometer at OD 450 nm (Thermo Labsystems, Finland). Further analyses

of the results were performed on a PC Excel windows program.

Western blot

Tissue preparation.

Hippocampal (1 animal = 1 sample) tissue samples from the left half of the rat brain were

homogenized with 3 volumes of lysis buffer containing 10 mM HEPES, 1 mM EDTA, 100

mM KCl, and 1% Triton X-100, pH 7.5, and protease inhibitors coctail (1:100), and the

homogenates were centrifuged at 600xg for 10 min. The supernatants were further centrifuged

at 45 000 xg for 30 min at 4 oC, and the pellets were resuspended in 100 μL of the lysis buffer.

Finally, the resuspended pellets were mixed with appropriate previous supernatants obtained

after second centrifugation. Protein concentration was measured by Bradford Protein assay.

Samples were frozen and stored at -80 oC.

Immunoblotting.

12


Equal amounts of total protein (50 μg per sample) were separated by SDS-PAGE using 8%

polyacrylamide gels and transferred to nitrocellulose membranes (Schneppenheim et al.

1991). The nitrocellulose membranes were blocked by incubation in 5% non-fat milk added to

low salt washing buffer (LSWB) containing 10 mM Tris and 150 mM NaCl, pH 7.5, and

0.5% Tween 20, one hour at room temperature. Blocked blots were incubated overnight at 4

oC with respective primary anti-total tau (1: 10 000), and anti PHF-1-tau antibodies (1:300).

Following the incubation, the membranes were washed three times with LSWB and incubated

for 60 min at room temperature with secondary antibody solution (anti-rabbit IgG, 1:2000,

and anti-mouse IgG, 1:500). The specificity of the signal was checked on the control

membranes that were not incubated with the primary antibody. After washing three times in

LSWB, the membranes were immunostained using chemiluminiscence Western blotting

detection reagents, signal captured and visualised with the Chemi Doc BioRad (UK) video

camera system.

Morris Water Maze Swimming Test

Cognitive functions were tested in Morris Water Maze Swimming Test (Anger 1991) twice, 2

weeks and 2 months after the first drug icv injection. Adaptation of rats to the experimental

environment and behavioural activity was done during two days before the experimental

trials. On the first of these two days animals were subjected to 1 min of freely swimming in a

pool (150x60 cm, 50 cm deep), with water temperature set at 25±1 oC, and on the second day

rats were allowed to freely swim in the pool divided in four quadrants (I-IV). In the

experimental trials, performed from day 1 to day 4, rats were thought to escape from water by

finding a hidden rigid platform submerged about 2 cm below the water surface in quadrant

IV. Stay on the platform was allowed for 15 sec. One trial consisted of three starts, each from

a different quadrant (I – III), separated by a 1-min rest period. Three consecutive trials were

performed per day, separated by a 30-min rest period. After the third trial on day 4, the fourth

trial was performed (starts from quadrants I-III) with a platform being removed from the pool,

13


and the time spent in searching for the platform after entering quadrant IV was recorded. The

cut off time was 1 min. Those rats who had no alterations in memory functions (control) were

supposed to remember that the platform had previously been there, and, in line with that, to

spend a long time swimming within quadrant IV, looking for the platform. In case of drug-

induced deterioration of memory functions, rats were supposed to remember less intensively

that the platform had been in quadrant IV, and thus to spend less time in searching for the

platform within this quadrant, in comparison with control rats.

Statistics

The differences of gene expression in the different brain regions were compared using the

one-way- analysis of variance (ANOVA) with Post-Hoc Test of Scheffe, using the StatView

computer program (Stat View 5.0. software, SAS Institute Inc. Cary, NC, USA) on a PC

computer. Statistically significant differences were accepted at p<0.05.

Densitometric values of proteins obtained in Western blot analysis were expressed as

percentage of the control group on the respective gel (mean ± SE), and the significance of

between-group difference was tested by Mann-Whitney U-test. P<0.05 was considered

significant. In the Morris Water Maze Swimming Test, values were expressed as total time

(seconds) spent in searching for the hidden platform in quadrant IV during the three

consecutive starts from quadrant I-III in the last experimental trial. Mean values with a

standard error and standard deviation range were presented. The significance of between-

group differences was tested by Kruskal-Wallis ANOVA median test, followed by Mann-

Whitney U-test, and p<0.05 considered statistically significant for both tests.

Ethics

The experiments carried out on 3 to 4-month-old rats in Zagreb, Croatia, were under the

guidance of the Principles of Laboratory Animal care (NIH Publication No. 86-23, revised in

1985), according to the Croatian Act on Animal Welfare (NN19; 1999) and were approved by

The Ethics Committee of the Zagreb University School of Medicine (No. 04-1343-2006).

14


Results

IR analyses

Control rats. In Table 2A, the normalized gene expression profiles of the insulin receptor,

insulin-1 and insulin-2 mRNA and their ratio under control conditions in frontoparietal brain

cortex, hippocampus and hypothalamus are demonstrated. The expression profiles of the IR

gene in frontoparietal brain cortex and hippocampus are in the same range, which seem to be

higher as compared to the hypothalamus. However, statistically significant difference was not

found. Both the expression of the insulin-1 and insulin-2 genes was highest in hippocampus,

followed by frontoparietal brain cortex and hypothalamus. In the latter, insulin-1 gene

expression was significantly decreased as compared to the hippocampus. The ratio of the

expression of the insulin-1 and -2 genes was highest in hippocampus, and nearly in the same

range in frontoparietal brain cortex and hypothalamus.

Table 2B shows the concentration of the total IR-β subunit, the concentrations of

phosphorylated tyrosine residues 1158 (pTyr1158) and 1162/1163 (pTyr1162/1163) per IR-

subunit, the activity of protein tyrosine kinase (PTK) and the ratio of PTK and the two

phosphorylated tyrosine residues. The concentration of the IR-β subunit was highest in

frontoparietal brain cortex (p<0.05) compared to hippocampus and hypothalamus. The

concentration of pTyr1158 per IR- subunit was highest in hippocampus as compared to

frontoparietal brain cortex (p<0.05) and to hypothalamus. The concentration of

pTyr1162/1163 per IR- subunit was found to be less concentrated in both frontoparietal

brain cortex and hippocampus compared to hypothalamus. Both residues may be

phosphorylated to the same degree in all brain areas studied. The highest activity of PTK was

found in frontoparietal brain cortex as compared to hippocampus and hypothalamus. The PTK

activity per phosphorylated tyrosine residue was found to be in the same range in each brain

region studied. However, regional differences became obvious with significantly higher ratio

in frontoparietal brain cortex and lower ratio in hippocampus and hypothalamus (p<0.0005).

15


STZ-icv treated rats. The effect of STZ icv on the gene expression profiles of insulin receptor,

insulin-1 and insulin-2 mRNA in frontoparietal brain cortex, hippocampus and hypothalamus

compared to controls is demonstrated in Figure 1. In both frontoparietal brain cortex and

hippocampus a statistically significant insulin receptor mRNA down-regulation was observed

(16% and 33% of control, respectively). In principle, the expression of both insulin-1 and -2

mRNAs demonstrated a trend of down-regulation after STZ icv treatment. A significant down

regulation of insulin-1 mRNA (20% of control) was observed in the hippocampus (p<0.05).

Insulin-2 mRNA expression was significantly down-regulated to 11% of control in the

frontoparietal brain cortex (p<0.05). The ratio of insulin-1 and insulin-2 expression has not

been found statistically significantly changed in STZ icv treated rats either in comparison to

the control group or between the three regions.

The protein content of the functionally important IR- subunit dropped to ~67% (of control)

in the frontoparietal brain cortex, increased in the hippocampus (169% of control) and

decreased in the hypothalamus (74% of control) after STZ icv treatment (Figure 2). STZ icv

caused a significant increase in the concentrations of both pTyr1158 and pTyr1162/1163 in

frontoparietal brain cortex, and in hypothalamus (pTyr1162/1163 only) as compared to

control. The activity of the PTK was unchanged in both frontoparietal brain cortex and

hypothalamus after STZ injection, but increased significantly nearly 3-fold in hippocampus

(Figure 2) (p<0.005). Regional difference was found in the ratio of PTK activity per

pTyr1158 with statistically significant increase (60%) demonstrated in hippocampus and no

change found in the other two regions. Ratio of PTK activity per pTyr1162/1163 was not

significantly different between the regions (Figure 2).

Tau protein

The immunoreaction of total tau (recognizing total tau protein at C-terminal part, amino acids

243-441) and p-tau (recognizing tau phoshorylated at serine S-396 and S-404, ie. GSK-3

related tau phosphorylation) increased significantly (177% and 90%, respectively, P<0.05) in

16


the hippocampus of STZ icv treated rats, in comparison to the control animals, as measured 3

months following the drug treatment (Figure 3 A-C).

Learning and memory function

Morris Water Maze Swimming Test discriminated rats that had no alterations in learning and

memory functions from those who have. The former ones remembered where the platform

had previously been, and in line with that, spent a long time swimming within the appropriate

quadrant looking for the platform. Rats with reduction of these functions, remembered less

intensively where the platform had previously been, and in line with that spent less time in

searching for the removed platform, in comparison with control rats. STZ 1x1 mg/kg and 3x1

mg/kg icv treated rats spent significantly less time in search for the removed platform, in

comparison to the control group, found as early as 2 weeks following the first drug treatment

(75.8 sec and 76.85 sec vs. 86.4 sec, respectively, P<0.05)(Figure 4). These STZ icv induced

cognitive deficits were persistent as found also 2 months following the first drug treatment

(66.7 sec and 57.6 sec vs. 110.2 sec, respectively, P<0.05) (Figure 4).

Interestingly, icv pre-administration of glucose transport inhibitors, 30MG and TG followed

by STZ icv administration, also induced significant cognitive deficits in comparison to the

control rats, found as early as 2 weeks after the first drug treatment (50.2 sec and 48.0 sec vs.

86.4 sec, respectively, P<0.05), and persistent as long as 2 months after the first drug

treatment (47.5 sec and 62.0 sec vs. 110.25 sec, respectively, P<0.05) (Figure 4). Therefore,

glucose transport inhibitor pre-treatment did not abolished STZ icv-induced cognitive deficits

(Figure 4).

Discussion

The normal brain

The present study suggests a dispersed gene expression of the IR and the two insulins

throughout the brain thus supporting former findings (Unger et al. 1989; Devaskar et al.

17


1994). The expression of IR mRNA showed a tendency to be higher in frontoparietal brain

cortex and in hippocampus than in hypothalamus. Rats and mice possess two insulin genes (1

and 2) both of which are localized to chromosome 1 (Todd et al. 1985). It is noteworthy that

the expression of both insulin-1 and insulin-2 was found to be relatively high-level in the

hippocampus followed by frontoparietal brain cortex, and by lower values in hypothalamus,

in accordance with literature data. It has been hypothesized that different distribution patterns

of insulin-1 and IR in the brain may suggest that IR in different brain regions may use insulin

from different sources, peripheral versus locally synthesized, for cell-to-cell communication

and neuronal signal transduction (Zhao et al. 2004). Interestingly, in post-mortem aged

control subjects, insulin gene expression was also highest in the hippocampus (Steen et al.

2005).

In this first in vivo-study performed at the protein level, a striking dissociation between IR-β

subunit and total IR mRNA was found among the brain areas studied reported earlier also by

Zhao and colleagues (Zhao et al. 1999). This finding is difficult to understand, and further

studies are needed to clarify whether or not the translational efficiency and/or the IR protein

stability is region-dependent e.g. that the turnover of the complete IR protein may be

regionally different i.e. higher in the metabolically particularly active hippocampus relative to

other brain regions. That differences of receptor concentration and protein turnover are

regionally different has, in principle, been demonstrated between different brain areas in favor

of the hippocampus (Stecher et al. 1997; Zhao et al. 1999).

STZ action in the brain

After systemic application, STZ was found to cause DNA breaks obviously in a dose-

dependent manner (Yamamoto et al. 1981; Kröncke et al. 1995) through intracellular

mechanisms, and after being transported into the cell by the GLUT2-transporter detailed by

Szkudelski (Szkudelski 2001). It is, however, not known as yet whether or not comparable

mechanisms take place in the brain after STZ icv administration, too. As a sensitive marker of

18


STZ action in the brain, the development of long-lasting disturbances in learning and memory

capacities has been repeatedly shown as a consequence of diverse abnormalities in neuronal

glucose metabolism (Mayer et al. 1990; Lannert and Hoyer 1998; Salkovic-Petrisic et al.

2006). In particular, the cholinergic transmission as the basis for learning and memory

capacities has been demonstrated to be severely disturbed inducing gene expression of choline

acetyltransferase (Lester-Coll et al. 2006) the activity of this enzyme (Blokland and Jolles

1993; Ishrat et al. 2006) and its function (Hellweg et al. 1992).

These data clearly indicate that the perturbed function of the neuronal insulin receptor is of

pivotal significance for the development of deficits in learning and memory capacities. This

assumption seems to be in contrast to insulin receptor knockout experiments in which no

alterations in basal brain glucose utilization and learning and memory capacities were found

(Schubert et al. 2004). However, it may have to be considered that the expression of the

insulin-like growth factor-1 (IGF-1) receptor remained unaltered in the latter study indicating

that an important compensation mechanism is intact. IGF-1 is an insulin homologue

abundantly found in the developing brain (Rotwein et al. 1988). The IGF-1 receptor is widely

distributed in the brain (Adamo et al. 1989; Marks et al. 1991b; Marks et al. 1991a). The IGF-

1 receptor and the insulin receptor are also found to be homologous with nearly identical

signal-transducing domains controlling most of the same intracellular pathways (De Meyts et

al. 1994). IGF-1 peaks during postnatal development only and is barely detected in normal

adult brain (Rotwein et al. 1988; Cheng et al. 2000). It is, however, highly induced in glia

cells reacting to damage (Lee et al. 1993). After STZ icv administration, IGF-1 receptor gene

expression was found to be reduced (Grünblatt et al. 2004).

To study the mode of action of STZ icv to brain cells, two different drugs, 5-thio-D-glucose

3-0-methyl glucose, well-known as glucose transport inhibitors, were administered icv. In line

with the fact of STZ entering beta cells by GLUT2, systemic administration of these drugs

19


immediately before STZ has been reported to prevent STZ-induced beta-cell toxicity and

diabetes (Ganda et al. 1976; Wang et al. 1993). Analogously, we have hypothesized that

glucose transport inhibitor icv pre-treatment may avoid STZ transport into the particular brain

cells, and learning and memory capacities served as a sensitive marker of STZ-induced

damage. Surprisingly, icv pre-treatment with two different glucose transport inhibitors did not

abolish the STZ-induced effect on mental capacities which was found to be reduced with STZ

icv treatment alone (Fig. 4), suggesting some differences between the peripheral and central

(icv) mechanism(s) of STZ cytotoxicity. This hypothesis has been further supported by the

fact that although GLUT2 has been demonstrated to be highly expressed in the hypothalamus

what would expect severe damage after STZ icv in this area, the STZ-induced damage on

gene expression in this study was found to be lowest in hypothalamus relative to

frontoparietal brain cortex and hippocampus (Fig. 1 and 2). Since the direct evidence of STZ

either entering the particular brain cells via GLUT2 or its CNS cytotoxicity being strictly

dependent on GLUT2 type of glucose transporter expression (as reported for the pancreatic

islet toxicity of STZ; (Hosokawa et al. 2001) is lacking, interpretation of glucose transport

inhibitor pre-treatment failure in abolishing STZ icv induced effects could be only a

speculative one. Theoretically, 3OMG and TG may also inhibit glucose uptake in all brain

cells expressing any type of glucose transporters leading to extensive intracellular glucose

deprivation. Such condition could be manifested as cognitive deficits, masking thus 3OMG

and TG pre-treatment induced abolishing of STZ icv associated cognitive deficits, if such

abolishment happened. However, there is no information from the literature that these two

substances inhibit all glucose transporter types.

Regionally specific character of brain neurochemical alterations following the STZ icv

administration has been convincingly reported at various levels; IR signaling (Salkovic-

Petrisic et al. 2006), glucose utilization (Duelli et al. 1994), monoaminergic transmission

(Salkovic et al. 1995; Salkovic-Petrisic and Lackovic 2003), suggesting they are not a

20


consequence of a general, non-specific toxicity of STZ. This is further supported by

regionally specific (and partly overlapping) distribution of structures that are known or

assumed to be its target (GLUT2 and IR).

Otherwise, STZ icv has been shown to cause broad effects on metabolic pathways being

under control of the neuronal insulin receptor allowing detailed studies on the

pathophysiology of the insulin/insulin receptor-dependent metabolism (see introduction).

Recent findings clearly demonstrated that STZ icv application caused the down regulation of

gene expression related to insulin signalling such as IGF-1 receptor. In contrast to this down

regulation, an up regulation was found in gene expression related to potassium channels,

GABA receptors and glutamate receptors (Grünblatt et al. 2004). Genes such as GDNF,

BDNF and integrin-alpha-M were up regulated whereas immediate-early-gene-transcription-

factor NGF-IB and methallothionein-1/2 were found to be down-regulated demonstrating that

transcription and inflammatory factors, apoptosis inducers, cell survival and oxidative stress-

involving proteins are altered (Grünblatt et al. 2006). This view is supported by the activation

of the markers of oxidative cell damage (Ishrat et al. 2006). As a consequence of the STZ icv-

induced cascade of genetic and metabolic abnormalities, neuronal damage and loss may

develop accompanied by an astrocytic rescue reaction (Lester-Coll et al. 2006).

This study shows a marked dissociation between severely reduced IR mRNA in frontoparietal

brain cortex and hippocampus, and nearly unchanged concentrations of IR-β subunit in these

areas. Likewise, unchanged or even elevated phosphorylation of the IR tyrosine residues and

PTK activity became obvious. These unexpected findings may point to imbalances between

the generation of proteins and their turnover and between protein phosphorylation and

dephosphorylation under pathological conditions. Receptor proteins localized postsynaptically

may undergo changes of synaptic plasticity, i.e. change from a labile to a stable or even

“regressed” state, the latter being nearly unable to transmit impulses (Changeux and Danchin

1976). It is not clear as yet in which way and to what degree this process influences the

21


turnover of the IR protein. There is also some evidence that failing receptor

dephosphorylation may inhibit autophosphorylation activity (Lai et al. 1989), and that, with

time, tyrosine-phosphorylated receptors become inaccessible to phosphatases, therefore

allowing persistence of tyrosine kinase activity (Paolini et al. 1996).

Indeed, the activity of the protein tyrosine phosphatase decreased after long-term STZ-

damage (Meyerovitch et al. 1989), and induced a drastic reduction of IR dephosphorylation

(Begum et al. 1991). Thus, the diminished activity of the protein tyrosine phosphatase may be

assumed to reduce dephosphorylation of the tyrosine residues of the IR- subunit and may

render it insufficient in function by inhibition of autophosphorylation, whereby regional

differences may come into play in frontoparietal brain cortex and hippocampus. Alternatively,

since a significant increase in brain insulin receptor kinase activity has been found in diabetic

rat brain, it has been hypothesized that brain insulin receptor kinase may be regulated

differently compared to peripheral tissue (Gupta et al. 1992). However, increased protein

tyrosine kinase activity does not necessarily lead to increased IR signal transduction

throughout the cell, if intracellular downstream pathway signaling elements are affected, as

found after STZ icv treatment in PI3 kinase pathway, at the level of Akt/PKB and GSK-3

(Salkovic-Petrisic et al. 2006). Further detailed studies are needed to clarify this issue e.g. the

release of the subunit of the IR from the cellular membrane into the cytosol and the

determination of protein phosphatases activity after STZ.

Bearing in mind that STZ icv treated rats have been proposed as a probable experimental

model of SAD, one could hypothesized that induction of disturbances in the brain insulin

system including insulin receptor signalling may be assumed to be the core of abnormalities

tightly related to SAD, i.e. intracellular fibrillary tangles with hyperphosphorylated tau

protein and extracellular deposits of neuritic plaques with -amyloids (A).

In a recent investigation, both the over production of tau-protein and the accumulation of A

in leptomeningal vessels could be demonstrated after STZ icv (Lester-Coll et al. 2006). In this

22


study we showed, in addition, that tau-protein is hyperphosphrylated as a long-term

consequence of STZ icv administration (Fig. 3). The intracerebral application of STZ in a

higher dosage than used in our study caused neuronal damage and cell loss as well as the

accumulation of A in the brain of pups (Lester-Coll et al. 2006). Bearing in mind the former

data comprising abnormalities in glucose/energy metabolism, acetylcholine formation and

function, insulin signal transduction and learning and memory capacities, it seems likely that

induction of the brain insulin system dysfunction may be relevant for the beginning of SAD.

Further research is needed to clarify this hypothesis.

Acknowledgment

The authors thank the funding that has been provided by the “Alzheimer Forschung Initiative

e.V”, DAAD (project No. A/04/20017), the Dr. Edda Neele Stiftung, and the Croatian

Ministry of Science, Education and Sport (project No. 0108253). Prof. Dr. E-M Mandelkow is

thanked for tau protein antibody donation. Special thank to Miss Miryame Hofmann for her

efficient and exact work in providing these great results. Mrs Bozica Hrzan is thanked for

technical assistance.

References

Abbott M. A., Wells D. G. and Fallon J. R. (1999) The insulin receptor tyrosine kinase

substrate p58/53 and the insulin receptor are components of CNS synapses. J Neurosci 19,

7300-7308.

Adamo M., Raizada M. K. and LeRoith D. (1989) Insulin and insulin-like growth factor

receptors in the nervous system. Mol Neurobiol 3, 71-100.

Anger W. K. (1991) Animal test systems to study behavioral dysfunctions of

neurodegenerative disorders. Neurotoxicology 12, 403-413.

23


Arluison M., Quignon M., Thorens B., Leloup C. and Penicaud L. (2004a)

Immunocytochemical localization of the glucose transporter 2 (GLUT2) in the adult rat

brain. II. Electron microscopic study. J Chem Neuroanat 28, 137-146.

Arluison M., Quignon M., Nguyen P., Thorens B., Leloup C. and Penicaud L. (2004b)

Distribution and anatomical localization of the glucose transporter 2 (GLUT2) in the adult

rat brain--an immunohistochemical study. J Chem Neuroanat 28, 117-136.

Ar'Rajab A. and Ahren B. (1993) Long-term diabetogenic effect of streptozotocin in rats.

Pancreas 8, 50-57.

Avruch J. (1998) Insulin signal transduction through protein kinase cascades. Mol Cell

Biochem 182, 31-48.

Banks W. A. (2004) The source of cerebral insulin. Eur J Pharmacol 490, 5-12.

Baskin D. G., Schwartz M. W., Sipols A. J., D'Alessio D. A., Goldstein B. J. and White M. F.

(1994) Insulin receptor substrate-1 (IRS-1) expression in rat brain. Endocrinology 134,

1952-1955.

Begum N., Sussman K. E. and Draznin B. (1991) Differential effects of diabetes on adipocyte

and liver phosphotyrosine and phosphoserine phosphatase activities. Diabetes 40, 1620-

1629.

Blokland A. and Jolles J. (1993) Spatial learning deficit and reduced hippocampal ChAT

activity in rats after an ICV injection of streptozotocin. Pharmacol Biochem Behav 44,

491-494.

Blondel O. and Portha B. (1989) Early appearance of in vivo insulin resistance in adult

streptozotocin-injected rats. Diabete Metab 15, 382-387.

Bradford M. M. (1976) Rapid and sensitive method for quantitation of microgram quantities

of proteins utilizing principle of protein dye binding. Anal Biochem 72, 248-254.

24


Brant A. M., Jess T. J., Milligan G., Brown C. M. and Gould G. W. (1993) Immunological

analysis of glucose transporters expressed in different regions of the rat brain and central

nervous system. Biochem Biophys Res Commun 192, 1297-1302.

Changeux J. P. and Danchin A. (1976) Selective stabilisation of developing synapses as a

mechanism for the specification of neuronal networks. Nature 264, 705-712.

Cheng C. M., Reinhardt R. R., Lee W. H., Joncas G., Patel S. C. and Bondy C. A. (2000)

Insulin-like growth factor 1 regulates developing brain glucose metabolism. Proc Natl

Acad Sci U S A 97, 10236-10241.

Combettes-Souverain M. and Issad T. (1998) Molecular basis of insulin action. Diabetes

Metab 24, 477-489.

De Meyts P., Wallach B., Christoffersen C. T., Urso B., Gronskov K., Latus L. J., Yakushiji

F., Ilondo M. M. and Shymko R. M. (1994) The insulin-like growth factor-I receptor.

Structure, ligand-binding mechanism and signal transduction. Horm Res 42, 152-169.

Devaskar S. U., Giddings S. J., Rajakumar P. A., Carnaghi L. R., Menon R. K. and Zahm D.

S. (1994) Insulin gene expression and insulin synthesis in mammalian neuronal cells. J

Biol Chem 269, 8445-8454.

Duelli R., Schrock H., Kuschinsky W. and Hoyer S. (1994) Intracerebroventricular injection

of streptozotocin induces discrete local changes in cerebral glucose utilization in rats. Int J

Dev Neurosci 12, 737-743.

Frölich L., Blum-Degen D., Bernstein H. G., Engelsberger S., Humrich J., Laufer S.,

Muschner D., Thalheimer A., Turk A., Hoyer S., Zochling R., Boissl K. W., Jellinger K.

and Riederer P. (1998) Brain insulin and insulin receptors in aging and sporadic

Alzheimer's disease. J Neural Transm 105, 423-438.

Ganda O. P., Rossini A. A. and Like A. A. (1976) Studies on streptozotocin diabetes.

Diabetes 25, 595-603.

25


Giorgino F., Chen J. H. and Smith R. J. (1992) Changes in tyrosine phosphorylation of insulin

receptors and a 170,000 molecular weight nonreceptor protein in vivo in skeletal muscle

of streptozotocin-induced diabetic rats: effects of insulin and glucose. Endocrinology 130,

1433-1444.

Goldstein B. J. (1993) Regulation of insulin receptor signaling by protein-tyrosine

dephosphorylation. Receptor 3, 1-15.

Grünblatt E., Hoyer S. and Riederer P. (2004) Gene expression profile in streptozotocin rat

model for sporadic Alzheimer's disease. J Neural Transm 111, 367-386.

Grünblatt E., Koutsilieri E., Hoyer S. and Riederer P. (2006) Gene expression alterations in

brain areas of intracerebroventricular streptozotocin treated rat. J Alzheimers Dis In Press.

Gupta G., Azam M. and Baquer N. Z. (1992) Modulation of rat brain insulin receptor kinase

activity in diabetes. Neurochem Int 20, 487-492.

Häring H. U. (1991) The insulin receptor: signalling mechanism and contribution to the

pathogenesis of insulin resistance. Diabetologia 34, 848-861.

Hellweg R., Nitsch R., Hock C., Jaksch M. and Hoyer S. (1992) Nerve growth factor and

choline acetyltransferase activity levels in the rat brain following experimental

impairment of cerebral glucose and energy metabolism. J Neurosci Res 31, 479-486.

Holness M. J., Langdown M. L. and Sugden M. C. (2000) Early-life programming of

susceptibility to dysregulation of glucose metabolism and the development of Type 2

diabetes mellitus. Biochem J 349, 657-665.

Hosokawa M., Dolci W. and Thorens B. (2001) Differential sensitivity of GLUT1- and

GLUT2-expressing beta cells to streptozotocin. Biochem Biophys Res Commun 289,

1114-1117.

Hoyer S. (1985) The effect of age on glucose and energy metabolism in brain cortex of rats.

Arch Gerontol Geriatr 4, 193-203.

26


Hoyer S. (1998) Is sporadic Alzheimer disease the brain type of non-insulin dependent

diabetes mellitus? A challenging hypothesis. J Neural Transm 105, 415-422.

Hoyer S. (2002) The brain insulin signal transduction system and sporadic (type II) Alzheimer

disease: an update. J Neural Transm 109, 341-360.

Hoyer S. (2004) Glucose metabolism and insulin receptor signal transduction in Alzheimer

disease. Eur J Pharmacol 490, 115-125.

Hoyer S. and Frölich L. (2006) Brain function and insulin signal transduction in sporadic

Alzheimer's disease, in Research Progress in Alzheimer's Disease and Dementia, Vol. In

Press (Sun M. K., ed.). Nova Science, New York.

Hoyer S., Nitsch R. and Oesterreich K. (1991) Predominant abnormality in cerebral glucose

utilization in late-onset dementia of the Alzheimer type: a cross-sectional comparison

against advanced late-onset and incipient early-onset cases. J Neural Transm Park Dis

Dement Sect 3, 1-14.

Ishrat T., Khan M. B., Hoda M. N., Yousuf S., Ahmad M., Ansari M. A., Ahmad A. S. and

Islam F. (2006) Coenzyme Q10 modulates cognitive impairment against

intracerebroventricular injection of streptozotocin in rats. Behav Brain Res 171, 9-16.

Kadowaki T., Kasuga M., Akanuma Y., Ezaki O. and Takaku F. (1984) Decreased

autophosphorylation of the insulin receptor-kinase in streptozotocin-diabetic rats. J Biol

Chem 259, 14208-14216.

Kenner K. A., Hill D. E., Olefsky J. M. and Kusari J. (1993) Regulation of protein tyrosine

phosphatases by insulin and insulin-like growth factor I. J Biol Chem 268, 25455-25462.

Kröncke K. D., Fehsel K., Sommer A., Rodriguez M. L. and Kolb-Bachofen V. (1995) Nitric

oxide generation during cellular metabolization of the diabetogenic N-methyl-N-nitroso-

urea streptozotozin contributes to islet cell DNA damage. Biol Chem Hoppe Seyler 376,

179-185.

27


Lai W. H., Cameron P. H., Doherty J. J., 2nd, Posner B. I. and Bergeron J. J. (1989) Ligand-

mediated autophosphorylation activity of the epidermal growth factor receptor during

internalization. J Cell Biol 109, 2751-2760.

Lannert H. and Hoyer S. (1998) Intracerebroventricular administration of streptozotocin

causes long-term diminutions in learning and memory abilities and in cerebral energy

metabolism in adult rats. Behav Neurosci 112, 1199-1208.

Lee W. H., Michels K. M. and Bondy C. A. (1993) Localization of insulin-like growth factor

binding protein-2 messenger RNA during postnatal brain development: correlation with

insulin-like growth factors I and II. Neuroscience 53, 251-265.

Leloup C., Arluison M., Lepetit N., Cartier N., Marfaing-Jallat P., Ferre P. and Penicaud L.

(1994) Glucose transporter 2 (GLUT 2): expression in specific brain nuclei. Brain Res

638, 221-226.

Lester-Coll N., Rivera E. J., Soscia S. J., Doiron K., Wands J. R. and de la Monte S. M.

(2006) Intracerebral streptozotocin model of type 3 diabetes: relevance to sporadic

Alzheimer's disease. J Alzheimers Dis 9, 13-33.

Li B., Xi X., Roane D. S., Ryan D. H. and Martin R. J. (2003) Distribution of glucokinase,

glucose transporter GLUT2, sulfonylurea receptor-1, glucagon-like peptide-1 receptor and

neuropeptide Y messenger RNAs in rat brain by quantitative real time RT-PCR. Brain Res

Mol Brain Res 113, 139-142.

Marks J. L., Porte D., Jr. and Baskin D. G. (1991a) Localization of type I insulin-like growth

factor receptor messenger RNA in the adult rat brain by in situ hybridization. Mol

Endocrinol 5, 1158-1168.

Marks J. L., King M. G. and Baskin D. G. (1991b) Localization of insulin and type 1 IGF

receptors in rat brain by in vitro autoradiography and in situ hybridization. Adv Exp Med

Biol 293, 459-470.

28


Mayer G., Nitsch R. and Hoyer S. (1990) Effects of changes in peripheral and cerebral

glucose metabolism on locomotor activity, learning and memory in adult male rats. Brain

Res 532, 95-100.

Meyerovitch J., Backer J. M. and Kahn C. R. (1989) Hepatic phosphotyrosine phosphatase

activity and its alterations in diabetic rats. J Clin Invest 84, 976-983.

Moss A. M., Unger J. W., Moxley R. T. and Livingston J. N. (1990) Location of

phosphotyrosine-containing proteins by immunocytochemistry in the rat forebrain

corresponds to the distribution of the insulin receptor. Proc Natl Acad Sci U S A 87, 4453-

4457.

Ngarmukos C., Baur E. L. and Kumagai A. K. (2001) Co-localization of GLUT1 and GLUT4

in the blood-brain barrier of the rat ventromedial hypothalamus. Brain Res 900, 1-8.

Nitsch R. and Hoyer S. (1991) Local action of the diabetogenic drug, streptozotocin, on

glucose and energy metabolism in rat brain cortex. Neurosci Lett 128, 199-202.

Noble E. P., Wurtman R. J. and Axelrod J. (1967) A simple and rapid method for injecting

H3-norepinephrine into the lateral ventricle of the rat brain. Life Sci 6, 281-291.

Paolini R., Serra A. and Kinet J. P. (1996) Persistence of tyrosine-phosphorylated FcepsilonRI

in deactivated cells. J Biol Chem 271, 15987-15992.

Park C. R., Seeley R. J., Craft S. and Woods S. C. (2000) Intracerebroventricular insulin

enhances memory in a passive-avoidance task. Physiol Behav 68, 509-514.

Plaschke K. and Hoyer S. (1993) Action of the diabetogenic drug streptozotocin on glycolytic

and glycogenolytic metabolism in adult rat brain cortex and hippocampus. Int J Dev

Neurosci 11, 477-483.

Plata-Salaman C. R. (1991) Insulin in the cerebrospinal fluid. Neurosci Biobehav Rev 15, 243-

258.

29


Raizada M. K., Shemer J., Judkins J. H., Clarke D. W., Masters B. A. and LeRoith D. (1988)

Insulin receptors in the brain: structural and physiological characterization. Neurochem

Res 13, 297-303.

Rajab A. A., Ahren B. and Bengmark S. (1989) Islet transplantation to the renal subcapsular

space in streptozotocin-diabetic rats: short-term effects on glucose-stimulated insulin

secretion. Diabetes Res Clin Pract 7, 197-204.

Rotwein P., Burgess S. K., Milbrandt J. D. and Krause J. E. (1988) Differential expression of

insulin-like growth factor genes in rat central nervous system. Proc Natl Acad Sci U S A

85, 265-269.

Salkovic M., Sabolic I. and Lackovic Z. (1995) Striatal dopaminergic D1 and D2 receptors

after intracerebroventricular application of alloxan and streptozocin in rat. J Neural

Transm Gen Sect 100, 137-145.

Salkovic-Petrisic M. and Lackovic Z. (2003) Intracerebroventricular administration of

betacytotoxics alters expression of brain monoamine transporter genes. J Neural Transm

110, 15-29.

Salkovic-Petrisic M. and Lackovic Z. (2005) Insulin resistant brain state and its link to

diabetes mellitus. Period. Biol. 107, 137-146.

Salkovic-Petrisic M., Tribl F., Schmidt M., Hoyer S. and Riederer P. (2006) Alzheimer-like

changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and

hippocampus after damage to the insulin signalling pathway. J Neurochem 96, 1005-1015.

Santos M. S., Pereira E. M. and Carvaho A. P. (1999) Stimulation of immunoreactive insulin

release by glucose in rat brain synaptosomes. Neurochem Res 24, 33-36.

Schechter R. and Abboud M. (2001) Neuronal synthesized insulin roles on neural

differentiation within fetal rat neuron cell cultures. Brain Res Dev Brain Res 127, 41-49.

30


Schechter R., Beju D., Gaffney T., Schaefer F. and Whetsell L. (1996) Preproinsulin I and II

mRNAs and insulin electron microscopic immunoreaction are present within the rat fetal

nervous system. Brain Res 736, 16-27.

Schechter R., Whitmire J., Holtzclaw L., George M., Harlow R. and Devaskar S. U. (1992)

Developmental regulation of insulin in the mammalian central nervous system. Brain Res

582, 27-37.

Schneppenheim R., Budde U., Dahlmann N. and Rautenberg P. (1991) Luminography--a new,

highly sensitive visualization method for electrophoresis. Electrophoresis 12, 367-372.

Schubert M., Gautam D., Surjo D., Ueki K., Baudler S., Schubert D., Kondo T., Alber J.,

Galldiks N., Kustermann E., Arndt S., Jacobs A. H., Krone W., Kahn C. R. and Bruning J.

C. (2004) Role for neuronal insulin resistance in neurodegenerative diseases. Proc Natl

Acad Sci U S A 101, 3100-3105.

Schwartz M. W., Figlewicz D. P., Baskin D. G., Woods S. C. and Porte D., Jr. (1992) Insulin

in the brain: a hormonal regulator of energy balance. Endocr Rev 13, 387-414.

Shoham S., Bejar C., Kovalev E. and Weinstock M. (2003) Intracerebroventricular injection

of streptozotocin causes neurotoxicity to myelin that contributes to spatial memory

deficits in rats. Exp Neurol 184, 1043-1052.

Stecher J., Muller W. E. and Hoyer S. (1997) Learning abilities depend on NMDA-receptor

density in hippocampus in adult rats. J Neural Transm 104, 281-289.

Steen E., Terry B. M., Rivera E. J., Cannon J. L., Neely T. R., Tavares R., Xu X. J., Wands J.

R. and de la Monte S. M. (2005) Impaired insulin and insulin-like growth factor

expression and signaling mechanisms in Alzheimer's disease--is this type 3 diabetes? J

Alzheimers Dis 7, 63-80.

Svaren J., Ehrig T., Abdulkadir S. A., Ehrengruber M. U., Watson M. A. and Milbrandt J.

(2000) EGR1 target genes in prostate carcinoma cells identified by microarray analysis. J

Biol Chem 275, 38524-38531.

31


Szkudelski T. (2001) The mechanism of alloxan and streptozotocin action in B cells of the rat

pancreas. Physiol Res 50, 537-546.

Todd S., Yoshida M. C., Fang X. E., McDonald L., Jacobs J., Heinrich G., Bell G. I., Naylor

S. L. and Sakaguchi A. Y. (1985) Genes for insulin I and II, parathyroid hormone, and

calcitonin are on rat chromosome 1. Biochemical and Biophysical Research

Communications 131, 1175-1180.

Ugozzoli L. A., Chinn D. and Hamby K. (2002) Fluorescent multicolor multiplex

homogeneous assay for the simultaneous analysis of the two most common

hemochromatosis mutations. Anal Biochem 307, 47-53.

Unger J., McNeill T. H., Moxley R. T., 3rd, White M., Moss A. and Livingston J. N. (1989)

Distribution of insulin receptor-like immunoreactivity in the rat forebrain. Neuroscience

31, 143-157.

van Houten M., Posner B. I., Kopriwa B. M. and Brawer J. R. (1979) Insulin-binding sites in

the rat brain: in vivo localization to the circumventricular organs by quantitative

radioautography. Endocrinology 105, 666-673.

van Houten M., Posner B. I., Kopriwa B. M. and Brawer J. R. (1980) Insulin binding sites

localized to nerve terminals in rat median eminence and arcuate nucleus. Science 207,

1081-1083.

Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A. and Speleman

F. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric

averaging of multiple internal control genes. Genome Biol 3, RESEARCH0034.

Wang Z., Dohle C., Friemann J., Green B. S. and Gleichmann H. (1993) Prevention of high-

and low-dose STZ-induced diabetes with D-glucose and 5-thio-D-glucose. Diabetes 42,

420-428.

32


Weinstock M. and Shoham S. (2004) Rat models of dementia based on reductions in regional

glucose metabolism, cerebral blood flow and cytochrome oxidase activity. J Neural

Transm 111, 347-366.

Yamamoto H., Uchigata Y. and Okamoto H. (1981) Streptozotocin and alloxan induce DNA

strand breaks and poly(ADP-ribose) synthetase in pancreatic islets. 294, 284-286.

Zhao W., Chen H., Xu H., Moore E., Meiri N., Quon M. J. and Alkon D. L. (1999) Brain

insulin receptors and spatial memory. Correlated changes in gene expression, tyrosine

phosphorylation, and signaling molecules in the hippocampus of water maze trained rats.

J Biol Chem 274, 34893-34902.

Zhao W. Q., Chen H., Quon M. J. and Alkon D. L. (2004) Insulin and the insulin receptor in

experimental models of learning and memory. Eur J Pharmacol 490, 71-81.

33


Figure Captions:

Figure 1: Normalized gene expression of IR, insulin-1 & -2 mRNA profiles and the ratio

between insulin-1 to -2 in STZ treated rats in cortex, hippocampus and hypothalamus

compared to controls. One-way ANOVA with Post-Hoc Test of Scheffee; a, p<0.005 vs.

control, b, p<0.05 vs. control.

Figure 2: IR concentration, IR pTyr1158, IR pTyr1162/1163, protein tyrosine kinase

activity, and ratio with pTyr1158 and with pTyr1162/1163 in STZ treated rats in cortex,

hippocampus and hypothalamus compared to control. One-way ANOVA with Post-Hoc

Test of Scheffee; a, p<0.005 vs. control, b, p<0.05 vs. control.

Figure 3: Western blot analysis of total tau visualized by K9JA antibody recognizing C-

terminal part of tau protein (A) and phospho (p) tau visualized by PHF-1 anti-tau antibody

recognizing tau phoshorylated at serine S-396 and S-404 (B) protein in the hippocampus

of rats intracerebroventricularly (icv) treated with streptozotocin (1 mg/kg) 3 months after

drug treatment, and respective statistics (C). CTRL, control group (lanes 1-5); STZ,

streptozotocin icv-treated group (lanes 6-11). *p<0.05 by Mann Whitney U test.

Figure 4: Memory function in Morris Water Maze Swimming Test of rats

intracerebroventricularly (icv) treated with streptozotocin and glucose transporter GLUT2

blockers, 5-thio-D-glucose, and 3-0-methyl glucose. Deficits were measured as the time

spent in search for the removed platform after entering the quadrant where the platform

had been placed in training trials. The better the memory had been preserved, the longer

the rats were searching for the platform, and vice versa. Values are expressed as a mean

with a standard error and standard deviation range. CTRL, control group; STZ1x,

streptozotocin single injection (1 mg/kg, icv) ; STZ3x, streptozotocin triple injection (3x 1

mg/kg, icv); 30MG, 3-0-methyl glucose triple injection (3x 1mg/kg, icv); TG, 5-thio-D-

glucose triple injection (3x 375 μg/kg, icv). *p<0.05 vs. control by Kruskal-Wallis

ANOVA median test followed by Mann Whitney U test.

34


Table 1: Quantitative PCR conditions and kits

Gene Gene

Symbo

l

Accession

No.

Firm Kit

description

Probe Primer sequence

(Forwar+Revese)

Produc

t side

(bp)

Annealing

Temperatu

r (0C)

Insulin 1 Ins1 NM_01912

9

Qiagen

QuantiTect

Primer

Assay Cat.

No.

QT0037330

3

--- n.a. 114 55

Insulin 2 Ins2 NM_01913

0

Qiagen

QuantiTect

Primer

Assay Cat.

No.

QT0017738

0

--- n.a. 116 55

Insulin

receptor

IR NM_01707

1

Qiagen

QuantiTect

Primer

Assay Cat.

No.

QT0019896

8

--- n.a. 92 55

Ribosomal

18S

Rnr1 M11188 Qiagen

QuantiTect

Primer

Assay Cat.

No.

QT0019937

4

--- n.a. 103 55

glyceraldehyde

-3-phosphate

dehydrogenase

Gapd NM_01700

8

No kit

(TaqMan

Probe)

atgcccccatgtttgtgatgggtgt Tcaccaccatggagaaggc

gctaagcagttggtggtgca

178 62

Actin beta Actx NM_03114

4

No kit

(TaqMan

tgtccctgtatgcctctggtcgtacc

ac

Agccatgtacgtagccatcc

a

81 65

35


probe) tctccggagtccatcacaatg

Not available, n.a.

36


Table 2: Normalized gene expression profiles (A) and PTK activity and IR-β subunit protein under control conditions in different brain areas.

A) gene Cortex (Mean±SEM , n) Hippocampus (Mean±SEM, n) Hypothalamus (Mean±SEM, n)

IR (F=1.55) 0.321±0.048 (3) 0.370±0.067 (4) 0.166±0.099 (6)

Insulin-1 (F=5.7) 0.980±0.529 (4) 2.618±0.784 (4) 0.246±0.164 a (5)

Insulin-2 (F=2.5) 0.264±0.079 (3) 0.457±0.201 (4) 0.084±0.050 (5)

Insulin-1/insulin-2 3.7±6.69 5.7±3.90 2.9±3.28

B) Protein

IR (ng/ng total protein)

F=4.95.154±0.744 a (5) 2.268±0.764 (5) 3.997±0.386 (6)

IR pTyr1158 (ng/ng IRβ)

(F=7.9)1.138±0.154 a (5) 1.932±0.146 (5) 1.499±0.110 (7)

IR pTyr1162/1163 (ng/ng IRβ)

(F=14.3)1.150±0.101 b (5) 1.215±0.117 b (5) 1.758±0.049 (6)

Protein Tyrosine kinase activity

(ng/µg total protein/30 min)

(F=14.1)

3.009±0.508 a,b (5) 1.312±0.387 (5) 0.603±0.096 (7)

1


PTK/IR pTyr1158 (ng/ng

pTyr1158/30 min) (x103)

(F=34.7)

25.9±1.4 a,b (5) 16.1±2.9 b (5) 5.7±0.9 (7)

PTK/IR ptyr1162/1163 (ng/ng

pTyr1162/1163/30 min) (x103)

(F=23.07)

25.9±3.6 b (5) 25.5±3.6 b (5) 4.7±0.9 (7)

One-way ANOVA with Post-Hoc Scheffee-Test: a, p<0.05 vs. hippocampus; b, p<0.05 vs. hypothalamus

2

ORIGINAL ARTICLE - Ruđer Bošković Institute · Web viewInsulin receptor (IR) mRNA expression...

Documents

Transcript of ORIGINAL ARTICLE - Ruđer Bošković Institute · Web viewInsulin receptor (IR) mRNA expression...