Int J Clin Exp Med 2015;8(8):13377-13382www.ijcem.com /ISSN:1940-5901/IJCEM0012005

Original Article Fasudil alleviates traumatic optic neuropathy by inhibiting Rho signaling pathway

Jianglong Yu1,2, Shiying Lan2, Ruijia Wang1, Aba Maier1, Xinping Luan1

1Department of Neurosurgery, The Second Affiliated Hospital of Xinjiang Medical University, Urumqi, P. R. China; 2Department of Neurosurgery, The People’s Hospital of Xinjiang Bazhou Region, Korla, P. R. China

Received June 27, 2015; Accepted August 11, 2015; Epub August 15, 2015; Published August 30, 2015

Abstract: Objectives: The present study is to investigate the pathological changes in rabbits with traumatic optic neuropathy (TON), as well as the effect of fasudil on the lesions. Methods: A total of 144 New Zealand rabbits were successfully established as TON models. Twelve hours after surgery, the rabbits in control, dexamethasone, and fasudil groups were administrated with saline, dexamethasone, and fasudil via ear veins, respectively. Then, retinas of the rabbits were obtained at 72 h and on days 7, 14 and 21 after surgery. The pathological changes in retina and optic nerves were observed by hematoxylin and eosin staining and transmission electron microscopy. The expression levels of Rho-associated genes were measured using quantitative real-time polymerase chain reaction. Results: In control group, the axons were swelling, and mitochondria showed vacuolation after optic nerve crush. Mitochondria were swelled slightly in dexamethasone group. By contrast, nerves in fasudil group were repaired. Reti-nal ganglion cells in control group were reduced significantly due to optic nerve crush. The loss of retinal ganglion cells was alleviated in fasudil group. Quantitative real-time polymerase chain reaction showed that the expression of Rho-associated genes were down-regulated. Conclusions: The present study demonstrates that fasudil inhibits the apoptosis of retinal ganglion cells and ameliorates damages of optic nerves in traumatic optic neuropathy.

Keywords: Traumatic optic neuropathy, Rho kinase, pathology

Introduction

Traumatic optic neuropathy (TON) is indirect lesion in optic nerves caused by external force via skeleton or the movement of eye balls. The clinical manifestation of TON is progressive decline of visual function [1]. TON is the main reason for traumatic blindness, with 40-50% patients losing eye sight after the occurrence of TON [2, 3]. Because it is difficult to perform pro-spective clinical trials for TON, little progress is made in the clinical and animal researches of TON. Clinically, sustained systemic administra-tion of steroids [4], surgical decompression [5], the combination of hormones and surgery [6], and conservative observation are usually adopted to suppress secondary pathological lesions, but little significant progress is made. In optic nerve system, Rho family plays impor-tant roles in the growth of axons [7-11]. The activation of Rho-ROCK signaling pathway dam-ages myosin light chain phosphorylation, and inhibits the regeneration of optic nerve axons

[12]. In the present study, we investigate the effect of fasudil, a kind of Rho kinase inhibitor, on the pathological changes caused by TON.

Materials and methods

Animals

A total of 144 New Zealand rabbits were divid-ed into control, fasudil and dexamethasone groups of 48 rabbits. Twelve hours after TON rabbit models were built [13], rabbits in fasudil group were injected with fasudil hydrochloride (6 mg/kg body weight; Pude Pharma, Datong, China) via ear veins every 12 hours. The maxi-mal administration time was 12 days. Dexamethasone group of rabbits were injected via ear veins with dexamethasone (1 mg/kg; Pude Pharma, Datong, China) twice a day for a maximal duration of 14 days. Rabbits in control group received the same volumes of saline. All animal experiments were conducted according to the ethical guidelines of Xinjiang Medical University.

Fasudil alleviates traumatic optic neuropathy

13378 Int J Clin Exp Med 2015;8(8):13377-13382

Tissues

The 48 rabbits in each group were randomly divided into four subgroups of 12 rabbits that were sacrificed at four different time points (72 h, day 7, day 14, and day 21). Among the 12 rabbits, optical nerve tissues from 3 rabbits were used for hematoxylin and eosin (HE) stain-ing (Beyotime Biotechnology, Shanghai, China), tissues from another 3 rabbits were processed for transmission electron microscopy (TEM), and tissues from the last 6 rabbits were subject to RNA extraction.

HE staining

Tissue samples were fixed with 10% formalde-hyde for 24 h, followed by dehydration with 70% ethanol for 4 h, 80% ethanol for 4 h, and 90% ethanol overnight. Then, the samples were treated with 95% ethanol for 4 h twice, 100% ethanol for 1.5 h twice, and then xylene for 50 min before transparency with xylene. The tis-sues were then soaked in wax at 58-60°C for 1.5 h twice, and sliced into 4-6 μm. Then the slices were soaked in water at 45-47°C, before being baked at 65°C for 8 h. The sections were stained with HE (Richard-Allan Scientific, Kalamazoo, MI, USA) and examined under a magnification of ×100.

TEM

The samples were cut into pieces of 1 mm3, and fixed by 4% glutaraldehyde for 1 or 2 hours, followed by washing with phosphate-buffered saline for 3 times of 10-15 min. Then, the sam-ples were fixed again with 1% osmium tetroxide for an hour, followed by washing with phos-phate-buffered saline for 3 times of 15 min. The samples were then dehydrated using ace-tone (50%, 70%, 80%, 90% and 100%) for 3 times of 10-15 min. Subsequently, the samples were soaked with EPON812 and acetone (1:1) for 1 hour, EPON812 and acetone (3:1) for 3 hour, and EPON812 for 12 hour. The samples were embedded and labeled before aggrega-tion at 37°C for 12 hour, 45°C for 12 hour, and 60°C for 24 hour. After slicing, the slices were stained with lead nitrate for 10-20 min, and uranyl acetate for 20-30 min, before observa-tion of the integrity of the nerve fibers under transmission electron microscope (JEM-1230, JEOL, Tokyo, Japan).

Quantitative real-time polymerase chain reac-tion (qRT-PCR)

Total RNA was extract from 100 mg tissues using TRIzol Reagent (Thermo Fisher Scientific, Waltham, MA, USA). RNA template (1 μg) was denaturized at 65°C for 5 min, followed by immediate cooling on ice. cDNA was obtained by reverse transcription using TIANScript RT Kit (Tiangen, Beijing, China) under 37°C for 15 min, followed by enzyme inactivation reaction at 98°C for 5 min. qRT-PCR was performed using SYBR Select Master Mix PCR kit (Thermo Fisher Scientific, Waltham, MA, USA) on ABI 7500 FAST Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The PCR system (20.0 µl) was composed of 10.0 μl SYBRR Select Master Mix (2X), 0.4 µl forward primer (10 µM), 0.4 µl reverse primer (10 µM), 1.0 µl cDNA template, and 8.2 µl ddH2O. PCR protocol was as follows: UDG Activation AmpliTaq DNA at 50°C for 2 min and Polymerase, UP Activation at 95°C for 2 min; 40 cycles of 95°C for 15 s and 60°C for 60 s. The sequences of primers were as follows. RhoA: forward primer, CCGTGCATCTTGCAGTAC- ATCT; reverse primer, CCAGCTCTACCTGTTTCC- CATC. ROCK1: forward primer, CATGCAAGCGC- AATTGGTAGA; reverse primer, CGAAAGCTTAG- CACGCAACT. ROCK2: forward primer, CTGGT- GGTCTGTGGGTGTTT; reverse primer, CTACCC- CATTTCGCCCAAGT. GAPDH: forward primer, ACCATCTTCCAGGAGCGAGA; reverse primer, GGTTCACGCCCATCACAAAC.

Statistical analysis

All results were analyzed using SPSS 17.0 (IBM, Armonk, NY, USA). Measurement data were expressed as means ± standard deviation. Comparisons between multiple groups were performed using one-way analysis of variance. Differences were considered significant if P < 0.05.

Results

Fasudil ameliorates pathological lesions in retina induced by TON

To examine pathological changes in retina, HE staining was performed. In control group, blood capillaries in ganglion cell layer (GCL) were bro-ken or filled with blood, and cells in GCL had reduced size of nucleus. In addition, the num-ber of cells in inner nuclear layer (INL) and outer nuclear layer (ONL) was slightly reduced. On

Fasudil alleviates traumatic optic neuropathy

13379 Int J Clin Exp Med 2015;8(8):13377-13382

day 14 after TON, the nucleuses of cells in GCL became sparse, and the number of cells in INL and ONL was reduced. In addition, a large num-ber of empty cells were observed in GCL, and retina became thinner. In dexamethasone group, fewer empty cells were observed in GCL, and the arrangement of cells in photoreceptor cell layer (PCL) was more ordered than control. Moreover, the number of apoptotic retinal gan-glion cells (RGCs) in fasudil group was fewer

than that in control group, and the number of cells in INL and ONL was more than that in con-trol group. In addition, the number of vacuoles in fasudil group was greater than that in control group and dexamethasone group, and the thickness of retina in fasudil group was thicker than that in control group and dexamethasone group (Figure 1). These results suggest that fasudil ameliorates pathological lesions in reti-na induced by TON.

Figure 1. Pathological changes in retina of rabbits with traumatic optic neuropathy. Hematoxylin and eosin staining of retina in (A) control, (B) dexamethasone, and (C) fasudil on day 14 after the occurrence of traumatic optic neu-ropathy. Magnification, 400×.

Figure 2. Lesions in optic nerves of rabbits with traumatic optic neuropathy. Transmission electron microscopy was performed (scale bar = 2 μm; magnification, 1200×).

Fasudil alleviates traumatic optic neuropathy

13380 Int J Clin Exp Med 2015;8(8):13377-13382

Fasudil treatment repairs damaged structures in optic nerves induced by TON

To observe the structural changes in optic nerves induced by TON, TEM was employed. TEM images showed that mitochondria in con-trol group was reduced in number, became swelled, and exhibited vacuole-like degenera-tion. On day 14 after the occurrence of TON, axon vacuolar structures were observed, micro-filaments and microtubules became swelled and twisted, and lamellar separation appeared. On day 21, the number of myelin was reduced, microfilaments were dissolved, and bundles of myelin were observed. In dexamethasone group, the swelling of mitochondria was allevi-ated compared with control group. In fasudil group, little lamellar separation was observed, and more axonal buds appeared (Figure 2). These results indicate that fasudil treatment repairs damaged structures in optic nerves induced by TON.

Fasudil inhibits Rho signaling pathway by reducing the expression of RhoA, ROCK1 and ROCK2

To measure the expression of Rho-associated genes in optic nerves, qRT-PCR was used. The

data showed that the levels of RhoA, ROCK1 and ROCK2 at 72 h and on day 7 were high, while those on days 14 and 21 were reduced compared with earlier time points. Furthermore, the levels of RhoA, ROCK1 and ROCK2 in fasudil group were significantly lower than con-trol group and dexamethasone group at all time points (P < 0.05) (Figure 3). These results sug-gest that fasudil inhibits Rho signaling pathway by reducing the expression of RhoA, ROCK1 and ROCK2.

Discussion

TON is a kind of acute lesions in optic nerves that can lead to visual function decline or even blindness [14]. Hormones, neurotrophic drugs or vasodilators are the main drugs for the treat-ment of TON. However, their effects are not good enough, and hormones sometimes show severe adverse effects during treatment [15, 16]. The pathologic mechanism of TON is thought to mainly include primary injury, sec-ondary injury and the apoptosis of RGCs. Primary injury is usually caused by factors that directly break optic nerves; secondary injury is mainly caused by tissue edema, inflammation, lipid peroxidation, or Ca2+ influx [17]; the apop-tosis of RGCs is the result of axonal damages in

Figure 3. Relative expression of Rho-asso-ciated genes in optic nerves of rabbits with TON. A. Relative RhoA mRNA levels; B. Rela-tive ROCK1 mRNA levels; C. Relative ROCK2 mRNA levels. qRT-PCR was employed to measure the expression of mRNA. *, P < 0.05 compared with control group; #, P < 0.05 compared with dexamethasone group.

Fasudil alleviates traumatic optic neuropathy

13381 Int J Clin Exp Med 2015;8(8):13377-13382

optic nerves [18, 19]. Inhibition of apoptosis of RGCs after damages in optic nerves is the basis for the treatment of optic neuropathy and improvement of visual function. Compared with surrounding nerves, the regeneration ability of axons in central nervous system is weaker. A study indicates that RhoA/ROCK signaling pathway induces the inhibition of axonal regen-eration and repair after central nervous system is damaged [20]. Rho is a member of the Ras superfamily in GTPase family, including RhoA, RhoB, and RhoC [21]. Rho kinase, the down-stream effector molecule of RhoA, has two sub-types, ROCK1 and ROCK2 [22]. In central ner-vous system, ROCK is a downstream effector molecule of Rho that enhances myosin light chain (MLC) phosphorylation by directly phos-phorylating MLC and indirectly inhibiting MLC phosphatase. Rho/ROCK signaling pathway not only regulates actin reorganization, but also regulates microtubules and intermediate fila-ments [23-25]. Because of the importance of Rho signaling pathway in optic nerves [26], Rho inhibitors are used in several optic nerve dis-eases [27, 28]. Fasudil is the most widely used ROCK inhibitor that expands brain blood ves-sels, promotes axonal regeneration, and pro-tects neurons [29, 30].

Our results show that fasudil inhibits the apop-tosis of RGCs in rabbit optic nerves, and pro-tects the repair and regeneration of axons. Results by HE staining show that the repaired function of optic nerves in fasudil group is bet-ter than that in control. TEM results further demonstrate that the repair of microfilaments and microtubules in optic nerves of fasudil group is better than control. Subsequent deter-mination of expression of RhoA, ROCK1 and ROCK2 genes shows that Rho/ROCK signaling pathway in fasudil group is inhibited. In the present study, the repair effect of dexametha-sone is not as good as fasudil. Other Rho inhibi-tors such as Y-39983 and Y-27632 are also reported to promote the regeneration of axons [31-33]. However, they are not suitable for clini-cal treatments because they are chemical drugs. Fasudil also provides a good microenvi-ronment for axonal repair after TON by alleviat-ing inflammation by the inhibition of Rho signal-ing pathway. In conclusion, the present study demonstrates that treatment with fasudil pro-motes the repair and regeneration of damaged axons induced by TON, and inhibits secondary

degeneration of RGCs. This provides a novel way for the clinical treatment of TON.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (No. 81160153).

Disclosure of conflict of interest

None.

Address correspondence to: Xinping Luan, Depart- ment of Neurosurgery, The Second Affiliated Hos- pital of Xinjiang Medical University, No. 38 Nanhu East Road, Urumqi 830063, Xinjiang Autonomous Region, P. R. China. Tel: 86-991-4609099; Fax: 86-991-4609099; E-mail: Yuy1019@sina.com

References

[1] Chan JW. Traumatic Optic Neuropathies. Optic Nerve Disorders. Springer; 2014. pp. 155-176.

[2] Vagefi M and Seiff S. Traumatic optic neuropa-thy. Contemporary Ophthalmology 2005; 4: 1-7.

[3] Levin LA and Baker RS. Management of trau-matic optic neuropathy. J Neuroophthalmol 2003; 23: 72-75.

[4] Yu-Wai-Man P and Griffiths PG. Steroids for traumatic optic neuropathy. Cochrane Data-base Syst Rev 2013; 6: CD006032.

[5] Kumaran AM, Sundar G and Chye LT. Traumat-ic optic neuropathy: a review. Craniomaxillofac Trauma Reconstr 2015; 8: 31-41.

[6] Ropposch T, Steger B, Meco C, Emesz M, Reit-samer H, Rasp G and Moser G. The effect of steroids in combination with optic nerve de-compression surgery in traumatic optic neu-ropathy. Laryngoscope 2013; 123: 1082-1086.

[7] Gu H, Yu SP, Gutekunst CA, Gross RE and Wei L. Inhibition of the Rho signaling pathway im-proves neurite outgrowth and neuronal differ-entiation of mouse neural stem cells. Int J Physiol Pathophysiol Pharmacol 2013; 5: 11-20.

[8] Roloff F, Scheiblich H, Dewitz C, Dempewolf S, Stern M and Bicker G. Enhanced neurite out-growth of human model (NT2) neurons by small-molecule inhibitors of Rho/ROCK signal-ing. PLoS One 2015; 10: e0118536.

[9] Wu BQ, Bi ZG and Qi Q. Inactivation of the Rho-ROCK signaling pathway to promote neurologic recovery after spinal cord injuries in rats. Chin Med J (Engl) 2013; 126: 3723-3727.

[10] Pernet V, Joly S, Jordi N, Dalkara D, Guzik-Kor-nacka A, Flannery JG and Schwab ME. Mis-

Fasudil alleviates traumatic optic neuropathy

13382 Int J Clin Exp Med 2015;8(8):13377-13382

guidance and modulation of axonal regenera-tion by Stat3 and Rho/ROCK signaling in the transparent optic nerve. Cell Death Dis 2013; 4: e734.

[11] McKerracher L, Ferraro GB and Fournier AE. Rho signaling and axon regeneration. Int Rev Neurobiol 2012; 105: 117-140.

[12] Forgione N and Fehlings MG. Rho-ROCK inhibi-tion in the treatment of spinal cord injury. World Neurosurg 2014; 82: e535-539.

[13] Yan H, Li F and Zhang L. A new and reliable animal model for optic nerve injury. Curr Eye Res 2012; 37: 941-948.

[14] Steinsapir KD and Goldberg RA. Traumatic op-tic neuropathy: an evolving understanding. Am J Ophthalmol 2011; 151: 928-933.e2.

[15] Saxena R, Singh D and Menon V. Controversies in neuro-ophthalmology: steroid therapy for traumatic optic neuropathy. Indian J Ophthal-mol 2014; 62: 1028-1030.

[16] Guy WM, Soparkar CN, Alford EL, Patrinely JR, Sami MS and Parke RB. Traumatic optic neu-ropathy and second optic nerve injuries. JAMA Ophthalmol 2014; 132: 567-571.

[17] Yokota T, Kamimura N, Igarashi T, Takahashi H, Ohta S and Oharazawa H. Protective effect of molecular hydrogen against oxidative stress caused by peroxynitrite derived from nitric ox-ide in rat retina. Clin Experiment Ophthalmol 2015; 43: 568-77.

[18] Soares CA and Mason CA. Transient ipsilateral retinal ganglion cell projections to the brain: Extent, targeting, and disappearance. Dev Neurobiol 2015; [Epub ahead of print].

[19] Li Y, Li D, Ying X, Khaw PT and Raisman G. An energy theory of glaucoma. Glia 2015; 63: 1537-52.

[20] Fujita Y and Yamashita T. Axon growth inhibi-tion by RhoA/ROCK in the central nervous sys-tem. Front Neurosci 2014; 8: 338.

[21] Julian L and Olson MF. Rho-associated coiled-coil containing kinases (ROCK): structure, reg-ulation, and functions. Small GTPases 2014; 5: e29846.

[22] Thumkeo D, Watanabe S and Narumiya S. Physiological roles of Rho and Rho effectors in mammals. Eur J Cell Biol 2013; 92: 303-315.

[23] Lingor P, Teusch N, Schwarz K, Mueller R, Mack H, Bahr M and Mueller BK. Inhibition of Rho kinase (ROCK) increases neurite out-growth on chondroitin sulphate proteoglycan in vitro and axonal regeneration in the adult optic nerve in vivo. J Neurochem 2007; 103: 181-189.

[24] Riento K and Ridley AJ. Rocks: multifunctional kinases in cell behaviour. Nat Rev Mol Cell Biol 2003; 4: 446-456.

[25] Spillane M and Gallo G. Involvement of Rho-family GTPases in axon branching. Small GT-Pases 2014; 5: e27974.

[26] Koch J, Tönges L, Barski E, Michel U, Bähr M and Lingor P. ROCK2 is a major regulator of axonal degeneration, neuronal death and axo-nal regeneration in the CNS. Cell Death Dis 2014; 5: e1225.

[27] Inoue T and Tanihara H. Rho-associated ki-nase inhibitors: a novel glaucoma therapy. Prog Retin Eye Res 2013; 37: 1-12.

[28] Guan R, Xu X, Chen M, Hu H, Ge H, Wen S, Zhou S and Pi R. Advances in the studies of roles of Rho/Rho-kinase in diseases and the development of its inhibitors. Eur J Med Chem 2013; 70: 613-622.

[29] Chen M, Liu A, Ouyang Y, Huang Y, Chao X and Pi R. Fasudil and its analogs: a new powerful weapon in the long war against central ner-vous system disorders? Expert Opin Investig Drugs 2013; 22: 537-550.

[30] Feng Y and LoGrasso PV. Rho kinase inhibitors: a patent review (2012-2013). Expert Opin Ther Pat 2014; 24: 295-307.

[31] Yang Z, Wang J, Liu X, Cheng Y, Deng L and Zhong Y. Y-39983 downregulates RhoA/Rho-associated kinase expression during its pro-motion of axonal regeneration. Oncol Rep 2013; 29: 1140-1146.

[32] Hirata A, Inatani M, Inomata Y, Yonemura N, Kawaji T, Honjo M and Tanihara H. Y-27632, a Rho-associated protein kinase inhibitor, atten-uates neuronal cell death after transient reti-nal ischemia. Graefes Arch Clin Exp Ophthal-mol 2008; 246: 51-59.

[33] Jeon BT, Jeong EA, Park SY, Son H, Shin HJ, Lee DH, Kim HJ, Kang SS, Cho GJ, Choi WS and Roh GS. The Rho-kinase (ROCK) inhibitor Y-27632 protects against excitotoxicity-in-duced neuronal death in vivo and in vitro. Neu-rotox Res 2013; 23: 238-248.