OEB 192 – 10.09.13

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation possessed for some mediaeval scholastics. It can be considered a relatively harmless habit, like eating peanuts, unless it assumes the form of an obsession; then it becomes a vice” (Stanier, 1970)

Tree of Life: primary divisions

Microbial systematics

• Formerly Pseudomonas (partial list): Ralstonia, Burkholderia, Hydrogenophaga, Sphingomonas, Methylobacterium, Cellvibrio, Xanthomonas, Acidovorax, Hydrogenophillus, Brevundimonas, Pandoraea

multi-C C1(& all use methanol)

16S rRNA as phylogenetic marker• Why a good molecule?

70S 30S 50S

Tree of Life: three “domains”• Based on 16S rRNA (Woese, 1987):

Tree of Life: three “domains”• Based on 16S rRNA (Pace, 1997):

Bacteria & Archaeal: all genomes as of 12 Feb., 2010

(Lee, Robinson & Marx, in prep)

Tree basics: meaning

Tree basics: rotation

Tree basics: shape

Tree basics: character change

Key phylogenetic terms

Key phylogenetic terms

Phenetics vs. cladistics

Lysozyme amino acid changes in unrelated ruminants

Phenetics vs. cladistics

Maximum Parsimony• Parsimony – shortest tree (fewest homoplasies)

Neutral theory• Developed by Motoo Kimura, 1968

Good Dataset

[A1, A2, A3, A4] [A1, B2, A3, A4]

Bad Dataset

A B

species 1 species 2 species 3 species 4

A1B1

A2B2 A4

B4A3

B3

1. Collect Sequence DataOrtholog vs. paralog?

2. Sequence Alignment

CGGATAAACCGGATAGACCGCTGATAAACCGGATAC

taxa1taxa2taxa3taxa4

Alignment

Wednesday (9/15): Molecular evolution & phylogenetic inference:

case of HIV

& comment…

Upcoming talks in (microbial) evolution…

Wednesday, 9/15

11:00 AM Main Lecture HallBioLabs Building

OEB Weekly Seminar Series

Gunter WagnerYale University

Transcription factor protein evolution and the origin of evolutionary novelties

Host: Abzhanov Lab