1521-0103/356/1/32–42$25.00 http://dx.doi.org/10.1124/jpet.115.228080THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 356:32–42, January 2016Copyright ª 2015 by The American Society for Pharmacology and Experimental Therapeutics

Novel Epidermal Growth Factor Receptor Inhibitor AttenuatesAngiotensin II–Induced Kidney Fibrosis s

Yuanyuan Qian, Kesong Peng, Chenyu Qiu, Melissa Skibba, Yi Huang, Zheng Xu,Yali Zhang, Jie Hu, Dandan Liang, Chunpeng Zou, Yi Wang, and Guang LiangChemical Biology Research Center, School of Pharmaceutical Science (Y.Q., K.P., C.Q., M.S., Y.H., Z.X., Y.Z., J.H., D.L., Y.W.,and G.L.); Department of Ultrasonography, 2nd Affiliated Hospital (C.Z.), Wenzhou Medical University, Wenzhou, Zhejiang,People’s Republic of China

Received July 25, 2015; accepted October 27, 2015

ABSTRACTChronic activation of renin-angiotensin system (RAS) greatlycontributes to renal fibrosis and accelerates the progression ofchronic kidney disease; however, the underlying molecularmechanism is poorly understood. Angiotensin II (Ang II), thecentral component of RAS, is a key regulator of renal fibrogenicdestruction. Here we show that epidermal growth factor receptor(EGFR) plays an important role in Ang II–induced renal fibrosis.Inhibition of EGFR activation by novel small molecules or byshort hairpin RNA knockdown in Ang II–treated SV40 mesangialcells in vitro suppresses protein kinase B and extracellularsignal-related kinase signaling pathways and transforming

growth factor-b/Sma- and Mad-related protein activation, andabolishes the accumulation of fibrotic markers such as connec-tive tissue growth factor, collagen IV. The transactivation ofEGFR by Ang II in SV40 cells depends on the phosphorylation ofproto-oncogene tyrosine-protein kinase Src (c-Src) kinase.Further validation in vivo demonstrates that EGFR small mole-cule inhibitor successfully attenuates renal fibrosis and kidneydysfunction in a mouse model induced by Ang II infusion. Thesefindings indicate a crucial role of EGFR in Ang II–dependent renaldeterioration, and reveal EGFR inhibition as a new therapeuticstrategy for preventing progression of chronic renal diseases.

IntroductionChronic kidney disease (CKD) is now recognized to be a

worldwide problem associated with significant morbidity andmortality. The progression of CKD is an irreversible processthat eventually leads to end-stage renal failure, a devastatingcondition in which patients depend on lifelong treatment withdialysis or renal transplantation (Klahr andMorrissey, 2003).Although most patients with CKD receive the diagnosis longbefore they reach end-stage renal failure, no effective treat-ment can completely halt the progressive decline in renalfunctions.The pathogenesis of CKD is characterized by progressive

loss of kidney function, relentless accumulation and deposi-tion of extracellular matrix (ECM), leading to widespread

tissue fibrosis (Klahr and Morrissey, 2003). Interstitial fibro-sis, a hallmark of chronic renal failure, strongly correlateswith deterioration of renal function regardless of the un-derlying disease (Eddy, 2014). The current therapy strategy ofreducing the activities of the renin-angiotensin system (RAS)at best slows but does not completely halt the progression ofchronic renal fibrosis in experimental and clinical conditions(Locatelli et al., 2009).Angiotensin II (Ang II), the central component of RAS,

appears to be critical in initiating and sustaining the fibro-genic destruction of the kidney (Mezzano et al., 2001). Thecontribution of Ang II to the progression of renal pathologyhas been elegantly illustrated by genetic studies usingangiotensin-converting enzyme 2 (ACE-2) knockout mice(Zhong et al., 2011; Liu et al., 2012) and by pharmacologicstudies using ACE inhibitors and Ang II–receptor blockers(Ishidoya et al., 1995; Ruiz-Ortega et al., 1995; Taal andBrenner, 2000). The fibrogenic effects of Ang II are attributedto its activation of transforming growth factor-b (TGF-b)signaling (Coresh et al., 2007), the essential signaling path-way involved in extracellular matrix deposition and tissuehomeostasis and repair. Suppression of Ang II–induced TGF-

This work was supported by the National Natural Science Funding of China(81503123, 81502912, and 21472142), Zhejiang Provincial Natural ScienceFunding (LQ15H120005, LQ14H310003, and LY13H060007), and High-LevelInnovative Talent Funding of Zhejiang Department of Health (2010-017).

Y.Q. and K.P. contributed equally to this work.dx.doi.org/10.1124/jpet.115.228080.s This article has supplemental material available at jpet.aspetjournals.org.

ABBREVIATIONS: 451, N-(4-((1H-indol-5-yl)amino)quinazolin-6-yl)acrylamide; 557, N-(4-((1-(4-fluorobenzyl)-1H-indol-5-yl)amino)quinazolin-6-yl)acrylamide; ACE, angiotensin-converting enzyme; AG1478, N-(3-chlorophenyl)-6,7-dimethoxyquinazolin-4-amine; Akt, protein kinase B; Ang II,angiotensin II; CKD, chronic kidney disease; CMC-Na, sodium carboxyl methyl cellulose; c-Src, proto-oncogene tyrosine-protein kinase Src; CTGF,connective tissue growth factor; DMSO, dimethylsulfoxide; ECM, extracellular matrix; EGF, epidermal growth factor; EGFR, epidermal growth factorreceptor; ERK, extracellular signal-related kinase; MAPK, mitogen-activated protein kinase; PI3K, phosphoinositide 3-kinase; PP2, 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine; qRT-PCR, quantitative reverse transcription polymerase chain reaction; RAS, renin-angiotensinsystem; shRNA, short hairpin RNA; Smad, Sma- and Mad-related protein; TGF-b, transforming growth factor-b; UUO, unilateral ureteralobstruction.

32

http://jpet.aspetjournals.org/content/suppl/2015/10/29/jpet.115.228080.DC1Supplemental material to this article can be found at:

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

b stimulation may represent a promising therapeutic ap-proach for inhibition of renal fibrosis.Epidermal growth factor receptor (EGFR), also known as

ErbB1, is a receptor tyrosine kinase from the ErbB family.EGFR protein possesses an N-terminal extracellular ligand-binding region, a conserved alpha helical transmembraneregion, and a C-terminal cytoplasmic region with tyrosinekinase activity and phosphorylation sites (Herbst, 2004;Grimminger et al., 2010). Upon activation by phosphorylation,EGFR has been shown to stimulate cell growth, desensitizecells from apoptotic stimuli, and regulate angiogenesis, whichare achieved by the recruitment of subsequent signalingcascades such as protein kinase B (Akt) and extracellularsignal-related kinase (ERK) (Schlessinger, 2000; Grimmingeret al., 2010). Currently, EGFR inhibitors such as gefitinib anderlotinib have been used clinically in the treatment of humancarcinomas (Roskoski, 2014).In addition to tumorigenesis, a growing number of studies

have indicated that EGFR also contributes to the developmentand progression of renal disease in animal models of obstruc-tive nephropathy, diabetic nephropathy, hypertensive ne-phropathy, and glomerulonephritis through mechanismsinvolved in the activation of renal interstitial fibroblast,induction of tubular atrophy, overproduction of inflammationfactors, and/or promotion of glomerular and vascular injury(Advani et al., 2011; Panchapakesan et al., 2011; Zhang et al.,2014). Recent studies have brought to light that EGFR trans-activation by angiotensin II and angiotensin II receptor type 1interaction also plays a vital role in tissue fibrosis (Lautretteet al., 2005). EGFR contributes to Ang II–induced hypertrophyand fibrosis in the heart; mice with an overexpression ofdominant-negative EGFR construct exhibit significantly lesscardiac fibrosis compared with wild-type littermates whensubjected to chronic Ang II infusion (Moriguchi et al., 1999).However, whether EGFR plays a role in Ang II–induced renalfibrosis is not clearly understood.The classic EGFR inhibitor AG1478 [N-(3-chlorophenyl)-

6,7-dimethoxyquinazolin-4-amine], which competitively bindsto the ATP pocket of EGFR, causing a conformational changeto prevent EGF–EGFR interaction, is widely used in EGFR-related biologic studies (Gan et al., 2007). Using AG1478 asa leading compound, we have designed and synthesizeda series of analogs as EGFR inhibitors. Among these analogs,compounds 451 [N-(4-((1H-indol-5-yl)amino)quinazolin-6-yl)acrylamide] and 557 [N-(4-((1-(4-fluorobenzyl)-1H-indol-5-yl)amino)quinazolin-6-yl)acrylamide] exhibited strong and se-lective EGFR-inhibitory activity at both the molecular andcellular levels, with an IC50 of 0.2 nM and 2.1 nM againstrecombinant EGFR kinase activity, respectively (Fig. 1A). Weused AG1478, 451, and 557 to determine the effects of EGFRinhibition on Ang II–induced renal fibrosis and the underlyingmechanism.

Materials and MethodsMaterials. Ang II, AG1478, and PP2 [4-amino-5-(4-chlorophenyl)-

7-(t-butyl)pyrazolo[3,4-d]pyrimidine] were purchased from Sigma-Aldrich (St. Louis, MO). The recombinant mouse EGF protein with ahigh-pressure liquid chromatography purity .98.0% was also boughtfrom Sigma-Aldrich. Compounds 451 and 557 were synthesized andcharacterized using organic chemical methods (as described inSupplemental Figure 1), and were purified using high-pressure liquid

chromatography with a purity of 99.3% and 98.5%, respectively. Thestructures of 451 and 557 are shown inFig. 1. The compoundsAG1478,451, and 557 were dissolved in dimethylsulfoxide (DMSO) for in vitroexperiments and were dissolved in 1% sodium carboxyl methylcellulose (CMC-Na) for in vivo experiments. The antibodies againstAkt, ERK2, Sma- and Mad-related protein (Smad), proto-oncogenetyrosine-protein kinase Src (c-Src), and phosphorylated Akt1/2/3,ERK1/2, c-Src, Smad2/3, as well as collagen IV and GAPDH werepurchased from Santa Cruz Biotechnology (Dallas, TX). The anti-bodies against EGFR and phosphorylated EGFRtyr845 were purchasedfrom Cell Signaling Technology (Beverly, MA), and collagen IV waspurchased from Abcam (Cambridge, MA).

Cell Culture. The immortalized mice mesangial cell line SV40and rat tubular cell line NRK-52E were obtained from the ShanghaiInstitute of Biochemistry and Cell Biology (Shanghai, People’s Re-public of China). Cells were cultured in Dulbecco’s modified Eagle’smedium/Ham’s F12 medium and 25 mM (high-glucose) D-glucosesupplemented with 5% fetal bovine serum, 100 U/ml penicillin, and100 U/ml streptomycin at 37°C in a humidified 5% CO2. Fortreatment, cells were treated as follows: PP2, 10 mM; AG1478, 10mM; 451, 0.1mM, 1mM, and 10mM; and 557, 0.1mM, 1mM, and 10mM.All inhibitors were added 1 hour before Ang II or EGF incubation in allexperiments. All inhibitors were dissolved in DMSO, and the controlcells received an equal amount of DMSO. The cells were thenincubated with Ang II (1 mM) or EGF (100 ng/ml) for 5 minutes todetect phosphorylated EGFR, with c-Src for 15 minutes for phosphor-ylated Akt1/2/3 and ERK1/2, 6 hours for TGF-b and phosphorylatedSmad2/3, and 36 hours for collagen IV.

Short Hairpin RNA Transfection. Short hairpin RNA (shRNA)(1 mg) was mixed with 3 ml Lipofectamine RNAi-MAX in 200 ml ofserum-free Opti-MEM and incubated for 20 minutes at room temper-ature. Then the mix was added into each well containing SV40 (1 �105) in 1ml of Dulbecco’smodified Eagle’smedium (fetal bovine serumwithout antibiotics) and incubated for 48 hours.

Animals. The 6-week-old male C57BL/6 mice (n 5 48) weighing18–22 g were obtained from the Animal Centre of Wenzhou MedicalUniversity (Wenzhou, People’s Republic of China). The animals werehoused with a 12-hour light/dark cycle at a constant room temperature,fed with a standard rodent diet, and provided with free access to water.The animals were acclimatized to the laboratory for at least 2 weeksbefore the experiments. All animal care and experimental procedurescomplied with the “Detailed Rules and Regulations of Medical AnimalExperiments Administration and Implementation” (Order No. 1998-55,Ministry of Public Health, People’s Republic of China.), and the“Ordinance in Experimental Animal Management” (Order No. 1998-02,Ministry of Science andTechnology, People’s Republic of China), andwere approved by the Wenzhou Medical University Animal Policy andWelfare Committee (Approval Document No. 2013/APWC/0084). Pro-tocols involving the use of animals were approved by the WenzhouMedical University Animal Policy and Welfare Committee.

Renal fibrosis was induced in C57BL/6 mice by subcutaneousinjection of Ang II (1.4 mg·kg21 every day for 4 weeks) in phosphatebuffer (pH 7.2). C57BL/6 mice were randomly divided into six groupswith eight mice in each group: 1) control group: nonrenal fibrosiscontrol mice; 2) Ang II group: Ang II–induced renal fibrosis mice thatwere subcutaneously injected with Ang II and orally received thevehicle (1% CMC-Na solution) daily for 4 weeks; 3) Ang II1 PP2 at 20mg·kg21 group; 4) Ang II 1 AG1478 at 20 mg·kg21 group; 5) Ang II 1557 at 5.0 mg·kg21 group; and 6) Ang II1 557 at 20.0 mg·kg21 group.

In the Ang II1 inhibitor groups, Ang II–induced renal fibrosis micewere orally treated with the respective inhibitor (in 1% CMC-Nasolution) at the indicated dosage for 4 weeks, starting at 1 day beforethe first Ang II injection. The Ang II group received the vehicle (1%CMC-Na solution) alone in the same schedule as compound treatmentgroups. After 4 weeks of treatment, animals were sacrificed underether anesthesia, and the blood and kidney samples were collected.Kidney tissues were embedded in 4% paraformaldehyde for pathologic

EGFR Inhibition Attenuates Kidney Fibrosis 33

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

analysis and/or snap-frozen in liquid nitrogen for gene and proteinexpression analysis.

Quantitative Real-Time Polymerase Chain Reaction. Cellsor kidney tissues (20–50 mg) were homogenized in TRIzol (Invitrogen,Carlsbad, CA) for extraction of RNA according to each manufacturer’sprotocol. Both reverse transcription and quantitative reverse transcrip-tion polymerase chain reaction (qRT-PCR) were performed using atwo-step M-MLV Platinum SYBR Green qPCR SuperMix-UDG kit(Invitrogen) with an Eppendorf Mastercycler ep realplex detectionsystem (Eppendorf, Hamburg, Germany) for qRT-PCR analysis. Thefollowing primers were synthesized from Invitrogen: collagen IV, sense:TGGCCTTGGAGGAAACTTTG, and antisense: CTTGGAAACCTTGTG-GACCAG; connective tissue growth factor (CTGF), sense: TGGCCT-TGGAGGAAACTTTG, and antisense: CTTGGAAACCTTGTGGACCAG;TGF-b, sense: TGACGTCACTGGAGTTGTACGG, and antisense:GGTTCATGTCATGGATGGTGC;andb-actin, sense:CCGTGAAAAGAT-GACCCAGA, and antisense: TACGACCAGAGGCATACAG. Theamount of each gene was determined and normalized to the amountof b-actin.

Western Blotting. Cells or renal tissues (30–50 mg) were lysed,and the protein concentrations were determined by using theBradford protein assay kit (Bio-Rad Laboratories, Hercules, CA).Aliquots (about 100 mg of cellular protein) were subjected toelectrophoresis and transfer to polyvinylidene fluoride membranes,which were then blocked in Tris-buffered saline containing 0.05%Tween 20 and 5% nonfat milk. The polyvinylidene fluoride mem-brane was then incubated overnight with specific antibodies. Afterincubation with the appropriate secondary antibodies, immunore-active proteins were visualized with electrochemiluminescence (Bio-Rad Laboratories) reagent and quantitated by densitometry. The

amounts of the proteins were analyzed using Image J analysissoftware version 1.38e (http://imagej.nih.gov/ij/) and were normal-ized to their respective control.

Histologic Analyses. Kidneys were fixed in 4% paraformalde-hyde and embedded in paraffin. The paraffin sections (5 mm) werestained with H&E. Sections were also stained with Masson trichromestain (Nanjing KerGEN Bioengineering Institute, Jiangsu, People’sRepublic of China) and Sirius Red. To estimate the extent of damage,the specimen was observed under a light microscope (400� amplifi-cation; Nikon, Tokyo, Japan).

Immunohistochemistry. The renal sections (5 mm) weredeparaffinized and rehydrated, and then subjected to antigenretrieval in 0.01 M citrate buffer (pH 6.0) by microwaving. Afterblocking with 5% bovine serum albumin, the sections were in-cubated with anti-collagen IV antibody (1:500) overnight at 4°C,followed by the secondary antibody (1:100). The nucleus wasstained with 4ʹ,6-diamidino-2-phenylindole, and sections werethen viewed under the Nikon fluorescence microscope (400�amplification; Nikon).

Measurements of the Level of Serum Biomarkers. Thecomponents of serum including the albumin, creatinine, andurine protein, were detected using commercial kits (NanjingJiancheng Bioengineering Institute, Jiangsu, People’s Republicof China).

Statistical Analysis. All data represent at least three indepen-dent experiments and are expressed as mean 6 S.E.M. All statisticalanalyses were performed using GraphPad Pro Prism 5.0 (GraphPad,San Diego, CA). Student’s t test and two-way analysis of variance wasemployed to analyze the differences between sets of data.P, 0.05 wasconsidered statistically significant.

Fig. 1. AG1478, 451, and 557 inhibited EGF-induced EGFR, ERK1/2, and Akt phosphorylation in renal SV40 cells. (A) Chemical structures of EGFRinhibitors AG1478, 451, and 557. (B) Both 451 and 557 inhibited EGFR kinase activity. (C–E) Western blot analysis for SV40 cells protein expression.SV40 cells (5� 105) were pretreated with the AG1478 (10 mM), 451 (1 mM), 557 (1 mM), or vehicle (DMSO, 1 mL) for 1 hour and then stimulated with EGF(100 ng/ml) for 5 minutes and 15minutes, respectively. The levels of (C) p-EGFR (5minutes), (D) p-ERK1/2 (15 minutes), and (E) p-Akt1/2/3 (15 minutes)in the cell lysate were detected using Western blot analysis as described in Materials and Methods. Bars represent the mean 6 S.E.M. of threeindependent experiments (*P , 0.05, **P , 0.01, ***P , 0.001 versus the EGF group).

34 Qian et al.

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

ResultsAG1478, 451, and 557 Inhibited the EGFR Signaling

Pathway Induced by EGF in Mesangial Cell SV40. Wefirst validated whether EGFR inhibitors suppressed EGFRsignaling pathway in vitro. As shown in Supplemental Fig. 2,EGF stimulation for 5 minutes increased EGFR phosphoryla-tion in SV40 cells in a dose-dependent manner. The dosage100 ng/ml of EGF was used for the following experiments.Renal mesangial SV40 cells were pretreated with AG1478,

451, or 557 for 1 hour, followed by incubation with EGF for 5minutes. Western blot assay showed that renal mesangialcells had a high expression of EGFR protein (Fig. 1C).Acute EGF treatment significantly induced phosphorylationin tyrosine 845 residue of EGFR and activated its classicdownstream signaling pathways, including Akt1/2/3 andERK1/2 (Fig. 1, C–E). EGFR inhibitors, such as AG1478,451, and 557, remarkably decreased EGFRTyr 845 phosphory-lation (Fig. 1C) and its downstream Akt1/2/3 (Fig. 1D) andERK1/2 phosphorylation (Fig. 1E) in the presence of EGF,suggesting that these inhibitors antagonized the EGF signal-ing pathway in renal mesangial cells.AG1478, 451, and 557 Suppressed the Ang II–Induced

EGFR Signaling Pathway in SV40 Cells. In addition toendogenous EGFR ligands, the EGFR signaling pathway canalso be transactivated by Ang II (Lautrette et al., 2005). Toexamine whether novel EGFR inhibitors can overcome AngII–induced EGFR transactivation, SV40 cells were pretreatedwith the AG1478, 451, or 557 at various concentration for 1hour and then stimulated with Ang II (1 mM) for 5 minutes.Ang II activated theEGFR signaling pathway, as evidenced byan increase of EGFR, Akt, and ERK phosphorylation; 451 and557were able to reduce EGFR, Akt, and ERK phosphorylationin a dose-dependent fashion (Fig. 2, A–C). These data indicatethat EGFR inhibitors suppress Ang II–induced transactiva-tion of the EGFR signaling pathway in SV40 cells. Weobserved similar results in rat renal tubular NRK-52E cells(Supplemental Fig. 3).EGFR Inhibitors 451 and 557 Attenuate Ang

II–Induced Increase in Profibrosis Proteins in RenalCells. Ang II is one of the major contributors to renal fibrosis,and ACE inhibitor or angiotensin receptor blockers can blockthe effect of Ang II on kidney fibrosis (Mezzano et al., 2001).Because EGFR inhibitors efficiently abolish the EGFR trans-activation by Ang II, we further studied the effect of EGFRinhibitors on profibrosis signaling pathway in renal cells.Figure 3 shows that Ang II significantly increased TGF-bmRNA and protein expression in SV40 cells (Fig. 3, A and D).As a consequence, downstream signaling such as Samdphosphorylation as well as the expression of extracellularmatrix proteins including CTGF and collagen IV were all up-regulated, as measured by both qRT-PCR and immunoblot-ting (Fig. 3, B and C, E and F). The EGFR inhibitors 451 and557 were able to attenuate the TGF-b signaling and fibroticprotein expression in a dose-dependent fashion in SV40 cells(Fig. 3, A–F). Furthermore, similar results were observed inrat renal tubular NRK-52E cells (Supplemental Fig. 3). Theseresults indicate that these novel compounds exert an anti-fibrosis effect in renal mesangial cells.EGFR Is a Key Regulator of Profibrotic Signaling

Activation. To investigate whether EGFR modulates renalfibrosis, we examined the effects of shRNAknockdown of EGFR

on Ang II–stimulated renal fibrotic signaling activation. Com-pared with scrambled vector, transfection of cells with specificshRNA against EGFR reduced EGFR protein abundance by

Fig. 2. AG1478, 451, and 557 suppressed Ang II–induced EGFR, ERK1/2,and Akt phosphorylation in SV40 cells. (A–C) Western blot analysis of theSV40 cell protein expression. SV40 cells (5� 105) were pretreated with theAG1478 (10 mM), 451 (0.1 mM, 1 mM, 10 mM), 557 (0.1 mM, 1 mM, 10 mM),or vehicle (DMSO, 1 ml) for 1 hour and then incubated with Ang II (1 mM)for 5 minutes or 15 minutes, respectively. The levels of (A) p-EGFR (5minutes), (B) p-ERK1/2 (15 minutes), and (C) p-Akt1/2/3 (15 minutes) inthe medium were detected as described in Materials and Methods. Barsrepresent the mean 6 S.E.M. of three independent experiments (*P ,0.05, **P , 0.01, ***P , 0.001 versus the Ang II group).

EGFR Inhibition Attenuates Kidney Fibrosis 35

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

more than 60% (Fig. 4A) in SV40 cells and attenuated fibroticmarkers in the presence of Ang II (Fig. 4, B–D), indicating thatEGFR mediates Ang II–induced renal profibrosis pathway.Based on these data, we further hypothesized that EGFR

activation independent from Ang II could also induce renal

fibrosis. To test this hypothesis, we studied TGF-b signalingpathway as well as fibrotic markers in EGF-stimulated SV40cells. EGF alone was able to activate TGF-b production andinduce downstream signaling SMAD phosphorylation (Fig. 4,E and F, H). As a result, the extracellular matrix proteins

Fig. 3. EGFR inhibitors suppressed Ang II–induced increases in fibrosis-related protein expression in SV40 cells. (A–C) Western blot analysis of theSV40 cells protein expression. SV40 cells (5 � 105) were pretreated with the AG1478 (10 mM), 451 (0.1 mM, 1 mM, 10 mM), 557 (0.1 mM, 1 mM, 10 mM), orvehicle (DMSO, 1 mL) for 1 hour and then stimulated with Ang II (1 mM) for different periods. The levels of TGF-b (A), p-Smad2/3 (B), and collagen IV (C)in the cell lysate were detected as described inMaterials andMethods. (D–F) SV40 cells (5� 105) were pretreated with the AG1478 (10 mM), 451 (0.1 mM,1 mM, 10 mM), 557 (0.1 mM, 1 mM, 10 mM), or vehicle (DMSO, 1 ml) for 1 hour and then stimulated with Ang II (1 mM) for 6 hours. The mRNA levels ofTGF-b (D), CTGF (E), collagen IV (F) were detected by qRT-PCR as described in Materials and Methods. Bars represent the mean 6 S.E.M. of threeindependent experiments (*P , 0.05, **P , 0.01, ***P , 0.001 versus the Ang II group).

36 Qian et al.

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

(including CTGF and collagen IV), were up-regulated (Fig. 4,G, I, and J). Supplemental Fig. 4 also shows that EGFtreatment increased the levels of p-Smad2/3, TGF-b, andcollagen IV in SV40 cells in a dose-dependent manner.Pretreatment of EGFR inhibitors could down-regulate theexpression the fibrotic markers stimulated by EGF (Fig. 4,E–J). Taken together, these data indicate that EGFR signal-ing pathway plays a key role in renal profibrosis signalingactivation.Ang II–Inducing EGFR Phosphorylation Depends on

Src. Previous studies suggested that c-Src plays an impor-tant role in Ang II–induced EGFR transactivation in type 1diabetic mice (Taniguchi et al., 2013). To investigate whetherc-Src mediates Ang II–induced EGFR transactivation in arenal fibrosis model, SV40 cells were pretreated with the c-Srcinhibitor PP2 (10 mM) for 1 hour before Ang II (1 mM)stimulation. PP2 was shown to inhibit the phosphorylation

of c-Src and EGFR stimulated by Ang II (Fig. 5, A–B).However, knockdown of EGFR by shRNA had no effect onAng II–induced Src phosphorylation (Fig. 5C). These datasuggest that c-Src functions as an upstream of EGFR signalingpathway and mediates Ang II–induced EGFR transactivation(Fig. 5D).EGFR Inhibitor 557 Suppressed Ang II–Induced

EGFR Signaling Pathways and Fibrosis In Vivo. Tovalidate the in vivo function of EGFR inhibitors, kidneyfibrosis was induced in 6-week-old male C57BL/6 mice bysubcutaneous injection of Ang II (1.5 mg.kg21.d21) for1 month. The animals were administered PP2 (20.0mg·kg21), AG1478 (20.0 mg·kg21), or compound 557 (5.0mg·kg21 or 20.0 mg·kg21) by gavage at day 1 before the AngII injection. During the animal experiments, no toxicityand abnormality were observed in all experimental mice(data not shown).

Fig. 4. EGFR plays an important role in Ang II–induced renal cell fibrosis. (A–D) SV40 cells (1 � 105) were transfected with 1 mg EGFR-specific shRNAin medium for 48 hours. Then the cells were stimulated with Ang II (1 mM) for different periods. The levels of EGFR (A), TGF-b (B), p-Smad2/3 (C), andcollagen IV (D) in the cell lysate were detected by Western blot as described in Materials and Methods. Bars represent the mean 6 S.E.M. of threeindependent experiments (*P , 0.05, **P, 0.01 versus the Ang II group). (E–G) SV40 cells (5�105) were pretreated with AG1478 (10 mM), 451 (1 mM),557 (1 mM), or vehicle (DMSO, 1 ml) for 1 hour and then stimulated with EGF (100 ng/ml) for individual times, respectively. The protein levels of TGF-b(E), p-Smad2/3 (F), and collagen IV (G) in the cell lysate were detected by Western blot assay. The mRNA levels of TGF-b (H), CTGF (I), and collagen IV(J) were detected by qRT-PCR. Bars represent themean6 S.E.M. of three independent experiments (*P, 0.05, **P, 0.01, ***P, 0.001 versus the EGFgroup).

EGFR Inhibition Attenuates Kidney Fibrosis 37

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

Ang II did not alter mouse body weight over the treatmentperiod (Fig. 6A), but it did increase the kidney weight/bodyweight ratio (Fig. 6B), serum creatinine (Fig. 6C), urineprotein (Fig. 6D), and serum albumin (Fig. 6E), indicatingan impaired kidney function. Moreover, the kidney histologicstaining analysis revealed elevated kidney fibrosis with Ang IItreatment alone compared with the control animals (Fig. 6F).Administration of PP2, AG1478, or 557 reversed the patho-logic effect of Ang II on kidney weight and function (Fig. 6,B–E). EGFR inhibitor 557 was also able to reduce kidneyhistologic abnormalities (H&E staining), renal fibrosis (SiriusRed and Masson Trichrome Blue staining), and collagenaccumulation (anti-collagen IV staining) in Ang II–treatedmice in a dose-dependent manner (Fig. 6F). The quantifieddata for the fibrosis degree in Masson, Sirius Red, and anti-collagen IV staining are shown in Supplemental Fig. 5.For the mechanistic study, we examined the key signaling

molecules such as c-Src, EGFR, Akt, and ERK in the AngII–induced activation of the EGFR pathway. Treatment with20 mg/kg of PP2 was able to attenuate the phosphorylation ofSrc, EGFR, Akt, and ERK caused by infusion of Ang II. High-dose 557 (20 mg/kg) suppressed the activation of the EGFR,Akt, and ERK signaling pathways but not on c-Src phosphor-ylation induced by Ang II; low-dose 557 (5mg/kg) hadminimaleffect on the EGFR signaling pathway (Fig. 7A). These datasuggest that 557 at 20 mg/kg was able to block the AngII–induced EGFR signaling pathways in vivo. We also foundthat the c-Src inhibitor PP2 attenuated the production offibrotic markers in Ang II–infused animal kidneys. Consistentwith our observations about signaling molecules, high-dose

557 (20 mg/kg) was able to suppress the expression of fibroticmarkers, including TGF-b, SMAD2/3, CTGF, and collagen IV(Fig. 7, B–E); low-dose 557 (5 mg/kg) only attenuated CTGFproduction but had no obvious effect on TGF-b or collagen IV(Fig. 7, C–E). Taken together, these pathologic and mecha-nistic analyses reveal that the EGFR inhibitor 557 preventskidney abnormalities and fibrosis induced by Ang II.

DiscussionCKD with end-stage renal fibrosis is a debilitating problem

that has no known cure. There is growing evidence of the roleof the EGFR pathway in various types of renal lesions.Increased EGFR activation and expression have been corre-lated with interstitial fibrosis and tubular atrophy in humanrenal allograft biopsies (Sis et al., 2004). EGFR activation isinvolved in endothelin-induced renal vascular and glomerularfibrosis (Francois et al., 2004). However, the underlyingmechanism by which EGFR activation contributes to renalfibrosis remains unknown.In our study using pharmacologic approaches, we illustrate

the importance of EGFR in the development of renal fibrosis.EGFR inhibition by small molecules suppressed TGF-b up-regulation, activation of Smad2/3, and accumulation of colla-gen IV in a model of renal fibrosis induced by Ang II infusion;c-Src activity is required for transactivation of EGFR signal-ing by Ang II. In addition, we observed similarly that EGFRinhibitors attenuated Ang II–induced EGFR phosphorylationand profibrosis protein up-regulation in rat renal proximal

Fig. 5. c-Src may mediate the AngII–induced EGFR activation. (A, B) West-ern blot analysis of the SV40 cells proteinexpression. SV40 cells (5 � 105) werepretreated with the PP2 (10 mM) orvehicle (DMSO, 1 ml) for 1 hour and thenstimulated with Ang II (1 mM) for 5minutes. The protein levels of p-c-Src(A) and p-EGFR (B) in the cell lysatewere detected by Western blot. (C) SV40cells (1 � 105) were transfected with 1 mgEGFR-specific shRNA in medium for 48hours. Then the cells were stimulatedwith Ang II (1 mM) for 5 minutes. Thelevels of p-c-Src (C) in the cell lysate weredetected by Western blot. Bars representthe mean 6 S.E.M. of three independentexperiments (*P, 0.05, **P, 0.01, ***P,0.001 versus the Ang II group). (D) Aschematic signaling pathway for EGFR-mediated Ang II–induced kidney injury.

38 Qian et al.

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

tubular NRK-52E cells (Supplemental Fig. 3), indicating thatEGFR is involved in Ang II–induced renal interstitial fibrosis.EGFR is widely expressed in mammalian kidneys, includ-

ing glomeruli, proximal tubules, and cortical and medullarycollecting ducts, and expression increases in both glomeruliand tubules in response to diabetes (Gesualdo et al., 1996).

Our data also show that both SV40 cells and kidney tissuehave a high EGFR expression level (Figs. 1, 2, and 7), as do ratrenal proximal tubular NRK-52E cells (Supplemental Fig. 3).Given recent studies indicating that angiotensin II regulatesglomerular hemodynamics, filtration rate, and macromolecu-lar permeability and contributes to fibrosis and glomerular

Fig. 6. Administration of 557 significantly improved renal pathologic profiles, histologic abnormalities, fibrosis, and macrophage infiltration in AngII–stimulated mice. (A–E) The effects of 557 on the metabolic profiles of Ang II–treated mice: body weight (A), kidney/body weight ratio (B), serumcreatinine (C), urine protein (D), and serum albumin (E). The body weight of the mice was recorded after Ang II injection. Serum creatinine, serumalbumin, urine protein, and kidney/body weight ratio were detected at the time of death. Data are mean6 S.E.M. (n = 8 per group; *P, 0.05, **P, 0.01,***P , 0.001 versus Ang II–treated group). (F) Administration of 557 significantly improved histologic abnormalities and fibrosis in Ang II–infusedmice. Mouse and kidney samples were prepared as described in Materials and Methods. Renal histopathologic analysis was performed using H&Estaining (400�); representative figures of Sirius red staining and Masson trichrome staining (400�) on renal tissue; representative figures ofimmunohistochemistry (400�) for type IV collagen (brown) on renal tissue.

EGFR Inhibition Attenuates Kidney Fibrosis 39

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

injury (Navar, 2014), it is likely that EGFR plays a pathogenicrole inmultiple cell types of the nephron. Studies from Zhanget al. (2014) and other groups support EGFR as importantmediator of renal repair after acute injury and also describe adetrimental role of persistent EGFR activation in progres-sive renal fibrosis induced by diabetes, subtotal nephrec-tomy, unilateral ureteral obstruction, and renovascularhypertension. Our current study indicates an important rolefor EGFR activation in mediating kidney injury induced byAng II as well. Our finding of a protective role of 451 and 557concurs with a previous study on erlotinib, a structurallydifferent EGFR inhibitor (Chen et al., 2012b) that was alsofound to inhibit kidney injury induced by Ang II (Figs. 3, 6,and 7).Pathologic kidney fibrosis is a consequence of maladaptive

alterations and is an important pathologic process in diversekidney diseases. A role for RAS has been well documented inboth diabetic and nondiabetic progressive renal injury, andthe ameliorative effects of RAS inhibition retard not onlyglomerular but also tubulointerstitial injury in progressivedisease (van derMeer et al., 2010;Miyata et al., 2014; Yacouband Campbell, 2015). Activation of angiotensin II receptor

type 1 by Ang II induces TGF-b signaling and renal fibrosisvia several signaling molecules, including tyrosine kinasessuch as Akt and mitogen-activated protein kinases (MAPKs)(Lautrette et al., 2005). The EGFR pathway activation hasalso been shown to contribute to the development of kidneyfibrosis (Tang et al., 2013). Abrogation of EGFR kinaseactivity by selective pharmacologic inhibitors or gene de-letion significantly protects against kidney fibrosis (Francoiset al., 2004; Liu et al., 2013). For example, transactivation ofEGFR by high glucose leads to collagen synthesis in mesan-gial cells, and EGFR inhibition by erlotinib attenuates thedevelopment of diabetic nephropathy in type 1 diabetes(Zhang et al., 2014). Our results reveal that the EGFRinhibition by either three small-molecule inhibitors or byshRNA silencing could attenuate kidney fibrosis in AngII–treated SV40 cells (Figs. 3 and 4, A–D). Administrationof AG1478 and 557 also significantly reversed AngII–induced kidney fibrosis in a mouse model in vivo (Figs. 6and 7). These results indicate that EGFR plays a critical rolein mediating the induction of kidney fibrosis by Ang II, whichmay be one of mechanisms by which EGFR inhibitionattenuates a variety of kidney diseases.

Fig. 7. Administration of 557 inhibits the Ang II–activated EGFR pathway and fibrosis in the mouse kidney. Four weeks after 557 administration at 5mg·kg21·d21 or 20 mg·kg21·d21, all mice in six groups were killed under ether anesthesia, and kidney samples were harvested. The levels of p-c-Src, p-EGFR, p-Akt, p-ERK1/2, and total EGFR, ERK2, and Akt in kidney were determined by Western blot (A). The protein levels of TGF-b, p-Smad2/3,Smad2/3, and collagen IV in the kidney were detected by Western blot (B). The mRNA expression of TGF-b (C), CTGF (D), and collagen IV (E) wereestimated by the qRT-PCR. The mRNA expression of fibrosis genes was normalized to b-actin mRNA content. Bar graph shows mean 6 S.E.M. fromeight mice in each group (*P , 0.05 and **P , 0.01, ***P , 0.001 versus the Ang II group).

40 Qian et al.

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

EGFR mediates renal fibrosis possibly through its prom-inent downstream Akt and MAPK signaling pathways. Grow-ing evidence supports a potential role for active Akt inthe process of renal fibrosis and kidney dysfunction in viewof its targeted effects on multiple pathogenic pathways. It isreported that Akt2 contributes to the epithelial-to-mesenchymal transition and to interstitial fibrosis afterunilateral ureteral obstruction (UUO) (Lan et al., 2014).Further evidence of the involvement of the phosphoinositide3-kinase (PI3K)–Akt signaling pathway in renal damage hasbeen provided by a recent study that reported that earlypharmacologic down-regulation of the PI3K–Akt signalingpathway reduced not only the profibrotic interstitial cells butalso the potential number of tubular cells that have beendescribed as responsible for excessive interstitial matrixproduction at later stages of UUO (Yoon et al., 2014).The MAPK pathways are well characterized in regulating

ECM expression. A previous report showed that blockade ofERK after the emergence of established fibrosis is effective forreducing subsequent renal fibrosis in the UUO model (Patet al., 2005). Downstream targets of ERK and PI3K–Aktinclude transcription factors such as SMAD2/3, which regu-lates the expression of fibrotic genes such as TGF-b, procolla-gen I, procollagen IV, and CTGF (Coresh et al., 2007). Ourdata demonstrate that the phosphorylation of both ERK1/2and Akt is elevated in Ang II–treated mesangial cells andmice, accompanied with fibrosis. Three EGFR inhibitorsmarkedly inhibited both ERK1/2 and Akt activation in vivoand in vitro in response to Ang II. These findings confirm Aktand ERK as pivotal regulators of kidney fibrosis and suggestthat the profibrotic effect of EGFR in kidney may be mediatedby its downstream Akt and ERK signaling pathways.Activation of EGFR also triggers the TGF-b/Smad signaling

pathway (Fig. 4), the major mechanism that regulates theaccumulation of extracellular matrix proteins, collagen, andfibronectin in renal fibrosis. Previous studies have shown thatblockade of TGF-b diminishes Ang II–induced ECM produc-tion (Ruiz-Ortega et al., 2007). In our study, inhibition ofEGFR reduced the production of TGF-b, activation of Smad2/3, and accumulation of collagen. These findings verify that theprofibrotic effect of EGFR in kidney depends on the TGF-b/Smad signaling pathways.A limitation of our study is the missing in vivo blood

pressure data. Ang II injection could increase the bloodpressure of mice. However, a recent study demonstrated thattreatment with EGFR inhibitor erlotinib attenuated AngII–induced vascular remodeling and cardiac hypertrophy butnot hypertension in mice, indicating that the mechanisms bywhich Ang II elevates blood pressure and enhances end-organdamage may be distinct (Takayanagi et al., 2015). Anotherindependent group found that Ang II–induced hypertrophy incerebral arterioles involves EGFR signaling, which is in-dependent of blood pressure (Chan et al., 2015). Althoughthese previous studies have confirmed that EGFR inhibitionhas no effect on Ang II–induced blood pressure, there may bedifferences from experiment to experiment. The beneficialeffect of EGFR inhibition on renal histology may be indepen-dent of blood pressure.The mechanism by which Ang II activates EGFR signaling

is still unclear. Activation of EGFR occurs either by bindingwith ligands, such as EGF and heparin bound-EGF, or bytransactivation. Previous studies demonstrated that Ang II

induces c-Src activation (Chen et al., 2012a). In addition, c-Src-dependent transactivation of EGFR signaling pathway isessential for collagen synthesis in mesangial cells from di-abetic mice (Taniguchi et al., 2013). In the present study, weshowed that the c-Src inhibitor PP2 significantly blocked AngII–induced EGFR phosphorylation, and EGFR shRNA had noeffect on Ang II–induced c-Src phosphorylation. These dataindicate that c-Src functions as an upstream signaler tomediate EGFR transactivation by Ang II (Fig. 5D). Anotherimportant finding is that EGFR-stimulated renal fibrosis canalso be Ang II–independent, as evidenced by the fact that EGFstimulation alone induced kidney fibrosis in SV40 cells (Fig. 4,E–J). This suggests that EGFR autoactivation or EGFRoverexpression resulted from genetic mutation, which occursfrequently in cancer genesis and development andmay also bea risk factor for kidney diseases, although no tumorigenesiswas observed in the kidneys. Future studies should exploreEGFR as a biomarker or a therapeutic target for kidneydiseases or even as a cross-linker for kidney diseases andcancer, especially EGFR-positive cancer.In summary, we have demonstrated that EGFR plays a key

role in kidney fibrosis, and EGFR inhibition by either small-molecule inhibitors or genetic silencing can protect againstAng II–induced kidney fibrosis. Based on observations fromthe literature and our findings, Fig. 5D depicts a model for thesignaling mechanisms linking Ang II, EGFR, and kidneyfibrosis. Ang II transactivates EGFR through c-Src, whichfurther stimulates Akt and ERK signaling pathways to inducethe TGF-b/SMAD pathway and fibrotic gene expression.Pharmacologic approaches that target EGFR may be apromising therapeutic strategy for kidney diseases. Althoughseveral EGFR specific inhibitors and antibodies have beenused for anticancer treatment clinically, the extent to whichinhibition of EGFR is clinically applicable to the preventionand treatment of kidney diseases in human patient remains tobe determined.

Authorship Contributions

Participated in research design: G. Liang, Wang, Qian, Peng.Conducted experiments: Qian, Qiu, Xu, Zhang, D. Liang, Zou.Contributed new reagents or analytic tools: Huang, Hu.Performed data analysis: G. Liang, Peng.Wrote or contributed to the writing of the manuscript: G. Liang,

Peng, Skibba.

References

Advani A, Wiggins KJ, Cox AJ, Zhang Y, Gilbert RE, and Kelly DJ (2011) Inhibitionof the epidermal growth factor receptor preserves podocytes and attenuates albu-minuria in experimental diabetic nephropathy. Nephrology (Carlton) 16:573–581.

Chan SL, Umesalma S, and Baumbach GL (2015) Epidermal growth factor receptoris critical for angiotensin II-mediated hypertrophy in cerebral arterioles. Hyper-tension 65:806–812.

Chen J, Chen JK, and Harris RC (2012a) Angiotensin II induces epithelial-to-mesenchymal transition in renal epithelial cells through reactive oxygen species/Src/caveolin-mediated activation of an epidermal growth factor receptor-extracellular signal-regulated kinase signaling pathway.Mol Cell Biol 32:981–991.

Chen J, Chen JK, Nagai K, Plieth D, Tan M, Lee TC, Threadgill DW, Neilson EG,and Harris RC (2012b) EGFR signaling promotes TGFb-dependent renal fibrosis.J Am Soc Nephrol 23:215–224.

Coresh J, Selvin E, Stevens LA, Manzi J, Kusek JW, Eggers P, Van Lente F,and Levey AS (2007) Prevalence of chronic kidney disease in the United States.JAMA 298:2038–2047.

Eddy AA (2014) Overview of the cellular and molecular basis of kidney fibrosis.Kidney Int Suppl (2011) 4:2–8.

Francois H, Placier S, Flamant M, Tharaux PL, Chansel D, Dussaule JC,and Chatziantoniou C (2004) Prevention of renal vascular and glomerular fibrosisby epidermal growth factor receptor inhibition. FASEB J 18:926–928.

Gan HK, Walker F, Burgess AW, Rigopoulos A, Scott AM, and Johns TG (2007) Theepidermal growth factor receptor (EGFR) tyrosine kinase inhibitor AG1478 in-creases the formation of inactive untethered EGFR dimers. Implications for com-bination therapy with monoclonal antibody 806. J Biol Chem 282:2840–2850.

EGFR Inhibition Attenuates Kidney Fibrosis 41

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from

Gesualdo L, Di Paolo S, Calabró A, Milani S, Maiorano E, Ranieri E, Pannarale G,and Schena FP (1996) Expression of epidermal growth factor and its receptor innormal and diseased human kidney: an immunohistochemical and in situ hy-bridization study. Kidney Int 49:656–665.

Grimminger F, Schermuly RT, and Ghofrani HA (2010) Targeting non-malignantdisorders with tyrosine kinase inhibitors. Nat Rev Drug Discov 9:956–970.

Herbst RS (2004) Review of epidermal growth factor receptor biology. Int J RadiatOncol Biol Phys 59(2, Suppl):21–26.

Ishidoya S, Morrissey J, McCracken R, Reyes A, and Klahr S (1995) Angiotensin IIreceptor antagonist ameliorates renal tubulointerstitial fibrosis caused by unilat-eral ureteral obstruction. Kidney Int 47:1285–1294.

Klahr S and Morrissey J (2003) Progression of chronic renal disease. Am J Kidney Dis41(3, Suppl 1):S3–S7.

Lan A, Zhang J, Xiao Z, Peng X, Qi Y, and Du J (2014) Akt2 is involved in loss ofepithelial cells and renal fibrosis following unilateral ureteral obstruction. PLoSOne 9:e105451.

Lautrette A, Li S, Alili R, Sunnarborg SW, Burtin M, Lee DC, Friedlander G,and Terzi F (2005) Angiotensin II and EGF receptor cross-talk in chronic kidneydiseases: a new therapeutic approach. Nat Med 11:867–874.

Liu N, He S, Ma L, Ponnusamy M, Tang J, Tolbert E, Bayliss G, Zhao TC, Yan H,and Zhuang S (2013) Blocking the class I histone deacetylase ameliorates renalfibrosis and inhibits renal fibroblast activation via modulating TGF-beta andEGFR signaling. PLoS One 8:e54001.

Liu Z, Huang XR, Chen HY, Penninger JM, and Lan HY (2012) Loss of angiotensin-converting enzyme 2 enhances TGF-b/Smad-mediated renal fibrosis and NF-kB-driven renal inflammation in a mouse model of obstructive nephropathy. LabInvest 92:650–661.

Locatelli F, Del Vecchio L, and Cavalli A (2009) Inhibition of the renin-angiotensinsystem in chronic kidney disease: a critical look to single and dual blockade.Nephron Clin Pract 113:c286–c293.

Mezzano SA, Ruiz-Ortega M, and Egido J (2001) Angiotensin II and renal fibrosis.Hypertension 38:635–638.

Miyata K, Satou R, Inui D, Katsurada A, Seth D, Davis A, Urushihara M, Kobori H,Mitchell KD, and Navar LG (2014) Renoprotective effects of direct renin inhibitionin glomerulonephritis. Am J Med Sci 348:306–314.

Moriguchi Y, Matsubara H, Mori Y, Murasawa S, Masaki H, Maruyama K, TsutsumiY, Shibasaki Y, Tanaka Y, and Nakajima T, et al. (1999) Angiotensin II-inducedtransactivation of epidermal growth factor receptor regulates fibronectin and trans-forming growth factor-beta synthesis via transcriptional and posttranscriptionalmechanisms. Circ Res 84:1073–1084.

Navar LG (2014) Intrarenal renin-angiotensin system in regulation of glomerularfunction. Curr Opin Nephrol Hypertens 23:38–45.

Panchapakesan U, Pollock C, and Saad S (2011) Renal epidermal growth factor re-ceptor: its role in sodium and water homeostasis in diabetic nephropathy. Clin ExpPharmacol Physiol 38:84–88.

Pat B, Yang T, Kong C, Watters D, Johnson DW, and Gobe G (2005) Activation ofERK in renal fibrosis after unilateral ureteral obstruction: modulation by antiox-idants. Kidney Int 67:931–943.

Roskoski R, Jr. (2014) ErbB/HER protein-tyrosine kinases: structures and smallmolecule inhibitors. Pharmacol Res 87:42–59.

Ruiz-Ortega M, González S, Serón D, Condom E, Bustos C, Largo R, González E,Ortiz A, and Egido J (1995) ACE inhibition reduces proteinuria, glomerular lesionsand extracellular matrix production in a normotensive rat model of immunecomplex nephritis. Kidney Int 48:1778–1791.

Ruiz-Ortega M, Rodríguez-Vita J, Sanchez-Lopez E, Carvajal G, and Egido J (2007)TGF-beta signaling in vascular fibrosis. Cardiovasc Res 74:196–206.

Schlessinger J (2000) Cell signaling by receptor tyrosine kinases. Cell 103:211–225.Sis B, Sarioglu S, Celik A, Zeybel M, Soylu A, and Bora S (2004) Epidermal growthfactor receptor expression in human renal allograft biopsies: an immunohisto-chemical study. Transpl Immunol 13:229–232.

Taal MW and Brenner BM (2000) Renoprotective benefits of RAS inhibition: fromACEI to angiotensin II antagonists. Kidney Int 57:1803–1817.

Tang J, Liu N, Tolbert E, Ponnusamy M, Ma L, Gong R, Bayliss G, Yan H,and Zhuang S (2013) Sustained activation of EGFR triggers renal fibrogenesisafter acute kidney injury. Am J Pathol 183:160–172.

Takayanagi T, Kawai T, Forrester SJ, Obama T, Tsuji T, Fukuda Y, Elliott KJ, TilleyDG, Davisson RL, and Park JY, et al. (2015) Role of epidermal growth factorreceptor and endoplasmic reticulum stress in vascular remodeling induced byangiotensin II. Hypertension 65:1349–1355.

Taniguchi K, Xia L, Goldberg HJ, Lee KW, Shah A, Stavar L, Masson EA,Momen A, Shikatani EA, and John R, et al. (2013) Inhibition of Src kinaseblocks high glucose-induced EGFR transactivation and collagen synthesisin mesangial cells and prevents diabetic nephropathy in mice. Diabetes 62:3874–3886.

van der Meer IM, Cravedi P, and Remuzzi G (2010) The role of renin angiotensinsystem inhibition in kidney repair. Fibrogenesis Tissue Repair 3:7.

Yacoub R and Campbell KN (2015) Inhibition of RAS in diabetic nephropathy. IntJ Nephrol Renovasc Dis 8:29–40.

Yoon HE, Kim SJ, Kim SJ, Chung S, and Shin SJ (2014) Tempol attenuates renalfibrosis in mice with unilateral ureteral obstruction: the role of PI3K-Akt-FoxO3asignaling. J Korean Med Sci 29:230–237.

Zhang MZ, Wang Y, Paueksakon P, and Harris RC (2014) Epidermal growth factorreceptor inhibition slows progression of diabetic nephropathy in association with adecrease in endoplasmic reticulum stress and an increase in autophagy. Diabetes63:2063–2072.

Zhong J, Guo D, Chen CB, Wang W, Schuster M, Loibner H, Penninger JM, ScholeyJW, Kassiri Z, and Oudit GY (2011) Prevention of angiotensin II-mediated renaloxidative stress, inflammation, and fibrosis by angiotensin-converting enzyme 2.Hypertension 57:314–322.

Address correspondence to: Dr. Guang Liang, Chemical Biology ResearchCenter, School of Pharmaceutical Sciences, Wenzhou Medical University,Wenzhou 325035, People’s Republic of China. E-mail: wzmcliangguang@163.com

42 Qian et al.

at ASPE

T Journals on M

arch 23, 2020jpet.aspetjournals.org

Dow

nloaded from