NAC Transcription Factor SPEEDY HYPONASTIC GROWTHRegulates Flooding-Induced Leaf Movement in ArabidopsisW

Mamoona Rauf,a,b,1 Muhammad Arif,a,b,1 Joachim Fisahn,b Gang-Ping Xue,c Salma Balazadeh,a,b

and Bernd Mueller-Roebera,b,2

a University of Potsdam, Institute of Biochemistry and Biology, 14476 Potsdam, GermanybMax-Planck Institute of Molecular Plant Physiology, 14476 Potsdam, GermanycCommonwealth Scientific and Industrial Research Organization Plant Industry, St. Lucia, Queensland 4067, Australia

ORCID ID: 0000-0002-1410-464X (B.M-R.).

In rosette plants, root flooding (waterlogging) triggers rapid upward (hyponastic) leaf movement representing an importantarchitectural stress response that critically determines plant performance in natural habitats. The directional growth is basedon localized longitudinal cell expansion at the lower (abaxial) side of the leaf petiole and involves the volatile phytohormoneethylene (ET). We report the existence of a transcriptional core unit underlying directional petiole growth in Arabidopsisthaliana, governed by the NAC transcription factor SPEEDY HYPONASTIC GROWTH (SHYG). Overexpression of SHYG intransgenic Arabidopsis thaliana enhances waterlogging-triggered hyponastic leaf movement and cell expansion in abaxialcells of the basal petiole region, while both responses are largely diminished in shyg knockout mutants. Expression of severalEXPANSIN and XYLOGLUCAN ENDOTRANSGLYCOSYLASE/HYDROLASE genes encoding cell wall–loosening proteins wasenhanced in SHYG overexpressors but lowered in shyg. We identified ACC OXIDASE5 (ACO5), encoding a key enzyme of ETbiosynthesis, as a direct transcriptional output gene of SHYG and found a significantly reduced leaf movement in response toroot flooding in aco5 T-DNA insertion mutants. Expression of SHYG in shoot tissue is triggered by root flooding and treatmentwith ET, constituting an intrinsic ET-SHYG-ACO5 activator loop for rapid petiole cell expansion upon waterlogging.

INTRODUCTION

Root flooding (waterlogging) in rosette plants like Arabidopsisthaliana causes an upward leaf movement, called hyponasticgrowth, to reestablish contact with air and photosynthetic gasexchange (Pierik et al., 2005; Jackson, 2008; Vashisht et al., 2011).The upward leaf movement is triggered by unequal cell elongationat the basal (proximal to the shoot) petiole region, where abaxialcells extend more than adaxial cells, resulting in increased petioleangle. The gaseous phytohormone ethylene (ET; C2H4), whichregulates many plant developmental processes (Schaller andKieber, 2002; Lin et al., 2009; Stepanova and Alonso, 2009;Schaller, 2012), has been indicated as the primary trigger of severalwaterlogging or whole-plant submergence-induced physiologicaland morphological acclimations in plants, including hyponasticgrowth (Cox et al., 2003; Millenaar et al., 2005; Voesenek et al.,2003, 2006; Bailey-Serres and Voesenek, 2008; Jackson, 2008). Inthe semiaquatic dicot Rumex palustris, the ET level increases20-fold within the first hour of waterlogging (Banga et al., 1996).The hyponastic growth response to waterlogging is notably fast inR. palustris with a lag phase of only 1.5 to 3 h and the responsebeing completed after 7 h, depending on the initial leaf angle (Coxet al., 2003). A comparably fast hyponastic growth response to

flooding was observed in the Columbia-0 (Col-0) accession ofArabidopsis (Millenaar et al., 2005). Recently, a study by Polko et al.(2012) showed that ET-mediated hyponasty in Arabidopsis involvesthe reorientation of cortical microtubules at the abaxial side of thepetiole from longitudinal to transverse; thus, ET is associated withtissue-specific changes in the arrangement of cortical microtubulesalong the petiole and most likely ET also triggers local stimulationof cell expansion upon waterlogging.ROTUNDIFOLIA3 (ROT3) in Arabidopsis encodes the cyto-

chrome P450 enzyme CYP90C1, which catalyzes the C-23 hy-droxylation of various brassinosteroids (BRs). ROT3 is involved inpolar cell elongation, and it has recently been shown that rot3mutants have reduced hyponastic growth upon ET treatment, aswell as low-light treatment and heat treatment, which both alsoinduced hyponastic growth. Treatment with brassinazole, an in-hibitor of BR biosynthesis, reduces the ET-induced increase ofthe petiole angle, revealing a modulatory role of BRs in petioleangle establishment (Polko et al., 2013). In addition to BRs, otherphytohormones like auxin and gibberellins can act as positiveregulators of hyponastic leaf growth, while abscisic acid functionsas a negative regulator (Polko et al., 2011). Furthermore, the de-fense-related hormones methyl jasmonate and salicylic acid havebeen shown to act as positive and negative modulators, re-spectively, of ET-induced hyponastic leaf growth (van Zantenet al., 2012). Flooding triggers and accelerates leaf senescence inmany plant species, including tobacco (Nicotiana tabacum), to-mato (Solanum lycopersicum), sunflower (Helianthus annuus), andmaize (Zea mays), possibly because of the reduced production ofcytokinin, a phytohormone that delays senescence, in floodedroots (Burrows and Carr, 1969; Trought and Drew, 1980; VanToaiet al., 1994; Huynh et al., 2005). In line with this model, expression

1 These authors contributed equally to this work.2 Address correspondence to bmr@uni-potsdam.de.The author responsible for distribution of materials integral to the findingspresented in this article in accordance with the policy described in theInstructions for Authors (www.plantcell.org) is: Bernd Mueller-Roeber(bmr@uni-potsdam.de).W Online version contains Web-only data.www.plantcell.org/cgi/doi/10.1105/tpc.113.117861

This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been

edited and the authors have corrected proofs, but minor changes could be made before the final version is published. Posting this version online

reduces the time to publication by several weeks.

The Plant Cell Preview, www.aspb.org ã 2013 American Society of Plant Biologists. All rights reserved. 1 of 15

of the rate-limiting enzyme of cytokinin biosynthesis (i.e., iso-pentenyl transferase) from a senescence-induced promoter en-hanced flooding tolerance in Arabidopsis (Zhang et al., 2000).Taken together, although various molecular players affecting theadaptive leaf growth response to waterlogging have been iden-tified in recent years, an integrated view of the underlying regu-latory networks is currently missing.

ET regulates two important molecular processes during hypo-nastic leaf growth, namely, rapid acidification of the apoplast toreduce cell wall rigidity and enhance cell wall extensibility and theupregulation of the expression of various EXPANSIN genes,which encode cell wall–loosening enzymes. Four sequence-related expansin protein families are currently distinguished inplants: EXPANSIN A (EXPA), EXPB, EXPANSIN-LIKE A (EXLA),and EXLB (Kende et al., 2004). In R. palustris, Rp-EXPA1 mRNAlevels increased ninefold relative to air-exposed control plantswith a subsequent increase in expansin activity (Vreeburg et al.,2005). A phylogenetic comparison of Rp-EXPA1 with putativeorthologs in rice (Oryza sativa), Arabidopsis, and Regnellidiumdiphyllum revealed high similarity of Rp-EXPA1 to At-EXPA8 andAt-EXPA2 from Arabidopsis, Os-EXPA1, Os-EXPA2, Os-EXPA 3,Os-EXPA4, and Os-EXPA10 from rice, and Rd-EXPA1 fromR. diphyllum. These expansin genes are induced during flooding-induced growth responses (Cho and Kende, 1997; Kim et al.,2000). Furthermore, several members of the XYLOGLUCAN EN-DOTRANSGLYCOSYLASE/HYDROLASE (XTH) gene family areupregulated by submergence, including XTH23 from Arabidopsis(Lee et al., 2011). XTHs are another class of cell wall–modifyingproteins that contribute to loosening cell walls during cell ex-pansion (Rose et al., 2002; Nishitani and Vissenberg, 2007; VanSandt et al., 2007).

The biosynthesis of ET involves the conversion of Met to S-adenosyl-L-Met (S-AdoMet) by the enzyme S-AdoMet synthetase.S-AdoMet is then further converted to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS), followed by sub-sequent metabolism of ACC to ET by ACC oxidase (ACO) (Yangand Hoffmann, 1984). In all plant species studied so far, ACS isencoded by a multigene family, and the Arabidopsis genomecontains nine authentic ACS genes that exhibit distinct expres-sion patterns throughout plant development and in response tostresses (reviewed in Lin et al., 2009). Similarly, ACO is encodedby multiple genes in plants (ACO1 to ACO5 in Arabidopsis), andexpression patterns differ between the various ACO genes. InR. palustris, Rp-ACO transcript level is strongly induced by ETtreatment or submergence, and ACO enzyme activity in shootsincreases twofold within 24 h of submergence, suggesting that ETformation during submergence is due to a rise of ACO proteinlevel. Notably, the increased expression of Rp-ACO was partic-ularly evident in petioles, where most of the cell elongation occursduring submergence (Vriezen et al., 1999). In Arabidopsis, theACO2 gene is involved in endosperm cap weakening and ruptureduring seed germination (Linkies et al., 2009). In addition to thedirect activation of genes involved in ET biosynthesis, alteredexpression of perception- and signaling-related genes and tran-scription factors such as ETHYLENE RESPONSE2, ETHYLENEINSENSITIVE2 (EIN2), and EIN3 under submergence (Lee et al.,2011) may contribute to enhanced hyponastic leaf growth; how-ever, this has not been tested so far.

NAC (for NAM, ATAF1, ATAF2, and CUC2) domain transcriptionfactors (TFs) represent a plant-specific transcription regulatoryfamily encoded by ;100 to 150 genes in all higher plants se-quenced to date (Ooka et al., 2003; Nuruzzaman et al., 2010;Puranik et al., 2013; Singh et al., 2013), with 106 genes present inthe genome of Arabidopsis. NAC TFs typically contain a highlyconserved N-terminal DNA binding domain and a divergentC-terminal part (Olsen et al., 2005). NAC TFs play important rolesin various biological processes, including senescence (Guo andGan, 2006; Kim et al., 2009; Balazadeh et al., 2010, 2011; Leeet al., 2012; Hickman et al., 2013; Rauf et al., 2013), the responseto abiotic and biotic stresses (Tran et al., 2004; Hu et al., 2006;Jensen et al., 2008; Wang et al., 2009; Wu et al., 2009; Jeong et al.,2010), leaf development (Berger et al., 2009), secondary wall bio-synthesis (Zhong et al., 2010, 2011), regulation of Fru sensitivity(Li et al., 2011), regulation of iron homeostasis (Ogo et al., 2008),and others. The NAC TF VASCULAR-RELATED NAC-DOMAININTERACTING2 (ANAC083) integrates abscisic acid signaling withleaf senescence (Yang et al., 2011) and negatively regulates xylemvessel formation (Yamaguchi et al., 2010). The NAC TF JUNG-BRUNNEN1 (ANAC042) positively regulates plant longevity, mostlikely by reducing the cellular hydrogen peroxide level (Wu et al.,2012), and plays a role in acquired thermotolerance (Shahnejat-Bushehri et al., 2012). In wheat (Triticum aestivum), the NAC TFNAM-B1 was shown to affect senescence and nutrient remobili-zation during grain maturation (Uauy et al., 2006).Here, we report the physiological function of the NAC TF

SPEEDY HYPONASTIC GROWTH (SHYG; ANAC047; At3g04070).We demonstrate that SHYG mediates waterlogging-induced hy-ponastic leaf growth by directly regulating the expression of ACO5involved in ET biosynthesis.

RESULTS

SHYG Encodes a Submergence-Induced NAC TF

The TF SHYG (ANAC047) belongs to group III of the NAC family,which also includes the functionally characterized stress-relatedTFs ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR1(ATAF1), At-NAP (for NAC-LIKE, ACTIVATED BY APETALA3/PISTILLATA), and RESPONSIVE TO DESICCATION26 (Fujita et al.,2004; Guo and Gan, 2006; Lu et al., 2007). SHYG encodes a 359–amino acid protein with a calculated molecular mass of 40.8 kD.SHYG contains a NAM domain (pfam02365) at its N terminus. Itscoding region consists of three exons, interrupted by two introns.The SHYG protein does not have a transmembrane domain, whichotherwise is present in some NAC TFs (Seo et al., 2008).We analyzed public transcriptome data and found that SHYG

expression increased 4.3-fold in rosettes of fully submerged Arabi-dopsis plants within 7 h (Lee et al., 2011), indicating that it might actas a transcriptional regulator in waterlogging- or submergence-controlled processes. Indeed, as we show below, SHYG plays animportant role in waterlogging-induced hyponastic leaf movement,a function not reported for any of the other group III NACs.

SHYG Regulates the Expression of ACO5

First, to identify genes downstream of SHYG, we expressed it froman estradiol-inducible promoter (Zuo et al., 2000) and performed

2 of 15 The Plant Cell

Figure 1. SHYG Acts Upstream of ACO5.

(A) ACO5 and SHYG expression, determined by qRT-PCR in 2-week-old b-estradiol–treated (1, 2, 4, and 6 h) SHYG-IOE seedlings, relative to the wild type.(B) Immunodetection of ACO protein after b-estradiol induction using anti-ACC antibody (top panel). RbcL, ribulose-1,5-bis-phosphate carboxylase/oxygenase large subunit (loading control; bottom panel).(C) ACO5 expression in 35S:SHYG-GFP, 35S:SHYG, and shyg-1 and shyg-2 lines compared with the wild type.(D) SHYG transactivates the ;1.87-kb (three SHYG binding sites), but not the 169-bp (no binding site), ACO5 promoter. Luciferase signal wasdetermined 8 and 16 h after transfection. Data in (A), (C), and (D) represent means 6 SE (n $ 3).(E) EMSA. SHYG-GST protein binds to 40-bp double-stranded oligonucleotide containing SHYG BS-1 of ACO5 promoter (lane 2), while no bindingoccurs in the absence of SHYG-GST protein (lane 1) or when nonlabeled competitor is added (lane 3). For EMSA, we used 1 mL (0.05 pmol/µL) labeledprobe in 20 mL of total volume. Competitor was used in 100-fold molar excess.(F) ChIP-qPCR on 35S:SHYG-GFP Arabidopsis plants. Data are the means 6 SD (two biological replicates each with three technical replicates).Enrichment of sequences at BS-1, BS-2, and BS-3 of the ACO5 promoter was quantified by qPCR. Negative control (Neg cont): qPCR on a promoter(CLAVATA1; At1g75820) lacking SHYG binding sites.

SHYG Controls Hyponastic Leaf Movement 3 of 15

expression profiling 5 h after b-estradiol treatment, using 14-d-oldtransgenic seedlings (SHYG-IOE ). Only few genes robustlyincreased upon SHYG induction, including ACO5 (4.3-fold),encoding an uncharacterized enzyme involved in ET biosynthesis(see Supplemental Table 1 online). ACO5 transcript abundance andACO protein level increased upon SHYG induction in a time-dependent manner (Figures 1A and 1B). ACO5 mRNA was alsomore abundant in Arabidopsis 35S:SHYG overexpressors thanin Col-0 wild-type plants (Figure 1C) and showed reduced levelsin two homozygous T-DNA insertion lines, shyg-1 and shyg-2(Figure 1C; see Supplemental Figures 1A to 1C online). Theseobservations are consistent with the model that SHYG actsupstream of ACO5 in a regulatory cascade. SHYG fused togreen fluorescent protein (GFP) accumulated in nuclei of trans-formed Arabidopsis plants (see Supplemental Figure 2 online),consistent with its function as a TF.

SHYG Directly Binds to the ACO5 Promoter

To further test the SHYG-ACO5 regulatory cascade, we next per-formed transactivation assays using Arabidopsis mesophyll cellprotoplasts cotransfected with a 35S:SHYG effector plasmid anda reporter construct (pACO5-fLUC) carrying a fusion between theACO5 promoter (1.87 kb) and firefly luciferase (fLUC) as a reporterfor transcriptional activation. As shown in Figure 1D, SHYG stronglytransactivated ACO5 expression 8 and 16 h after transfection.

To investigate whether ACO5 is a direct target gene of SHYG,we analyzed the SHYG DNA binding sequence. Sequencealignment of SHYG with Ta-NAC69 (Xue et al., 2006) revealed90% amino acid identity in their five conserved NAC subdomains,while little sequence identity (19%) exists between their C-terminaldomains. Considering the fact that SHYG and Ta-NAC69 have

very high amino acid sequence similarity in their DNA bindingdomains, we assumed that these proteins may share similarDNA binding specificity. Previously, two high-affinity bindingsites of Ta-NAC69 (site I, rrwkmCGTrnnnnnyACGtmayy; site II,rswvktynnnnnnnnyACGwcwct) were identified through in vitrobinding site selection, followed by extensive mutation analysis ofthe two binding sites (Xue et al., 2006). To test the DNA bindingaffinity of SHYG to Ta-NAC69 binding sites, we determined thebinding activity of SHYG toward Ta-NAC69 binding site I (SO1)and site II (SO39). In addition, to learn more about the specificity ofbinding, we also included the following sequences in our analysis:SO1m (mutated SO1 motif) that appears to confer no Ta-NAC69binding affinity; SO39h that contains a sequence similar toTa-NAC69 binding site II; ANAC019 binding site (ANAC019S);35S motif-1 (2139 to 2110) from the cauliflower mosaic virus(CaMV) 35S promoter that contains a weak Ta-NAC69 binding siteI; and 35S motif-2 containing the sequence of agggatg, which isthe protected site of At-NAM (Duval et al., 2002). As shown inTable 1, the binding affinities of SHYG to Ta-NAC69 sites SO1 andSO39 were highly similar to that of Ta-NAC69 (Xue et al., 2006).SHYG also showed binding toward the ANAC019 binding site andthe CaMV 35S motif-1, but with higher binding affinity. In contrastwith Ta-NAC69, SHYG better tolerated mutations within the twoconsensus motifs (SO39h and ANAC19S).With these binding sequence data, we identified three potential

SHYG binding sites (BS) within the ACO5 promoter 170 bp (BS-1,TCAACTG[8n]TACGTTTTT), 206 bp (BS-2, CATAACGTA[6n]AAC-GATAAA), and 1719 bp (BS-3, AAGCTTT[7n]TACGTTTTG) up-stream of the translation initiation codon (see Supplemental Figure3 online). However, the predicted affinity of BS-3 is low, as thereduction in the spacer length in Ta-NAC69 binding site II markedlyreduces the binding affinity (Xue et al., 2006). Transactivation

Table 1. Comparison of Binding Sequence Specificity of SHYG and Ta-NAC69

RBA (%)

Motifs Synthetic Oligonucleotide Sequence Ta-NAC69 SHYG

Ta-NAC69 DNA binding site ISO1 ggagatcCGTgcacagtACGtaactgtta 100 6 3.1 100 6 8.7SO1m ggagatcCGTgcacagaaaataactgtta 0 0

Ta-NAC69 DNA binding site IISO39 gaggtgtttaatgtttacACGtctctagtg 94.2 6 3.5 96.6 6 4.1SO39h taggtaagcaaattgatcACGcaactgccc 32.8 6 1.7 86 6 4.7

ANAC019 binding siteANAC19S gagctcttcttctgtaacACGcatgtgttg 16.9 6 1.2 56.2 6 6

CaMV 35S motifs35S motif-1 aaagaagaCGTtccaaccACGtcttcaaag 10.3 6 1.0 31.6 6 1.435S motif-2 ccactgacgtaagggatgacgcacaatccc 0 1.4 6 0.2

Relative binding activity (RBA) is expressed as percentage relative to SO1. Values are means 6 SD of three assays.Bases matching with the high-affinity binding sequences of Ta-NAC69 site I (rrwkmCGTrnnnnnyACGtmayy) or site II(rswvktynnnnnnnnyACGwcwct) are in bold. The NAC core binding site is shown as capital letters. Substituted bases ofSO1 (SO1m) are underlined. SO39h contains a sequence similar to Ta-NAC69 binding site II. ANAC19S represents theANAC019 binding site. The as-1 site of the CaMV 35S promoter in 35S motif-2 (–87 to 258) is shown in italics. Thenucleotide positions of the 35S motif-1 in the 35S promoter are from 2139 to 2110. The data indicate that the high-affinity binding sites of SHYG can be modified from the Ta-NAC69 binding sites to rrwkmCGTr(5-6n)yACGtmayy (site I)and rswvdky(8n)yACGhmwst (site II), where d = a, g, or t; h = a, c, or t; k = g or t; m = a or c; r = a or g; s = g or c; v = a, c,or g; w = a or t; y = c or t.

4 of 15 The Plant Cell

capacity of SHYG toward ACO5 was strongly reduced when allthree binding sites were deleted (Figure 1D). Electrophoretic mo-bility shift assays (EMSAs) confirmed binding of recombinantSHYG-glutathione S-transferase (SHYG-GST) fusion protein toBS-1 (Figure 1E), which has a better match to the preferred bindingsequences of Ta-NAC69 than BS-2 and BS-3. Finally, to demon-strate in vivo binding of SHYG to the ACO5 promoter, we per-formed chromatin immunoprecipitation (ChIP) and determinedenrichment of ACO5 promoter fragments in the precipitatedchromatin by quantitative PCR (qPCR) with primers spanning thethree predicted SHYG binding sites. We detected clear enrich-ment of BS-1 and BS-2, whereas no binding to BS-3 was ob-served (Figure 1F).

SHYG Regulates Waterlogging-Induced HyponasticLeaf Growth

Although SHYG transcript abundance increased in plants sub-merged for several hours (see above), a physiological function forthis NAC TF was not known. As root flooding leads to hyponasticleaf growth in soil-grown plants in Arabidopsis, we thought to

investigate whether SHYG has a function in this adaptive growthresponse. To this end, 30-d-old plants grown in individual pots insoil were placed in a flat plastic tank and roots were flooded byfilling the tank with water up to a level slightly below the pot’supper edge (for details, see Methods). Shoots remained in am-bient air. For control treatments, plants were put inside the tankswithout flooding. We followed hyponastic leaf movement in Col-0wild-type plants and the two shyg T-DNA insertion mutants usinga time-lapse video setup. While hyponastic petiole growth wasclearly detected in the Col-0 wild type, it was strongly impaired inshyg-2 (Figures 2A and 2B; see Supplemental Movies 1 and 2online) and shyg-1 (see Supplemental Figure 4 and SupplementalMovie 2 online) over an 8-h waterlogging time span, revealingSHYG’s critical function in this physiological response. Thisconclusion was further supported by the fact that waterlogging-induced hyponastic growth was strongly stimulated comparedwith Col-0 wild-type plants in 35S:SHYG lines (Figures 2A and 2B;see Supplemental Movie 1 online). The petiole bending responsewas stimulated by ACC spray but diminished by treatment withaminoisobutyric acid (AIB), which blocks ACO activity and, hence,ET biosynthesis, and silver nitrate (AgNO3), an ET receptor

Figure 2. Hyponastic Leaf Movement.

Images in (A), (C), and (E) show plants in the absence (2WL) or presence of 8 h (+WL) of waterlogging.(A) Enhanced and reduced hyponastic growth in 35S:SHYG and shyg-2 plants, respectively, compared with the wild type (WT).(B) Leaf angle kinetics. Shown are initial and pairwise subtracted differential petiole angles, corrected for diurnal petiole movement in control conditions.(C) Leaf reorientation is inhibited in aco5 mutants compared with the wild type.(D) Leaf reorientation kinetics in aco5 and wild-type plants.(E) Leaf reorientation is impaired in aco5 mutants overexpressing SHYG or SHYG-GFP.(F) Leaf reorientation kinetics in 35S:SHYG/aco5-1, 35S:SHYG-GFP/aco5-2, and wild-type plants. Means 6 SE (n $ 5) in all experiments.

SHYG Controls Hyponastic Leaf Movement 5 of 15

antagonist that minimizes ET perception (Guo and Ecker, 2003;Ouaked et al., 2003; see Supplemental Figure 5A online), stronglysupporting the model that SHYG acts through ET and likely throughACO5. Similarly, treatment with another ET receptor antagonist,1-methylcyclopropene, prevented submergence-induced hy-ponasty in the strongly responding Col-0 accession and reducedit in the weaker responding accession Landsberg erecta (Millenaaret al., 2005).

SHYG Acts through ACO5

To substantiate our premise that waterlogging-induced petiolegrowth is controlled via the SHYG-ACO5 regulatory cascade, weidentified two homozygous T-DNA insertion mutants, aco5-1and aco5-2 (see Supplemental Figures 1D and 1E online), withlow ACO5 expression (see Supplemental Figure 1F online).Waterlogging-induced hyponastic growth was strongly reduced

in both mutants and correlated to the level of residual ACO5expression (Figures 2C and 2D; see Supplemental Figure 1F andSupplemental Movie 3 online), indicating that ACO5 hasa unique function in this process. ACO5 deficiency was virtuallyovercome by treating plants with the ET-releasing agent ethe-phon (see Supplemental Figure 5B online), a response blocked

Figure 3. Hyponastic Leaf Movement in SHYG Inducible Lines.

(A) SHYG-IOE plants. Petioles reorient to a more vertical position uponwaterlogging after pretreatment with either 10 µM b-estradiol (EST; fourrosette sprays during 48-h prior waterlogging), ACC, or both, while thisresponse is diminished after pretreatment either with AIB or AgNO3.(B) Leaf reorientation kinetics in SHYG-IOE line. Means 6 SE (n $ 5).Pretreatments were performed using 10 mM each chemical 4 h prior towaterlogging.

Figure 4. Petiole Epidermal Cells.

(A) Microscopic view of abaxial epidermal imprints of petiole segmentsproximal (1.4 mm) to the stem (leaf No. 9) before (2WL) and after 8 h ofwaterlogging (+WL). WT, the wild type. Bar = 100 mm.(B) to (E) Epidermal cell lengths of petiole regions of wild-type, 35S:SHYG, and shyg-2 plants, before ([B] and [C]) and after ([D] and [E])waterlogging. Data points represent means 6 SE (n = 8) of epidermal celllengths of the first 5.4-mm adaxial and abaxial petiole surfaces.(F) Expression of EXPA11 and EXPA8 in abaxial and adaxial proximalparts of the leaf petiole after waterlogging compared with control. Errorbars represent means 6 SE (n $ 4).

6 of 15 The Plant Cell

by the simultaneous application of AgNO3 (see SupplementalFigure 5B online).Next, we tested whether SHYG indeed functions via activation

of ACO5 and to this end established 35S:SHYG/aco5-1 and 35S:SHYG-GFP/aco5-2 lines. We found waterlogging-induced hypo-nastic leaf movement to be strongly impaired in both aco5mutantbackgrounds (Figures 2E and 2F; see Supplemental Movie 4online); the lack of petiole bending was reversed by treatment ofplants with ethephon, a response that was blocked by AgNO3

(see Supplemental Figure 5C online). Finally, we tested the effectof waterlogging in SHYG-IOE lines. Although root flooding alonetriggered hyponastic leaf growth, as expected, this response wasenhanced by treatment with b-estradiol or ACC (Figures 3A and3B); the strongest growth effect was observed when b-estradioland ACC were applied together to waterlogged plants, a reactionalmost completely diminished in the presence of AIB or AgNO3

(Figures 3A and 3B). Collectively, our data show that ACO5 iscritically important for SHYG-mediated petiole bending duringroot flooding.

Localized Cell Expansion Is Modified by SHYG Expression

Waterlogging-induced hyponastic leaf growth requires localizedexpansion of abaxial cells of the basal (shoot-proximal) petiolesegment, while cell elongation in adaxial petiole cells is not af-fected by waterlogging (Polko et al., 2012). We determined thelength of epidermal cells in petioles of wild-type, shyg, and 35S:SHYG plants. Whereas cell length in the abaxial and adaxial petioleepidermis did not significantly differ between genotypes beforewaterlogging (Figures 4A to 4C), abaxial cells elongated more in35S:SHYG than wild-type petioles after root flooding, but abaxialcell elongation was reduced in shyg-2 petioles (Figures 4A to 4D).As expected, adaxial cell length remained unaffected by rootflooding in all three genotypes (Figure 4E). Thus, the level of SHYGexpression is critically important for root waterlogging-inducedlocalized cell expansion at the petiole base.Expansins are secreted proteins playing critical roles during cell

expansion (Cosgrove, 2000). EXPANSIN A11 (EXPA11) is a markerfor ET-induced cell elongation in Arabidopsis petioles (Millenaaret al., 2005; Polko et al., 2011), and we therefore tested its ex-pression in the SHYG-modified plants. Upon root flooding, EXPA11expression increased in shoot-proximal abaxial petiole segments ofwild-type plants, as expected. Notably, EXPA11 expression inabaxial petiole cells increased to higher levels in the 35S:SHYGoverexpressor plants but remained low in shyg-2 (Figure 4F). Ex-pression of EXPA11 remained largely unaffected in adaxial cells.EXPA8, a submergence-induced gene (Lee et al., 2011), behavedsimilarly (Figure 4F).We also tested SHYG expression in the proximal segment of the

leaf petiole using the ProSHYG:GUS lines. As seen in Supplemental

Figure 5. Expression Profiling of EXP and XTH Genes in SHYG Trans-genic Plants.

(A) Phenotype of 30-d-old wild-type (WT), 35S:SHYG overexpressor, andshyg-2 mutant plants treated with waterlogging for 8 h. Dissected leafpetioles were subjected to EXP and XTH gene expression profiling byqRT-PCR.

(B) Venn diagram showing an overview of EXP and XTH genes that weresignificantly differentially expressed in 35S:SHYG and shyg-2 mutantlines compared with the wild type.(C) The heat map indicates expression ratios of EXP and XTH genes in35S:SHYG and shyg-2 compared with the wild type. Expression ratios(log2): red, increased expression (between 0 and + 2); blue, reducedexpression (between 0 and 22).

SHYG Controls Hyponastic Leaf Movement 7 of 15

Figure 6A online, b-glucuronidase (GUS) staining was low beforewaterlogging but was strongly enhanced after 8 h of waterlogging.However, no major difference in staining intensity between theabaxial and adaxial petiole regions was observed. We also testedSHYG expression by quantitative real-time PCR (qRT-PCR) and,like in the GUS studies, did not detect a major difference betweenthe abaxial and adaxial petiole regions, similar to ACO5, whileEXPA11 and EXPA8 expression was considerably higher in theabaxial than adaxial petiole regions (see Supplemental Figure 6Bonline), suggesting that also ET formation may not be locally dif-ferent between the two petiole sides.

We used qRT-PCR to test the expression of 44 additional cellexpansion–related genes, namely, EXP and XTH genes, and ob-served opposite responses for several of them in 35S:SHYG andshyg-2 plants versus the wild type (Figure 5), supporting the im-portant role of SHYG as a regulator of cell expansion during hy-ponastic leaf growth.

Waterlogging Triggers SHYG Expression

Global expression profiling revealed elevated transcript levels ofmany genes, including SHYG, in fully submerged plants (Leeet al., 2011). To test whether enhanced SHYG expression is dueto promoter activation, we tested waterlogging-dependent GUSactivity in SHYG promoter-GUS fusion (ProSHYG:GUS) lines. GUS

staining in petioles and the rosette center was weak in non-stressed plants. However, GUS activity was strongly elevated after8 h of waterlogging (Figures 6A and 6B), when petiole angle wasalso increased in these lines (Figure 6A; see Supplemental Figure 7online); this response was further enhanced by simultaneous ap-plication of ACC but diminished by AIB (Figures 6A and 6B; seeSupplemental Figure 7 online), indicating a positive feedback loopconnecting SHYG expression with ET level, most likely via ACO5.We next tested the effect of ET released from b-estradiol–inducedSHYG-IOE seedlings on SHYG expression in neighboring ProSHYG:GUS lines (pooled in a tightly sealed deep-well plate to ensure thecapture of ET produced by SHYG:IOE plants; see SupplementalFigure 8 online). As seen in Figures 6C and 6D, b-estradiol treat-ment strongly enhanced GUS activity in ProSHYG:GUS lines ina time-dependent manner. This induction was not observed inmock-treated seedlings or when ET synthesis was blocked by AIBin b-estradiol–treated samples.

Natural Variation of the SHYG-ACO5 Regulatory Cascade

To assess whether there exists natural variation of the SHYG-ACO5 regulatory cascade, we tested the response to root floodingin accession Cvi-0, which shows a low tolerance to completesubmergence, and compared it with Col-0, an accession reportedto exhibit moderate submergence tolerance (Vashisht et al., 2011).

Figure 6. GUS Activity in ProSHYG:GUS Plants.

(A) SHYG expression in rosettes triggered by waterlogging for 8 h (+WL) relative to control (2WL). GUS staining was further enhanced by ACCpretreatment; the response was blocked by AIB. The corresponding plant phenotypes are shown on the top.(B) Quantification of GUS activity; experimental setup as in (A); means 6 SE (n $ 3). FW, fresh weight.(C) GUS activity in ProSHYG:GUS seedlings, triggered by ET released from neighboring SHYG-IOE seedlings treated with b-estradiol (10 µM) for the indicatedtime points (see Supplemental Figure 8 online for experimental details). Note elevated GUS activity in the first true leaves after b-estradiol (EST) treatment(arrows) compared with mock. GUS activity remains low in seedlings pretreated for 4 h with ACO inhibitor AIB, even in the presence of b-estradiol.(D) Quantification of GUS from (C); means 6 SE (n $ 4).

8 of 15 The Plant Cell

Leaf movement was much less pronounced in Cvi-0 than in Col-0(see Supplemental Figure 9 online). Expression of SHYG andACO5 (and EXPA8) increased upon waterlogging in the proximalpetiole segments of Col-0 but remained largely unaffected in Cvi-0,in accordance with its weak growth response (see SupplementalFigure 9 online). As expected, expression of these genes was notaffected by waterlogging in the distal petiole segments.

DISCUSSION

NAC TFs have been shown to be involved in many developmentaland stress-related processes in plants (Tran et al., 2004; Jensenet al., 2008; Ogo et al., 2008; Berger et al., 2009; Kim et al., 2009;Wu et al., 2009, 2012; Balazadeh et al., 2010; Li et al., 2011;Zhong et al., 2011; Lee et al., 2012). Here, we report the biologicalfunction of SHYG, a group III NAC TF from Arabidopsis, in rootflooding–induced hyponastic leaf growth. Expression of SHYG inshoots of soil-grown plants is low to moderate before root water-logging but rapidly increases upon waterlogging as well as ACCtreatment. As we demonstrate here, SHYG directly regulates theexpression of ACO5 by binding to its promoter, in accordance withthe observation that root flooding triggers ET formation (as re-viewed in Bailey-Serres and Voesenek, 2008; Jackson, 2008). Lossof SHYG function strongly diminishes waterlogging-induced hy-ponastic leaf growth (Figures 2A and 2B), and a loss of ACO5 hasa similar effect (Figures 2C and 2D).

Notably, when SHYG was overexpressed from the CaMV 35Spromoter in the absence of a functional ACO5 gene (in aco5-1and aco5-2 mutant backgrounds) waterlogging-induced hypo-nastic leaf movement was strongly impaired (Figures 2E and 2F),revealing ACO5 to be a key element of this physiological re-sponse under the direct regulation of SHYG. Therefore, our dataprovide firm evidence for a central role of SHYG as an upstreamregulator of waterlogging-induced hyponasty by influencing ET

biosynthesis through direct transcriptional activation of an ETbiosynthesis gene. Our data indicate that other ACO genes inArabidopsis do not compensate for the lack of ACO5 in thisphysiological response. An important aspect of our findings isthat SHYG expression itself is stimulated by ACC/ET, therebyconstituting a positively acting ET-SHYG-ACO5 activator loop forrapid petiole cell expansion upon root flooding.Upon flooding, ACC accumulates in the anoxic roots and after

transport via the xylem to the shoot ET is liberated by the action ofACO (Bradford and Yang, 1980). Generally, ACO is not consid-ered to be rate-limiting; thus, ACC arriving at the shoot might beexpected to be readily converted to ET. However, as we dem-onstrate, ACO5 expression is barely induced in the proximalpetiole segment upon root flooding in accession Cvi-0, whichshows a weak hyponastic growth response to waterlogging, whileit is strongly induced in accession Col-0, which exhibits a muchmore pronounced hyponastic response to root flooding (seeSupplemental Figure 9 online). This observation and the fact thatthe strength of the hyponastic growth response correlates withthe level of residual ACO5 expression in the two aco5 T-DNAinsertion mutants (Figures 2C and 2D; see Supplemental Figure1F online) points to rate-limiting expression (and potentially ac-tivity) of ACO during waterlogging-induced hyponastic leafgrowth. Notably, SHYG did not modulate expression of any of thenine ACS genes in the Arabidopsis genome in our experimentalsetting, indicating that SHYG-mediated enhanced ET formationupon waterlogging does not involve these genes. However,submergence-triggered increases of ACS gene expression havebeen observed (Peng et al., 2005; Lee et al., 2011), leaving openthe possibility that other transcriptional regulators control theirexpression. Currently, however, no single ACS gene has beenfunctionally connected to hyponastic leaf growth.Hyponastic leaf movement is due to a locally restricted ex-

pansion of cells in the proximal, abaxial petiole region, while cellsat the adaxial petiole side remain largely unaffected with respectto cell length upon root flooding. Compared with the wild type, wefound increased and decreased abaxial cell expansion, re-spectively, in SHYG overexpressors and shyg mutants, a pheno-type consistent with the macroscopic leaf movement response. Incontrast with the locally restricted cell elongation, however, ex-pression of both SHYG and ACO5 did not appear to be regionallydistinct at the abaxial and adaxial petiole sides (see SupplementalFigure 6 online), suggesting that also ET formation may not belocally different between the two petiole sides.Previously, it was shown in Arabidopsis that ET triggers ele-

vated expression of EXPA11 at the proximal abaxial but not ad-axial petiole side (Polko et al., 2012), which is consistent with ourobservation of the differential cell elongation responses duringwaterlogging. We observed a similar transcriptional response forEXPA11 as well as for EXPA8 in wild-type (Col-0) Arabidopsisplants; notably, compared with wild-type plants, expression of thetwo genes at the abaxial petiole side was stimulated in SHYGoverexpressors, while it was reduced in the shyg-2 mutant; nodifference in EXPA8 and EXPA11 expression was observed at theadaxial petiole side. Thus, although expression of SHYG itselflacks local specificity (as does ACO5), genes involved in cell ex-pansion are likely to be of functional relevance for the upwarddirected petiole bending (EXPA8 and EXPA11) and maintain their

Figure 7. Model of SHYG Action during Waterlogging-Induced Hypo-nastic Leaf Growth.

Waterlogging triggers SHYG expression through unknown upstream fac-tors. SHYG directly activates ACO5, leading to elevated ET formation.Waterlogging also induces expression of ACS genes involved in ET bio-synthesis. In parallel, various EXP and XTH genes are induced, facilitatingpetiole bending and, hence, hyponastic growth.

SHYG Controls Hyponastic Leaf Movement 9 of 15

locally distinct patterns of expression upon SHYG overexpression.Currently, it remains an open question whether EXPA8 and EXPA11are direct transcriptional output genes of SHYG or whether addi-tional TFs are involved in regulating these genes during water-logging. Of note, however, EXPA8 is an ortholog of Rp-EXPA1,a marker gene for submergence-induced leaf hyponasty inR. palustris (Vreeburg et al., 2005), indicating regulatory and func-tional conservation of the gene networks controlling this physio-logical response.

As we show in Figure 5, several other EXP genes as well as XTHgenes are modulated by SHYG, which most likely contributes toabaxial petiole cell expansion upon waterlogging. However, thecontribution of each individual gene to hyponastic leaf growth hasso far not been analyzed; it is possible that several of the EXP/XTHgenes affected by SHYG work in concert to contribute to cellexpansion during waterlogging-triggered leaf hyponastic leafgrowth. In addition, our data reveal several other genes rapidlymodulated by SHYG after its induction by estradiol in SHYG-IOElines (see Supplemental Table 1 online). However, their functionalinvolvement in hyponastic leaf growth remains open at present.

A further important question that remains to be addressed in fu-ture experiments is which upstream transcriptional regulators con-trol the expression of SHYG. A possible candidate is EIN3, a mastertranscriptional regulator of ET-controlled processes (Roman et al.,1995; Chao et al., 1997). Of note, an EIN3 core binding site is lo-cated;580 bp upstream of the SHYG start codon (data not shown),and ChIP-seq studies have revealed binding of EIN3 to the SHYGpromoter (Chang et al., 2013), indicating that both TFs constitutea transcriptional cascade with SHYG as an output regulator of theEIN3 TF. However, a detailed functional analysis will be required tounravel in detail under which physiological conditions and in whichcells EIN3 regulates SHYG expression.

Collectively, our data suggest a regulatory model (Figure 7)whereby SHYG plays a decisive role in regulating root water-logging-induced leaf movement by directly or indirectly stimulat-ing localized cell expansion at the abaxial petiole side throughdirect activation of ACO5 and ET formation. The control circuitinvolves an intrinsic ET-SHYG-ACO5 activator loop that accel-erates cell expansion after an initial trigger and underlies the rapidpetiole growth response that becomes already evident 90 minafter starting root flooding (Figure 2). Our data also suggest nat-ural variation of SHYG, ACO5, and EXPA8 gene expression,which is in accordance with the differential hyponastic leaf re-sponse observed in Col-0 (relatively strong responder) versus Cvi-0(weak responder; see Supplemental Figure 9 online), providingfurther evidence for the biological importance of the SHYG-ACO5regulatory interaction.

Future work will have to unravel the peculiarities of the signalingcircuitry that fine-tunes SHYG expression at the cell level and thedetails of the downstream gene network(s) that governs local cellexpansion to drive directional leaf movement. The SHYG-ACO5regulatory system appears to be distinct from the regulatorynetworks controlled by the SNORKEL1 (SK1) and SK2 genes indeepwater rice, both of which encode ET response factor TFs thatregulate internode elongation to keep leaves above the risingwater surface and avoid tissue anoxia. Both SK genes are upre-gulated by ET. Experimental evidence shows an involvement ofgibberellic acid in the elongation process controlled by SK1 and

SK2 (Hattori et al., 2009, 2011). Flash flood is another type ofstress that appears suddenly and often damages rice seedlings.Tolerance to flash flood is achieved by temporally restrictinggrowth (up to a few weeks), leading to stunted seedlings. Whenflood waters recede, seedlings restart growth. The ET responsefactor TF Submergence-1A has been shown to be a centralregulator of submergence tolerance (Xu et al., 2006; Jung et al.,2010). Within the Arabidopsis NAC family, several other NACsbesides SHYG, including, for example, ANAC013, ANAC084,ANAC091, and ATAF1, are induced by submergence (Lee et al.,2011). It appears that plants have evolved different strategiesand molecular mechanisms to combat threats posed by water-logging or submergence.

METHODS

General

Standardmolecular techniques were employed as reported (Sambrook et al.,2001; Skirycz et al., 2006). Chemicals and reagents were obtained fromSigma-Aldrich, Fluka, and Roche Diagnostics. For sequence and expressionanalyses, the following tools were used: eFP browser (www.bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi), GENEVESTIGATOR (www.genevestigator.com), theNational Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/),The Arabidopsis Information Resource (http://www.Arabidopsis.org/), theEuropean Bioinformatics Institute (http://www.ebi.ac.uk/), and the PlantTranscription Factor Database (http://plntfdb.bio.uni-potsdam.de/v3.0/).

Plants

Seeds of Arabidopsis thaliana, accessions Col-0 and Cvi-0, were obtainedfrom the Arabidopsis thaliana Resource Centre for Genomics (Institut Na-tional de la Recherche Agronomique, France; http://dbsgap.versailles.inra.fr/publiclines/). For growth under long-day conditions, seedlings weregrown in soil (Einheitserde GS90; Gebrüder Patzer) in a climate-controlledchamber with 16-h daylength provided by fluorescent light at ;100 µmolm22 s21, and day/night temperatures of 20/16°C and RH of 60/75%. After2 weeks, seedlings were transferred to a growth chamber (16-h day,120 µmol m22 s21) with day/night temperature of 22/16°C and 60/75%RH.For growth on nutrient agar medium (13 Murashige and Skoog and 1%Suc, pH 5.8), the Arabidopsis seeds were surface-sterilized using sodiumhypochlorite solution (10%) and sown on the plates. The vertically orientedplates were stored for 2 d under vernalization conditions and then trans-ferred to long-day growth conditions (16 h light at 22°C and 8 h dark at18°C). Seed stocks of the SALK (http://signal.salk.edu/cgi-bin/tdnaexpress)T-DNA insertion lines shyg-1 (SALK-066615) and aco5-1 (SALK-042400)and the GABI-Kat (http://www.gabikat.de) insertion lines shyg-2(GK-343D11) and aco5-2 (GK-119A07) were obtained from the NottinghamArabidopsis Stock Centre (http://Arabidopsis.info). T-DNA insertionsites and homozygosity were confirmed by PCR-based genotyping (seelegend to Supplemental Figure 1 online). Primer sequences are listed inSupplemental Table 2 online. qRT-PCR was performed to check fortranscript abundance. Plant 35S:SHYG (BASTAr) was crossed with aco5-1(Kanr). Plant 35S:SHYG-GFP (Kanr) was crossed with aco5-2 (sulfadiaziner).

DNA Constructs

Constructs were generated by PCR. Construct generation strategiesand primer sequences are listed in Supplemental Table 2 online.Amplicons generated by PCR were checked for correctness byDNA sequence analysis (Eurofins MWG Operon). Constructs weretransformed into Arabidopsis Col-0 via Agrobacterium tumefaciens–mediated transformation.

10 of 15 The Plant Cell

Expression Profiling by qRT-PCR

RNA extraction, synthesis of cDNA, and qRT-PCR were done as described(Caldana et al., 2007; Balazadeh et al., 2008, 2010). Genes included in theqRT-PCR platforms and primer sequences are given in Supplemental Table3 online. Primers were designed using QuantPrime (Arvidsson et al., 2008;www.quantprime.de). PCR reactions were run on an ABI PRISM 7900HTsequence detection system (Applied Biosystems Applera).

Affymetrix ATH1 Microarray Hybridization

The RNeasy plant mini kit (Qiagen) was used to extract total RNA from twobiological replicates of 14-d-old SHYG-IOE seedlings treated with 10 µMb-estradiol (Sigma-Aldrich) for 5 h or ethanol (0.1%) for control. Probepreparation and hybridization to the Arabidopsis ATH1 array were per-formed by ATLAS Biolabs. Data analysis was performed as reported(Balazadeh et al., 2010). Microarray data (SHYG-IOE-5 h) are availablefrom the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/) underaccession number GSE38721.

Identification of SHYG Binding Sites

The DNA binding activity of SHYG-CELD fusion protein was determined asdescribed previously (Xue, 2002, 2005), using 1 pmol biotin-labeled syn-thetic oligonucleotides that were immobilized in the wells of streptavidin-coated eight-well strips and binding/washing buffer (25 mM HEPES/KOH,pH7.0, 50mMKCl, and 2mMMgCl2) containing 0.5mMDTT, 0.15mgmL21

sheared herring sperm DNA, 0.3 mgmL21 BSA, 10% glycerol, and 0.025%Nonidet P-40. DNA binding assays with a biotin-labeled single-strandedoligonucleotide or a biotin-labeled double-stranded oligonucleotide withouta target binding site were used as controls.

Transactivation Assay

Transactivation assays in Arabidopsis mesophyll cell protoplasts wereperformed as described (Wu et al., 2012; Rauf et al., 2013), with 35S:SHYGand ProACO5:FLuc as effector and reporter plasmids, respectively. The 35S:RLuc (for Renilla luciferase) vector (Licausi et al., 2011) was used fornormalization against transformation efficiency. FLuc and RLuc were as-sayed using the Dual Luciferase Reporter Assay System (Promega). Sixmicrograms of DNAwas used for protoplast transformation. Readingswereperformed 8 and 16 h after transfection using a GloMax 20/20 Luminometer(Promega). Data were collected as ratio (FLuc activity:RLuc activity).

EMSA

Recombinant SHYG-GST protein for EMSA experiments was expressed inEscherichia coli as described (Dortay et al., 2011). Protein purification forEMSA was performed using a 1-mL GSTrap HP column (GE Healthcare)coupled to an Äkta-Purifier FPLC system (GE Healthcare). EMSA wasperformed as described (Wu et al., 2012) using the Odyssey Infrared EMSAKit (LI-COR). 59-DY682–labeled DNA fragments were purchased fromEurofins MWG Operon. Sequences of labeled DNA fragments and un-labeled competitors are given in Supplemental Table 2 online.

Immunoblot

Fourteen-day-old seedlings were incubated in liquid Murashige andSkoog medium containing 10 mM b-estradiol (control treatment: 0.1%ethanol). The seedlings were kept on a rotary shaker for 1, 2, 4, and 6 h,harvested, and after removal of the roots immediately frozen in liquidnitrogen. Total protein was extracted from seedlings essentially as de-scribed (Martínez-García et al., 1999). Proteins (15 µg) were separated on12% polyacrylamide SDS gels and transferred to Protran nitrocellulose

membrane (Whatman). Immunoblot analysis was performed as described(Dortay and Mueller-Roeber, 2010) using goat polyclonal IgG primaryantibody directed against ACO (aE-18; Santa Cruz Biotechnology) andIRDye800CW donkey anti-goat IgG secondary antibody (LI-COR). Signalintensities were analyzed at 800 nm using the Odyssey Infrared ImagingSystem (LI-COR).

In Vivo Binding of SHYG to the ACO5 Promoter

ChIP followed byqPCR (ChIP-qPCR)was performedwith whole shoots fromshort-day-grown, 35-d-old Arabidopsis plants expressing GFP-taggedSHYG protein from the CaMV 35S promoter (35S:SHYG-GFP). Wild-typeplants were used as negative control. ChIP was performed as described(Kaufmann et al., 2010) using an anti-GFP antibody. The experiment was runin two independent replications with three technical replications per assay.Equal amounts of starting plant material and ChIP products were used forPCR reactions. Primers used for qPCR flanked the SHYG binding site withinthe ACO5 promoter. As a negative control, we used primers annealing toa promoter region of an Arabidopsis gene (At1g75820) lacking a SHYGbinding site. Primers are listed in Supplemental Table 2 online. ChIP-qPCRdata analysis was performed as described (Wu et al., 2012).

Waterlogging Experiments

Seedlingswere grown in soil in a climate-controlled chamberwith an 8-h lightperiod (short-day condition) provided by fluorescent light at;100 µmol m22

s21 and day/night temperatures of 20/16°C and RH of 60/75%. After 2weeks, seedlings were transferred to a growth chamber with a 16-h lightperiod (long-day condition) providedby fluorescent light at 120 µmolm22 s21

and day/night temperatures of 22/16°C and 60/75%RH. For all waterloggingexperiments, 30-d-old plants were used. Root flooding was started (t = 0 h) 6h after the beginning of the photoperiod to prevent against the effect ofdiurnal leaf movement. Plants grown individually in pots (height 5.6 cm) withorganic potting mix were placed inside plastic tanks (45 cm:27 cm:5 cm,length:width:height) andwere exposed to floodingwith tapwater by filling upto 5 cm such that the upper water level always remained below the pot upperedge. For control treatments, plants were put inside the tanks withoutflooding. To assess natural variation ofwaterlogging-induced hyponastic leafmovement in Arabidopsis, accession Cvi-0 (low tolerance to flooding) wascompared with Col-0 (intermediate tolerance) (Vashisht et al., 2011).

Treatment with ET Synthesis Inducers and Signaling Modifiers

To determine whether ACC or 2-chloroethylphosphonic acid (ethephon)promotes waterlogging-induced hyponastic leaf movement, shoots weresprayed with 10mM each compound (in aqueous solution containing 0.1%Tween 20) 4 h before flooding. The aqueous solution containing 0.1%Tween 20 was used in control treatments. To test the effect of ET bio-synthesis and signaling inhibitors on waterlogging-induced leaf move-ments, plants were sprayed with 10 mM AIB (ACO inhibitor) or 10 mMAgNO3 (ET signaling inhibitor). To evaluate whether AgNO3 reverses eth-ephon-promoted waterlogging-induced hyponastic leaf movement, plantswere sprayed with 10 mM ethephon and 10 mM AgNO3 in combination. Allchemicals were from Sigma-Aldrich.

Petiole Angle Measurements

In the intact plants, leaf hyponastic movements were recorded using high-resolution digital images of rosette leaves captured using time-lapsephotography on a Color Box charge-coupled device Camera XC621(X-Core), at a rate of one frame per 20 s. Quantitative measurements ofpetiole angle kinetics from the adaxial surface of the petiole relative to thehorizontal plane were obtained on the digital images by drawing a straightline from the petiole base using the freeware algorithm ImageJ version

SHYG Controls Hyponastic Leaf Movement 11 of 15

1.46n (http://imagej.nih.gov/ij/). For all plants, three or more petioles weremeasured, and the mean value was used for further analysis. In order tocorrect for diurnal and circadian effects on leaf movements, values ofdifferential petiole angles were obtained by pairwise subtraction in all cases.This was done by calculating the differences between the absolute petioleangles of treated and control plants for each time point separately. Absolutepetiole angles are defined as the angle between the horizontal and thepetiole/lamina junction through the base of the petiole in the rosette center(Salter et al., 2003; Benschop et al., 2007).

Epidermal Cell Length Measurements

Epidermal imprints along the abaxial and adaxial epidermal surfaces of leafpetioles before and after waterlogging were obtained by agarose impres-sions (Mathur and Koncz, 1997). To this end, 1-cm-long proximal petioleregions close to the stem were placed in 3% molten agarose and carefullyremoved from the solidified carrier before taking microscopic photographs.When dried, the thin film of gel was placed onto a microscopic slide andobserved under an M125 stereomicroscope (Leica). Cell length measure-ments were performed on 5-mm-long segments of the abaxial and adaxialsurfaces of the leaf petiole proximal to the stem using laser absorptionspectrometry Live-Measurement software (Leica). To allow calculations ofaverage cell sizes relative to the distance from the stem along the petiole,each cell was assigned to a 200-µmclass, depending on its position relativeto the most proximal part of the petiole.

GUS Assays in Twinned SHYG-IOE and ProSHYG:GUS Seedlings

Two-week-old SHYG-IOE and ProSHYG:GUS seedlings were pooled to-gether in a tightly sealed deep-well plate to ensure the capture of ETproduced by SHYG-IOE plants inside the wells after b-estradiol induction(see Supplemental Figure 8 online). SHYG expression in SHYG:IOEseedlings was induced by 10 µM b-estradiol for 0, 6, 12, and 24 h (mocktreatment: 0.1% ethanol). GUS activity in the ProSHYG:GUS seedlings wasdetermined histochemically and quantified by spectrophotometric assay.AIB (10 mM) was used to block ACO activity.

Other Methods

The histochemical assay for GUS activity was performed according toJefferson et al. (1987). Quantitative GUS assays using p-nitrophenyl glu-curonide were performed as described (Wilson et al., 1992; Subramaniamet al., 2009). For GUS staining in petioles ofProSHYG:GUS rosette leaves (seeSupplemental Figure 6A online), waterlogging was performed for 8 h. AfterGUS staining, rosettes were submerged in 70% ethanol to remove chlo-rophyll. Free-hand cross section through the petiole region proximal to thebase was performed by cutting with a sharp razor blade. Sections werecleared in 8:2:1 (chloral hydrate:glycerol:water) before microscopy analysis.

Microscopy

Distribution of SHYG-GFP fusion protein was analyzed by confocalfluorescence microscopy using an Eclipse E600 microscope (Nikon).

Statistical Analyses

Statistical analyses were performed using Student’s t test embedded inthe Microsoft Excel software. Only the return of P < 0.05 was taken asstatistically significant.

Accession Numbers

Sequence data from this article can be found in the Arabidopsis GenomeInitiative or GenBank/EMBL databases under the following accession

numbers: SHYG (At3g04070),ACO5 (At1g77330), At-EXPA8 (At2g40610),and At-EXPA11 (At1g20190). Microarray data (SHYG-IOE-5h) are avail-able at the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/) underaccession number GSE38721.

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure 1. Confirmation of T-DNA Insertions in shyg-1,shyg-2, aco5-1, and aco5-2 Mutants.

Supplemental Figure 2. Nuclear Localization of SHYG-GFP FusionProtein in Transgenic Arabidopsis.

Supplemental Figure 3. Schematic Presentation of Predicted SHYGBinding Sites in the ACO5 Promoter and Recombinant SHYG-GSTProtein Used for EMSA.

Supplemental Figure 4. Hyponastic Leaf Growth in 4-Week-Old Wild-Type and shyg-1 Mutant Plants upon Waterlogging.

Supplemental Figure 5. Hyponastic Leaf Movement in SHYG- andACO5-Modified Plants.

Supplemental Figure 6. Gene Expression in Proximal Petiole Region.

Supplemental Figure 7. Quantitative Measurements for AbsoluteAngles of Leaf Petiole Kinetics Obtained Using a Time-Lapse DigitalCamera Setup.

Supplemental Figure 8. Schematic Representation of the Experimen-tal Setup of the Twinned-Seedling Experiment.

Supplemental Figure 9. Hyponastic Leaf Movement in ArabidopsisAccessions Col-0 and Cvi-0.

Supplemental Table 1. Genes Affected by SHYG.

Supplemental Table 2. Constructs and Primer Sequences.

Supplemental Table 3. Sequences of Primers Used for ExpressionProfiling by qRT-PCR.

Supplemental Movie 1. Time-Lapse Video of Waterlogging-InducedHyponastic Leaf Growth in 35S:SHYG, Wild-Type, and shyg-2 Plants.

Supplemental Movie 2. Time-Lapse Video of Waterlogging-InducedHyponastic Leaf Growth in shyg-1, Wild-Type, and shyg-2 Plants.

Supplemental Movie 3. Time-Lapse Video of Waterlogging-InducedHyponastic Leaf Growth in aco5-1, aco5-2, and Wild-Type Plants.

Supplemental Movie 4. Time-Lapse Video of Waterlogging-InducedHyponastic Leaf Growth in 35S-SHYG/aco5-1, Wild-Type, and 35S:SHYG-GFP/aco5-2 Plants.

ACKNOWLEDGMENTS

We thank Eugenia Maximova for microscopy assistance, Josef Bergsteinfor photographic work, and Karin Koehl and colleagues for plant care.Financial support was provided by the Deutsche Forschungsgemein-schaft (MU 1199/14-1).

AUTHOR CONTRIBUTIONS

B.M.-R. initiated the research. B.M.-R., S.B., M.R., and M.A. designed theexperiments. M.R. and M.A. conducted the experiments. G.-P.X. per-formed the binding site selection assay. J.F. provided expertise in time-lapse video imaging. B.M.-R., M.R., and S.B. prepared the article with inputfrom all the authors.

12 of 15 The Plant Cell

Received August 27, 2013; revised November 9, 2013; acceptedNovember 30, 2013; published December 20, 2013.

REFERENCES

Arvidsson, S., Kwasniewski, M., Riaño-Pachón, D.M., and Mueller-Roeber, B. (2008). QuantPrime—A flexible tool for reliable high-throughput primer design for quantitative PCR. BMC Bioinformatics9: 465.

Bailey-Serres, J., and Voesenek, L.A.C.J. (2008). Flooding stress:Acclimations and genetic diversity. Annu. Rev. Plant Biol. 59: 313–339.

Balazadeh, S., Kwasniewski, M., Caldana, C., Mehrnia, M., Zanor, M.I.,Xue, G.P., and Mueller-Roeber, B. (2011). ORS1, an H₂O₂-responsiveNAC transcription factor, controls senescence in Arabidopsis thaliana.Mol. Plant 4: 346–360.

Balazadeh, S., Riaño-Pachón, D.M., and Mueller-Roeber, B. (2008).Transcription factors regulating leaf senescence in Arabidopsis thaliana.Plant Biol. (Stuttg.) 10 (suppl. 1): 63–75.

Balazadeh, S., Siddiqui, H., Allu, A.D., Matallana-Ramirez, L.P.,Caldana, C., Mehrnia, M., Zanor, M.I., Köhler, B., and Mueller-Roeber, B. (2010). A gene regulatory network controlled by the NACtranscription factor ANAC092/AtNAC2/ORE1 during salt-promotedsenescence. Plant J. 62: 250–264.

Banga, M., Slaa, E.J., Blom, C.W.P.M., and Voesenek, L.A.C.J.(1996). Ethylene biosynthesis and accumulation under drained andsubmerged conditions (a comparative study of two Rumex species).Plant Physiol. 112: 229–237.

Benschop, J.J., Millenaar, F.F., Smeets, M.E., van Zanten, M.,Voesenek, L.A.C.J., and Peeters, A.J. (2007). Abscisic acidantagonizes ethylene-induced hyponastic growth in Arabidopsis.Plant Physiol. 143: 1013–1023.

Berger, Y., Harpaz-Saad, S., Brand, A., Melnik, H., Sirding, N.,Alvarez, J.P., Zinder, M., Samach, A., Eshed, Y., and Ori, N.(2009). The NAC-domain transcription factor GOBLET specifies leafletboundaries in compound tomato leaves. Development 136: 823–832.

Bradford, K.J., and Yang, S.F. (1980). Xylem transport of 1-aminocyclopropane-1-carboxylic acid, an ethylene precursor, inwaterlogged tomato plants. Plant Physiol. 65: 322–326.

Burrows, W.J., and Carr, D.J. (1969). Effects of flooding the rootsystem of sunflower plants on the cytokinin content of the xylemsap. Plant Physiol. 22: 1105–1112.

Caldana, C., Scheible, W.R., Mueller-Roeber, B., and Ruzicic, S.(2007). A quantitative RT-PCR platform for high-throughput expressionprofiling of 2500 rice transcription factors. Plant Methods 3: 7.

Chang, K.N., et al. (2013). Temporal transcriptional response to ethylene gasdrives growth hormone cross-regulation in Arabidopsis. Elife 2: e00675.

Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., andEcker, J.R. (1997). Activation of the ethylene gas response pathway inArabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and relatedproteins. Cell 89: 1133–1144.

Cho, H.T., and Kende, H. (1997). Expression of expansin genes iscorrelated with growth in deepwater rice. Plant Cell 9: 1661–1671.

Cosgrove, D.J. (2000). Loosening of plant cell walls by expansins.Nature 407: 321–326.

Cox, M.C.H., Millenaar, F.F., Van Berkel, Y.E.M.D.J., Peeters, A.J.M.,and Voesenek, L.A.C.J. (2003). Plant movement. Submergence-inducedpetiole elongation in Rumex palustris depends on hyponastic growth.Plant Physiol. 132: 282–291.

Dortay, H., Akula, U.M., Westphal, C., Sittig, M., and Mueller-Roeber, B. (2011). High-throughput protein expression usinga combination of ligation-independent cloning (LIC) and infraredfluorescent protein (IFP) detection. PLoS ONE 6: e18900.

Dortay, H., and Mueller-Roeber, B. (2010). A highly efficient pipelinefor protein expression in Leishmania tarentolae using infrared fluorescenceprotein as marker. Microb. Cell Fact. 9: 29.

Duval, M., Hsieh, T.F., Kim, S.Y., and Thomas, T.L. (2002). Molecularcharacterization of AtNAM: A member of the Arabidopsis NAC domainsuperfamily. Plant Mol. Biol. 50: 237–248.

Fujita, M., Fujita, Y., Maruyama, K., Seki, M., Hiratsu, K., Ohme-Takagi,M., Tran, L.S.P., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2004).A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 39: 863–876.

Guo, H., and Ecker, J.R. (2003). Plant responses to ethylene gas aremediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3transcription factor. Cell 115: 667–677.

Guo, Y., and Gan, S. (2006). AtNAP, a NAC family transcription factor,has an important role in leaf senescence. Plant J. 46: 601–612.

Hattori, Y., Nagai, K., and Ashikari, M. (2011). Rice growth adaptingto deepwater. Curr. Opin. Plant Biol. 14: 100–105.

Hattori, Y., et al. (2009). The ethylene response factors SNORKEL1 andSNORKEL2 allow rice to adapt to deep water. Nature 460: 1026–1030.

Hickman, R., et al. (2013). A local regulatory network around threeNAC transcription factors in stress responses and senescence inArabidopsis leaves. Plant J. 75: 26–39.

Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q., and Xiong, L.(2006). Overexpressing a NAM, ATAF, and CUC (NAC) transcriptionfactor enhances drought resistance and salt tolerance in rice. Proc.Natl. Acad. Sci. USA 103: 12987–12992.

Huynh, N., Vantoai, T., Streeter, J., and Banowetz, G. (2005).Regulation of flooding tolerance of SAG12:ipt Arabidopsis plants bycytokinin. J. Exp. Bot. 56: 1397–1407.

Jackson, M.B. (2008). Ethylene-promoted elongation: An adaptationto submergence stress. Ann. Bot. (Lond.) 101: 229–248.

Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUSfusions: Beta-glucuronidase as a sensitive and versatile gene fusionmarker in higher plants. EMBO J. 6: 3901–3907.

Jensen, M.K., Hagedorn, P.H., de Torres-Zabala, M., Grant, M.R., Rung,J.H., Collinge, D.B., and Lyngkjaer, M.F. (2008). Transcriptional regulationby an NAC (NAM-ATAF1,2-CUC2) transcription factor attenuates ABAsignalling for efficient basal defence towards Blumeria graminis f. sp. hordeiin Arabidopsis. Plant J. 56: 867–880.

Jeong, J.S., Kim, Y.S., Baek, K.H., Jung, H., Ha, S.H., Do Choi, Y.,Kim, M., Reuzeau, C., and Kim, J.K. (2010). Root-specificexpression of OsNAC10 improves drought tolerance and grain yieldin rice under field drought conditions. Plant Physiol. 153: 185–197.

Jung, K.H., Seo, Y.S., Walia, H., Cao, P., Fukao, T., Canlas, P.E.,Amonpant, F., Bailey-Serres, J., and Ronald, P.C. (2010). Thesubmergence tolerance regulator Sub1A mediates stress-responsiveexpression of AP2/ERF transcription factors. Plant Physiol. 152:1674–1692.

Kaufmann, K., Muiño, J.M., Østerås, M., Farinelli, L., Krajewski, P., andAngenent, G.C. (2010). Chromatin immunoprecipitation (ChIP) of planttranscription factors followed by sequencing (ChIP-SEQ) or hybridizationto whole genome arrays (ChIP-CHIP). Nat. Protoc. 5: 457–472.

Kende, H., Bradford, K.K., Brummell, D.A., Cho, H.T., Cosgrove, D.J.,Fleming, A.J., Gehring, C., Lee, Y., McQueen-Mason, S., Rose, J.K.C.,and Voesenek, L.A.C.J. (2004). Nomenclature for members of theexpansin superfamily of genes and proteins. Plant Mol. Biol. 55: 311–314.

Kim, J.H., Cho, H.T., and Kende, H. (2000). Alpha-expansins in thesemiaquatic ferns Marsilea quadrifolia and Regnellidium diphyllum:Evolutionary aspects and physiological role in rachis elongation.Planta 212: 85–92.

Kim, J.H., Woo, H.R., Kim, J., Lim, P.O., Lee, I.C., Choi, S.H., Hwang, D.,and Nam, H.G. (2009). Trifurcate feed-forward regulation of age-dependentcell death involving miR164 in Arabidopsis. Science 323: 1053–1057.

SHYG Controls Hyponastic Leaf Movement 13 of 15

Li, P., Wind, J.J., Shi, X., Zhang, H., Hanson, J., Smeekens, S.C., andTeng, S. (2011). Fructose sensitivity is suppressed in Arabidopsis by thetranscription factor ANAC089 lacking the membrane-bound domain.Proc. Natl. Acad. Sci. USA 108: 3436–3441.

Lee, S., Seo, P.J., Lee, H.J., and Park, C.M. (2012). A NAC transcriptionfactor NTL4 promotes reactive oxygen species production duringdrought-induced leaf senescence in Arabidopsis. Plant J. 70:831–844.

Lee, S.C., Mustroph, A., Sasidharan, R., Vashisht, D., Pedersen, O.,Oosumi, T., Voesenek, L.A.C.J., and Bailey-Serres, J. (2011).Molecular characterization of the submergence response of theArabidopsis thaliana ecotype Columbia. New Phytol. 190: 457–471.

Licausi, F., Weits, D.A., Pant, B.D., Scheible, W.R., Geigenberger,P., and van Dongen, J.T. (2011). Hypoxia responsive geneexpression is mediated by various subsets of transcription factorsand miRNAs that are determined by the actual oxygen availability.New Phytol. 190: 442–456.

Lin, Z., Zhong, S., and Grierson, D. (2009). Recent advances inethylene research. J. Exp. Bot. 60: 3311–3336.

Linkies, A., Müller, K., Morris, K., Turecková, V., Wenk, M.,Cadman, C.S., Corbineau, F., Strnad, M., Lynn, J.R., Finch-Savage, W.E., and Leubner-Metzger, G. (2009). Ethylene interactswith abscisic acid to regulate endosperm rupture duringgermination: a comparative approach using Lepidium sativum andArabidopsis thaliana. Plant Cell 21: 3803–3822.

Lu, P.L., Chen, N.Z., An, R., Su, Z., Qi, B.S., Ren, F., Chen, J., andWang, X.C. (2007). A novel drought-inducible gene, ATAF1,encodes a NAC family protein that negatively regulates the expressionof stress-responsive genes in Arabidopsis. Plant Mol. Biol. 63:289–305.

Martínez-García, J.F., Monte, E., and Quail, P.H. (1999). A simple,rapid and quantitative method for preparing Arabidopsis proteinextracts for immunoblot analysis. Plant J. 20: 251–257.

Mathur, J., and Koncz, C. (1997). Method for preparation ofepidermal imprints using agarose. Biotechniques 22: 280–282.

Millenaar, F.F., Cox, M.C.H., van Berkel, Y.E.M.D.J., Welschen, R.A.M., Pierik, R., Voesenek, L.A.C.J., and Peeters, A.J.M. (2005).Ethylene-induced differential growth of petioles in Arabidopsis.Analyzing natural variation, response kinetics, and regulation. PlantPhysiol. 137: 998–1008.

Nishitani, K., and Vissenberg, K. (2007). Roles of the XTH proteinfamily in the expanding cell. In The Expanding Cell. Plant CellMonographs, Vol. 5, Verbelen, J.-P., and Vissenberg, K., eds(Berlin: Springer), pp. 89–116.

Nuruzzaman, M., Manimekalai, R., Sharoni, A.M., Satoh, K.,Kondoh, H., Ooka, H., and Kikuchi, S. (2010). Genome-wideanalysis of NAC transcription factor family in rice. Gene 465: 30–44.

Ogo, Y., Kobayashi, T., Nakanishi Itai, R., Nakanishi, H., Kakei, Y.,Takahashi, M., Toki, S., Mori, S., and Nishizawa, N.K. (2008). Anovel NAC transcription factor, IDEF2, that recognizes the irondeficiency-responsive element 2 regulates the genes involved iniron homeostasis in plants. J. Biol. Chem. 283: 13407–13417.

Olsen, A.N., Ernst, H.A., Leggio, L.L., and Skriver, K. (2005). NACtranscription factors: Structurally distinct, functionally diverse.Trends Plant Sci. 10: 79–87.

Ooka, H., et al. (2003). Comprehensive analysis of NAC family genesin Oryza sativa and Arabidopsis thaliana. DNA Res. 10: 239–247.

Ouaked, F., Rozhon, W., Lecourieux, D., and Hirt, H. (2003). AMAPK pathway mediates ethylene signaling in plants. EMBO J. 22:1282–1288.

Peng, H.P., Lin, T.Y., Wang, N.N., and Shih, M.C. (2005). Differentialexpression of genes encoding 1-aminocyclopropane-1-carboxylatesynthase in Arabidopsis during hypoxia. Plant Mol. Biol. 58: 15–25.

Pierik, R., Millenaar, F.F., Peeters, A.J.M., and Voesenek, L.A.C.J.(2005). New perspectives in flooding research: The use of shadeavoidance and Arabidopsis thaliana. Ann. Bot. (Lond.) 96: 533–540.

Polko, J.K., Pierik, R., van Zanten, M., Tarkowská, D., Strnad, M.,Voesenek, L.A.C.J., and Peeters, A.J. (2013). Ethylene promoteshyponastic growth through interaction with ROTUNDIFOLIA3/CYP90C1 in Arabidopsis. J. Exp. Bot. 64: 613–624.

Polko, J.K., van Zanten, M., van Rooij, J.A., Marée, A.F.M.,Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik, R. (2012).Ethylene-induced differential petiole growth in Arabidopsis thalianainvolves local microtubule reorientation and cell expansion. NewPhytol. 193: 339–348.

Polko, J.K., Voesenek, L.A.C.J., Peeters, A.J., and Pierik, R. (2011).Petiole hyponasty: An ethylene-driven, adaptive response to changes inthe environment. AoB Plants 2011: plr031.

Puranik, S., Sahu, P.P., Mandal, S.N., B, V.S., Parida, S.K., andPrasad, M. (2013). Comprehensive genome-wide survey, genomicconstitution and expression profiling of the NAC transcription factorfamily in foxtail millet (Setaria italica L.). PLoS ONE 8: e64594.

Rauf, M., Arif, M., Dortay, H., Matallana-Ramírez, L.P., Waters, M.T.,Nam, H.G., Lim, P.O., Mueller-Roeber, B., and Balazadeh, S. (2013).ORE1 balances leaf senescence against maintenance by antagonizingG2-like-mediated transcription. EMBO Rep. 14: 382–388.

Roman, G., Lubarsky, B., Kieber, J.J., Rothenberg, M., and Ecker,J.R. (1995). Genetic analysis of ethylene signal transduction inArabidopsis thaliana: Five novel mutant loci integrated into a stressresponse pathway. Genetics 139: 1393–1409.

Rose, J.K.C., Braam, J., Fry, S.C., and Nishitani, K. (2002). The XTHfamily of enzymes involved in xyloglucan endotransglucosylationand endohydrolysis: Current perspectives and a new unifyingnomenclature. Plant Cell Physiol. 43: 1421–1435.

Salter, M.G., Franklin, K.A., and Whitelam, G.C. (2003). Gating of therapid shade-avoidance response by the circadian clock in plants.Nature 426: 680–683.

Sambrook, J., Fritsche, E.F., and Maniatis, T. (2001). MolecularCloning: A Laboratory Manual, 3rd ed. (Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press).

Schaller, G.E. (2012). Ethylene and the regulation of plant development.BMC Biol. 10: 9.

Schaller, G.E., and Kieber, J.J. (2002). Ethylene. The ArabidopsisBook 1: e0071, doi/10.1199/tab.0071.

Seo, P.J., Kim, S.G., and Park, C.M. (2008). Membrane-boundtranscription factors in plants. Trends Plant Sci. 13: 550–556.

Shahnejat-Bushehri, S., Mueller-Roeber, B., and Balazadeh, S.(2012). Arabidopsis NAC transcription factor JUNGBRUNNEN1affects thermomemory-associated genes and enhances heat stresstolerance in primed and unprimed conditions. Plant Signal. Behav.7: 1518–1521.

Singh, A.K., Sharma, V., Pal, A.K., Acharya, V., and Ahuja, P.S.(2013). Genome-wide organization and expression profiling of theNAC transcription factor family in potato (Solanum tuberosum L.).DNA Res. 20: 403–423.

Skirycz, A., Reichelt, M., Burow, M., Birkemeyer, C., Rolcik, J.,Kopka, J., Zanor, M.I., Gershenzon, J., Strnad, M., Szopa, J.,Mueller-Roeber, B., and Witt, I. (2006). DOF transcription factorAtDof1.1 (OBP2) is part of a regulatory network controlling glucosinolatebiosynthesis in Arabidopsis. Plant J. 47: 10–24.

Stepanova, A.N., and Alonso, J.M. (2009). Ethylene signaling andresponse: Where different regulatory modules meet. Curr. Opin. PlantBiol. 12: 548–555.

Subramaniam, S., Balasubramaniam, V., Poobathy, R., Sreenivasan,S., and Rathinam, X. (2009). Chemotaxis movement and attachment ofAgrobacterium tumefaciens to Phalaenopsis violacea orchid tissues: An

14 of 15 The Plant Cell

assessment of early factors influencing the efficiency of gene transfer.Trop. Life Sci. Res. 20: 39–49.

Tran, L.S.P., Nakashima, K., Sakuma, Y., Simpson, S.D., Fujita, Y.,Maruyama, K., Fujita, M., Seki, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2004). Isolation and functional analysis of Arabidopsisstress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1promoter. Plant Cell 16: 2481–2498.

Trought, M.C.T., andDrew, M.C. (1980). The development of waterloggingdamage in wheat seedlings (Triticum aestivum L.). I. Shoot and rootgrowth in relation to changes in the concentrations of dissolved gasesand solutes in the soil solution. Plant Soil 54: 77–94.

Uauy, C., Distelfeld, A., Fahima, T., Blechl, A., and Dubcovsky, J.(2006). A NAC gene regulating senescence improves grain protein,zinc, and iron content in wheat. Science 314: 1298–1301.

Van Sandt, V.S.T., Suslov, D., Verbelen, J.P., and Vissenberg, K.(2007). Xyloglucan endotransglucosylase activity loosens a plantcell wall. Ann. Bot. (Lond.) 100: 1467–1473.

VanToai, T.T., Beuerlein, J.E., Schmitthenner, A.F., and St. Martin,K.S. (1994). Genetic variability for flooding tolerance in soybeans.Crop Sci. 34: 1112–1115.

van Zanten, M., Ritsema, T., Polko, J.K., Leon-Reyes, A.,Voesenek, L.A.C.J., Millenaar, F.F., Pieterse, C.M.J., andPeeters, A.J.M. (2012). Modulation of ethylene- and heat-controlledhyponastic leaf movement in Arabidopsis thaliana by the plant defencehormones jasmonate and salicylate. Planta 235: 677–685.

Vashisht, D., Hesselink, A., Pierik, R., Ammerlaan, J.M.H., Bailey-Serres, J., Visser, E.J., Pedersen, O., van Zanten, M., Vreugdenhil,D., Jamar, D.C.L., Voesenek, L.A.C.J., and Sasidharan, R. (2011).Natural variation of submergence tolerance among Arabidopsis thalianaaccessions. New Phytol. 190: 299–310.

Voesenek, L.A.C.J., Benschop, J.J., Bou, J., Cox, M.C.H., Groeneveld,H.W., Millenaar, F.F., Vreeburg, R.A.M., and Peeters, A.J.M. (2003).Interactions between plant hormones regulate submergence-inducedshoot elongation in the flooding-tolerant dicot Rumex palustris. Ann.Bot. (Lond.) 91 (Spec. No.): 205–211.

Voesenek, L.A.C.J., Colmer, T.D., Pierik, R., Millenaar, F.F., andPeeters, A.J.M. (2006). How plants cope with complete submergence.New Phytol. 170: 213–226.

Vreeburg, R.A.M., Benschop, J.J., Peeters, A.J.M., Colmer, T.D.,Ammerlaan, A.H.M., Staal, M., Elzenga, T.M., Staals, R.H.J.,Darley, C.P., McQueen-Mason, S.J., and Voesenek, L.A.C.J.(2005). Ethylene regulates fast apoplastic acidification and expansinA transcription during submergence-induced petiole elongation inRumex palustris. Plant J. 43: 597–610.

Vriezen, W.H., Hulzink, R., Mariani, C., and Voesenek, L.A.C.J.(1999). 1-Aminocyclopropane-1-carboxylate oxidase activity limitsethylene biosynthesis in Rumex palustris during submergence.Plant Physiol. 121: 189–196.

Wang, X., Basnayake, B.M.V.S., Zhang, H., Li, G., Li, W., Virk, N.,Mengiste, T., and Song, F. (2009). The Arabidopsis ATAF1, a NACtranscription factor, is a negative regulator of defense responsesagainst necrotrophic fungal and bacterial pathogens. Mol. PlantMicrobe Interact. 22: 1227–1238.

Wilson, K.J., Hughes, S.G., and Jefferson, R.A. (1992). TheEscherichia coli gus operon, induction and expression of the gusoperon in E. coli and the occurrence and use of GUS in otherbacteria. In GUS Protocols: Using the GUS Gene as a Reporter ofGene Expression, S. Gallagher, ed (New York: Academic Press),pp. 7–23.

Wu, A., et al. (2012). JUNGBRUNNEN1, a reactive oxygen species-responsive NAC transcription factor, regulates longevity in Arabidopsis.Plant Cell 24: 482–506.

Wu, Y., Deng, Z., Lai, J., Zhang, Y., Yang, C., Yin, B., Zhao, Q.,Zhang, L., Li, Y., Yang, C., and Xie, Q. (2009). Dual function ofArabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res.19: 1279–1290.

Xu, K., Xu, X., Fukao, T., Canlas, P., Maghirang-Rodriguez, R.,Heuer, S., Ismail, A.M., Bailey-Serres, J., Ronald, P.C., andMackill, D.J. (2006). Sub1A is an ethylene-response-factor-likegene that confers submergence tolerance to rice. Nature 442:705–708.

Xue, G.P. (2002). Characterisation of the DNA-binding profile of barleyHvCBF1 using an enzymatic method for rapid, quantitative andhigh-throughput analysis of the DNA-binding activity. Nucleic AcidsRes. 30: e77.

Xue, G.P. (2005). A CELD-fusion method for rapid determination of theDNA-binding sequence specificity of novel plant DNA-binding proteins.Plant J. 41: 638–649.

Xue, G.P., Bower, N.I., McIntyre, C.L., Riding, G.A., Kazan, K., andShorter, R. (2006). TaNAC69 from the NAC superfamily of transcriptionfactors is up-regulated by abiotic stresses in wheat and recognisestwo consensus DNA-binding sequences. Funct. Plant Biol. 33:43–57.

Yamaguchi, M., Ohtani, M., Mitsuda, N., Kubo, M., Ohme-Takagi,M., Fukuda, H., and Demura, T. (2010). VND-INTERACTING2, a NACdomain transcription factor, negatively regulates xylem vessel formationin Arabidopsis. Plant Cell 22: 1249–1263.

Yang, S.D., Seo, P.J., Yoon, H.K., and Park, C.M. (2011). TheArabidopsis NAC transcription factor VNI2 integrates abscisic acidsignals into leaf senescence via the COR/RD genes. Plant Cell 23:2155–2168.

Yang, S.F., and Hoffmann, N.E. (1984). Ethylene biosynthesis and itsregulation in higher plants. Annu. Rev. Plant Physiol. 35: 155–189.

Zhang, J., VanToai, T.T., Huynh, L.N., and Preiszner, J. (2000).Flooding tolerance of transgenic Arabidopsis plants containing theautoregulated cytokinin biosynthesis system. Mol. Breed. 6: 135–144.

Zhong, R., Lee, C., and Ye, Z.H. (2010). Global analysis of directtargets of secondary wall NAC master switches in Arabidopsis. Mol.Plant 3: 1087–1103.

Zhong, R., McCarthy, R.L., Lee, C., and Ye, Z.H. (2011). Dissectionof the transcriptional program regulating secondary wall biosynthesisduring wood formation in poplar. Plant Physiol. 157: 1452–1468.

Zuo, J., Niu, Q.W., and Chua, N.H. (2000). Technical advance: Anestrogen receptor-based transactivator XVE mediates highlyinducible gene expression in transgenic plants. Plant J. 24: 265–273.

SHYG Controls Hyponastic Leaf Movement 15 of 15

DOI 10.1105/tpc.113.117861; originally published online December 20, 2013;Plant Cell

Mueller-RoeberMamoona Rauf, Muhammad Arif, Joachim Fisahn, Gang-Ping Xue, Salma Balazadeh and Bernd

ArabidopsisMovement in NAC Transcription Factor SPEEDY HYPONASTIC GROWTH Regulates Flooding-Induced Leaf

 This information is current as of January 6, 2019

 

Supplemental Data /content/suppl/2013/12/11/tpc.113.117861.DC1.html /content/suppl/2013/12/19/tpc.113.117861.DC2.html

Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists