NIH Public Access *,†, †, Xiaohui Cui Marion Vogel Charles...

Targeting a DNA Binding Motif of the EVI1 Protein by a Pyrrole–Imidazole Polyamide

Yi Zhang*,†,∥, Géraldine Sicot†,∥, Xiaohui Cui†, Marion Vogel†, Charles A. Wuertzer†,Kimberly Lezon-Geyda‡, John Wheeler‡, Daniel A. Harki§,⊥, Katy A. Muzikar§, Daniel A.Stolper, Peter B. Dervan§, and Archibald S. Perkins*,†

†Department of Pathology and Lab Medicine, University of Rochester Medical Center, 601Elmwood Avenue, Rochester, New York 14642, United States‡Department of Pathology, Yale School of Medicine, New Haven, Connecticut 06510, UnitedStates§Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena,California 91125, United States

Abstract

The zinc finger protein EVI1 is causally associated with acute myeloid leukemogenesis, andinhibition of its function with a small molecule therapeutic may provide effective therapy forEVI1-expressing leukemias. In this paper we describe the development of a pyrrole–imidazolepolyamide to specifically block EVI1 binding to DNA. We first identify essential domains forleukemogenesis through structure–function studies on both EVI1 and the t(3;21)(q26;q22)-derivedRUNX1-MDS1-EVI1 (RME) protein, which revealed that DNA binding to the cognate motifGACAAGATA via the first of two zinc finger domains (ZF1, encompassing fingers 1–7) isessential transforming activity. To inhibit DNA binding via ZF1, we synthesized a pyrrole–imidazole polyamide 1, designed to bind to a subsite within the GACAAGATA motif and therebyblock EVI1 binding. DNase I footprinting and electromobility shift assays revealed a specific andhigh affinity interaction between polyamide 1 and the GACAAGATA motif. In an in vivo CATreporter assay using NIH-3T3-derived cell line with a chromosome-embedded tetinducible EVI1-VP16 as well as an EVI1-responsive reporter, polyamide 1 completely blocked EVI1-responsivereporter activity. Growth of a leukemic cell line bearing overexpressed EVI1 was also inhibited bytreatment with polyamide 1, while a control cell line lacking EVI1 was not. Finally, colony

© 2011 American Chemical Society*Corresponding Author Phone: 585 276-3399. Fax: 585 756-4468. [email protected].⊥Present AddressUniversity of Minnesota, Minneapolis, MN.∥NotesCo-first authors.

Supporting InformationFigure S1: intermediate compounds in polyamide synthesis. Shown is the base polyamide structure from which the IPA and FITCderivatives were synthesized; compounds 5 and 6 correspond to the base polyamide with the side chain modifications indicated. Thismaterial is available free of charge via the Internet at http://pubs.acs.org.

NIH Public AccessAuthor ManuscriptBiochemistry. Author manuscript; available in PMC 2013 April 08.

Published in final edited form as:Biochemistry. 2011 December 6; 50(48): 10431–10441. doi:10.1021/bi200962u.

NIH

-PA Author Manuscript

NIH


NIH


http://pubs.acs.org

formation by RME was attenuated by polyamide 1 in a serial replating assay. These studiesprovide evidence that a cell permeable small molecule may effectively block the activity of aleukemogenic transcription factor and provide a valuable tool to dissect critical functions of EVI1in leukemogenesis.

The EVI1 gene was first identified as a site of proviral insertion in retrovirally inducedmurine myeloid leukemias, which resulted in activation of the gene with overexpression ofat least three different isoforms, p135, p123, and p103, that possess varying numbers ofC2H2-type zinc fingers. The p135 and p123 isoforms possess 10 zinc finger motifs in twodomains separated by 480 amino acids, suggesting a role in transcriptional regulation. TheN-terminally located zinc finger domain 1 (termed ZF1, and encompassing fingers 1–7;amino acids 1–249) binds specifically to GACAAGATA-like sequences;1,2 domain 2 bindsGAAGATGAG motif.3 Transformation assays have shown that the Nterminal, but not theC-terminal, region is required for transforming activity.4 Transfection assays fortranscriptional activation by EVI1 using synthetic reporters bearing EVI1 binding sitesindicate that EVI1 can act as either a transcription repressor5-7 or an activator.8-10 Indeed, arepression domain that binds the corepressor CtBP was identified by Palmer et al. and ispresent in the p135, p123, and p103 isoforms.7,11,12 The overlap between the binding motiffor domain 1 (GACAAGATA) and the GATA protein binding site (WGATAR) suggestedthat EVI1 may bind to GATA sites in the genome and block the action ofdifferentiationpromoting GATA proteins.5,6 This possibility was pursued in a series of invitro and in vivo studies, from which it was concluded that high affinity binding by EVI1 toDNA via domain 1 required a longer sequence than WGATAR,5 specificallyGACAAGATA.5

Studies by Delwel et al. indicated that zinc fingers 4–7 within zinc finger domain 1 (ZF1) ofEVI1 are necessary for that domain to bind to DNA with sequence specificity.2 Through invitro and in vivo structure–function studies, we determined that amino acids Q199 and R205residing in zinc finger six are critical for sequencespecific DNA binding. This analysisallowed for the generation of single amino acid missense mutations (R205N and Q199D) thatare essentially devoid of DNA binding ability.13 Furthermore, through a series of in vitroand in vivo studies, it was determined that the nature of EVI1 zinc fingers 1–7 binding to itscognate DNA motif is high affinity and highly specific.5 To identify in vivo targets forEVI1, we devised a tetracycline-regulated EVI1-VP16 chimera that had the bindingspecificity of EVI1 zinc finger domain 1 fused to the potent transcriptional activationdomain of VP16. We expressed this in NIH3T3 fibroblasts under tetracycline regulation andused gene expression profiling on oligonucleotide microarrays to identify upregulated genes.This allowed the identification of 16 genes that were specifically induced by EVI1-VP16 butnot by the R205N mutant that lacked DNA binding.13 The EVI1-VP16-responsive genesinclude genes encoding transcription factors (e.g., GATA2), signaling molecule (e.g., Nik)and extracellular matrix components (e.g., decorin). For many of these genes, EVI1 bindingsites were identified in cis by a combination of in silico analysis of evolutionary conservedbinding motifs and chromatin immunoprecipitation. Importantly, most of these sites wereoccupied by EVI1 both in fibroblasts and in myeloid leukemia cells overexpressing EVI1.13

These data suggest that these genes were indeed direct targets of EVI1 in leukemic cells andmay contribute to leukemogenesis.

The development of small molecules that block the binding of EVI1 to DNA may bepotential therapeutic strategy for treatment of acute myeloid leukemia. Hairpin pyrrole–imidazole (Py-Im) polyamides are a class of synthetic cell permeable ligands that can beprogrammed to bind DNA with high affinity and sequence specificity.14,15 The molecularrecognition properties of these compounds for specific DNA sequences are encoded by the

Zhang et al.

Biochemistry. Author manuscript; available in PMC 2013 April 08.

NIH


NIH


NIH


side-by-side arrangement of N-methylpyrrole (Py), N-methylimidazole (Im), and N-methyl-3-hydroxypyrrole (Hp) carboxamides that form distinct hydrogen bonds to the fourWatson–Crick base pairs in the minor groove. Im/Py pairs distinguish G·C from C·G,whereas Hp/Py specifies T·A from A·T and Py/Py pairs are degenerate for T·A and A·T.16-18

These small molecules achieve affinities and specificities comparable to those of DNAbinding proteins,19 have been designed to target a broad repertoire of DNA sequences,20

inhibit the DNA binding of a wide range of transcription factors, bind to chromatin,21 arecell permeable,22,23 and have been shown to downregulate endogenous gene expression incell culture.24-27

The exact role of DNA binding of EVI1 in leukemogenesis remains elusive. In this paper,we demonstrate that DNA binding via ZF1 is essential for malignant transformation. Wealso describe our efforts to directly target the EVI1–DNA binding interaction using apyrrole–imidazole polyamide. Our results indicate that polyamide 1 significantly blockedthe ZF1-mediated interaction between EVI1 and DNA and partially inhibited leukemic cellgrowth. This study thus describes a first attempt at inhibiting the leukemogenic activity ofEVI1 with a targeted therapy; this polyamide provides a valuable tool for dissecting criticalZF1–DNA direct interaction.

EXPERIMENTAL PROCEDURESPolyamide Synthesis

Py-Im polyamides 1–2 were synthesized on Kaiser oxime resin utilizing solid-phasesynthesis protocols.28 Polyamides were cleaved from resin by aminolysis with 3,3′-diamino-N-methyldipropylamine and HPLC purified, yielding compounds 5 and 6 (FigureS1). C-terminal isophthalic acid (IPA) conjugates (polyamides 1 and 2) were synthesizedfrom 5 or 6 utilizing previously reported conditions.26 Detailed experimental protocols tocleave the benzyl carbamate (Cbz) protecting group on the chiral β-NH2 turn and transformthe resulting amine to the β-NHAc functionality have been reported elsewhere.29 The benzylcarbamate (Cbz) protecting group on the chiral β-NH2 turn was cleaved by our standardconditions.29 Polyamides were purified by preparative HPLC on an Agilent 1200 Seriesinstrument equipped with a Phenomenex Gemini preparative column (250 × 21.2 mm, 5μm) with the mobile phase consisting of a gradient of acetonitrile (MeCN) in 0.1%CF3CO2H (aqueous). Polyamide purity was evaluated by analytical HPLC analysis on aBeckman Gold instrument equipped with a Phenomenex Gemini analytical column (250 ×4.6 mm, 5 μm), a diode array detector, and the mobile phase consisting of a gradient ofMeCN in 0.1% CF3CO2H (aqueous). Matrix-assisted, LASER desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) was performed on an Applied BiosystemsVoyager DE-Pro spectrometer using α-cyano-4-hydroxycinnamic acid as matrix.Electrospray ionization (ESI+) MS was performed on a Waters Acquity UPLC-LCTPremiere XE TOF-MS system. Polyamide 1 MALDI-TOF MS calculated for C65H77N22O12[M + H]+ 1357.6, found 1357.2; polyamide 2 MALDI-TOF calculated for C65H77N22O12[M + H]+ 1357.6, found 1357.4.

Thermal melting temperature analysis/UV absorption spectrophotometry was performed aspreviously described.29,30 Results from this study are shown in Table 1.

DNase I FootprintingDNase I footprinting was performed on a 5′-32P-labeled PCR amplicon essentially aspreviously described.31 Primer oligonucleotides (Integrated DNA Technologies) 5′-AGGCGATTAAGTTGGGTAACG-3′ (forward) and 5′-TCGGCCTCTGCATAAATAAAA-3′ (reverse) were designed to amplify a 223 basepair

Zhang et al.


NIH


NIH


NIH


region of p406 surrounding an insert (5′-AGATCTGACAAGATAAATTAAGAGATCT-3′) containing the EVI1 binding site(underlined). The forward primer was radiolabeled using [α-32P]-dATP (MP Biomedicals)and polynucleotide kinase (Roche). The PCR product was generated using the primer pairand Expand High Fidelity PCR Core Kit (Roche) following the manufacturer’s protocol, andan unradiolabeled PCR amplicon was confirmed by sequencing (Laragen). The PCR productwas purified on a 7% nondenaturing preparatory polyacrylamide gel (5% crosslink) andvisualized by autoradiography. The labeled band was excised, crushed, and soakedovernight (14 h) in 2 M NaCl. The gel pieces were removed by centrifugal filtration, and theDNA was precipitated with 2-propanol (1.5 volumes). The pellet was washed with 75%ethanol, lyophilized to dryness, and then resuspended in 1 mL of RNase-free H2O.Footprinting was performed on 1 μM, 300 nM, 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 300pM, 100 pM, 30 pM, and 10 pM solutions of compounds polyamide 1 (match polyamide)and polyamide 2 (mismatch polyamide), where polyamide solutions were quantitated usingε = 69 500 M−1 cm−1. All reactions were carried out in a volume of 400 μL according to thepublished procedures.31 Quantitation by storage phosphor autoradiography anddetermination of equilibrium association constants (Table 2) were as previously described.31

Chemical sequencing reactions were performed according to published protocols.32,33

Retroviral ConstructsThe EVI1R769C mutation was created with mutagenic oligonucleotides 5′GTTGCGCACATGACATTGCAGGTTGGAAG 3′ using the dut-ung system34 with single-stranded p39413 serving as a template. The resultant plasmid, p684, was confirmed by DNAsequencing and transferred to pBabe-Puro35 as a BamHI fragment to create p692. To createthe RME fusion, 1.63 kb EcoR1-BglII fragment from a human pBSRME plasmid (p495; giftof G. Nucifora) was inserted into EcoR1-BglII-cut plasmids p394, p620, and p684 to createp798, gs475, and gs477, respectively. In each of these, the NotI site was replaced with anEcoR1 site, and the 3.6 kb EcoR1 product was inserted into pMIGR1 to generate p854,p855, and p856, respectively. The creation of EVI1R205N mutation has been describedpreviously.13

Production of VirusRetroviral stocks were prepared by calcium phosphate/DNA precipitate-mediated genetransfer into BOSC cells in the presence of 25 μM chloroquine. Retroviral plasmidconstructs (5 μg per 60 mm plate) were coprecipitated with pNCA, a plasmid containing afull-length, functional clone of Mo-MuLV. DNA was allowed to remain on the cells for 12–18 h, and the medium was then changed. Viral supernatants were harvested at 48 and 72 hpost-transfection. Viral titers were determined by infecting BAF3 cells and determining thepercent GFP+ at 48 h postinfection.

Transformation AssaysRat1 fibroblast cells were transduced with pBabe-Puro-based retroviral constructs viaretroviral infection in the presence of 8 μM Polybrene. Cells were selected in 2 μg/mLpuromycin, and population of resistant cells was assayed by Western blot for proteinexpression and by colony formation for malignant transformation. Assays were performed intriplicate in 0.6% soft agar/DMEM supplemented with 20% FBS, seeding 1 × 103 cells per60 mm plate in 3 mL total volume with a 0.3% agar overlay, also containing DMEM and20% FBS. Colonies in the three plates were totalled and reported in Figure 1. The entireexperiment was repeated once. RME mutants were assayed by serial replating:36 Bonemarrow was harvested from male Balb/c mice 5d following injection with 5-fluorouracil.Cells were flushed from the marrow with Tissue Dissociation Medium (Life Sciences) at

Zhang et al.


NIH


NIH


NIH


room temperature. Mononuclear cells were purified on a metrizamide cushion (Histopaque,Sigma-Aldrich), washed in phosphate buffered saline, and then cultured in bone marrowculture medium (DMEM/10% FBS/pen/strep/amphotericinB/6 ng/mL IL-3, 10 ng/mL IL-6,and 100 ng/mL SCF). On the day following bone marrow harvest, cells were infected withretrovirus by “spinfection” as described.37 The serial replating assay was performed asdescribed.36

Electromobility Shift AssayZF2 of EVI1 from N710 to E821

38 was inserted as a PCR product into the EcoR1 site ofplasmid pGEX1N; the PCR product was generated with primers 5′GATGAATTCAACACCCTGCCAGAG 3′ and 5′GACGAATTCTAGCTCTGAGTGAGG 3′. This construct was used to produce GST-tagged protein which was purified as described.39

Hexahistidine-tagged amino-terminal fragment of EVI1 (amino acids 1–249, encompassingZF1) was purified from IPTGinduced E. coli Rosetta strain harboring a pET-22b+-EVI1plasmid by nickel affinity chromatography as described.13 The elute was dialyzed against12.5% glycerol, 5 mM MgCl2, 0.01 mM ZnSO4, 50 mM NaCl, 10 mM DTT, 50 mMHEPES, pH 7.9. Purity and concentration of the protein were determined with a CoomassieBlue stained SDS-PAGE. Oligonucleotides containing the EVI1 binding site (5′-TCGACTTGACAAGATAAGCATAG-3′ and 3′-AGCTGAACTGTTCTATTCGTATC-5′)were annealed and end-labeled with [γ32P]ATP to a specific activity of ~4300 cpm/fmol.Binding reactions (50 μL, containing 10 000 cpm of labeled oligonucleotides, 5 mM MgCl2,0.01 mM ZnSO4, 50 mM NaCl, 10 mM DTT, 50 mM HEPES, pH 7.9, 100 μg/mL BSA, 50μg/mL, poly(dI-dC) (Sigma-Aldrich, St. Louis, MO), and 12.5% glycerol) were incubated at25 °C for 30 min prior to fractionation on 4% nondenaturing PAGE (39:1 polyacrylamide–bisacrylamide, 0.5× TBE, and 2.5% glycerol). Active protein was determined by DNAtitration experiments as described.40 Polyamides were preincubated at room temperature for30 min with 32P-labeled oligonucleotides in a 20 μL reaction containing 5 mM MgCl2, 0.01mM ZnSO4, 50 mM NaCl, 10 mM DTT, 50 mM HEPES, pH 7.9, 10 μg/mL BSA, 50 ug/mL, poly(dI-dC), and 12.5% glycerol. The amount of oligonulceotides (labeled andunlabeled) and protein varied in the femtomole range with each experiment, as describedunder Results. 10 000 cpm were used for each reaction, and the appropriate amount ofunlabeled (cold) DNA was added to give a total amount of 1250 fmol DNA per reaction.Protein was added, and the binding reaction was performed as described above. All dilutionswere performed in binding buffer in the presence of 100 μg/mL BSA. Dried gels wereexposed to BioMax MR film at −80 °C. Quantitation was performed with a MolecularDynamics Storm 840 phosphor imager using Quantity One software. All reactions wereperformed in triplicate; results were adjusted to normalize total counts in bound and freeoligonucleotides. The protein:DNA Ka was determined as described,40 with the assumptionthat the stoichiometry of protein/DNA binding is 1:1. From the plot of protein/DNAcomplex [DP] against total concentration of protein [PT], the slope can be determined andthis can be used to determine Keq.40

CAT Assay and Target Gene QuantitationCell line 6D-AP1713 was cultured in DMEM supplemented with 10% calf serum, glutamine,penicillin, streptomycin, and 0.5 μg/mL tetracycline, and plated on 10 cm plates at 2 × 105

per plate, with three plates for each condition. The following day, cells were washed andplated in medium devoid of tetracycline and containing various concentrations ofpolyamide. After 48 h, the cells were harvested and assayed for CAT activity and for proteinconcentration as described.13

Zhang et al.


NIH


NIH


NIH


Inhibition StudiesLeukemic lines were plated in 96-well plates at 3000 cells per well in 100 μL. 24 h later,polyamide was added to various concentrations. At various times after polyamide addition, 1μC 3H-labeled thymidine was added, and the cells were incubated for an additional 16 h.Cells were harvested onto a glass filter paper sheet with a Tomtek cell harvester; the sheetwas saturated with scintillation fluid and counted. For the colony formation assay, 10 000cells were plated in IL-3-supplemented mixed with 1.5 mL of methylcellulose supplementedwith 15% of WEHI condition media and 1% glutamine and were plated on 30 mm plates(three plates per sample). Cells were incubated in 37 °C for 1–2 weeks, and colonies werecounted.

RESULTSDNA Binding via First Set of Zinc Fingers Is Required for Transformation

Toward the development of agents to inhibit EVI1 action, we performed structure–functionstudies to identify domains required for malignant transformation. We previously describedan R205N mutation, located at the +6 position of finger 6 in ZF1 that results in loss ofsequencespecific binding via ZF1 to the GACAAGATA motif.13 Here we describe thedevelopment of EVI1 mutants that fail to bind DNA via ZF2 (fingers 8–10). ZF2 binds withhigh affinity to GAAGATGAG motif.3 On the basis of this understanding of zinc fingerstructure41 (Figure 1A) and analysis of non-DNA binding mutants in other systems,42,43 wepredicted that finger 9, with N and R at positions +3 and +6 (Figure 1B), would contributeconsiderable strength to binding and that R769 in particular might be critical for domain 2binding to DNA. To test this, we mutated residue 769 to C, mimicking a mutation found inNGFI-A that resulted in loss of DNA binding.43 We fused EVI1 comprising zinc fingers 8,9, and 10 (from N710 to E821

38) both with and without the R769C mutation to glutathione S-transferase (GST), purified by affinity chromatography (Figure 1C), and tested for ability tobind to a doublestranded radiolabeled oligonucleotide containing the GAAGATGAG motif(Figure 1D). This revealed that the R769C mutant was essentially incapable of high affinitybinding.

Next, we wanted to assess if DNA binding via ZF1 or ZF2 is required for EVI1-mediatedmalignant transformation; for this we employed mutants R205N and R769C, respectively.Rat1 cells were transduced with pBabe-puro-based retroviruses bearing HA-tagged EVI1,either wt, EVI1R205N, or EVI1R769C. Pools transduced cells were shown to express EVI1 byWestern blot, with equal expression of the three constructs (Figure 1E). These cells wereseeded in soft agar, and colonies (>1 mm) were enumerated after 10 days (Figure 1F). Rat1cells transduced with wildtype EVI1 yielded over 140 colonies/plate in soft agar; the R769Cmutant was nearly as transforming, yielding over 90 colonies. Remarkably, the R205Nmutation was devoid of all transforming ability, having essentially the same number ofcolonies per plate as empty vector, pBabe-Puro (Figure 1F).

To further assess the effect of the R205N and R769C mutations, we determined their effectson transformation of primary bone marrow cells by the RUNX1-MDS1-EVI1 fusion protein(termed RME), which is the product of the leukemia-associated t(3;21) (Figure 1G). Weemployed a serial replating assay in semisolid medium supplemented with growth factors.44

In two separate experiments, bone marrow was harvested 5 days after treatment of C57BL/6mice with 5-fluorouracil (5FU) and was transduced with high titer MIGR1-based retroviruscontaining either wildtype EVI1p135, RME, RMER205N, RMER769C, or RMED586A/L587S orno insert. As expected, vector-transduced and untransduced bone marrow cells formed veryfew colonies on the fourth plating (Figure 1H). RME proved to be transforming, yieldingsignificantly more colonies than the vector-transduced or untransduced bone marrow cells

Zhang et al.


NIH


NIH


NIH


(Figure 1H). Strikingly, however, the R205N mutant was essentially devoid of transformingability (p < 0.001 relative to wildtype RME, Student t test; Figure 1H). However, the R769Cmutation in ZF2 and the RMED586A/L587S mutant in the CtBP binding domain were nodifferent than wildtype RME protein, as was EVI1p135 (Figure 1H). These findings areconsistent with the data obtained from the Rat1 transformation assay (Figure 1F).

Design of a Py-Im Polyamide To Block EVI1 Binding via ZF1The results of these two transformation assays clearly indicated that the ability of EVI1 totransform cells is dependent on its ability to bind to the GACAAGATA motif via ZF1. Thissuggested that blocking the ability of the protein to bind to this DNA sequence motif with asmall molecule inhibitor such as a polyamide would abrogate EVI1-induced transformation.We thus designed a Py-Im polyamide to specifically interact with the GACAA half of themotif and thereby block EVI1 binding to DNA. We chose the GACAA half motif ratherthan the AGATA portion due to the role of the latter in GATA protein function. Based onthe basis of the pairing rules, polyamide 1, which consists of a sequence of the aromaticrings of N-methylpyrrole (Py) and N-methylimidazole (Im) amino acids [ImPyPyPy-(R)β-H2N-γ-PyImPyPy-(+)-IPA (Figure 2)], should bind to the sequence 5′-WGWCWW-3′,where W = A or T.15,45 As a control, a “mismatch” polyamide 2 (ImPyPyPy-(R)β-H2N-γ-PyPyImPy-(+)-IPA; Figure 2) was synthesized, which targets the sequence 5′-WGCWWW-3′. Versions of polyamide were synthesized conjugated to isophthalic acid(IPA; Figure 2).

To assess whether polyamide 1 binds specifically to the GACA motif, the magnitude ofDNA thermal stabilization (ΔTm) of DNA–polyamide complexes was determined bymelting temperature analysis (Table 1). A ΔTm reflects stronger stabilization of the helix,indicating tighter binding of the polyamide to the duplex. Relative to naked DNA (Tm =50.2 °C), addition of match polyamides 1 yielded the greatest increase in Tm (11.5–17.3 °C).The value for IPA-conjugated polyamide (polyamide 1; ΔTm = 17.3) is similar to thatobtained for polyamides targeting the androgen receptor response element.30 The mismatchpolyamides had smaller ΔTm values, indicative of weaker binding (Table 1).

To assess the DNA binding specificity of polyamide 1 and determine the affinity ofpolyamide–DNA complexes, DNase I footprinting was performed using as a template a5′-32P end-labeled 223 bp DNA fragment that contains a single GACAAGATA motif.5

Binding was performed in parallel with the mismatch polyamide 2. This revealed thespecificity of DNA binding for the polyamides and the affinity of these interactions (Figure3 and Table 2): polyamide 1 showed high affinity binding over the entire GACAAGATAEVI1 binding motif that was observed down to 300 pM, reflecting a Ka of 1.7 (±0.3) × 1010

M−1 (Table 2). Given that the polyamide was designed to bind 5′-WGWCWW-3′, thisextent of binding, over the whole GACAAGATA motif, was expected. The binding affinityobtained is in the same range as that obtained with other polyamides designed to bindspecific motifs (e.g., ref 24). Polyamide 2 binds to the GATA motif but not GACAA, andonly at the highest concentrations of polyamide (Figure 3B, right, lanes 14 and 15),corresponding to a Ka of binding 2 orders of magnitude lower than the match polyamide (Ka= 1.0 (±0.3) × 108 M−1, Table 2). Interestingly, there is a second binding site on the plasmid(bracketed area II, TGTAA), with a binding affinity much lower than that for theGACAAGATA motif (Table 2). The differential in binding affinities between the desiredinteraction (between polyamide 1 and site I, the GACAA motif) and the second site (site II:TGTAA motif) is over 5-fold, possibly providing a therapeutic window between specificand nonspecific effects.

Zhang et al.


NIH


NIH


NIH


Polyamide 1 Reduces EVI1 Binding AffinityThe ability of polyamide 1 to inhibit EVI1 binding to its DNA recognition site in vitro wasassessed by electromobility shift assay (EMSA). We determined the equilibrium constant(Keq) for EVI1 binding to its cognate recognition site without polyamide and withpolyamide. In the first experiment, we used only the match polyamide (polyamide 1) to seeif it is capable of inhibiting EVI1 binding at all. A protein titration was done at a constantconcentration of DNA, with and without polyamide 1 at a 4:1 ratio of polyamide to DNA(Figure 4A). For a total DNA, 1250 fmol was used as previously described;13 polyamideconcentration was 5000 fmol in a 50 μL reaction. In the absence of polyamide, the titrationrevealed a strong linear relationship between input DNA and the amount shifted (Figure 4,panel B) with a Keq of 3.1 × 107 M−1 (Table 3). Addition of polyamide 1 caused asignificant drop in affinity of DNA for protein, to 1.7% of control (Table 3). Withpolyamide present, at the highest concentration of protein (700 fmol), there is a slight shift,roughly equivalent to that obtained with 10 fmol of protein in the absence of polyamide; thisrepresents a remarkable inhibition of binding.

A second protein titration was done at a polyamide:DNA ratio of 1:1. In this experiment, themismatch polyamide control was employed to assess the specificity of the inhibitory effectexhibited by polyamide 1 (Figure 4C). Again, in the absence of polyamide, protein titrationresults in a near linear increase in DNA bound (Figure 4D). As in the first experiment,pretreatment of the DNA with polyamide 1 yields a dramatic inhibition of binding, giving aKeq 1.2% of that without polyamide (Table 3). While the mismatch polyamide 2 did cause aminor inhibition, likely due to nonspecific binding (Table 3), it was not nearly as effective asthe match polyamide, indicating that polyamide 1 is more specific.

In these EMSA assays, we did not observe any retardation of the radioactive probe by thepolyamide, most likely due to the relatively small molecular mass of polyamide 1.

Polyamide 1 Causes Inhibition of EVI1-Dependent Transcriptional ActivityWe next investigated the effect of polyamide 1 on EVI1-dependent transcriptionalregulation. Since the transcriptional effects of native EVI1 isoforms on transcription are notreadily assayed, we initially employed a synthetic reporter system we have designed andpreviously described.13 This system involves the assaying transcriptional activity of achimeric EVI1-derived activator composed of ZF1 domain of EVI1 (zinc fingers 1–7) fusedto the activation domain of viral protein 16 (VP16) from herpes simplex virus 1 (HSV1).This protein has the binding specificity of ZF1 domain of EVI1 to the GACAAGATA motifbut functions as a potent transcriptional activator. Importantly, this activation activity iscompletely dependent on the interaction between EVI1 ZF1 and the GACAAGATA motif.We have shown previously that this chimeric activator binds to and transactivates achloramphenicol acetyl transferase (CAT) reporter we have made bearing EVI1 bindingsites within the promoter. In addition, we have shown by chromatin immunoprecipitationand gene expression analyses that this protein binds to the promoter regions of endogenousgenes that are candidate EVI1 targets.13 We have developed an NIH-3T3-derived cell line,termed 6D, in which the EVI1-VP16 chimera is under the control of a tetracycline operon;13

in the same cell line, there is an autoregulatory tetracycline repressor-VP16 construct.46

Thus, in the presence of tetracycline, EVI1-VP16 is off but is turned on within 6–10 hfollowing removal of tetracycline. We have further added to the 6D cell line achromosomeembedded CAT reporter harboring EVI1 binding sites within the promoterregion. This cell line, termed 6D+AP17, has inducible CAT activity upon tetracyclineremoval that is dependent on interaction between EVI1 zinc fingers and its cognate bindingsite within the CAT promoter.

Zhang et al.


NIH


NIH


NIH


To test the ability of polyamide 1 to inhibit ZF1 binding to the GACAAGATA motif in theCAT promoter, we removed tetracycline from 6D+AP17 cells and simultaneously addedvehicle, polyamide 1, or the mismatched polyamide 2. We incubated the cells for 48 h andthen assayed CAT activity (Figure 5). Doses of polyamide ranged from 0.1 to 1 μM. Thesedoses of polyamide 1 significantly suppressed EVI1-VP16-mediated activation of the CATreporter: activity was decreased 68 to 80% relative to minus Tet/no polyamide (all p values<0.01). The suppression caused by the mismatched polyamide was not as great—20–58%reduction—with p values >0.01. However, only at 1 μM concentration of polyamide was thematch polyamide significantly lower than the mismatch control (Figure 5).

Polyamide 1 Partially Inhibits Growth of DA-1 and NFS-60 CellsTo assess the growth inhibitory effect of polyamide 1 on myeloid cells, we tested the growthrate of two different immortalized lines after incubation with match polyamide. One of thetwo cell lines, NFS-60, has a high level of EVI1 expression due to proviral insertionalactivation, and the control cell line, FDCP, does not express EVI1.13 We incubated the twocell lines with 20 μM match polyamide 1 for 1 week and measured 3H-thymidineincorporation. The result showed a 35.8% (Figure 6A, p = 0.0006) decrease of incorporationin NFS-60, but no significant inhibition of thymidine uptake was observed in FDCP. Next,we examined whether the inhibition is dose-dependent; in this experiment we also comparedmatch (1) to mismatch (2) polyamide. We treated NSF-60 cells for 1 week with polyamides1 and 2 at different doses, ranging from 0 to 20 μM, and tested the growth. Our datademonstrated that with match polyamide 1 3H-thymidine incorporation was effectivelydecreased by 52.3% (p = 0.000; Figure 6B), whereas it was slightly increased by 13.7%when treated with mismatch polyamide 2 (p = 0.0007). Together, these data suggest that theEVI1-targeted polyamide specifically inhibits EVI1-expressing cells in a dose-dependentmanner. However, polyamide treatment did not completely inhibit leukemic cell growth.

Polyamide Significantly but Partially Inhibits RME-Induced TransformationIn Figure 1H, we showed that transformation by the RME leukemogenic fusion protein isdependent on the ZF1 domain to transform primary bone marrow cells in a serial replatingassay. Given this dependence, we predicted that polyamide 1 would be able to inhibit RME-induced transformation of primary bone marrow cells, but not marrow cells transformed byNUP98-HoxA9, an oncogene that is independent of RME or EVI1. We thus transducedprimary bone marrow cells with either RME or NUP98-HoxA9 and plated them in cytokine-supplemented methylcellulose that contained either the match polyamide 1 or mismatchpolyamide 2. Colonies were then serially replated to three platings. The results (Figure 6C)indicate a significant yet incomplete inhibition of colony formation by RME with the matchpolyamide 1, but not for NUP98-HoxA9-induced colony formation. These data support thedata described above that the match polyamide 1 has a significant but partial ability toinhibit EVI1 or RME-induced leukemic cell growth.

DISCUSSIONThe diagnosis of acute myeloid leukemia portends a particularly poor prognosis. Withcurrent therapies, 5 year survival rates range from 5 to 30%, depending on the subtype:leukemias with t(8;21), inv(16), and t(15;17) have a significantly better prognosis than thosein the poor-risk category. This latter category includes leukemias with abnormalities at3q26, which results in deregulated expression of EVI1. We have shown previously thatshRNA-mediated suppression of EVI1 results in slowing of leukemic cell expansion inculture due to an increase in apoptotic cell death via the intrinsic pathway.47 In the studiesdescribed herein, we provide a first attempt at developing a small molecule therapeuticspecifically designed to block transformation–critical EVI1 molecular interactions. Given

Zhang et al.


NIH


NIH


NIH


that EVI1 lacks enzymatic activity, the design of a small molecule inhibitor is challenging.Since EVI1 is a nuclear protein with sequence-specific DNA binding and transcriptionalregulatory activities, polyamides represent a logical choice as potential therapeutic. In thispaper, we demonstrate that the ability of the EVI1 protein to transform cells is dependent onits binding to DNA; this argues that blocking DNA binding with a polyamide should blockleukemic growth.

Polyamides hold significant promise in the treatment of disease processes that are driven byaberrant transcriptional regulation. Previous studies have reported efficacy of polyamides insuppressing gene expression in vivo.24-27,48,49 Lai et al. reported the development of apolyamide directed against Fat Specific Element 2 (FSE2) in the TGF-β promoter; thispolyamide significantly but not completely suppresses the expression of TGF-β in cellculture.48 Yao et al. developed a polyamide to target the AP-1 binding site in the lectin-likeoxidized low-density lipoprotein receptor 1 (LOX-1) and show that it suppresses expressionof the target in damaged vessels and significantly ameliorates narrowing of arteries indamaged vessels, a process that depends on LOX-1 expression. Their data clearly show thatpolyamides can penetrate to the nucleus of endothelial cells lining vessel walls followingintravascular injection of the polyamide into rats.49

Our polyamide design is based on binding rules previously established by the Dervan lab forhairpin-configuration polyamides such as the ones employed here: Im/Py binds to G:A; Py/Py binds to A:T, and Py:Im binds to C:G. Thus, for sequence GACA, we chose a polyamidewith sequence (ImPyPyPy-(R)β-H2N-γ-PyImPyPy; polyamide 1); this folds into a hairpinstructure with resides paired as follows: Im/Py-Py/Py-Py/Im-Py/Py. To test the specificityand affinity of polyamide 1 for the GACA sequence, we first perform DNase I footprintingthat this polyamide binds to the GACAA motif at very high affinity (association constant =1.7 × 1010 M−1). The specificity of binding is good, but not perfect: another site on ourDNase I protection probe (TGTAAA or TTTACA) also bound, but at a 5-fold lower affinity.This binding can likely be explained by the presence of an ACA motif within the TTTACAsequence. Since the highest affinity is observed for the GACAA motif, it may be possible toonly bind the desired sites through dose adjustment. Alternatively, it may be possible toincrease the specificity of binding by modifying the structure of polyamide 1, perhapsincorporating derivatives of the standard imidazole/pyrrole moieties. For instance, Py/Hphas been shown to bind more specifically to A:T pairs than the Py/Py used in polyamide 1.15

However, hydroxypyrrole is unstable and can degrade over time; more stable alternativestructures has been discussed.

Given the high affinity of polyamide 1 for the GACAA motif, it is not surprising that iteffectively blocks the ability of EVI1 bind to this site in vitro, as demonstrated by EMSAassay (Figure 4). We were also able to demonstrate inhibition of EVI1 binding in vivo, usingour 6D+AP17 cell line (Figure 5). Importantly, the CAT reporter we are using is embeddedin the chromosome, so it is chromatinized, unlike transient transfection constructs used byother investigators.48

Finally, we assess the ability of polyamide 1 to inhibit leukemic cell growth. While no effecton growth is seen in cell lines that lack EVI1 expression, a small but significant effect isseen on leukemic cells that have provirally activated EVI1 allele. These results raise thehopeful possibility that with further optimization of administration strategies or in drugdesign, a highly specific and effective novel anti-EVI1 therapy can be developed. One issueto be addressed is the efficacy of cellular uptake: while a fluorescently tagged polyamidewas taken into cells and localized to the nucleus (data not shown), its intranuclearconcentration may have been low, since the intensity of fluorescent staining was lower thatthat seen in polyamide-treated permeabilized cells, into which the drug freely enters (data

Zhang et al.


NIH


NIH


NIH


not shown). Leukemic cells are known to possess effective P1 glycoprotein-type multidrugresistance export pumps;50 we assessed the importance of these to the low entry ofpolyamide into cells by coadministering verapimil, an effective inhibitor of these pumps,and no marked improvement of uptake was observed (data not shown). Other options existfor increasing cellular uptake. These include manipulating the charge on the γ-turn of thehairpin: Previous studies by the Dervan laboratory have noted that α-NHAc substituted γ-turns often facilitate better cellular uptake compared to unsubstituted (lacking the NHAcmoiety) γ-turns.23 In this study we are employing β-substituted turns, which is a recentadvance in polyamide technology.29 Nonetheless, changing the −NH3 + moiety (see Figure2) to an −NHAc moiety may increase cellular uptake. This is the focus of currentexperimentation.

Specific Role of ZF1 and Relevant Target Genes for Malignant TransformationTo eliminate DNA binding via ZF1 and ZF2, we created point mutations rather than largedeletions, thus minimizing the possibility that other functions of the zinc fingers, such asprotein:protein interactions (e.g., with SMAD proteins51,52) are disrupted. Previous studieshave suggested that DNA binding via ZF1 is required for EVI1-mediated malignanttransformation.4 However, the deletions used also abrogated binding to SMAD proteins,51

making a definitive conclusion difficult. To address this, and to assess the role of DNAbinding via ZF2 in transformation, we tested the ability of two different DNA binding-deficient mutants, one in ZF1 (EVI1R205N

13) and one in ZF2 (EVI1R769C), for their abilityto transform cells using the Rat1 transformation assay for EVI1.7 The results of theseexperiments clearly indicate that EVI1-induced malignant transformation is dependent onDNA binding via ZF1; however, they do not indicate what are the relevant and critical DNAtargets. Recent chromatin immunoprecipitation-sequencing (ChIP-Seq) experiments wehave performed have shed new light on the issue of leukemiarelevant EVI1 target genes andsuggest that one reason for the limited efficacy of polyamide 1 in inhibiting the growth ofEVI1-expressing leukemias is that we have not targeted the correct sequence. Thus, furtheradvances in targeting EVI1 with polyamides will likely require more information concerningthe identity of key transcriptional targets for EVI1 and the exact nature of the DNA motif bywhich EVI1 regulates these genes.

The identification of critical target genes that are essential for leukemogenesis has beendifficult. The GACAAGATA motif to which ZF1 binds was first identified by an iterativesiteselection strategy,1 selecting for the highest affinity binding under EMSA conditions;selection of EVI1 binding sites in mouse genomic DNA using an in vitro filter binding assayyielded the same motif.53 These strategies for binding site identification are flawed in thatthey select for the highest affinity binders using purified EVI1 protein under artificialconditions; native conditions within the nucleus differ markedly due to the presence of otherproteins and chromatinized DNA packed within higher order structures. In addition, it ispossible that bona fide DNA binding sites for EVI1 do not have the highest affinity, sincetoo low an off-rate might not allow for fine regulation of gene expression.

To further refine our understanding of true EVI1 target genes, we have recently performedChIP-Seq experiments using mouse leukemic cell lines that overexpress EVI1.47 Thisapproach identified nearly 5000 different EVI1 binding sites within the genome, and someof these sites suggest compelling mechanisms for leukemogenesis. Interestingly, only asmall minority of these contained the DNA motifs identified by site selection,1,3 and nonewas the same as the genomic fragments we selected using an in vitro filter bindingapproach.53 Even the sites identified by our in vivo selection strategy13 were only rarelyoccupied in vivo within leukemic cells. We are in the process of confirming the location ofEVI1 binding that we obtained from ChIP-Seq experiments.

Zhang et al.


NIH


NIH


NIH


The discrepancy between our previous selection schemes and the data from ChIP-Seqexperiments indicates that bona fide EVI1 binding sites and bona fide EVI1 target gene stillneed to be more thoroughly delineated and characterized. The identification of theseleukemia-critical targets, and the site to which EVI1 binds within these genes, remains acritical goal. Once these are identified, it will likely be possible to block these interactionswith polyamides and thereby inhibit the growth of EVI1-driven myeloid leukemias. The datapresented here clearly indicate that EVI1 binding to DNA can be effectively blocked both invivo and in vitro with polyamides. With further improvements in nuclear localization ofpolyamides and knowledge of leukemia-critical targets, we contend that these agents canbecome very effective therapeutics for the treatment of myeloid leukemia.

Supplementary MaterialRefer to Web version on PubMed Central for supplementary material.

AcknowledgmentsWe thank Giuseppina Nucifora for providing the pBS-AML1-MDS1-EVI1 plasmid.

Funding

Support for this work comes from NIH [R01 CA-112188 (A.S.P.), R01 GM51747 (P.B.D.)], the AA-MDSFoundation, and the Dobranski Foundation. D.A.H. thanks the California Tobacco-Related Disease ResearchProgram (16FT-0055) for a postdoctoral fellowship. The National Science Foundation Chemistry ResearchInstrumentation and Facilities Program (CHE-0541745) is acknowledged for providing the UPLC-MS instrument.

References1. Perkins AS, Fishel R, Jenkins NA, Copeland NG. Evi-1, a murine zinc finger proto-oncogene,

encodes a sequence-specific DNA-binding protein. Mol Cell Biol. 1991; 11:2665–2674. [PubMed:2017172]

2. Delwel R, Funabiki T, Kreider B, Morishita K, Ihle J. Four of the seven zinc fingers of the Evi-1myeloid transforming gene are required for sequence-specific binding to GA(C/T)AAGA(T/C)AAGATAA. Mol Cell Biol. 1993; 13:4291–4300. [PubMed: 8321231]

3. Funabiki T, Kreider BL, Ihle JN. The carboxyl domain of zinc fingers of the Evi-1 myeloidtransforming gene binds a consensus sequence GAAGATGAG. Oncogene. 1994; 9:1575–1581.[PubMed: 8183551]

4. Kilbey A, Bartholomew C. Evi-1 ZF1 DNA binding activity and a second distinct transcriptionalrepressor region are both required for optimal transformation of Rat1 fibroblasts. Oncogene. 1998;16:2287–2291. [PubMed: 9619838]

5. Perkins A, Kim J. Zinc fingers 1–7 of EVI1 fail to bind to the GATA motif by itself but require thecore site GACAAGATA for binding. J Biol Chem. 1996; 271:1104–1110. [PubMed: 8557637]

6. Kreider B, Orkin S, Ihle J. Loss of erythropoietin responsiveness in erythroid progenitors due toexpression of the Evi-1 myeloid transforming gene. Proc Natl Acad Sci U S A. 1993; 90:6454–6458. [PubMed: 8341654]

7. Bartholomew C, Kilbey A, Clark A, Walker M. The Evi-1 proto-oncogene encodes a transcriptionalrepressor activity associated with transformation. Oncogene. 1997; 14:569–577. [PubMed:9053855]

8. Yuasa H, Oike Y, Iwama A, Nishikata I, Sugiyama D, Perkins A, Mucenski M, Suda T, MorishitaK. Oncogenic transcription factor Evi1 regulates hematopoietic stem cell proliferation throughGATA-2 expression. EMBO J. 2005; 24:1976–1987. [PubMed: 15889140]

9. Morishita K, Suzukawa K, Taki T, Ihle JN, Yokota J. EVI-1 zinc finger protein works as atranscriptional activator via binding to a consensus sequence of GACAAGATAAGATAAN1–28CTCATCTTC. Oncogene. 1995; 10:1961–1967. [PubMed: 7761097]

Zhang et al.


NIH


NIH


NIH


10. Tanaka T, Nishida J, Mitani K, Ogawa S, Yazaki Y, Hirai H. Evi-1 raises AP-1 activity andstimulates c-fos promoter transactivation with dependence on the second zinc finger domain. JBiol Chem. 1994; 269:24020–24026. [PubMed: 7929053]

11. Izutsu K, Kurokawa M, Imai Y, Maki K, Mitani K, Hirai H. The corepressor CtBP interacts withEvi-1 to repress transforming growth factor beta signaling. Blood. 2001; 97:2815–2822. [PubMed:11313276]

12. Palmer S, Brouillet J, Kilbey A, Fulton R, Walker M, Crossley M, Bartholomew C. Evi-1transforming and repressor activities are mediated by CtBP co-repressor proteins. J Biol Chem.2001; 276:25834–25840. [PubMed: 11328817]

13. Yatsula B, Lin S, Read A, Poholek A, Yates K, Yue D, Hui P, Perkins A. Identification of bindingsites of EVI1 in mammalian cells. J Biol Chem. 2005; 280:30712–30722. [PubMed: 16006653]

14. Dervan P. Molecular recognition of DNA by small molecules. Bioorg Med Chem. 2001; 9:2215–2235. [PubMed: 11553460]

15. Dervan P, Edelson B. Recognition of the DNA minor groove by pyrrole-imidazole polyamides.Curr Opin Struct Biol. 2003; 13:284–299. [PubMed: 12831879]

16. Kielkopf C, Bermer R, White S, Szewczyk J, Turner J, Baird E, Dervan P, Rees D. Structuraleffects of DNA sequence on T·A recognition by hydroxypyrrole/pyrrole pairs in the minor groove.J Mol Biol. 2000; 295:557–567. [PubMed: 10623546]

17. Kielkopf CL, Baird EE, Dervan PB, Rees DC. Nat Struct Biol. 1998; 5:104–109. [PubMed:9461074]

18. Kielkopf CL, White S, Szewczyk JW, Turner JM, Baird EE, Dervan PB, Rees DC. Science. 1998;282:111–115. [PubMed: 9756473]

19. Trauger JW, Baird EE, Dervan PB. Nature. 1996; 382:559–561. [PubMed: 8700233]

20. Hsu CF, Phillips JW, Trauger JW, Farkas ME, Belitsky JM, Heckel A, Olenyuk BZ, Puckett JW,Wang CC, Dervan PB. Tetrahedron. 2007; 63:6146–6151. [PubMed: 18596841]

21. Dudouet B, Burnett R, Dickinson LA, Wood MR, Melander C, Belitsky JM, Edelson B, Wurtz N,Briehn C, Dervan PB, Gottesfeld JM. Chem Biol. 2003; 10:859–867. [PubMed: 14522056]

22. Best T, Edelson B, Nickols N, Dervan P. Nuclear localization of pyrrole-imidazole polyamide-fluorescein conjugates in cell culture. Proc Natl Acad Sci U S A. 2003; 100:12063. [PubMed:14519850]

23. Edelson B, Best T, Olenyuk B, Nickols N, Doss R, Foister S, Heckel A, Dervan P. Influence ofstructural variation on nuclear localization of DNA-binding polyamide-fluorophore conjugates.Nucleic Acids Res. 2004; 32:2802. [PubMed: 15155849]

24. Olenyuk B, Zhang G, Klco J, Nikols N, Kaelin W, Dervan P. Inhibition of vascular endothelialgrowth factor with a sequence-specific hypoxia response element antagonist. Proc Natl Acad Sci US A. 2004; 101:16768–16773. [PubMed: 15556999]

25. Nickols N, Jacobs C, Farkas M, Dervan P. Modulating Hypoxia-Inducible Transcription byDisrupting the HIF-1-DNA Interface. ACS Chem Biol. 2007; 2:561. [PubMed: 17708671]

26. Nickols N, Jacobs C, Farkas M, Dervan P. Improved nuclear localization of DNA-bindingpolyamides. Nucleic Acids Res. 2007; 35:363–370. [PubMed: 17175539]

27. Muzikar KA, Nickols NG, Dervan PB. Proc Natl Acad Sci U S A. 2009; 106:16598–16603.[PubMed: 19805343]

28. Belitsky J, Nguyen D, Wurtz N, Dervan P. Solid-phase synthesis of DNA binding polyamides onoxim resin. Bioorg Med Chem. 2002; 10:2767–2774. [PubMed: 12057666]

29. Dose C, Farkas ME, Chenoweth DM, Dervan PB. Next generation hairpin polyamides with(R)-3,4-diaminobutyric acid turn unit. J Am Chem Soc. 2008; 130:6859–6866. [PubMed:18459783]

30. Chenoweth D, Harki D, Phillips J, Dose C, Dervan P. Cyclic pyrrole-imidazole polyamidestargeted to the androgen response element. J Am Chem Soc. 2009; 131:7182–7188. [PubMed:19413319]

31. Trauger J, Dervan P. Footprinting methods for analysis of pyrrole-imidazole polyamide/DNAcomplexes. Methods Enzymol. 2001; 340:450–466. [PubMed: 11494863]

Zhang et al.


NIH


NIH


NIH


32. Iverson B, Dervan P. Adenine specific DNA chemical sequencing reaction. Nucleic Acids Res.1987; 15:7823–7830. [PubMed: 3671067]

33. Maxam A, Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages.Methods Enzymol. 1980; 65:499–560. [PubMed: 6246368]

34. Kunkel, T. Oligonucleotide-directed mutagenesis without phenotypic selection. In: Ausubel, F.;Brent, R.; Kingston, R.; Moore, D.; Seidman, J.; Smith, J.; Struhl, K., editors. Current Protocols inMolecular Biology. John Wiley and Sons; New York: 1993. p. 8.1.1-8.1.6.

35. Morgenstern J, Land H. Advanced mammalian gene transfer: high titre retroviral vectors withmultiple drug selection markers and a complementary helper-free packaging cell line. NucleicAcids Res. 1990; 18:3587–3596. [PubMed: 2194165]

36. Lavau C, Szilvassy S, Slany R, Cleary M. Immortalization and leukemic transformation of amyelomonocytic precursor by retrovirally transduced HRX-ENL. EMBO J. 1997; 16:4226–4237.[PubMed: 9250666]

37. Ausubel, F.; Brent, R.; Kingston, R.; Moore, D.; Seidman, J.; Smith, J.; Struhl, K. Chanda, V.,editor. John Wiley & Sons, Inc.; Hoboken, NJ: 1997.

38. Morishita K, Parker DS, Mucenski ML, Jenkins NA, Copeland NG, Ihle JN. Retroviral activationof a novel gene encoding a zinc finger protein in IL3-dependent myeloid leukemia cell lines. Cell.1988; 54:831–840. [PubMed: 2842066]

39. Smith D. Purification of glutathione-S-transferase fusion proteins. Methods Mol Cell Biol. 1993;4:220–229.

40. Chodosh LA, Carthew RW, Sharp PA. A single polypeptide possesses the binding andtranscription activities of the adenovirus major late transcription factor. Mol Cell Biol. 1986;6:4723–4733. [PubMed: 3796614]

41. Pavletich N, Pabo C. Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at2.1 A. Science. 1991; 252:809–817. [PubMed: 2028256]

42. Blumberg H, Eisen A, Sledziewski A, Bader D, Young E. Two zinc fingers of a yeast regulatoryprotein shown by genetic evidence to be essential for function. Nature. 1987; 328:443–445.[PubMed: 3112579]

43. Wilson T, Day M, Pexton T, Padgett K, Johnston M, Milbrandt J. In vivo mutational analysis ofthe NGFI-A zinc fingers. J Biol Chem. 1992; 267:3718–3724. [PubMed: 1740423]

44. Luo R, Lavau C, Du C, Simone F, Polak P, Kawamata S, Thirman M. The elongation domain ofELL is dispensible but its ELL-associated factor 1 interaction domain is essential for MLL-ELL-induced leukemogenesis. Mol Cell Biol. 2001; 21:5678–5687. [PubMed: 11463848]

45. White S, Szewczyk J, Turner J, Baird E, Dervan P. Recognition of the four Watson-Crick basepairs in the DNA minor groove by synthetic ligands. Nature. 1998; 391:468–471. [PubMed:9461213]

46. Shockett P, Difilippantonio M, Hellman N, Schatz D. A modified tetracycline-regulated systemprovides autoregulatory, inducible gene expression in cultured cells and transgenic mice. Proc NatlAcad Sci U S A. 1995; 92:6522–6. [PubMed: 7604026]

47. del Campo J, Wuertzer C, Xiao Y-Y, Zhang Y, Lin S, Dudley J, Tuck D, Yatsula B, Perkins A.EVI1 blocks apoptosis in myeloid leukemia cells via enhanced transcription of the prosurvivalgene Bcl2a1 (A1). Blood. in revision.

48. Lai Y, Fukuda N, Ueno T, Matsuda H, Saito S, Matsumoto K, Ayame H, Bando T, Sugiyama H,Mugishima H, Serie K. Synthetic pyrrole-imidazole polyamide inhibits expression of the humantransforming growth factor-β1 gene. J Pharm Exp Ther. 2005; 315:571–575.

49. Yao E, Fukuda N, Ueno T, Matsuda H, Matsumoto K, Nagase H, Matsumoto Y, Takasaka A, SerieK, Sugiyama H, Sawamura T. Novel Gene Silencer Pyrrole-Imidazole Polyamide TargetingLectin-Like Oxidized Low-Density Lipoprotein Receptor-1 Attenuates Restenosis of the ArteryAfter Injury. Hypertension. 2008; 52:86–92. [PubMed: 18519843]

50. Campos L, Guyotat D, Archimbaud E, Calmard-Oriol P, Tsuruo T, Troncy JDT, Fiere D. Clinicalsignificance of multidrug resistance P-glycoprotein expression on acute non-lymphoblasticleukemia cells at diagnosis. Blood. 1992; 79:473–476. [PubMed: 1370388]

Zhang et al.


NIH


NIH


NIH


51. Kurokawa M, Mitani K, Irie K, Matsuyama T, Takahashi T, Chiba S, Yazaki Y, Matsumoto K,Hirai H. The oncoprotein Evi-1 represses TGF-beta signalling by inhibiting Smad3. Nature. 1998;394:92–96. [PubMed: 9665135]

52. Alliston T, Ko T, Cao Y, Liang Y-Y, Feng X-H, Chang C, Derynck R. Repression of bonemorphogenetic protein and activin-inducible transcription by Evi-1. J Biol Chem. 2005;280:24227–24237. [PubMed: 15849193]

53. Kim J, Hui P, Yue D, Aycock J, Leclerc C, Bjoring A, Perkins A. Identification of candidate targetgenes for EVI1, a zinc finger oncoprotein, using a novel selection strategy. Oncogene. 1998;17:1527–1538. [PubMed: 9794230]

ABBREVIATIONS

5-FU 5-fluorouracil

CAT chloramphenicol acetyl transferase

Cbz benzyl carbamate

ChIP-Seq chromatin immunoprecipitation-sequencing

DIC differential interference contrast

dIdC deoxyinosine–deoxycytosine

DIEA diisopropylethylamine

DMEM Dulbecco’s modified Eagle’s medium

DMF N,N-dimethylformamide

EMSA electromobility shift assay

ESI+ electrospray ionization

FDCP factor-dependent cell – pluripotent

fmol femtomole

FSE2 fat-specific element 2

GST glutathione S-transferase

HA hemagglutinin

Hp N-methyl-3-hydroxypyrrole

Im N-methylimidazole

IPA isophthalic acid

Ka association constant

Keq equilibrium constant

LOX-1 lectin-like oxidized low-density lipoprotein receptor 1

MALDI-TOF MS matrix-assisted, LASER desorption/ionization time-of-flight massspectrometry

MeCN acetonitrile

NUP98 nuclear pore complex protein Nup98

Py pyrrole

Q-PCR quantitative polymerase chain reaction

RME RUNX-MDS1-EVI1

Zhang et al.


NIH


NIH


NIH


SMAD mothers against decapentaplegic

Tm melting temperature

VP16 viral protein 16, herpes simplex virus

ZF1 zinc finger domain 1

ZF2 zinc finger domain 2

Zhang et al.


NIH


NIH


NIH


Figure 1.Analysis of zinc finger mutants of EVI1. (A) Ribbon structure of a C2H2 Krüppel-type zincfinger. (B) Amino acid sequence of zinc finger 9 of EVI1, showing the EVI1R769C mutation.Dotted residues are those on the exposed face of the helix and interacting with DNA. (C)Purification of GST-tagged EVI1. 1. Crude lysates; 2 and 3, glutathione eluant from affinityresin of wildtype protein, fractions 1 and 2; 4 and 5, eluant of EVI1R769C mutant. (D)Electromobility shift assay using proteins shown in lanes 3 and 5 of panel C, and a 32P-radiolabeled probe containing the GAAGATGAG motif. Lane 1, probe alone; lanes 2–5,dilutions of wildtype protein as indicated; lanes 6–9, dilutions of mutant protein as indicated.(E) Upper panel, Western blot analysis of pools of drug-selected retrovirally transducedRat1cells, infected with the constructs indicated. To the left, location of molecular weightmarker. Band representing hemagglutinin (HA)-tagged EVI1 is indicated at right. The 127kDa band seen in all lanes represents background signal. (F) Colonies in soft agar formedafter plating transduced Rat1 cells in soft agar. (G) Diagram of the structure of the RUNX-MDS1-EVI1 (RME) fusion protein product of t(3;21), with mutations R205N and R769C asindicated. Not to scale. (H) Serial replating assay of transduced primary bone marrow cellsfrom 5-FU-treated C57BL/6 mice. Retrovirally transduced mouse bone marrow cells wereplated in cytokine-supplemented semisolid methylcellulose medium, allowed to formcolonies, and then passaged onto secondary and then tertiary plates of the same medium.The x-axis presents the number of colonies formed on tertiary plating, which representmalignantly transformed cells; each bar indicates the average of colonies in triplicateplating. Student t test showed the R205N significantly different than vector-transducedcontrol (p < 0.001). This experiment was repeated with essentially the same results.

Zhang et al.


NIH


NIH


NIH


Figure 2.Structure and binding of polyamide. Match (1) and mismatch (2) polyamides, withmodifications as shown. Dark circles represent imidazole (Im) and white circles pyrrole(Py). IPA indicates isophthalic acid.

Zhang et al.


NIH


NIH


NIH


Figure 3.DNase I footprint of polyamide on DNA template. (A) Schematic of the 223 bp double-stranded DNA template used for DNase I footprint, derived by PCR from plasmid p406,5

with labeling of the top strand as depicted. Below, DNA sequence showing the two regionsfootprinted: EVI1 binding motif (sequence I) and the TGTAAA motif (sequence II). (B)DNase I footprint with polyamides 1 (left) and 2 (right). Lanes 1, 2: Maxam–Gilbertsequencing reactions for G and A, respectively; lane 3: no DNase I; lane 4: DNase I, nopolyamide; lanes 5–15: titration of polyamide from 10 pM to 1 μM. At bottom, graphicdepiction of binding data to sequences I and II, for polyamides 1 and 2. X-axis, polyamideconcentration in moles; Y-axis, fraction of maximal occupancy.

Zhang et al.


NIH


NIH


NIH


Figure 4.Electromobility shift assay (EMSA). (A) EVI1 protein titration from 0 to 700 fmol protein,as indicated, with 1250 fmol DNA template, in the absence and presence of a 4-fold excess(relative to DNA; 5000 fmol) of match polyamide 1, as indicated. The probe is a double-stranded 20-mer containing the GACAAGATA EVI1 binding motif. (B) Quantitation ofEMSA data in panel A, displaying concentration DNA shifted relative to proteinconcentration. The slope of the plot is used to calculate the Keq values in Table 3 asdescribed in the Experimental Procedures. (C) EMSA experiment using same probe as inpanel A (1250 fmol); protein at various amounts as indicated are incubated with probe in theabsence or presence of match (polyamide 1) or mismatch (polyamide 2) polyamide at a 1:1molar ratio relative to DNA probe. (D) Quantitation of EMSA data in panel C, as in panel B.

Zhang et al.


NIH


NIH


NIH


Figure 5.Polyamide 1 inhibits EVI1-VP16-mediated activation of EVI1 target. Y-axis showsnormalized values of acetylated chloramphenicol. Error bars denote standard error.Significance (p values) is calculated with Student t test. Cells are washed of tetracycline toinduce EVI1-VP16, and polyamide, either match or mismatch, is added at concentrationsindicated. Cells are incubated 48 h and harvested for CAT assay.

Zhang et al.


NIH


NIH


NIH


Figure 6.Growth assessment of murine leukemic cells following treatment with polyamide. (A)Tritiated thymidine incorporation in myeloid cell lines that do (NFS-60) or do not (FDCP)express EVI1, with or without 1 week incubation with 20 μM match polyamide, intriplicate. Bars denote standard deviation. The decrease in thymidine uptake is significantfor NFS-60 (p = 0.0006, Student t test), but not for FDCP cells. (B) NFS-60 cells grown for1 week with either match or mismatch polyamide at the doses indicated, followed byassessment of growth by 3H-thymidine incorporation. Assays were performed in triplicate.Student t test revealed a significant decrease in incorporation at 20 μM of match relative tountreated (p = 0.000). (C) Serial replating assay in cytokine-supplemented methylcellulose,of mouse bone marrow cells transduced with either RME or NUP98-HoxA9, as shown, andtreated with either match or mismatch polyamide (20 μM) as indicated. p value wascalculated using Student t test. Data are expressed as a percentage of the “control”, which isthe number of colonies obtained with the specified oncogene at each round with polyamide2.

Zhang et al.


NIH


NIH


NIH


NIH


NIH


NIH


Zhang et al.

Tabl

e 1

The

rmal

Sta

bilit

y D

ata

for

Poly

amid

es 1

and

2 C

ompl

exes

with

DN

Aa

Mat

ch P

olya

mid

eT

m/°

CΔ

Tm

/ °C

Mis

mat

ch P

olya

mid

eT

m/ °

CΔ

Tm

/ °C

67.6

(±

0.2)

17.3

(±

0.9)

57.1

(±

0.2)

6.8

(±0.

9)

a All

valu

es r

epor

ted

are

deri

ved

from

at l

east

thre

e m

eltin

g te

mpe

ratu

re e

xper

imen

ts w

ith s

tand

ard

devi

atio

ns in

dica

ted

in p

aren

thes

es. Δ

Tm

val

ues

are

give

n as

Tm

(DN

A/p

olya

mid

e) −

Tm

(DN

A) .

The

prop

agat

ed e

rror

in T

m m

easu

rem

ents

is th

e sq

uare

roo

t of

the

sum

of

the

squa

re o

f th

e st

anda

rd d

evia

tions

for

the

Tm

val

ues.


NIH


NIH


NIH


Zhang et al.

Table 2

Equilibrium Association Constants (M−1) Determined for Polyamides 1 and 2

1 2

site I: TGACAA 1.7 (±0.3) × 1010 1.0 (±0.3) × 108

site II: TGTAAA 3.1 (±0.6) × 109 5.5 (±1.0) × 108


NIH


NIH


NIH


Zhang et al.

Tabl

e 3

Dec

reas

e in

Aff

inity

of

EV

I1 f

or C

ogna

te D

NA

Bin

ding

Site

Due

to P

olya

mid

e

poly

amid

eex

peri

men

t 1

expe

rim

ent

2

slop

eK

eq (

M−1

)%

of

cont

rol

slop

eK

eq (

M−1

)%

of

cont

rol

no p

olya

mid

e (c

ontr

ol)

0.66

3.1

× 1

0710

0%0.

911.

62 ×

108

100%

poly

amid

e 1

(mat

ch)

0.03

5.3

× 1

051.

7%0.

108

1.94

× 1

061.

19%

poly

amid

e 2

(mis

mat

ch)

ndnd

nd0.

724

4.20

× 1

0725

.9%


NIH Public Access *,†, †, Xiaohui Cui Marion Vogel Charles...

Documents

Transcript of NIH Public Access *,†, †, Xiaohui Cui Marion Vogel Charles...