New MLS B -resistance gene erm (43) in Staphylococcus...

1

Full-length paper-revised manuscript AAC00627-12 1

2

New MLSB-resistance gene erm(43) in Staphylococcus lentus 3

4

5

Sybille Schwendener and Vincent Perreten∗ 6

Institute of Veterinary Bacteriology, Vetsuisse Faculty, University of Bern, Bern, Switzerland 7

8

9

Running title: erm(43) in Staphylococcus lentus 10

11

∗ Corresponding author. Mailing address: Institute of Veterinary Bacteriology, University of Bern, Länggass-Strasse 122, CH-3012 Bern, Switzerland. Phone: ++41 31 631 2430. Fax: ++41 31 631 2634. E-mail: [email protected].

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Antimicrob. Agents Chemother. doi:10.1128/AAC.00627-12 AAC Accepts, published online ahead of print on 25 June 2012

on October 12, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

2

The search for a specific rRNA methylase motif led to the identification of the 12

new macrolide-, lincosamide-, and streptogramin B-resistance gene erm(43) in 13

Staphylococcus lentus. The inducible-resistance phenotype was demonstrated by cloning 14

and expressing erm(43) and its regulatory region in S. aureus. The erm(43) gene was 15

detected in two different DNA fragments of 6230 bp and 1559 bp, respectively, that were 16

each integrated at the same location in the chromosome of several S. lentus isolates of 17

human, dog, and chicken origin. 18

19

Staphylococcus lentus is a commensal bacterium colonizing the skin of several animal 20

species. It has been commonly isolated from food-producing animals, including poultry and 21

dairy animals (10, 39), and their food products (18, 23). People working with animals have 22

also been reported to be carriers of S. lentus (5, 10). In dairy sheep and goats, S. lentus has 23

been associated with subclinical mastitis (6, 16), and in rare cases, S. lentus caused infections 24

in humans (11, 13, 33). 25

Like other staphylococci, S. lentus has the ability to acquire antibiotic resistance genes 26

(5, 10, 12, 31, 35, 39), including erythromycin ribosome methylase (erm) genes, which confer 27

resistance to macrolide, lincosamide, and streptogramin B antibiotics (MLSB) (9, 17, 37). Erm 28

methylases add one or two methyl groups to the adenine A2058 of the 23S rRNA, hindering 29

MLSB antibiotics’ ability to bind to the rRNA target (26). Erm methylases are either 30

constitutively expressed or inducible. When inducible, the erm transcript contains an intact 31

leader region that is involved in translational attenuation (7). In the absence of inducer 32

molecules, such as 14- or 15-membered ring macrolides, the bacteria remain susceptible to 33

non-inducing lincosamides and streptogramin B antibiotics in vitro. 34

To date, 34 Erm methylase classes have been described in bacterial species (35) (Fig. 35

1). While Erm(A), Erm(B), Erm(C), Erm(F), Erm(G), Erm(Q), Erm(T), Erm(Y), and Erm(33) 36


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

3

have been reported in several staphylococci (35), thus far, S. lentus has been found to contain 37

only the erm(A), erm(B), erm(C), or erm(F) genes (2, 9, 17, 21, 37). 38

In March 2007, one S. lentus strain that displayed an inducible MLSB-phenotype but 39

carried none of the described erm genes was isolated from the ear of a healthy 5-year-old dog 40

(Bruno Jura hound). The aim of this study was to identify the nature of this MLSB-resistance 41

mechanism and to determine whether it is also present in S. lentus strains of different origins. 42

43

Materials and Methods 44

Bacterial strains, identification, and growth conditions. The origin and 45

characteristics of the Staphylococcus strains used in this study are listed in Table 1. The 46

strains were identified by matrix-assisted laser desorption/ionization time-of-flight mass 47

spectrometry (MALDI-TOF MS) (microflex LT, Bruker Daltonics, Bremen, Germany). 48

Strains SD952 and ASC0 were additionally identified by 16S rDNA sequencing as described 49

previously (15). The S. aureus strains RN4220 (14) and 80CR5 (8) were used in 50

transformation and conjugation experiments, respectively. E. coli DH5α was used for cloning 51

and plasmid propagation. S. lentus strains were cultivated on trypticase soy agar plates 52

containing 5% sheep blood (Becton, Dickinson and company, Franklin Lakes, NJ) at 37°C. S. 53

aureus RN4220 and E. coli DH5α transformants were grown on Lennox broth (LB) agar 54

plates (Becton, Dickinson and company) containing 10 μg/ml tetracycline for selection of 55

pBUS1 constructs or 20 μg/ml chloramphenicol and 70 μg/ml ampicillin for selection of 56

pRB474 constructs in RN4220 or DH5α, respectively. These concentrations were also used to 57

maintain plasmids in the cells. 58

Antimicrobial susceptibility testing. MICs of erythromycin, clindamycin (Sigma-59

Aldrich, St. Louis, MO), and pristinamycin IA (Molcan Corporation, Richmond Hill, ONT) 60

were determined by broth microdilution (3). Inducible resistance to clindamycin and 61

pristinamycin IA was measured in the presence of 4 μg/ml erythromycin (4). 62


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

4

The presence of antibiotic resistance genes was determined using the custom-made 63

microarray AMR+ve-2 (Alere GmbH, Cologne, Germany) (25). 64

DNA extraction. Genomic DNA was isolated using the peqGOLD Bacterial DNA kit 65

(PEQLAB Biotechnologie GMBH, Erlangen, Germany). Plasmid DNA was extracted using 66

the NucleoBond PC20 plasmid purification kit (Macherey-Nagel GmbH & Co., Düren, 67

Germany). The kit lysis buffers were supplemented with 50 μg/ml lysostaphin (Sigma-68

Aldrich), and the cells were lysed for 20 min at 37°C. 69

PCR and sequence analysis. Standard PCR was performed using Taq DNA 70

polymerase (Solis BioDyne, Tartu, Estonia). PCR for larger amplicons (> 1.5 kb) was 71

performed using Roche Expand Long Template PCR system (Roche Diagnostics GmbH, 72

Mannheim, Germany). DNA amplification was performed for 35 cycles; primers and 73

conditions are indicated accordingly in the text. The erm(43) gene was detected by PCR 74

amplification of a 609-bp fragment using primers erm(43)-F (5'-75

TACAGCAGATGATAACATTG) and erm(43)-R (5'-76

TGTTGTTTCGATATTTTATTTAAG), an annealing temperature of 50°C, and an extension 77

time of 40 sec. To test for erm(43)-containing circular molecules, PCR was performed using 78

primers directed outwards from the erm(43)-containing fragment in SD952, namely with 79

primer erm(43)-R and the SD952 orf-7-specific primer contig50-F5 (5'-80

TGATTACTGGAGCCGCTG) (expected product size: 1.8 kb; annealing temperature: 50°C; 81

extension time: 2 min). 82

Whole genome sequencing of S. lentus SD952 was performed using Roche 454 GS 83

Titanium chemistry and protocols (GS Junior System, Roche). In total, 1 μg of genomic DNA 84

was used for Rapid Library preparation. The sequencing reads were assembled de novo using 85

newbler 2.6 at the Vital-IT Center for high-performance computing at the Swiss Institute of 86

Bioinformatics (http://www.vital-it.ch). The translated contigs were analyzed for the presence 87

of the ribosomal RNA adenine dimethylases signature [PROSITE pattern PS01131 88


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

5

(http://prosite.expasy.org/)] using the GenomeNet Bioinformatic Tool MOTIF 89

(http://www.genome.jp/tools/motif/). 90

Based on the obtained 454-sequence data, the same region that contains the integrated 91

erm(43)-fragment in SD952 was also sequenced for the S. lentus strains M155 and ASC0. 92

Sequences were obtained from long-range PCR products using ABI PRISM 3100 genetic 93

analyzer (Applied Biosystems, Forster City, CA). Primers contig50-F4 (5'-94

TGACTAGCCACATCTCCG) and contig50-R6 (5'-ATCCGTTAATTTACCGAGC) were 95

used to amplify the DNA fragment containing erm(43) in M155 (2.3 kb) and the integration 96

region in ASC0 (0.8 kb) (annealing temperature: 52°C; extension time: 7 min) (Fig. 2). 97

Primers contig50-F13 (5'-GTTTGTTAAAATACTTTATCACC) and contig50-R9 (5'-98

CTCTGCTAAATGATGTTCTG) were used to amplify flanking DNA of the integration 99

region in ASC0 (3.2 kb) (annealing temperature: 51°C; extension time: 3.5 min), which 100

contains the mfs and sugar transporter gene (Fig. 2). Primer pairs IS431-R (5'-101

AATGTATGTCCCTCTGCATC) and erm(43)-R (1.9-kb) (annealing temperature: 50°C; 102

extension time: 2 min) as well as contig50-F4 and contig50-R9 (3.5 kb) (annealing 103

temperature: 51°C; extension time: 3.5 min) were used to amplify both the 5' and the 3' 104

regions of the integration site in M155 (Fig. 2). In M155, the IS431 sequence was first 105

detected by sequencing a 0.7-kb PCR product that was obtained with primers specific to DNA 106

upstream of the integration region in SD952 (contig50-F12: 5'-TCACCTTTCTGCATCAAC; 107

contig50-R8: 5'-CAAATTATGGATACATCTCAG) at a low annealing temperature (45°C). 108

Cloning. The erm(43) gene was cloned into the shuttle vectors pBUS1 (28) and 109

pRB474 (1) as follows: one fragment containing the erm(43) gene and a 294-bp upstream 110

region was amplified by PCR from S. lentus SD952 DNA using the forward primer erm(43)-111

SalI-F1 (5'-catgtcgacTAAATGAGGGTTAATATCCAG) and the reverse primer erm(43)-112

XbaI-R (5'-cattctagATGAATTTAACGAAGGTGATTC) and cloned into pBUS1, generating 113

the plasmid pBSSC1. A second fragment containing the erm(43) gene and a 63-bp upstream 114


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

6

region was cloned into both the pBUS1 and pRB474 vectors after PCR amplification using 115

the forward primer erm(43)-SalI-F2 (5'-catgtcgacTAAATTACTGGTCATGATGAAC) and 116

the reverse primers erm(43)-XbaI-R and erm(43)-EcoRI-R (5'-117

catgaattcATGAATTTAACGAAGGTGATTC), generating the plasmids pBSSC2 and 118

pRSSC2, respectively. The primers were supplemented with linkers (lowercase) containing a 119

restriction site (underlined) to facilitate cloning into the vectors. PCR for cloning was 120

performed with Pfu DNA polymerase (Promega, Madison, WI) (annealing temperature: 51°C; 121

extension time: 2 min 15 sec). 122

DNA-DNA hybridization. Southern blot analysis of genomic and plasmid DNA was 123

performed using a standard protocol for alkaline transfer (29). The erm(43)-specific probe 124

was synthesized by incorporation of digoxigenin-11-2'-deoxyuridine-5'-triphosphates (Roche) 125

into PCR products using primers erm(43)-F and erm(43)-R and SD952 DNA as template. 126

Hybridized probes were detected on the membrane using anti-DIG-AP Fab fragments and the 127

CDP-Star chemiluminescence substrate (Roche). 128

Conjugation and electrotransformation. As described previously, conjugation was 129

performed by filter mating using S. lentus SD952 as the donor strain and S. aureus 80CR5 130

(Fusr, Rifr) as the recipient strain (24). Selection occurred on brain heart infusion (BHI) agar 131

containing 100 μg/ml rifampicin, 25 μg/ml fusidic acid, and 20 μg/ml erythromycin. In 132

addition, transferability of erm(43) was tested by electroporation of SD952 genomic DNA 133

into RN4220 and selection on NYE agar (1% casein hydrolysate, 0.5% yeast extract, 0.5% 134

sodium chloride) containing 20 μg/ml erythromycin. Electrotransformation of S. aureus 135

RN4220 was performed as previously described (30). The same protocol was used to 136

transform RN4220 cells with pBUS1 and pRB474 constructs with the exception that NYE 137

agar containing 10 μg/ml tetracycline and 20 μg/ml chloramphenicol was used for selection, 138

respectively. 139


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

7

Nucleotide sequence accession number. The nucleotide sequences of erm(43) and/or 140

its flanking regions have been deposited in the EMBL database under the accession number 141

HE650138 for S. lentus SD952, HE775264 for S. lentus M155, and HE775265 for S. lentus 142

ASC0. 143

144

Results and discussion 145

Identification of erm(43). The S. lentus strain SD952, which displayed constitutive 146

resistance to erythromycin and inducible resistance to clindamycin, did not contain any of the 147

erm genes previously described in staphylococci as determined by microarray analyses (Table 148

1). No transfer of macrolide resistance occurred either by conjugation to S. aureus 80CR5 or 149

by the electroporation of genomic DNA into S. aureus RN4220. To identify the new 150

mechanism of resistance, the entire genome of S. lentus SD952 was sequenced using 454-151

next-generation sequencing. The obtained reads (total number: 129,297; average length: 430) 152

were assembled de novo into 85 contigs with an N50 (length-weighted media) of 90,586 bp, 153

mean contig size of 33,165 bp, maximum contig length of 16,5612 bp, and contig sum of 154

2,819,025 bp. The translated contigs were analyzed for the presence of the ribosomal RNA 155

adenine dimethylases signature PROSITE pattern PS01131. This motif is present in all 156

described MLSB methylases except Erm(I), Erm(N), Erm(Z), Erm(32), Erm(37), and Erm(41) 157

(Fig. 3). Two PS01131 amino acid (aa) motifs were detected in the translated contig 158

sequences of SD952, one associated with a bacterial 16S rRNA dimethylase KsgA-like 159

protein (22) and the other associated with a 23S rRNA methylase. This 23S rRNA methylase 160

shared less than 61 % aa identity and less than 72 % DNA identity with other acquired Erm 161

proteins (Fig. 1). The gene encoding this new methylase was named erm(43), according to the 162

nomenclature for MLSB genes (http://faculty.washington.edu/marilynr/) (27). 163

Characterization and expression of erm(43). The erm(43) gene encodes a 243-aa 164

protein, which is preceded by two leader peptides of 17 aa (lp1) and 22 aa (lp2) (Fig. 2), 165


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

8

similar to the regulatory region of erm(A) in Tn554 (19). The lp2 contains the aa motif 166

(FS)IFVI, which has a key role in the induction of erm(C) (36). In addition, the regulatory 167

sequence of erm(43) contains two pairs of inverted repeats (IR) (IR1: 5'-AAAGTTCATTAT 168

and IR2: 5'-ATGATGAACTTT; IR3: 5'-TTCATTATGATTC and IR4: 5'-169

GAATATAATGAA) that are capable of forming stem-loop structures similar to that 170

described for the translational attenuator sequences upstream of inducible erm(C) genes (38). 171

The putative translational attenuator sequence upstream of the erm(43) showed 80 % identity 172

in a 204-bp overlap (204/207) to erm(A) in Tn554 (GenBank acc. no. X03216) and 73 % 173

identity in a 133-bp overlap (204/133) to erm(C) in pT48 (GenBank acc. no. NC_001395). 174

Putative -10 and -35 promoter sequences exist 223 bp and 245 bp upstream of the erm(43) 175

start codon, respectively. 176

To study its expression, the erm(43) gene was cloned with and without its putative 177

promoter sequences into the shuttle vectors pBUS1, which lacks an expression promoter, and 178

pRB474, which allows expression of the cloned genes under the control of the vegII promoter. 179

Plasmid pBSSC1 contained the erm(43) gene and a 294-bp upstream region including the 180

putative promoter sequences. Plasmids pBSSC2 and pRSSC2 contained the erm(43) gene and 181

a 63-bp upstream region lacking promoter sequences, leader peptides, and IR1. The plasmids 182

were electroporated into S. aureus RN4220, and transformants were tested for erythromycin, 183

clindamycin, and pristinamycin IA resistance as well as for the inducible resistance to 184

clindamycin and pristinamycin IA. In S. aureus RN4220, pBSSC1 conferred a greater than 9-185

fold increase in resistance to erythromycin; resistance to clindamycin (> 9-fold) and 186

pristinamycin IA (2-fold) after induction with erythromycin increased as well (Table 1). No 187

phenotypic expression was observed with pBSSC2, which contains erm(43) lacking the 188

promoter region (Table 1). However, when the same erm(43)-containing fragment was placed 189

downstream of the vegII promoter in plasmid pRSSC2, constitutive resistance to 190

erythromycin (> 9-fold), clindamycin (> 10-fold), and pristinamycin IA (> 6-fold) was 191


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

9

observed (Table 1). Untransformed RN4220 cells and RN4220 cells, harboring the empty 192

vectors, remained susceptible to these antibiotics (Table 1). 193

Distribution of erm(43) in S. lentus. The erm(43) gene was detected in six additional 194

MLSB-resistant S. lentus strains originating from chickens (S. lentus strains G38, G45, G56, 195

G85) and humans (M155, M163), determined by PCR using the primers erm(43)-F and 196

erm(43)-R, and was absent in MLSB-susceptible strains (ASC0, G64, M157) (Table 1). The 197

erm(43)-containing isolates displayed resistance to erythromycin as well as an inducible 198

resistance to clindamycin and did not contain any other erm genes yet described in 199

staphylococci, as determined by microarray analyses (Table 1). PCR analysis, using the 200

primers contig50-F4 and contig50-R6 that annealed to DNA regions situated directly 201

upstream and downstream of the putative erm(43)-containing fragment in SD952, revealed 202

the presence of a 2.3-kb fragment in erm(43)-positive strains from chickens and humans and a 203

7-kb amplicon in the SD952 strain from dog (Fig. 2). These results indicated that erm(43) was 204

present on two different DNA fragments that were integrated into the same genomic region. 205

In contrast, a 0.8-kb fragment was amplified in MLSB-susceptible strains ASC0, G64, and 206

M157 using the same primers. The erm(43) gene was also detected in the S. lentus collection 207

strains CCM2598, CCM2599, and CCUG15599. 208

Localization of erm(43) on the S. lentus chromosome and characterization of the 209

flanking region. The erm(43)-containing fragment and its flanking regions in SD952 were 210

compared to those of the S. lentus strain M155, containing erm(43), as well as the MLSB-211

susceptible strain ASC0, lacking erm(43) (Fig. 2). Sequence analysis showed that the 212

erm(43)-containing fragments of SD952 and M155 integrated into a unique site between a 213

putative major facilitator superfamily gene (mfs) and a putative sugar transporter gene in the 214

genome of S. lentus (Fig. 2). In SD952, the erm(43) gene was located on a 6230-bp fragment 215

that was flanked by 135/134-bp imperfect direct repeat (DR) sequences that differed from 216

each other by seven mismatches. The 5'-DR was part of the chromosome as it was also 217


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

10

present in M155 and ASC0 and the 3'-DR appeared to belong to the erm(43)-containing 218

integrated sequence (Fig. 2). This sequence duplication, even though only found in SD952, 219

emphasizes that the chromosomal DR sequence may play a role as an attachment site. In 220

addition to erm(43), the integrated fragment in SD952 contained four other open reading 221

frames (orf 4-7), which coded for a putative dihydrodipicolinate synthase (orf-4), a putative 222

IclR family transcriptional regulator (orf-5), a putative mandelate racemase/muconate 223

lactonizing protein (orf-6), and a putative MFS transporter (orf-7). In M155, the integrated 224

fragment had a length of 1559 bp and contained the erm(43) gene followed by a 480-bp non-225

coding region absent in the SD952 sequence (Fig. 2). The sequence of the same region in 226

ASC0 contained only the potential attachment sequence (DR) between the putative mfs and 227

sugar transporter genes (Fig. 2). In strain M155, the putative mfs gene was found to be 228

truncated by the insertion element IS431 (Fig. 2). The location of erm(43) on the chromosome 229

of S. lentus was demonstrated by DNA hybridization using probes for erm(43) (data not 230

shown). There was no evidence that the erm(43)-containing fragment in SD952 is capable of 231

autonomous translocation. Transfer of macrolide resistance was neither observed by DNA 232

transformation nor by conjugation using SD952 cells as the donor. Furthermore, no circular 233

forms of erm(43)-containing fragments were detected by PCR. 234

Although, the mode of acquisition of erm(43) remains unknown, identification of 235

erm(43) in S. lentus from different sources, including methicillin-resistant isolates from 236

chickens and humans (Table 1), indicate that erm(43) is widely distributed in different 237

environments. Erythromycin resistance has been frequently observed among bacteria from the 238

S. sciuri group (S. sciuri, S. lentus, S. vitulinus), but frequently, the mechanism of resistance 239

remains unknown (32, 34), suggesting that erm(43) may also be widespread in these bacteria. 240

Searching for aa motifs involved in enzymatic functions is one approach to detect 241

related proteins with low overall sequence identity. The new Erm(43) protein was identified 242

by such a bioinformatic search for a specific methylase motif in the translated SD952 draft 243


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

11

genome. The erm(43) gene is another example that illustrates the presence of novel antibiotic 244

resistance determinants in Staphylococcus species with zoonotic potential. 245

246

Acknowledgements 247

We thank Sybill Descloux-Langer and Alexandre Scherer for isolation of S. lentus 248

strains SD952 and ASC0, respectively; Doreen Becker, Cord Drögemüller, and Tosso Leeb 249

for help and advice with the 454-sequencing at the Institute of Genetics at the University of 250

Bern; Edy Vilei for support in genome assembly; Roger Stephan, Claudio Zweifel, and Nicole 251

Cernela for providing S. lentus strains; and Reinhold Brückner for providing the pRB474 252

plasmid. 253

254


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

12

255

References 256

1. Brückner R. 1992. A series of shuttle vectors for Bacillus subtilis and Escherichia coli. 257

Gene 122:187-192. 258

2. Chung WO, Werckenthin C, Schwarz S, Roberts MC. 1999. Host range of the ermF 259

rRNA methylase gene in bacteria of human and animal origin. J. Antimicrob. 260

Chemother. 43:5-14. 261

3. Clinical and Laboratory Standards Institute. 2009. Methods for dilution 262

antimicrobial susceptibility tests for bacteria that grow aerobically, 8th ed., vol. 29, no. 263

2. Approved standard M07-A8. Clinical and Laboratory Standards Institute, Wayne, PA. 264

4. Clinical and Laboratory Standards Institute. 2011. Performance standards for 265

antimicrobial susceptibility testing; twenty-first informational supplement M100-S21, 266

vol. 31, no. 1. Clinical and Laboratory Standards Institute, Wayne, PA. 267

5. De Martino L, Lucido M, Mallardo K, Facello B, Mallardo M, Iovane G, Pagnini 268

U, Tufano MA, Catalanotti P. 2010. Methicillin-resistant staphylococci isolated from 269

healthy horses and horse personnel in Italy. J. Vet. Diagn. Invest. 22:77-82. 270

6. Deinhofer M, Pernthaner A. 1995. Staphylococcus spp. as mastitis-related pathogens 271

in goat milk. Vet. Microbiol. 43:161-166. 272

7. Depardieu F, Podglajen I, Leclercq R, Collatz E, Courvalin P. 2007. Modes and 273

modulations of antibiotic resistance gene expression. Clin. Microbiol. Rev. 20:79-114. 274

8. Engel HW, Soedirman N, Rost JA, van Leeuwen WJ, van Embden JD. 1980. 275

Transferability of macrolide, lincomycin, and streptogramin resistances between group 276

A, B, and D streptococci, Streptococcus pneumoniae, and Staphylococcus aureus. J. 277

Bacteriol. 142:407-413. 278


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

13

9. Hauschild T, Lüthje P, Schwarz S. 2005. Staphylococcal tetracycline-MLSB resistance 279

plasmid pSTE2 is the product of an RSA-mediated in vivo recombination. J. 280

Antimicrob. Chemother. 56:399-402. 281

10. Huber H, Ziegler D, Pflüger V, Vogel G, Zweifel C, Stephan R. 2011. Prevalence 282

and characteristics of methicillin-resistant coagulase-negative staphylococci from 283

livestock, chicken carcasses, bulk tank milk, minced meat, and contact persons. BMC 284

Vet. Res. 7:6. 285

11. Karachalios GN, Michelis FV, Kanakis KV, Karachaliou I, Koutri R, Zacharof 286

AK. 2006. Splenic abscess due to Staphylococcus lentus: a rare entity. Scand. J. Infect. 287

Dis. 38:708-710. 288

12. Kehrenberg C, Schwarz S. 2004. fexA, a novel Staphylococcus lentus gene encoding 289

resistance to florfenicol and chloramphenicol. Antimicrob. Agents. Chemother. 48:615-290

618. 291

13. Koksal F, Yasar H, Samasti M. 2009. Antibiotic resistance patterns of coagulase-292

negative staphylococcus strains isolated from blood cultures of septicemic patients in 293

Turkey. Microbiol. Res. 164:404-410. 294

14. Kreiswirth BN, Löfdahl S, Betley MJ, O'Reilly M, Schlievert PM, Bergdoll MS, 295

Novick RP. 1983. The toxic shock syndrome exotoxin structural gene is not detectably 296

transmitted by a prophage. Nature 305:709-712. 297

15. Kuhnert P, Frey J, Lang NP, Mayfield L. 2002. Phylogenetic analysis of Prevotella 298

nigrescens, Prevotella intermedia and Porphyromonas gingivalis clinical strains reveals 299

a clear species clustering. Int. J. Syst. Evol. Microbiol. 52:1391-1395. 300

16. Kunz F, Corti S, Giezendanner N, Stephan R, Wittenbrink M, Zweifel C. 2011. 301

Antimicrobial resistance of Staphylococcus aureus and coagulase negative 302

staphylococci isolated from mastitis milk samples from sheep and goats. Schweiz. Arch. 303

Tierheilk. 153:63-69. 304


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

14

17. Lodder G, Werckenthin C, Schwarz S, Dyke K. 1997. Molecular analysis of naturally 305

occuring ermC-encoding plasmids in staphylococci isolated from animals with and 306

without previous contact with macrolide/lincosamide antibiotics. FEMS Immunol. Med. 307

Microbiol. 18:7-15. 308

18. Mauriello G, Casaburi A, Blaiotta G, Villani F. 2004. Isolation and technological 309

properties of coagulase negative staphylococci from fermented sausages of Southern 310

Italy. Meat. Sci. 67:149-158. 311

19. Murphy E. 1985. Nucleotide sequence of ermA, a macrolide-lincosamide-streptogramin 312

B determinant in Staphylococcus aureus. J. Bacteriol. 162:633-640. 313

20. Nash KA, Brown-Elliott BA, Wallace RJ, Jr. 2009. A novel gene, erm(41), confers 314

inducible macrolide resistance to clinical isolates of Mycobacterium abscessus but is 315

absent from Mycobacterium chelonae. Antimicrob. Agents. Chemother. 53:1367-1376. 316

21. Nawaz MS, Khan AA, Khan SA, Paine DD, Pothuluri JV, Cerniglia CE. 1999. 317

Biochemical and molecular characterization of erthromycin-resistant avian 318

Staphylococcus spp. isolated from chickens. Poult. Sci. 78:1191-1197. 319

22. Park AK, Kim H, Jin HJ. 2010. Phylogenetic analysis of rRNA methyltransferases, 320

Erm and KsgA, as related to antibiotic resistance. FEMS Microbiol. Lett. 309:151-162. 321

23. Perreten V, Giampà N, Schuler-Schmid U, Teuber M. 1998. Antibiotic resistance 322

genes in coagulase-negative staphylococci isolated from food. Syst. Appl. Microbiol. 323

21:113-120. 324

24. Perreten V, Kollöffel B, Teuber M. 1997. Conjugal transfer of the Tn916-like 325

transposon TnFO1 from Enterococcus faecalis isolated from cheese to other Gram-326

positive bacteria. System. Appl. Microbiol. 20:27-38. 327

25. Perreten V, Vorlet-Fawer L, Slickers P, Ehricht R, Kuhnert P, Frey J. 2005. 328

Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J. 329

Clin. Microbiol. 43:2291-2302. 330


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

15

26. Poehlsgaard J, Douthwaite S. 2005. The bacterial ribosome as a target for antibiotics. 331

Nat. Rev. Microbiol. 3:870-881. 332

27. Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J, Seppala H. 1999. 333

Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance 334

determinants. Antimicrob. Agents Chemother. 43:2823-2830. 335

28. Rossi J, Bischoff M, Wada A, Berger-Bächi B. 2003. MsrR, a putative cell envelope-336

associated element involved in Staphylococcus aureus sarA attenuation. Antimicrob. 337

Agents Chemother. 47:2558-2564. 338

29. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning. A laboratory 339

manual. Cold Spring Harbor Laboratory Press, New York. 340

30. Schenk S, Laddaga RA. 1992. Improved method for electroporation of Staphylococcus 341

aureus. FEMS Microbiol. Lett. 73:133-138. 342

31. Schwarz S, Roberts MC, Werckenthin C, Pang Y, Lange C. 1998. Tetracycline 343

resistance in Staphylococcus spp. from domestic animals. Vet. Microbiol. 63:217-227. 344

32. Simjee S, McDermott PF, White DG, Hofacre C, Berghaus RD, Carter PJ, Stewart 345

L, Liu T, Maier M, Maurer JJ. 2007. Antimicrobial susceptibility and distribution of 346

antimicrobial-resistance genes among Enterococcus and coagulase-negative 347

Staphylococcus isolates recovered from poultry litter. Avian. Dis. 51:884-892. 348

33. Stepanović S, Ježek P, Vuković D, Dakić I, Petráš P. 2003. Isolation of members of 349

the Staphylococcus sciuri group from urine and their relationship to urinary tract 350

infections. J. Clin. Microbiol. 41:5262-5264. 351

34. Stepanović S, Martel A, Dakić I, Decostere A, Vuković D, Ranin L, Devriese LA, 352

Haesebrouck F. 2006. Resistance to macrolides, lincosamides, streptogramins, and 353

linezolid among members of the Staphylococcus sciuri group. Microb. Drug. Resist. 354

12:115-120. 355


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

16

35. van Hoek AH, Mevius D, Guerra B, Mullany P, Roberts AP, Aarts HJ. 2011. 356

Acquired antibiotic resistance genes: an overview. Front. Microbiol. 2:203. 357

36. Weisblum B. 1995. Insights into erythromycin action from studies of its activity as 358

inducer of resistance. Antimicrob. Agents Chemother. 39:797-805. 359

37. Werckenthin C, Schwarz S, Dyke K. 1996. Macrolide-lincosamide-streptogramin B 360

resistance in Staphylococcus lentus results from the integration of part of a transposon 361

into a small plasmid. Antimicrob. Agents. Chemother. 40:2224-2225. 362

38. Werckenthin C, Schwarz S, Westh H. 1999. Structural alterations in the translational 363

attenuator of constitutively expressed ermC genes. Antimicrob. Agents. Chemother. 364

43:1681-1685. 365

39. Zhang Y, Agidi S, LeJeune JT. 2009. Diversity of staphylococcal cassette 366

chromosome in coagulase-negative staphylococci from animal sources. J. Appl. 367

Microbiol. 107:1375-1383. 368

369

370


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

17

Figure legends 371

FIG. 1. Phylogenetic tree showing the relatedness between Erm methylases. Each class 372

of Erm methylase is represented by one determinant. The dendrogram was constructed using 373

BioNumerics 6.6 (Applied Maths NV, Sint-Martens-Latem, Belgium) with the standard 374

algorithm for pairwise alignment of amino acid sequences indicated by protein accession 375

numbers (open gap penalty, 100%; unit gap penalty, 0%) and clustering with the unweighted 376

pair group method with arithmetic mean (UPGMA). The percentage of amino acid (aa) and 377

nucleotide (nt) identity between Erm(43) and other Erm determinants was determined by 378

sequence alignment with clustralw2 [http://www.ebi.ac.uk/Tools/msa/clustalw2/ (input: 379

protein/dna; pairwise alignment: slow)]. NA, not available; no linked nucleotide sequence for 380

Erm(I) could be found in the GenBank database. The complete Erm protein sequence of 381

Erm(41) was obtained from Nash (20). 382

FIG. 2. Comparison of flanking regions and integration sites of the erm(43)-containing 383

fragment in S. lentus strains SD952, M155, and ASC0. Grey areas indicate regions with high 384

DNA similarity [more than 95% (left) and more than 99% (right)]. Positions and orientations 385

of open reading frames (orfs) are represented by arrows. The new MLSB resistance gene 386

erm(43) and its two leader peptides (lp: lp1, lp2) involved in inducible expression of erm(43) 387

are shown in black. A 134/135-bp duplicated imperfect direct repeat (DR) sequence is located 388

at both extremities of the integrated erm(43)-containing element in SD952, as indicated by a 389

dark grey rectangle. In SD952, the insert contained four additional orfs (light grey arrows) 390

coding for a putative dihydrodipicolinate synthase (orf-4), a putative IclR family 391

transcriptional regulator (orf-5), a putative mandelate racemase/muconate lactonizing protein 392

(orf-6), and a putative major facilitator superfamily transporter (orf-7). In M155, a 480-bp 393

non-coding region absent in SD952 is situated downstream of erm(43), represented by a grey 394

line. orfs flanking the insertion site are indicated by white arrows: mfs, major facilitator 395

superfamily gene; mfs', mfs truncated by an IS431 element in M155; sugar transporter, 396


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

18

putative sugar transporter gene; and orf-9, gene coding for a putative xylose isomerase 397

domain-containing protein. Primers used to amplify fragments from ASC0 and M155 DNA 398

are represented by small black arrows: F4, contig50-F4; F13, contig50-F13; IS, IS431-R; R, 399

erm(43)-R; R6, contig50-R6; R9,contig50-R9. 400

FIG. 3. Alignment of ribosomal RNA adenine dimethylase signatures (PROSITE 401

pattern PS01131) of 35 Erm representatives. The pattern is defined as: [LIVMAC]-402

[LIVMFYWT]-[DE]-x-G-[STAPVLCG]-G-x-[GAS]-x-[LIVMF]-[ST]-x(2,3)-[LIVMA]-403

x(5,8)-[LIVMYF]-x-[STAGVLC]-[LIVMFYHCS]-E-x-D, with amino acids (aa) acceptable 404

for one given position listed between square brackets and x for any aa followed by the 405

possible repetition range between parentheses. In the figure, invariant aa are shaded black, 406

highly conserved aa dark grey, and less conserved positions light grey. Threonine (T) at the 407

first and histidine (H) at the last position could be included in the PS0113 signature to 408

recognize most Erm methylases. For Erm(41), the sequence published by Nash et al (20) was 409

included. Erm(32) is listed although it does not contain a complete PS01131 signature. 410

411


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

19

TABLE 1. Antimicrobial susceptibility of Staphylococcus strains to erythromycin, clindamycin and pristinamycin IA as determined by 412 broth microdilution. 413

Strain Source and origin Antibiotic resistance genes a) MIC of antibiotics (μg/ml)b)

ERY CLI iCLIc) PIA iPIAc) S. aureus/vector

RN4220 Recipient strain, plasmid free (14) 0.25 ≤0.25 NAf) 4 NAf)

RN4220/pBUS1 RN4220 with cloning vector pBUS1 (28), this study

tet(L) 0.25 ≤0.25 NAf) 4 NAf)

RN4220/pBSSC1 RN4220 with erm(43)d) cloned into pBUS1; pBSSC1, this study

erm(43), lp, tet(L) >128 ≤0.25 128 4 8

RN4220/pBSSC2 RN4220 with erm(43)e) cloned into pBUS1; pBSSC2, this study

erm(43), tet(L) 0.25

≤0.25 NAf) 4 NAf)

RN4220/pRB474 RN4220 with cloning vector pRB474 (1), this study

catpC221 0.25 ≤0.25 NAf) 4 NAf)

RN4220/pRSSC2 RN4220 with erm(43)e) cloned into pRB474; pRSSC2, this study

erm(43), catpC221 >128 >128 >128 >128 >128

S. lentus

SD952 Dog, this study str, erm(43) 64 0.5 128 4 16

ASC0 Sheep, this study tet(K), mph(C) ≤0.25 0.5 NAf) 2 NAf)

G64 Chicken (10), this study mecA, mph(C) ≤0.25 1 NAf) 2 NAf)

G38 Chicken (10), this study mecA, mph(C), erm(43) 128 2 64 32 128




M157 Human (10), this study mecA, mph(C) ≤0.25 1 NAf) 8 NAf)

M155 Human (10), this study mecA, mph(C), erm(43) 32 1 16 4 8

M163 Human (10), this study mecA, mph(C), erm(43), tet(K) 64 1 64 4 8 414 a) Antibiotic resistance genes and functions: catpC221, chloramphenicol acetyltransferase; erm(43), macrolide-lincosamide-streptogramin B rRNA methylase; mecA, penicillin-binding protein PBP 2a; mph(C); macrolide 415

phosphotransferase;str, streptomycin nucleotidyltransferase; lp, leader peptides involved in inducible expression of erm(43); tet(K), tet(L)-1 tetracycline efflux. 416 b) Antibiotics: CLI, clindamycin; ERY, erythromycin; PIA, pristinamycin IA. 417 c) iCLI, iPIA, inducible resistance to clindamycin and pristinamycin IA was measured in the presence of 4 μg/ml erythromycin. 418 d) The erm(43) gene from SD952 was cloned along with 294 bps upstream DNA that contains the leader peptides as well as promoter sequences. 419 e) The erm(43) gene from SD952 was cloned along with 63 bps upstream DNA, without leader peptides and promoter sequences. 420 f) NA, not applicable. 421


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

Protein Prot. acc. no. Species

Erm(34) AAP74657 Bacillus clausiiErm(D) AAA22599 Bacillus licheniformisErm(35) AAK07612 Bacteroides coprosuisE (F) AAA98217 B id f ili

100

8060

identity (%) ofnt

22 5626 6323 6121 57

aa

Erm(F) AAA98217 Bacteroides fragilisErm(C) AAA20192 Staphylococcus aureusErm(T) AAA98096 Lactobacillus reuteriErm(Y) BAB20748 Staphylococcus aureusErm(G) AAA22419 Lysinibacillus sphaericusErm(33) CAC86410 Staphylococcus sciuriErm(A) CAA26964 Staphylococcus aureusErm(43) CCF55073 Staphylococcus lentusErm(B) CAA73921 Staphylococcus aureus

21 5754 7158 7153 7155 7058 7060 70100 10048 64

Erm(Q) AAC36915 Clostridium perfringensErm(42) CBY77552 Pasteurella multocidaErm(31) AAC69327 Streptomyces venezuelaeErm(U) CAA55770 Streptomyces lincolnensisErm(39) AAR92235 Mycobacterium fortuitumErm(40) AAS76623 Mycobacterium mageritenseErm(38) AAN86837 Mycobacterium smegmatisErm(36) AAL68827 Micrococcus luteusErm(X) AAM12763 Corynebacterium diphtheriae

35 6430 6516 3116 3218 3318 3217 3823 4018 44( ) y p

Erm(W) BAA03402 Micromonospora griseorubidaErm(30) AAC69328 Streptomyces venezuelaeErm(O) AAA26779 Streptomyces lividansErm(V) AAB51440 Streptomyces viridochromogenesErm(S) AAA26742 Streptomyces fradiaeErm(H) AAC32026 Streptomyces thermotoleransErm(E) CAB60001 Saccharopolyspora erythraeaErm(R) AAU93796 Aeromicrobium erythreumErm(37) AAK46317 Mycobacterium tuberculosis

15 3016 3711 2712 2316 2814 3620 3819 3115 32Erm(37) AAK46317 Mycobacterium tuberculosis

Erm(41) ABW06859 Mycobacterium abscessusErm(I) Q7M0X7 Streptomyces mycarofaciensErm(Z) CAM96571 Streptomyces ambofaciensErm(N) CAA66307 Streptomyces fradiaeErm(32) CAB37345 Streptomyces fradiae

15 3216 3916 NA17 3513 344 30

Fig 1Fig. 1


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

S. lentus ASC0 (Acc. No. HE775265)mfs

S. lentus SD952 (Acc. No. HE650138)

sugar transporter

F4F13 R6 R9DR

orf-4 orf-5 orf-6mfs

(

sugar transporter orf-9orf-7erm(43)

F4

F4

F13

IS

R6

R6

R9

R9

R

R

lp

DR

DR

DR

S. lentus M155 (Acc. No. HE775264)sugar transportermfs' erm(43)

2000 4000 6000 8000 10000

(bps)

IS431

F4IS R6 R9R

lp

DR

Fig. 2


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

Protein Acc. No. Position Signature patternErm(A) CAA26964 34-61: VIEiGSGkGhFTkelVkmsrs...VtAIEiD Erm(B) CAA73921 33-60: VYEiGTGkGhLTtklAkiskq...VtSIElDErm(B) CAA73921 33 60: VYEiGTGkGhLTtklAkiskq...VtSIElDErm(C) AAA20192 34-61: IFEiGSGkGhFTlelVqrcnf...VtAIEiD Erm(D) AAA22599 48-75: VLElGAGkGaLTtv.Lsqkagk..VlAVEnD Erm(E) CAB60001 65-92: VLEaGPGeGlLTrelAdrarq...VtSYEiD Erm(F) AAA98217 37-64: VLDiGAGkGfLTvhlLkiann...VvAIEnD Erm(G) AAA22419 34-61: IFEiGAGkGhFTaelVkrcnf...VtAIEiD Erm(H) AAC32026 78-105: VLEvGAGnGaITrelArlcrr...VvAYEiD Erm(I) Q7M0X7 54-81: TVEiGAGsGrVTkalAsagrs...LlAVEiD Erm(N) CAA66307 61-88: TVEvGPGaGrITkelVrdghp...IvAVEvD Erm(O) AAA26779 39-66: LLEvGAGnGaLTeplArrsre...LhAYEiD Erm(Q) AAC36915 42-69: VIEiGPGkGhITea Lceksyw VtAIElDErm(Q) AAC36915 42 69: VIEiGPGkGhITea.Lceksyw..VtAIElDErm(R) AAU93796 61-88: VVEaGPGeGlLTrelArragr...VrTYElD Erm(S) AAA26742 89-116: LLEvGAGrGvLTealApycgr...LvAHEiD Erm(T) AAA98096 34-61: IIEiGSGkGhFSfelAkrcny...VtAIEiD Erm(U) CAA55770 36-63: IVDlGAGdGaLTlp.Lsrlgrp..VtAVElD Erm(V) AAB51440 39-66: LLEvGAGkGaLTellAprcrs...LlAYEiD Erm(W) BAA03402 50-77: VLElGAGdGaITralVaanlp...VtALElD Erm(X) AAM12763 36-63: IIEiGPGsGaLThpmAhlgra...ItAVEvD Erm(Y) BAB20748 34-61: VFEiGSGkGhFTlelVqkcny...VtVIEiD Erm(Z) CAM96571 60–87: TVEiGAGsGrVTkvlAspgtp...LlAVEiD Erm(30) AAC69328 45-72: VLEiGPGkGaITeelVrsfdt VtVVEmDErm(30) AAC69328 45 72: VLEiGPGkGaITeelVrsfdt...VtVVEmDErm(31) AAC69327 37-64: ILEiGPGdGaLTlp.Lsrhgrp..ItAVElD Erm(32) CAB37345 93-123: VVDiGGGtGhHLarvLeefedaegLlLDMsK Erm(33) CAC86410 34-61: IFEiGSGkGhFTlelVqrcnf...VtAIEiD Erm(34) AAP74657 48-75: VLElGAGkGaLTti.Lseradr..VlAVEyD Erm(35) AAK07612 37-64: VLDiGAGkGfLTvhlLknvdk...ViAIEnD Erm(36) AAL68827 36-63: IVEiGPGqGrLTre.Lqklgrs..LtAVEiD Erm(37) AAK46317 36–63: VFDiGAGeGaLTahlVragar...VvAVELH Erm(38) AAN86837 36-63: IIEiGAGdGaLTip.Lqrlarp..LtAVEvD Erm(39) AAR92235 36-63: IVEiGAGdGaLTlp.Lqrlgrp..LtAIEiD Erm(40) AAS76623 36-63: IVEiGAGdGaLTvp Mqrlgrp LtAIEiDErm(40) AAS76623 36-63: IVEiGAGdGaLTvp.Mqrlgrp..LtAIEiDErm(41) ABW06859 35–62: VVDlGAGhGaLTahlVaagar...VlAVElH Erm(42) CBY77552 42-69: VVEiGPGkGiITka.Lskicka..VnAIEfD Erm(43) CCF55073 34-61: IVEiGTGkGhFTka.Lskvvks..ViGVEiD

Fig. 3


http://aac.asm.org/

Dow

nloaded from

http://aac.asm.org/

New MLS B -resistance gene erm (43) in Staphylococcus...

Documents

Transcript of New MLS B -resistance gene erm (43) in Staphylococcus...