AN ABSTRACT OF THE THESIS OF

Miranda L. Pierson for the degree of Master of Science in Animal Sciences presented on March 23, 2007. Title: The Use of Natural Plant Extracts as a Feed Additive to Prevent Laminitis in Lactating Dairy Cows. Abstract approved:

Neil E. Forsberg

Two experiments were conducted looking at both acute and sub-acute laminitis. An

acute nutritional induction model was used to examine whether blood profiles and

gene expression are similar to other studies conducted using an endotoxin induction

model. Twelve sheep were randomly assigned to three treatment groups which were

control, 4-hour slaughter (4HS) and 48-hour slaughter (48HS). Lactic acid (LA) was

infused into the rumen of sheep in 4HS and 48HS and sterile saline solution was

infused into the rumen of control sheep using an esophageal tube. 4HS and 48HS

were slaughtered 4 and 48 hours after infusion, respectively. Control was slaughtered

48 hours after infusion. Tissue samples were taken and analyzed for cyclooxygenase-

2 (COX-2), Macrophage Inflammatory Protein-1 (MIP-1) and Matrix

Metalloproteinases (MMP) -2, -9 and -14 gene expression with RT-PCR. CBC

differentials were performed on blood samples to obtain white blood cell (WBC)

counts. WBC counts in 4HS and 4HS increased 67% and 99%, respectively, from

control groups by 4 hours after induction and returned to pretrial levels by slaughter.

Lymphocytes in 4HS and 48HS were reduced by 44% and 39%, respectively,

compared to control and remained low for the remainder of the trial. Neutrophils

increased in 4HS and 48HS by 151% and 121%, respectively, compared to control and

remained elevated for the remainder of the trial. PCR analysis did not yield

differential mRNA expression, but trends were observed. MMP-9 expression

increased 5-fold by 48 hours. MMP-2 mRNA expression decreased by 50% at 4 hours

and returned to pretrial levels by 48 hours. MMP-14 mRNA expression decreased 4

hours after LA infusion and increased 4.5-fold by 48 hours. MIP-1α expression

increased 2-fold by 48 hours. COX-2 expression decreased at 4 hours and returned to

pretrial levels by 48 hours. Larger sample size is needed for more definitive results.

A second experiment was conducted to examine a new induction model of

laminitis that focuses on slow induction of laminitis and to test the effects of quercetin,

naringin, and white willow bark as a feed additive on nutritionally challenged dairy

cows. Eighteen multiparous lactating dairy cows were blocked by days in milk and

randomly assigned to three treatment groups which were control, a group that received

a high energy ration (HE) and a group that received a high energy ration and an

experimental feed additive consisting of quercetin, naringin and white willow bark

(HEQ). Cows remained on the diets for 70 days, after which white line measurements

and hoof evaluations were taken from each cow and repeated 70 days after the

conclusion of the trial. Milk yield, daily feed intake, locomotion scores, rumen pH

and milk composition were recorded throughout the trial to measure cow productivity.

HE developed pronounced white line separation whereas HEQ did not differ from

control. Cow productivity was not negatively impacted by the feed additive and cows

had a tendency to eat more with the feed additive. The slow induction model shows

promise, but experimental error needs to be reduced for definitive results.

©Copyright by Miranda L. Pierson March 23, 2007

All Rights Reserved

The Use of Natural Plant Extracts as a Feed Additive to Prevent Laminitis in Lactating Dairy Cows

by

Miranda L. Pierson

A THESIS

submitted to

Oregon State University

in partial fulfillment of the requirements for the

degree of

Master of Science

Presented March 23, 2007 Commencement June 2007

Master of Science thesis of Miranda L. Pierson presented on March 23, 2007. APPROVED: Major Professor, representing Animal Sciences Head of the Department of Animal Sciences Dean of the Graduate School I understand that my thesis will become part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my thesis to any reader upon request.

Miranda L. Pierson, Author

ACKNOWLEDGEMENTS

I would like to express my sincere appreciation to Dr. James Males and the

Oregon State University Department of Animal Sciences for sponsoring my research

assistantship. I would also like to express my appreciation and thanks to Dr. Neil

Forsberg for his continued support, advice and the opportunity to conduct my research

under his direction. I would like to express my appreciation Dr. Patrick French and

Dr. Nancy Kerkvliet for their continuing advice and support throughout my graduate

program and to Mike Gamroth and Dr. Robert Tanguay for joining my graduate

committee on such short notice. I would also like to express my appreciation for the

assistance of Ben Krahn and the entire staff of the OSU dairy in maintaining my

research cows. I would also like to express my sincere appreciation to OmniGen

Research, LLC, for funding my research projects. In addition, I would like to thank

Ben Wustenburg, Mary Loennig, Michelle Millar and Ryan Scholz for help with

sample collections, Dr. Yongqiang Wang for his continued support in lab and his

unwavering confidence in my abilities, and Dr. Steve Puntenney for help in

formulating my trial rations and statistical analysis. Without everyone’s support, this

research would not have been possible.

TABLE OF CONTENTS

Page

Introduction……………………………………………………………………….........2

Literature Review………………………………………………………………………2

Definition of Laminitis…………………………………………………………3

Impact on Industry……………………………………………………………..3

Causes…………………………………………………………………….........6

Nutrition………………………………………………………………..6

Management Techniques………………………………………………8

Toxins…………………………………………………………………..9

Facilities……………………………………………………..………..11

Genetics…………………………………………………….....………12

Progression of Laminitis……………………………………………………12

Metabolic Upheaval…………………………………………...……...12

Mechanical Damage……………………………………………..........13

White Line Separation………………………………………………..14

Ulcer Formation………………………………………………………15

Role of Inflammation…………………………………………………………16

Inflammatory Markers………………………….……………….........17

Cyclooxygenase-2……………………………………….........17 Interleukin-1 Beta and Tumor Necrosis Factor Alpha.….........19 Macrophage Inflammatory Protein…………………………...20

Treatment……………………………………………………………..20

Target of Prevention Strategy………………………………………...21

TABLE OF CONTENTS (Continued)

Page

Experimental Feed Additive…………………………………………….........22

Quercetin……………………………………………………………...24

Naringin………………………………………………………………28

White Willow Bark………………………………….………………..29

Research Challenges………………………………………………….............30

Research Objectives…………………………………………………………..30

Materials and Methods………………………………………………………………..32

Lactic Acid Trial……………………………………………………………...32

Feeding Trial…………………………………………………………...……..34

Statistical Analysis……………………………………………………………37

Results………………………………………………………………………………...38

Lactic Acid Trial……………………………………………………………...38

Blood pH……………………………………………………………...38

CBC Differential……………………………………………………...39

Tissue Analysis……………………………………………………….44

Tissue PCR……………………………………………………44 Tissue Histology……………...................................................48

Feeding Trial………………………………………………………………….49

Changes in White Line………………………………………………49

Right Front Hoof……………………………………………...50 Left Back Hoof……………………………………………….53 Right Back and Left Front Hooves…………………………...54

TABLE OF CONTENTS (Continued)

Page

Hoof Evaluation………………………………………………………55

Locomotion Score, Feed Intake and Rumen pH……………………...58

Milk Yield and Composition………………………………………….60

Discussion…………………………………………………………………………….60

Conclusion……………………………………………………………………………66

Bibliography…………………………………………………………………………..67

LIST OF TABLES

Table Page

1. Estimating profit loss due to lameness in 90 Holsteins at OSU..……………………6

2. NRC nutrient requirements for lactating dairy cattle in early lactation….…….........7

3. Primer sequences and melting and annealing temperatures………………………..33

4. Feed trial ration ingredients……………………………….…………………….....36

5. Ration nutrient analysis……………………………………………………….........36

6. CBC differential least square means and P values in first four hours……………...40

7. CBC differential least square means and P-values for control and 48HS …………41

8. Tissue mRNA treatment means, standard errors and P-values ……………………44

9. RFH least square mean white line/claw ratio, standard errors and P values……….51

10. LBH least square mean white line/claw ratio, standard errors and P values……..53

11. LFH and RBH least square mean white line/claw ratio, standard errors and P

values ……………………………………………………………………………..54

12. Hoof evaluation at day 70………………………………………………………...56

13. Hoof evaluation at day 140……………………………………………………….57

LIST OF FIGURES

Figure Page

1. Lameness in dairy cows since 1982…………………...……………………….........4

2. Least square mean blood pH relative to LA infusion……………………………...39

3. Least square mean WBC counts relative to LA infusion.………….........................42

4. Least square mean lymphocyte count relative to LA infusion……………………..43

5. Least square mean neutrophil count relative to LA infusion……………………....44

6. COX-2 mRNA expression in tissue………………………………………………..45

7. MIP-1α mRNA expression in tissue……………………………………………….46

8. MMP-9 mRNA expression in tissue……………………………………………….46

9. MMP-2 mRNA expression in tissue……………………………………………….47

10. MMP-14 mRNA expression in tissue…………………………………………….48

11. Tissue histology…………………………………………………………………..49

12. Photograph used for white line measurement…………………………………….50

13. RFH least square mean white line/hoof ratio over time with outlier………..........52

14. RFH least square mean white line/hoof ratio over time w/o outlier………...........52

15. LBH least square mean white line/hoof ratio over time w/o outlier……………...54

16. LFH least square mean white line/hoof ratio over time………………..…………55

17. Least square mean adjusted rumen pH…………………………………………...59

The Use of Natural Plant Extracts as a Feed Additive to Prevent Laminitis in Lactating Dairy Cows

2

Introduction

Laminitis is rapidly becoming the most prevalent disease in the dairy industry

today. In terms of profit loss, it has been suggested that laminitis will soon surpass

mastitis in economic impact (Espejo et al., 2006). Extensive research has been

conducted into the causes, occurrence, etiology, symptoms and health impacts of

laminitis on dairy cows. According to one study, 3,078 publications on lameness can

be found using electronic search engines (Hirst et al., 2002). Hirst reported that in

2000, an average of 80 English references on lameness were published, whereas less

than 10 were published in 1980. Despite the increased interest and ever-growing

knowledge of the disease, an effective prevention strategy has yet to be found.

Finding a cure has been elusive because the disease is multi-faceted with many factors

influencing its onset and progression. Management and husbandry techniques,

facilities, animal health, genetics and nutrition have all been linked to the disease.

Literature Review

Nutrition is widely accepted as the main contributing factor to laminitis

development. Lactating dairy cows are often fed high energy rations with limited

effective fiber in an attempt to maximize cow productivity, particularly in the first

stage of lactation where peak milk yield occurs. This high carbohydrate diet

predisposes the animal to acidosis due to a shift in the microbial population in the

rumen. As carbohydrate intake increases, so do gram positive microbes responsible

for digesting this nutrient. Several gram positive bacteria, including Streptococcus

bovis and Allisonella histaminiformans produce histamine, endotoxins, lactic acid and

other volatile fatty acids (VFAs) (Nocek, 1997; Garner et al., 2002). Acidosis is

3

characterized by a drop in rumen pH due the VFA buildup in the rumen (Suber et al.,

1979). Not only do these molecules inhibit bacteria responsible for fiber digestion but,

once absorbed into the blood stream, can cause metabolic and systemic disorders that

can lead to destruction of hoof tissue.

Definition of Laminitis There are many different manifestations and degrees of laminitis. Clinically,

laminitis can be described as the inflammation and degradation of the laminae and

corium tissues in the hoof. These are both found in the dermal layer of the hoof, also

known as the laminar region, separating the epidermal wall and the bones. The dermal

layer acts as a shock absorber for the hoof, protecting the coffin bone and other bones

in the leg from damage. It is this tissue that also helps regulate growth of the

epidermal wall (Tomlinson et al., 2004). Once the dermal layer becomes damaged,

conformational changes occur due to pain and pressure buildup on the sole of the hoof,

as well as abnormal hoof growth.

Most hoofed animals can suffer from laminitis (Greenough, 1997). Ruminants

such as sheep and cattle are susceptible to laminitis due to their unique digestive

system. Even though horses are not ruminants, they are also prone to the disease

because of high grain diets commonly fed and are often used as models for research.

Impact on Industry Nationally, occurrence of lameness in dairy operations, regardless of size of

the operation, averaged around 20% of cows in any given herd in 2001 (NAHMS,

2002). This number has increased dramatically from 1996, where on average only

10.5% of a herd exhibited lameness (NAHMS, 1996). The National Animal Health

Monitoring System (NAHMS) also reported 16% of all culls in 2002 were due to

4

lameness. According to a study done in Great Britain, laminitis can be linked to 70-

90% of lesions associated with lameness (Russell et al., 1982). There have been

several studies conducted looking at lameness incidence (see Figure 1). Lameness

incidence was reported to be 7.5% in 1982 in the U.K. (Russell et al., 1982). Wells et

al. (1993) reported a 14%-17% occurrence of lameness in thirty freestall dairies in

Minnesota. Clarkson et al. (1996) reported an average of 21% in the U.K. In 2006,

Espejo et al. reported an average occurrence of lameness in 53 Minnesota freestall

dairies to be almost 25%, which is a substantial increase from the previous study

conducted in 1993. Increased awareness of the disease in recent years may also play a

role in the increase demonstrated over the last decade. It is clear from these numbers

that lameness is a problem that is continuing to escalate at an alarming rate.

0

5

10

15

20

25

%

Russell,1982

Wells,1993

Clarkson,1996

Espejo,2006

Figure 1. Lameness in dairy cows since 1982.* *Reported as percent of cows afflicted in each herd surveyed

In 1997, Sprecher et al. developed a locomotion scoring system as a means to

assess the level of lameness within a herd that is now commonly used in industry and

research. It is based on a score from one to five, with one being healthy with no signs

of lameness. A score of two indicates the animal is slightly lame with a normally

5

straight back while standing, but a slightly arched back when walking. A score of

three classifies the animal as moderately lame, with a slightly arched back while

standing and walking, and a short stride. A score of four indicates a pronounced arch

in the back while standing and walking, with even shorter, unsure strides. A score of

five means the animal is severely lame and is unable or unwilling to bear weight on

one or more hoof. Peter Robinson, a dairy extension specialist at the University of

California Davis, reports that as the severity of lameness increases, milk profits are

lost. A score higher than one will result in depressed milk production, which equates

to lost profits for the dairy producer (Robinson, 2006). Lower productivity can be

related to the effects of pain and discomfort for the cow (Greenough, 1997). When the

hooves are sore and tender, the cow is less willing to travel to and from feeding

stations, and spends less time eating. As feed intake decreases, so does milk

production.

According to a spreadsheet designed by Robinson that calculates profit loss

associated with lameness, a herd of 90 Holsteins, such as the herd at Oregon State

University (OSU), with a 25% rate of lameness as reported in Espejo et al. (2006), has

the potential to lose $518 in profits per month due to lameness (See Table 1). This

equates to over $6,200 a year. This estimate is based on the projected Mailbox Milk

Price for 2007 of $13.70 (USDA, 2007), and an average of 55 pounds of milk

produced by each cow per day. As of 2002, according to NAHMS, 55 pounds per

Holstein per day is the national average; however, it is probably more in most herds.

This number is based on the total yearly milk production for the entire herd, including

6

dry cows. If dry cows were not included in this average, daily milk production

estimates would increase. This also means profit loss may be underestimated as well.

Table 1. Estimating profit loss due to lameness in 90 Holsteins at OSU. PREDICTING MILK LOSSES DUE TO LAMENESS

Animal Inputs Predicted Outputs

Group milk average 55.0 lb/d Avg. LS 2.11 LS units

Group size 90 total cows

Milk price $13.70 $/100 lbs Losses

Milk 1.40 lb/cow/d

Locomotion scores (LS) 126 lb/group/d

1 19.3 % of cows

2 56.1 % of cows Fiscal $0.19 $/cow/d

3 18.6 % of cows $17 $/group/d

4 5.8 % of cows $518 $/group/mo

5 0.2 % of cows

Total 100.0

(Adapted from Robinson, 2006)

The average daily milk production at the OSU dairy for lactating Holsteins is

approximately 75 pounds. If this average is entered into the spreadsheet with the

above numbers, monthly losses increase to $706. Yearly losses of up to $8,500 can be

potentially devastating to dairy producers, especially for small dairies that are

particularly susceptible to market fluctuations.

Causes Several factors have been shown to influence the progression of laminitis, but

nearly all of these can be linked to nutrition. Of the many factors, genetics and

facilities are not directly related to nutrition but can predispose an animal, particularly

one pushed to the limits of her production capabilities.

Nutrition Nutritional requirements for lactating dairy cows vary according to a number

of factors. Stage in lactation, daily milk production, total digestible nutrients (TDN)

7

of the ration, and producer goals all factor into the nutritional needs of the animal.

Table 2 outlines the nutrient requirements as recommended by the National Research

Council (NRC) as of 2001. In addition to the requirements listed in Table 2, there are

other factors that must be considered when focusing on laminitis prevention. Not only

is proper nutrient balancing important, but the form in which the nutrient is supplied

must also be considered. Because lactating dairy cows have an increased energy

requirement to fulfill milk production, producers have a tendency to reduce the

amount of effective fiber and replace it with non-fiber carbohydrates (NFC) such as

corn or soybean meal.

Table 2. NRC nutrient requirements for lactating dairy cattle in early lactation. Nutrient Recommended

Level Fat 3-4%

True Protein 2.5-3.5% DMI 26-38% NEL 23-41 Mcal RDP 1,360-1,900 g RUP 500-1,890 g RDP* 10-11% RUP* 3-11% CP* 15.5-22%

*Presented as a percentage of True Protein Ranges based on a body weight of 680 kg, 78% TDN and daily milk production between 20 and 40 kg

Effective fiber is essential to proper rumen function in two ways. Forage

content of the diet stimulates rumination and rumen motility, both essential to promote

fermentation. Without the scratchy material provided by fiber, the rumen has the

potential to become static, halting further digestion of rumen contents. In addition, by

increasing NFCs, rumen microflora populations are altered to accommodate digestion

of nutrients present in the ration. Bacteria such as Fibrobacter succinogenes,

8

Ruminococcus flavefaciens and Ruminococcus albus are some of the main microbes

responsible for fiber digestion in the rumen. As forage is replaced by NFCs, microbes

such as Streptococcus bovis exhibit an increased rate of growth (Nocek, 1997). As S.

bovis and other lactobacilli species increase, so does lactic acid and other VFA

concentrations in the rumen. Fiber digesting microbe growth is inhibited by lactic

acid buildup in the rumen because these bacteria cannot tolerate the drop in pH

characteristic of large amounts of VFAs in the rumen.

Management Techniques As with all aspects of health, aside from nutrition, herd management is one of

the most important aspects to the prevention of laminitis. Clean housing, individual

attention and proper ration formulation play a central role in disease prevention

(Vermunt et al., 1994).

Feeding strategy must be considered when thinking about laminitis prevention.

It has been a common practice in the dairy industry to entice cows into the milking

parlor by using feed bags full of grain at the milking station, known as slug feeding.

For dairies that milk two or three times a day, slug feeding can induce multiple

acidotic events in the rumen a day. Repeated and prolonged fluctuations in rumen pH

can activate metabolic processes that lead to varying degrees of laminitis over time

(Vermunt, 1992).

Ration formulation can be considered the most important aspect of

management techniques that influence the development of laminitis. Not only is it

important to ensure the animals receive the proper balanced nutrition, but quality of

feedstuffs and proper ration preparation is important as well. The lactating ration

9

consists of several ingredients that are mixed to provide a proper balance of nutrients

for the cow. Most dairies use a large feed mixer to create a homogenous blend of all

ingredients. Improper use of the mixer can promote sorting habits, where a cow can

pick through the feed to find the ingredients appealing to them, mainly the high

energy, carbohydrate loaded portion of the ration such as corn and cottonseed. This

occurs when the forage particles are large enough that the cow can move them aside

with her tongue to get to the feedstuffs she wants.

In addition to not mixing enough to break down forage into small enough

pieces, too much mixing can be just as detrimental. If the feed particles are too small,

they cannot stimulate proper rumen movement. Rumen motility is imperative to

stimulate fermentation and breakdown of forage by rumen microbes, eructation, and

passage of small particles into the abomasum.

Toxins As early as 1960, research has been conducted trying to pinpoint the causes

and mechanisms of laminitis. One of the original theories, which is still widely

accepted, involves endotoxin activity in the blood (Garner et al., 2002). Unidentified

toxic substances found in rumen fluid of sheep were shown to induce physiological

responses similar to lipopolysaccharides (LPS) (Mullenax et al., 1966). It was

hypothesized that endotoxins from gram negative bacteria are released into the

ruminal digesta as these microbes are lysed due to the acidic environment created by

S. bovis and other lactobacilli species that are up-regulated during acidosis, and

subsequently absorbed into the blood stream. Mullenax demonstrated that cows and

sheep injected with LPS exhibited elevated inflammatory activities that are related to

10

the progression of laminitis. In addition, treatment of antihistamines to animals

exhibiting inflammatory responses showed improvement in inflammatory marker

levels in affected animals. This suggested that endotoxins elicit a response in the

animal through activating histamine and other inflammatory molecule production and

release. This theory was supported by the discovery of increased vaso-activity in the

hoof made years later (Elmes et al., 1977). Research in the 1970’s further supported

the endotoxin theory by demonstrating elevated endotoxin concentrations in the blood

of grain engorged sheep (Dougherty et al., 1975). Dougherty was careful to point out,

however, that due to the limited number of sheep used in the research, it cannot be

determined whether endotoxin activity is present in all cases of laminitis, only that it

can be implicated as a contributing factor to the development of some cases.

Presence of systemic diseases have also been linked to the endotoxin theory

(Vermunt et al., 1994). A commonly accepted hypothesis is that bacteria which cause

diseases such as mastitis, metritis and liver abscesses produce toxins that activate

systemic histamine release (Nocek, 1997). It is known that cows with these diseases

are predisposed to laminitis. However, the extent of the role these diseases play have

yet to be established.

Aflatoxins have also been linked to laminitis (Özsoy et al., 2005). Aflatoxins

are potent mycotoxins that can be found in poorly-managed feedstuffs. Özsoy et al.

conducted a study on a 300 head dairy farm in Turkey with over 15% of the cows

exhibiting lameness. It was found that lame cows had significantly higher aflatoxin

concentrations in milk than cows that were not afflicted.

11

It has been suggested that histamine production in the rumen also contributes

to laminitis development (Garner et al., 2002). Allisonella histaminiformans is a

recently discovered microbe present in bovine rumen fluid. This microbe utilizes

histadine as its primary source of energy through a decarboxylating mechanism by

which histamine is produced. A. histaminiformans is found in high concentrations in

grain engorged cattle, but not in cows fed only hay.

Facilities Types of facilities can be extremely important in the development and

predisposition to laminitis. There are three commonly used types of facilities

employed in the dairy industry. NAHMS reported in 2002 that tie stalls are most

commonly used to house lactating animals, with 52.5% of all surveyed dairy

operations using this form of confinement. Freestall barns are second most popular,

with 30.8% of operations housing their lactating animals in freestalls, and 11.2% using

a multiple animal area such as dry lots or pasture. Of these three commonly used

facilities, freestall housing with concrete flooring has been found to be the most

detrimental to hoof health (Somers et al., 2003). Of all types of flooring, regardless of

type of facility, 75% of lactating dairy cows are housed on concrete flooring

(NAHMS, 2002).

Due to its strength in compression, concrete flooring is the most detrimental to

hoof health. The average mature lactating Holstein weighs 1500 pounds. With that

much weight to support, pasture or dry lot housing provides an environment closest to

the cow’s physiological requirements. Concrete flooring greatly increases pressure

and strain to hoof tissues as well as the ligaments and bone support throughout the leg.

12

Genetics Conformation is important to the structural integrity of the animal. Claw and

body conformation are heritable traits that can attribute to laminitis development

(Vermunt, 1992). Cows should have angular leg bones. With the standard trend to

select for animals that have straight hocks, sometimes referred to as post-legged, cows

have become increasingly susceptible to leg and hoof problems through years of

genetic selection (Greenough, 1997). Angular bone placement throughout the leg acts

as an added shock absorption mechanism. Straight legs and heavy body weights

increase the pressure on the sensitive dermal tissue in the hoof.

Progression of Laminitis Phases in the progression of laminitis are somewhat subjective and a number

of experts have attempted to outline specific events of the disease based on different

criteria (Greenough, 1997; Nocek, 1997). For the purposes of this study, the disease is

broken down into four phases: metabolic upheaval, mechanical damage, white line

separation and ulcer formation.

Metabolic Upheaval The first phase can be categorized as the activation stage in which ruminal

acidosis initiates a metabolic upheaval. Blood pH drops due to increased circulating

VFAs absorbed from the rumen. Low blood pH, increased endotoxin absorption from

the rumen, endogenous histamine production, as well as histamine produced in the

rumen, all activate vasculatory mechanisms that lead to changes in osmolarity and

blood flow to the hoof of the cow (Nocek, 1997). Along with the changes in

osmolarity, elevated histamine and endotoxin concentrations create a series of vaso-

constriction and -dilation events in the arterioles feeding into the hoof tissue

13

(Greenough, 1997). This increased vaso-activity and changes in osmolarity leads to

fluid seepage, or edema, into the dermal layer of the hoof. Depending on the feeding

strategy and eating patterns of the animal, this phase can last a very short period of

time before moving into the next phase, or it can be slow and insidious. In acute

laminitis, it can progress to the second phase in a matter of hours (Black et al., 2006).

In sub-clinical or chronic laminitis it can be a matter of months before mechanical

damage and inflammatory responses are seen at the tissue level (Greenough, 1997).

Sub-clinical laminitis can take so long to manifest itself because it is usually initiated

through a series of short-lived acidotic events. Between each acidotic event, blood

flow and other factors contributing to the progression of laminitis start to return to

normal levels. It can take months before conditions in the hoof reach critical levels to

initiate inflammation and subsequent tissue damage.

Mechanical Damage Edema is the transition point to the second phase in the development of

laminitis, the mechanical damage to the soft tissues of the hoof. As serum is forced

into the dermis through osmosis, tight junctions and endothelial cells are damaged in

the blood vessels feeding the hoof. Endothelial damage can lead to arterial vascular

shunting throughout the hoof to compensate for damaged vessels (Nocek et al., 1997).

This leads to a drop in blood pressure and pooling of blood in the hoof. Edema in the

laminar region can be characterized by a yellowish discoloration in the sole of the

hoof due to serum and fluid buildup in the tissue. Blood pooling can also lead to

bruising on the bottom of the hoof. Ischemia, cell death due to lack of oxygen, ensues

which leads to an increased loss of blood flow through the hoof (Greenough, 1997).

14

As a result of damaged blood vessels feeding the foot, nutrient and oxygen

flow is reduced in the corium. The assault upon the dermal layer of tissue is now

twofold. Not only is cell death occurring because of fluid buildup and pressure in the

most sensitive part of the hoof, but the tissue now lacks the oxygen and nutrients

required to maintain normal cellular processes. This is when corium degeneration

begins, which marks the third stage in laminitis development.

White Line Separation As tissue degeneration progresses throughout the laminar region, the dermis

begins to separate from the horn wall (Greenough, 1997). The junction of the

epidermal and dermal layers of the hoof is referred to as the white line, and is visible

from the underside of the hoof. The white line has a network of filamentous

connective tissue including laminins and integrins that act as an anchoring system

between the epidermal and dermal layer. As the disease progresses, the laminar

degeneration and tissue separation becomes increasingly pronounced. This is known

as white line separation. Matrix Metalloproteinases (MMPs), specifically MMP-2 and

MMP-9, are up-regulated during developmental stages of laminitis (French et al.,

2004; Hendry et al., 2003)). MMPs are zinc dependent proteases, and are synthesized

in its inactive form. MMPs are synthesized and regulated by smooth muscle tissue

(Keiser et al., 1998). With the activity of other proteases and oxygen reactive species,

MMPs are tightly regulated during normal hoof growth. Under normal conditions,

MMPs are involved in the keratinization process, but several studies suggest drastic

up-regulation and/or activation of MMPs are involved in hoof destruction (Bailey,

2004). Both MMP-9 and MMP-2 are active in normal and laminitic horses, but are

15

drastically higher in horses afflicted with laminitis (Johnson et al., 1998). MMPs also

play roles in bovine hoof growth and are implicated in laminitis (Hendry et al., 2003).

Within the epidermal-dermal junction of the hoof, anchoring filaments known as

laminins act as anchors to keep the two tissue layers connected. Activated MMP-2

cleaves laminin and is directly involved in white line separation (French et al., 2004).

In addition, MMPs have also been linked to accelerated hoof growth in chronic

laminitis (Pollitt et al., 2004). Although MMPs are involved in both equine and

bovine laminitis, models for induction and regulation of MMPs in both healthy and

diseased animals have yet to be elucidated.

Blood perfusion into the white line can also occur, depending on the severity

of the damage to the blood vessels. If this occurs, the white line is susceptible to

developing abscesses and fissures in the horn tissue. Once laminitis has progressed to

this stage, the fourth phase in its development, irreversible damage has occurred

(Greenough, 1997).

Ulcer Formation As white line separation progresses, so does the pain and discomfort for the

cow. This leads to a tendency for the cow to shift her weight onto the back part of her

hoof to relieve pressure on the dorsal dermal tissue (Greenough, 1997). Dermal tissue

in the hoof has no regeneration capabilities. Therefore, once cell death occurs, that

tissue is lost forever. As the dermal tissue degenerates, the coffin bone begins to

rotate dorsally, creating pressure and friction on the sole and bulb of the hoof. This

rotation is not only due to a shift in stance, but also because of the lack of tissue

support within the hoof. Inflammation and swelling of the bulb of the hoof is a good

16

visual indicator that an ulcer could be forming under the epidermal layers. An ulcer

will develop because compression of the sole and bulb tissue causes localized tissue

damage to the dermal and epidermal layers. Coffin bone rotation and realignment is

essentially an irreversible condition and will plague the cow the rest of her life, even if

the ulcer eventually heals. Prolonged and repeated development of ulcers caused by

coffin bone rotation can lead to a buildup of scar tissue in the epidermal layer, which

predisposes the animal to reoccurring and chronic lameness problems and exacerbates

coffin bone realignment (Greenough, 1997).

Bleeding ulcers present a further risk to the cow as it increases the risk of

bacterial and fungal infection in the exposed soft tissues. Ulcers give bacteria a direct

route into the foot to set up infection. Heel erosion and digital dermatitis, both

bacterial infections, have been linked to ulcer trauma (Enevoldsen et al., 1991).

Role of Inflammation In recent years, a great deal of research has been conducted looking at the

inflammatory process involved in laminitis, but it has long been known that

inflammation plays a significant role in laminitis development (Morrow et al., 1973).

Neutrophils, macrophages and T cells have all been implicated in laminitis

development, although specific roles have yet to be determined (Greenough, 1997).

Lactic acid induced laminitis in sheep demonstrated significant changes in

blood profiles, including an increase in serum inorganic phosphorus, potassium,

glucose and hemoglobin (Morrow et al., 1973). Morrow suggested this is due to

severe dehydration caused by the injection of lactic acid into the rumen. This study

also reported changes in the hoof including edema, blood pooling, arterial constriction

17

and lymphocyte infiltration in the hoof as early as two hours after treatment. Two

days after treatment of LPS, corium tissue did not exhibit these pronounced

histological changes, but widespread morphological changes were apparent.

Hurley et al. (2006), demonstrated that the administration of Black Walnut

Extract (BWE), known to induce acute laminitis in horses, elicits a significant

decrease in total circulating white blood cells (WBC) present in the blood samples

taken from horses that developed laminitis after treatment. Specifically, monocytes

showed a significant decrease beginning two hours after treatment with BWE and

reached the lowest levels at four hours after administration of BWE. However,

neutrophil populations between control and treated horses did not differ or change

significantly throughout the experiment (Hurley et al., 2006). Hurley hypothesized the

reason for decreases in circulating leukocytes can be attributed to WBCs leaving

circulation and infiltrating afflicted tissue in the hoof. This hypothesis was supported

by a similar experiment where increases in leukocyte populations in the perivascular

region of the laminae were present in horses that received BWE and developed

laminitis (Black et al., 2006).

Inflammatory Markers A number of pro-inflammatory molecules are up-regulated during laminitis

induction such as cyclooxygenase (COX) -1 and -2 (Belknap et al., 2004; Blikslager et

al., 2006; Waguespack et al., 2004), Interleukin-1 beta (IL-1β) (Fontaine et al., 2001)

and Tumor Necrosis Factor alpha (TNF α) (Rodgerson et al., 2001).

Cyclooxygenase-2 COX-2, also known as Prostaglandin H Synthase (PGHS), has received quite a

bit of attention in laminitis research due to its role in disease, both as a homeostatic

18

agent and a harmful antagonist (Waguespack et al., 2004). COX-2 has been

implicated in several diseases such as osteoarthritis, septic shock and endotoxemia

(Wu, 1996). COX-2 has also been suggested to be involved in nerve transmission,

ovulation, embryo implantation and parturition (Vane et al., 1998). COX-2 is best

known for its role in inflammation induction. A whole host of cytokines are known to

induce COX-2 mRNA transcription, including TNF α, IL-1β and various

glucocorticoids (Vane et al., 1998). As part of the arachidonic acid cascade, COX-1

and -2 catalyze the first two steps in prostaglandin (PG) synthesis. Prostaglandins

play a central role in pain and inflammation, and through COX-2 induction, PGs also

play an important role in normal biological functions in a variety of tissues (Wu,

1996). COX-2 and PGs are involved in the keratinization process in rats and humans

as well (Evans et al., 1993).

Several studies, both in vivo and in vitro, have deyermined COX-2 plays an

active role in the development of laminitis when experimentally induced. One in vitro

study showed a significant up-regulation of COX-2 with the introduction of LPS in

smooth muscle tissue extracted from equine laminar tissue (Rodgerson et al., 2001).

Interestingly, COX-2 was not differentially regulated in mononuclear cells treated

with LPS compared to control groups. This suggests that the smooth muscle or

dermal layers of the laminae are responsible for at least part of the inflammatory

process involved in laminitis. Blikslager et al., (2006) found similar results in BWE

induced laminitis. COX-2 was up-regulated in laminar vasculature in horses infused

with BWE prior to tissue extraction when compared to control horses. These findings

were consistent with previous studies done on COX-2 expression in vascular tissue in

19

several different species such as rats and mice. Blikslager also suggested COX-2 and

prostaglandins could be involved in up-regulation of MMPs, which have been linked

to abnormal hoof growth during laminitis.

Interleukin-1 Beta and Tumor Necrosis Factor Alpha IL-1β is synthesized by macrophages and elicits responses in almost every type

of cell in the body (Dinarello, 1996). It is synthesized very rapidly in response to both

inflammation and microbial products. IL-1β is not found in any detectible levels in

healthy subjects, indicating it does not have any homeostatic functions (Dinarello,

1993). Vascular changes including both constriction and dilation and platelet

activation are triggered in the presence of IL-1β (Fontaine et al., 2001). In addition,

IL-1β is also a potent activator of MMPs (Dinarello, 1993).

TNF α is produced by macrophages and elicits a number of responses,

depending upon what type of tissue it acts. TNF α mobilizes neutrophils, activates

nitric oxide (NO) activity, and activates the adaptive immune response via T cell

activation. TNF-α also activates endothelial cells by changing the shape of these cells.

This increases blood flow, vascular permeability and leukocyte emigration to the site

of production.

It is well established that IL-1β and TNF α activate COX-2 mRNA

transcription (Vane et al., 1998), and both have been linked to laminitis. IL-1β is

present in perivascular cells in the venules and capillaries of BWE induced laminitis

but not in laminar tissue or in control animals (Fontaine et al., 2001). In contrast, an in

vitro study showed no differential presence of IL-1β when vascular tissue was exposed

20

to LPS (Rodgerson et al., 2001). However, in the same in vitro study, both IL-1β and

TNF α were differentially expressed in mononuclear cells.

Macrophage Inflammatory Protein-1 alpha Macrophage inflammatory protein-1 alpha (MIP-1α) is primarily produced in

hematopoietic stem cells and connective tissue and elicits responses in a number of

types of cells. As its name suggests, it is mainly involved in the inflammatory

response. An extensive repertoire of cytokines induce MIP-1α, including TNF α and

several members of the Interleukin and Interferon families. MIP-1α acts as a

chemoattractant to all types of immune cells (Terpos et al., 2005). MIP-1α has been

implicated in macrophage recruitment in wounds as well as lymphocytes to synovial

fluid (Di Pietro et al., 1998; Hanyuda et al., 2003). It is also involved in bone

destruction associated with bone cancer (Choi et al., 2000).

To the best of our knowledge, no research regarding a possible connection

between laminitis progression and MIPs has been published. However, given that

MIPs are produced in connective tissue, activated by IL-1β and TNF α, and that

MMPs break down connective tissue in the white line of the hoof, it is quite possible

that MIP-1α is involved in the inflammatory process and tissue destruction in laminitic

hooves. For these reasons, MIP-1α was included in this study.

Treatment Currently, two commonly used medications used to treat laminitis are

sulfadimethoxine and flunixin meglumine (Erkert et al., 2005). Sulfadimethoxine,

commonly known as Albon, is an antibiotic mainly used to combat bacterial infections

associated with laminitis. Albon requires a 60-hour withdrawal period for milk before

entering the food chain. Flunixin meglumine, commonly known as Banamine, is an

21

anti-inflammatory which has a 72-hour withdrawal period. Ketoprofen is another anti-

inflammatory approved for use in dairy cattle which does not have a required

withdrawal period (Whay et al., 2005). Although these treatments are commonly used

and sometimes successful, it is clear from the growing occurrence of lameness in the

dairy industry that prevention, not treatment, is the key to combating the disease.

Target of Prevention Strategy Current research indicates the inflammatory process happens early in laminitis

development and results in tissue destruction. As the disease progresses and tissue

destruction begins, immune responses return to normal levels and other processes take

over as the disease progresses. We hypothesize that blocking inflammation will halt

the progression of the disease into stages where irreparable damage occurs.

Furthermore, due to the insidious nature of the disease, taking a proactive approach to

preventing laminitis could prove to be the most effective way to combat it.

Frequently, by the time clinical signs become apparent in the animal it is too late to

treat without losing time and money, and in extreme cases, the animal. As with many

diseases, producers will take steps to prevent a disease from happening. As an

example, dipping teats in an antiseptic solution before and after milking greatly

reduces the chance of developing mastitis. Vaccinating against zoonotic diseases is

another proactive approach to disease prevention. Although there are ways to reduce

susceptibility to laminitis, it is clear that current approaches are not effective enough.

The effectiveness of a prevention strategy not only relies on combating the

disease, but also on ease of implementation. Success of any strategy depends on

whether a producer can and will implement such a program. It is in the best interests

22

of cow and producer to make it as simple as possible to implement a prevention

strategy with minimal labor and thought. Lengthy and complicated strategies are less

likely to be utilized because producers have limited time and labor to devote to

individual cow attention. Therefore, creating a prevention strategy that can be

included into a normal daily task with minimal effort will be more appealing than

adding another task to an already busy schedule. This can be accomplished by

developing a feed additive that helps prevent laminitis which is easy to implement and

requires negligible effort to include into the daily ration of the herd. Since lactating

and dry cows receive different rations formulated for their specific nutritional

requirements, targeting cows susceptible to laminitis is as easy as mixing separate

rations.

Experimental Feed Additive For over a decade there has been a growing trend towards the use of natural

supplements and alternative remedies in human health (Eisenberg et al., 1998).

Supplements and herbal remedies have been used and found to be effective in

everything from Obsessive Compulsive Disorder, colon and breast cancer, to the

treatment of insomnia, osteoarthritis, depression, Alzheimer’s and Schizophrenia

(Fugh-Berman et al., 1999). This trend, coupled with the increasing concerns over

genetically modified food, use of antibiotics and growth hormones in animals grown

for consumption and the growing popularity of organically grown foods, demonstrates

a push by consumers to search for healthy and natural alternatives instead of the

traditional medical and agricultural methods. For this reason, the focus of this

research was to find natural alternatives to current treatment methods for laminitis.

23

Developing a feed additive consisting of natural plant extracts will appeal to

the producer and the consumer alike. For the producer, a supplement that can be

easily incorporated into the daily ration is appealing for a number of reasons. First,

the ease of implementation is appealing. Virtually no time would be added into the

daily feeding routine. In addition, any added cost of feed per cow would be

significantly offset by money saved in milk production and vet and farrier costs. If a

feed additive can be developed that makes a significant impact on the health of the

herd, it could greatly improve the marketability of the dairy as well. Consumers

would probably be more likely to buy dairy products if the dairy advertises all natural

remedies to illness as an alternative to antibiotics and other drugs.

In an attempt to tackle multiple aspects of laminitis development, an extensive

review of current literature was conducted to search for several possible ingredients

for an experimental feed additive. There has been extensive research in the last

decade in the healing properties of plants; therefore, focus was centered on plants with

properties known to be beneficial in human health. Three plant extracts were

identified as potentially creditable ingredients: quercetin, naringin and white willow

bark. In concert, these three ingredients have the potential to reduce numerous aspects

of laminitis development.

A large number of healing plant constituents are classified as flavonoids.

Flavonoids are a class of naturally occurring compounds found in most plants, and

have a wide variety of biological activities. Flavonoids are responsible for a number

of physiological functions in plants. Not only are they often responsible for the colors

of flowers and leaves, they also play a role in plant growth and differentiation

24

(Nijveldt et al., 2001). They have demonstrated anti-microbial and anti-fungal

properties, as well as protect against insect damage and animal foraging (Erlund et al.,

2000). There is no standard recommended daily allowance for daily flavonoid

supplementation, but generally, most commercially sold supplements recommend 300

mg per day. Two flavonoids were identified to have a potential impact on laminitis

and incorporated into the experimental feed additive: quercetin and naringin.

Quercetin Of the ingredients included in the feed additive, quercetin has been researched

most extensively. Quercetin is a powerful natural antihistamine, blocking histamine

release from mast cells and basophils, as well as blocking enzymes involved in the

synthesis of pro-inflammatory molecules such as COX-2 (Middleton et al., 1992).

Research also indicates quercetin to be a potent anti-oxidant, have anti-carcinogenic

properties and powerful anti-inflammatory properties. Quercetin also reduces edema

of the extremities of mice (Rotelli et al., 2003). With its vast repertoire of effects in

the body, several of which can be associated with laminitis, quercetin has the potential

to be the key to battling laminitis.

Classified as a polyphenol, quercetin often occurs naturally as a glycoside.

Rutin is the most commonly occurring quercetin glycoside. The structural differences

between the two compounds determine where in the digestive tract it is absorbed, but

ultimately, both molecules lead to the same metabolites found in the blood (Manach et

al., 1995). Quercetin has a relatively low absorption rate, as low as 0.3% in humans;

however, because it has such profound effects in so many ways in the body, extensive

dietary studies have been carried out (Formica et al., 1995). Rutin is absorbed in the

25

large intestine after exposure to glycosidase produced by resident microflora in the

bowel (Formica et al., 1995). Although mechanisms of absorption have yet to be

elucidated, multiple studies looking at the pharmacokinetics of quercetin concluded

that the non-glycosylated form of the flavonoid is absorbed much faster than rutin

(Erlund et al., 2000; Manach et al., 1995; Nijveldt et al., 2001). Oddly, one such study

found that quercetin is better absorbed by females than men, and those women on birth

control had the highest absorption rates (Erlund et al., 2002). This could suggest a

possible hormonal influence on absorption.

In recent years, flavonoids have become a large area of scientific research due

to their recently discovered health implications. There are over 4,000 known

flavonoids, with quercetin being one of the best documented of the compounds

(Nijveldt et al., 2001). Quercetin elicits beneficial effects on the cardiovascular

system and linked to what is known as the French paradox. First described in 1990,

researchers discovered a link between unusually low occurrences of cardiovascular

disease such as coronary heart disease (CHD) in Mediterranean countries, despite diets

with a relatively high fat content (Formica et al., 1995). It is believed that red wine,

tomato and olive oil consumption in Mediterranean cultures is linked with this

phenomenon, with flavonoids such as quercetin playing an important role. Quercetin

and several other flavonoids were found in the seeds and skin of grapes (Erexson,

2002). With this discovery, quercetin research increased dramatically. Although much

has been discovered, there is still much more to learn about all the benefits of daily

quercetin intake.

26

Quercetin is involved in a number of anti-oxidative effects in the body.

Flavonoids prevent oxidative damage several ways, of which free radical scavenging

is one. By donating a hydrogen atom from one of its highly reactive hydroxyl groups

to free radicals such as superoxide (Brovkovych et al., 1998), oxidants are rendered

less harmful to the cell. Oxygen radicals in particular can lead to the oxidation of low

density lipoprotein (LDL). Oxidized LDL can lead to damage to blood vessel walls

and lead to atherosclerotic plaque (Formica et al., 1995).

Another mechanism for protection of oxidative damage involves the inhibition

of nitric oxide (NO) activity. NO plays an important role in the cardiovascular

system, involved in vaso-dilation of blood vessels at low concentrations. At high

concentrations however, NO can cause oxidative damage to macrophage and

endothelial cells (Nijveldt et al., 2001). It is still questionable whether quercetin

inhibits NO by treating it as a free radical or if it inhibits nitric oxide synthase activity

(Mamani-Matsuda et al., 2004). Either way, this leads to the blocking the cGMP

cascade that initiates vessel relaxation.

Several anti-oxidative mechanisms have been studied beyond these examples.

There is evidence that quercetin acts as an iron chelator (Middleton et al., 1992). In

the presence of iron, reactive oxygen species will cause extensive lipid peroxidation,

leading to the destruction of cellular membranes. Quercetin also inhibits xanthine

oxidase (van Hoorn et al., 2002) and peroxidase release (Nijveldt et al., 2001), both

free radical producers found in most tissues.

The most extensive activity of quercetin involves arachidonic acid cascade

(Formica et al., 1995). Arachidonic acid is the precursor molecule to several

27

molecules that regulate immune responses in the cell such as leukotrienes and

prostaglandins. Quercetin inhibits several enzymes involved in the arachidonic

cascade including protein kinase C, protein tyrosine kinase, cyclooxygenase and

lipoxygenase (Formica et al., 1995; Middleton et al., 1992; Nijveldt et al., 2001).

With most of these inhibitive effects, not much is known about the specific

mechanisms that lead to inactivation of each enzyme. Competitive inhibition and

enzyme inactivation are two possible mechanisms proposed.

As summarized by Middleton et al., 1992, flavonoids elicit responses in

several types of cells involved in immune function. T lymphocytes are the major site

of the arachidonic acid cascade. T lymphocytes are drawn to sites of infection and

release pro-inflammatory molecules such as leukotrienes and prostaglandins to initiate

the inflammatory response. In addition to inhibiting this cascade, it was also reported

that quercetin inhibits thymidine transport in lymphocytes, impairing DNA synthesis

in the cell. Quercetin also inhibits cytotoxic activities of immune cells by disrupting

calcium ion channels involved in cytotoxic killing of cells. Macrophages and

monocytes are also susceptible to inhibition of leukotriene production like

lymphocytes.

Mast cells and basophils release histamine in response to pro-inflammatory

agents. Quercetin and other flavonoids have been shown to inhibit histamine release

in these cells, possibly through receptor disruption (Formica et al., 1995). There is

also evidence that quercetin directly inhibits histamine releasing factors that act on

basophils. Calcium ion channel disruption is yet another proposed mechanism much

like that in lymphocytes.

28

Neutrophil function is also affected by flavonoids such as quercetin. When

neutrophils reach a site of infection, they can burst open to release lysosomal enzymes

and other molecules to battle the infection. This is known as degranulation. Quercetin

dramatically inhibits this process (Middleton et al., 1992).

Quercetin also protects against platelet aggregation in blood vessels (Nijveldt

et al., 2001). It accomplishes this through the inhibition of enzymes involved in

thromboxane A2 synthesis. Like leukotrienes and prostaglandins, thromboxane A2 is

synthesized through the arachidonic acid cascade. It initiates platelet activation and

aggregation. Platelets play a large role in blood clotting and a buildup in blood vessels

can lead to atherosclerosis (Middleton et al., 1992).

Studies indicate that quercetin could affect several factors in laminitis

progression. Quercetin inhibits elevated vaso-activity, histamine release, platelet

aggregation, COX-2 activity and tissue destruction caused through oxidative damage,

all of which have been implicated in laminitis.

Naringin Naringin (4,5,7-trihydroxyflavanone 7-rhamnoglucoside) is another flavonoid

that has similar properties to quercetin. Naringin is a bitter tasting flavonoid found in

citrus fruits such as grapefruit, oranges and pineapples. It is involved in growth of

leaves and flower buds, and it has been suggested to be involved in protection against

insect damage (Castillo et al., 1992). Naringin occurs naturally in plants as a

flavonoid glycoside. Like quercetin, naringin is hydrolyzed by intestinal microflora

into its absorbable form, naringinin. Naringin has a relatively low bioavailability, less

than 25% of administered naringin is shown to be absorbed (Ameer et al., 1996).

29

Just like quercetin, naringin influences vaso-activity, cancer proliferation, and

oxidative damage caused by oxygen reactive species (Singh et al., 2004). In fact,

much of the preventative actions of naringin are similar to quercetin function (Jeon et

al., 2001). Naringin also inhibits renal ischemia in rats by inhibiting free radicals and

oxidative damage (Singh et al., 2004). Of particular interest for this study, naringin is

also an effective histamine blocker. It was determined that naringinin inhibits

histidine decarboxylase, therefore it could be effective in inhibiting histamine

production in the rumen, specifically histamine produced by A. histaminiformans.

White Willow Bark White willow bark (WWB) has been used for centuries as a pain reliever,

traced back as far as ancient Greece, but it wasn’t until 1828 that the specific pain

relieving compound was isolated. It is now known that WWB is effective at reducing

pain, fever and inflammation (Vane et al., 1998). Acetylsalicylic acid, commonly

known as aspirin, was developed through the discovery of salicin, the analgesic

isolated in 1828. Common recommended dose is between 120 and 240 mg a day for

pain management.

Salicylic acid is classified as a phenol. The compound has an aromatic ring

with a hydroxyl group that determines its functionality. Salicylates are found

ubiquitously in plants, and like flavonoids, it is involved with the development of

flowers and disease prevention in plants (Raskin, 1992). Salicylic acid inhibits

cyclooxygenases by acetylating a hydroxyl group of the enzymes, and in turn blocking

PG synthesis and inflammation.

30

Research Challenges As early as 1966, induction models have been developed to study laminitis.

Lactic acid, oligofructose boluses, black walnut extract and LPS have all been shown

to be effective induction methods in various species. The biggest challenge to live

animal research is cost. Because there is no way to extract tissue from hoof tissue

without causing irreparable damage to the animal, any histological or morphological

analysis requires sacrifice of the research animal. With the monetary constraints of

doing this type of research, the number of animals used and sacrificed is very limited

in most experiments. For this reason, researchers often indicate that conclusions that

can be drawn from the research are limited to the small sampling size. Often times,

when significance is not found, researchers suggest a larger sample size may give the

appropriate P-value.

For many of the same reasons, disease quantification is also a challenge,

particularly slow developing forms of laminitis. Much of the research looking at the

disease use acute induction models. As of yet, it is unclear if there are differences in

blood and histology profiles in acute and sub-acute manifestations of the disease.

MMPs appear to be the best molecular indication at the tissue level, but since MMPs

are only found to be active in the dermal layer, detection of the proteases requires

animal sacrifice. Locomotion scoring and white line evaluation are the best external

sources of disease evaluation but these methods do not give an accurate picture of how

far the disease is progressing at cellular levels.

Research Objectives If trends in lameness continue as they have in the last decade, the ever

increasing financial impact to the dairy producer could have devastating effects,

31

especially to small production units who are particularly vulnerable to market

fluctuations. Lameness is getting more and more attention. There are several models

of induction tried and tested for the disease, but most are focused on acute laminitis.

Knowledge on the progress of sub-acute laminitis is limited to what can be implied

through acute laminitis research. In addition, recent discoveries involving

inflammatory influences on the disease have used endotoxin models of induction.

Although nutrition is the largest contributor to the development of laminitis, it

is a complex disease. There is no cure for laminitis, and as stated previously, once it

progresses to a certain point, there is no going back. Until an effective prevention

strategy is found and implemented, the pressure is on the dairy producer to provide the

optimal environment and diet through careful and intensive management of the

facilities and animals. At this point in time, the best management strategy to control

lameness is prevention. However, with such high rates of lameness across the

country, it is clear more must be done to combat the disease.

Three research objectives have been identified for this research project, with

the hope that the outcome will bring the dairy industry closer to finding an effective

prevention strategy. The first goal of this project is to determine whether nutritional

induction models involve genes found to be involved in endotoxin models. The

second goal was to examine a new induction model of laminitis that focuses on slow

induction of laminitis. The third goal is to test the effects of quercetin, naringin, and

white willow bark as a feed additive on nutritionally challenged dairy cows.

32

Materials and Methods Lactic Acid Trial To examine genes shown to be involved in endotoxin induction models, an

acute laminitis model described by Morrow et al. (1973) was used. This trial was

made possible through funding by OmniGen Research, LLC, and was carried out at

the OmniGen Research Farm. Twelve lambs, seven months of age, were used for this

trial. The lambs were randomly assigned to three groups, a control group, a 4-hour

slaughter group (4HS) and a 48-hour slaughter (48HS) group. 4HS and 48HS

treatment groups received an infusion of 180 ml of 85% D/L lactic acid (LA) (Sigma-

Aldrich Inc., St. Louis, MO) into the rumen using an esophageal tube before being

slaughtered at the Oregon State University slaughter facilities. Animals were

slaughtered following industry standard practices and regulations. The control group

was infused with 180 ml of sterile saline solution 48 hours before slaughter. One lamb

in 48HS died before the end of the trial and was not included in the analysis.

Blood samples were taken from the jugular vein with BD vacutainers®

containing EDTA every 2 hours for the first 12 hours after infusion, and at hour 18, 24

and 48. Blood pH was measured at hour 4, 8, 12, 18 and 24 using Thermo Orion 310

pH meter. Blood samples were also submitted to the Oregon State University

Veterinary Hospital Diagnostics Lab for full CBC differential analysis.

Immediately after slaughter, a cross-section of epidermis, laminae and corium

was extracted from the back hoof of each lamb. The keratinized wall of the claw was

cut away to expose the soft tissue underneath. With a scalpel, tissue was peeled away

from the underlying bone. Tissue reserved for PCR was snap frozen with liquid

33

nitrogen and stored at -80°C until analysis. Tissue for histopathological analysis was

extracted by the pathologist at the Oregon State University Veterinary Hospital

Diagnostic Lab who performed the analysis. In addition, tissue samples were

analyzed using RT-PCR to analyze mRNA levels for numerous cytokines and

proteases implicated in laminitis, including TNF α, MIP-1α, COX-2, MMP-2, -9 and -

14. Primers for β-actin were also synthesized, and this gene was included in all Q-RT-

PCR analyses for the purpose of data normalization. Gene sequences were obtained

from the National Center of Biotechnology Information, and primers were determined

using Beacon Design (Premier Biosoft International, Palo Alto, CA) (see Table 3).

Table 3. Primer sequences and melting and annealing temperatures.

Gene Sense sequence Anti-sense sequence Annealing

temp Melting

temp β-actin CGCCATGGATGATGATATTGC AAGCCGGCCTTGCACAT 84 58 TNF- α CGGTGGTGGGACTCGTATGC CAATGCGGCTGATGGTGTGG 81 54 COX-2 TCACCTCCGCTTCACTTGTTC AAACTGACCCTGAGCACTTATCC 83 56 MIP-1 CAGCAGCAAGCACCGAGTC GCGACATAGGAGAAGCAGCAG 81 58

MMP-2 GACCAGAGCACCATTGAGACC CACGAGCGAAGGCATCATCC 83 58 MMP-9 TGAGGGTAAGGTGCTGCTGTTC AAGATGTCGTGCGTGCTAATGG 81 58 MMP-14 CAACCCAGGACCACTTC CGCCAGAACCAACGC 83 58

MyiQ single-color real-time PCR detection system (Bio-Rad, Hercules, CA) was used

in the study, and sample and primers were prepared for PCR using iScript One-Step

RT-PCR kit with SYBR Green (Bio-Rad, Hercules, CA). Primers were screened

using whole blood samples collected in the same manner as this study to determine

proper annealing and melting temperatures for each primer, which were used in the

PCR protocols to separate PCR product signal from primer-dimer signal. Samples

were run at 50°C for ten minutes for the initial reverse transcription step, then 45

34

cycles of denaturation at 95°C for ten seconds per cycle. The primer annealing step

was performed at annealing temperature for each primer for 30 seconds, followed by

the melting temperature for 15 seconds, 95°C for one minute, and 55°C for one

minute. The melting step consisted of 80 cycles with an increase in temperature after

the second cycle at a rate of 0.5°C per cycle. Finally, the fluorescent signal was

measured at the greatest frequency. CT values were analyzed as described in Livak et

al., (2001) using the 2-∆∆CT method, where ∆∆CT= (CT, Target - CT, Actin)Time x- (CT, Target

- CT, Actin)Time 0. This method monitors relative gene expression between control and

treatment based on differences in the PCR amplified target reaching a fixed threshold

cycle (CT) number. For this analysis, the CT for control was the calibrator used to

determine relative gene expression changes on treatment for each β-actin-normalized

test gene.

Feeding Trial The Oregon State University Institutional Animal Care and Use Committee

approved all procedures involving animals in this project. This project was carried out

at the Oregon State University Dairy and made possible through funding by OmniGen

Research, LLC. Eighteen multiparous lactating Holstein cows with no history of sole

ulcers were utilized for this trial. They were selected from a pool of animals at the

Oregon State University Dairy. All cows selected had no ulcers present before trial,

and only slight white line separation evident. Cows selected were blocked by days in

milk and randomly assigned to three treatment groups. Over the course of the trial,

one cow from the HEQ group developed mastitis and had to be removed from the trial

for treatment, resulting in an incomplete block.

35

The control group received the normal total mixed ration (TMR) formulated

for the OSU dairy containing 38% NDF and 36% NFC. The high energy group (HE)

received a high carbohydrate diet consisting of less fiber than the normal TMR: 32%

NDF, and more corn: 42% NFC, the main source of carbohydrates in the dairy ration

(see Tables 4 and 5). A second high energy group (HEQ) was supplemented with 40g

of 95% quercetin extract, 24g of 95% naringin extract, and 180g white willow bark

every day. Plant extracts were purchased through Amax NutraSource, Eugene OR.

Supplement was hand-mixed into TMR for each cow after delivery by OSU dairy

staff. The HEQ group began receiving the additives seven days before the high energy

diets were introduced. On day zero, the high energy rations were started, with a 5-day

ramp-up period in which the amount of corn added to the diet was gradually increased.

The purpose of the ramp-up was to prevent sudden and drastic changes in the rumen

microflora.

The HE and HEQ groups were fed individually using a Calan® gate system.

This system allowed us to monitor and record the daily intake of each cow. Due to the

space constraints at the OSU dairy, the control group was not able to be fed using the

Calan® gate system. These six cows were housed with the main herd; therefore

individual intake was not able to be taken. All other sampling events remained

consistent with the other groups.

Cows were milked twice daily, with weights recorded both by the milkers on

duty and by the dairy computer system and cross checked against each other. When

discrepancies were found, weights recorded by the milkers were used. Three times

throughout the trial milk samples were sent to an independent lab for protein, fat and

36

Table 4. Feed trial ration ingredients. Ration Ingredients

OSU Ration

(lb) * Experimental Ration (lb) *

OSU Total Mixed Grain (lb) *

Corn Silage 31.60 31.60 Grass Silage 38.35 18.00 Alfalfa Hay 10.42 10.42 Ground Corn 7.00 OSU TMG 28.15 28.15 Ground Corn 7.13 Barley Grain 7.13 Soybean Meal 1.56 Distillers Grain 5.71 Whole Cottonseed

4.96

JVB Dairy Mineral

1.67

Cost ($) 3.90 4.10 2.36 *As Fed

Table 5. Ration nutrient analysis.

Nutrient OSU

Ration Experimental

Ration

OSU Total Mixed Grain

Dry Matter

% 51.32 58.57 89.60

Protein % 15.99 16.13 19.06 RUP Prot %* 41.56 42.60 45.66 RDP Prot %* 58.44 57.40 54.34 RDP DM %+ 9.34 9.26 10.36 SOL Prot %* 29.99 26.22 17.77 Fat % 4.69 4.88 6.85 Ash % 8.20 7.55 9.43 NDF % 37.69 32.09 23.95 Rough NDF

% 26.85 20.26 -

eNDF % 29.37 23.48 10.67 ADF % 23.75 19.78 12.81 NEl Mcal/

lb 0.74 0.79 0.91

NEg Mcal/lb

0.47 0.52 0.59

NEm Mcal/lb

0.74 0.79 0.7

NFC % 36.42 42.22 44.24 Conc DM

% 45.29 56.30 100.00

Forage DM

% 54.71 43.70 -

*Reported as % of total protein in ration +Total digestible protein as % DM in ration

37

somatic cell counts (AgriTech Analytics, Visalia, CA). Three weeks into the trial,

rumen pH was tested using a Thermo Orion 310 pH meter, to use as an indicator of

acidotic events in the rumen. Rumen fluid was siphoned using an esophageal tube.

On day 0, day 70, and 70 days post-trial, all cows were evaluated with the

assistance of Travis Robison, a certified hoof trimmer contracted by the OSU dairy for

overall hoof health. Pictures of each hoof were taken and measurements were taken of

the white line and the claw width at the widest part of the hoof using a caliper. To

account for differences in pictures of distance and angle, a ratio of the white line width

and hoof width was used for analysis. Locomotion scores were also recorded three

times over the course of the trial.

Statistical Analysis All data with multiple sampling periods were analyzed using the MIXED

procedure of SAS 9.1 (SAS Users Guide, 2001). The model used for the lactic acid

induction trial is Y= µ + Tk + Skl + Rm + TRkm + eklm where µ= overall mean, Tk = kth

treatment group (control, 4HS, or 48HS), Skl = lth sheep in kth treatment group, Rm =

hour (repeated measure), TRkm = treatment repeated-measure interaction, and e =

residual error. For data with equally spaced measures, AR(1) auto-regression was

used. Akaike’s information criteria (AIC) was used to select the best covariance

structure from one of three spatial structures [SP (POW) (spatial power law), SP

(GAU) (Gaussian), and SP (SPH) (spherical)] for unequally spaced repeated measures

(Littell et al., 1996). Trends over time were determined using differences in least

square means (LSMEANS/PDIFF) when treatment significance was found. Statistical

analysis of PCR data was performed using analyses of variance (ANOVA) with SAS.

38

For the feed trial, cows were nested within block of days in milk (DIM) and

defined as the subject. AR(1) covariance structure was used because all data collected

had equally spaced measures. Model used was Y= µ + Covo + Bi + Tk + C(ik)l + Rm +

TRkm + eiklm where µ= overall mean, Covo = oth regression coefficient for pretrial

measurements (used only for daily feed intake or milk yield), Bi = ith block (1,2…6),

Tk = kth treatment group (control, HE or HEQ), C(ik)l = lth cow within ith block and

kth treatment group, Rm = day (repeated measure), TRkm = treatment-day interaction,

and e = residual error. Trends over time were determined using differences in least

square means (LSMEANS/PDIFF) when treatment significance was found. Hoof

evaluation data was analyzed using logistic regression for binomial data using the

model Y = µ + Tk + H(ik)l + TH(ik)l + e(ik)l where µ = overall treatment mean, Tk = kth

treatment group, H(ik)l = ith hoof (1,2…4) from lth cow in kth treatment group, TH(ik)l

= treatment-hoof interaction, and e = residual error.

Results Lactic Acid Trial Blood pH Blood pH was taken for the first 24 hours after treatment from the control

group and 48HS (see Figure 2). Comparison between groups indicate a significant

difference in pH by four hours after treatment (P<0.05), but by 18 hours post-

treatment, the two groups do not differ from each other (P>0.05). By 24 hours post-

treatment, pH levels were back to pre-trial levels in both groups (p>0.05). Lower

blood pH in LA infused animals indicates absorption of LA increased the acidity of

the blood and confirmed the onset of metabolic acidosis in affected animals.

39

7.1

7.2

7.3

7.4

7.5

7.6

7.7

7.8

0 4 8 12 16 20 24

Hour

pH

Control

48HS

Figure 2. Least square mean blood pH relative to LA infusion.

CBC Differential Focus for this project included total WBC counts, individual counts for all

types of WBCs, red blood cells (RBC), plasma protein, fibrinogen, hemoglobin and

platelet counts. Because 4HS only had 3 measurements, data was examined in 2 ways.

The first four hours after induction were analyzed including all three groups. The

control and 48HS groups were also analyzed separately over the entire 48 hours of the

trial and reported separately in Tables 6 and 7. Figures 2, 3 and 4 include least square

means from both analyses.

During the first four hours after LA infusion, the control group fell within the

normal limits of all blood factors analyzed. The 4HS group had abnormally large

numbers of WBC and platelets and the 48HS had abnormally large numbers of WBC,

platelets and eosinophils. RBC, hemoglobin, platelet, plasma protein and fibrinogen

counts all did not show significant differences between groups (P>0.05, see Table 6).

40

Table 6. CBC differential least square means and P values in first four hours after LA infusion.

Control 4HS 48HS Normal Range LSM SE LSM SE LSM SE

P Value

WBC (cell/ul)

4,000-12,000 12,082 1,029.08 15,476‡ 1,029.08 19,894‡ 1,188.28 0.004†*

RBC (cellx106/ul)

9-15 12 0.53 13 0.53 13 0.61 0.21

Plasma Protein (g/dl)

6-7.5 7 0.17 7 0.17 7 0.2 0.65

Platelet (x1000/ul)

250-750 630 93.96 896 ‡ 93.96 537 108.49 0.077

Hemoglobin (g/dl)

9-15 13 0.66 15 0.66 15 0.76 0.08

Fibrinogen (mg/dl)

100-500 217 42.35 283 42.35 297 48.9 0.46

Neutrophil (cell/ul)

7,00-6,000 5,386 894.76 11,187‡ 894.76 14,093‡ 1,067.79 0.001*†

Lymphocyte (cell/ul)

2,000-9,000 5,780 406.81 3,553 406.81 5,393 488.66 0.01*

Monocyte (cell/ul)

<750 322 84.61 137 94.32 370 108.91 0.26

Eosinophil (cell/ul)

<1,000 618 173.29 620 173.29 1,189‡ 288.51 0.15

† treatment-hour interaction significant (P<0.05) ‡Cells counts larger than normal limits *significant at P=0.05 Monocyte and eosinophil counts also showed no significant differences between

groups (P>0.05). WBCs and neutrophils showed treatment-hour interaction (P>0.05).

To examine counts between control and 48HS across the 48 hours of the trial,

data from 4HS were not included in the analysis and Akaike’s information criteria

(AIC) was used to select the best covariance structure from one of three spatial

structures [SP (POW) (spatial power law), SP (GAU) (Gaussian), and SP (SPH)

(spherical)] for unequally spaced repeated measures. WBC, RBC, neutrophils,

lymphocytes, and hemoglobin all differed significantly between control and 48HS,

however, WBC count is the only analysis that did not have significant treatment-hour

interaction. WBCs also fell outside of normal limits in both groups (see Table 7).

41

Table 7. CBC differential least square means and P-values for control and 48HS Control 48HS

Normal Range LSM SE LSM SE

P Value

WBC (cell/ul)

4,000-12,000 12,031‡ 1,305.98 23,253‡ 2,508.01 0.003*

RBC (cellx106/ul) 9-15 12 0.25 14 0.29 0.002†*

Plasma Protein (g/dl) 6-7.5 6.71 0.098 6.56 0.11 0.72

Platelet (x1000/ul) 250-750 639 63.83 566 73.71 0.49 Hemoglobin (g/dl) 9-15 12.27 0.54 15.03 0.62 0.02†*

Fibrinogen (mg/dl) 100-500 250.0 21.44 322.22 24.76 0.07

Neutrophil (cell/ul) 700-6,000 5,369 1,487.58 17,429 1,735.57 0.003†*

Lymphocyte (cell/ul) 2,000-9,000 5,849 251.91 4,452 299.7 0.02†*

Monocyte (cell/ul) <750 234 65.44 413 79.44 0.14

Eosinophil (cell/ul) <1,000 606 92.06 791 140.09 0.32

†treatment-hour interaction significant at P=0.05 *significant at P=0.05 ‡Cells counts larger than normal limits

WBC counts in 4HS and 48HS increased dramatically by 4 hours after infusion

and 48HS remained elevated throughout the first 24 hours of the trial (see Figure 3).

By 4 hours, there was a 67% increase in WBCs in 4HS compared to the control group.

48HS WBC populations saw a 100% increase after 24 hours of LA infusion. In the

48HS group there was a 99% increase in WBC counts compared to control by 4 hours

after infusion, and a 154% increase by 24 hours. By slaughter, 48HS counts had

returned to pretrial levels.

42

0

5000

10000

15000

20000

25000

30000

35000

40000

0 4 8 12 16 20 24 28 32 36 40 44 48Hour

Control

4HS

48HSW

BC

/ul

Figure 3. Least square mean WBC counts relative to LA infusion.

Lymphocytes are the only WBC that demonstrated a differential response

without a treatment-hour interaction in the first four hours of induction (P<0.05, see

Figure 4). When comparing treatment groups across sampling times, the control

group did not differ from 4HS or 48HS at the start of the trial (P>0.05), but 4HS and

48HS did differ significantly. Two hours after LA infusion, the 4HS group was

significantly different from control and 48HS groups (P<0.05), and the 48HS did not

differ from control (P>0.05). By 4 hours after infusion, lymphocyte populations

decreased by 46% in the 48HS group and 39% in 4HS compared to the control group.

When comparing within treatment groups, 4HS had a 39% decrease in lymphocyte

population by 4 hours. 48HS decreased by 46% at 4 hours, 56% by 24 hours and

remained low for the remainder of the trial.

43

0100020003000400050006000700080009000

0 4 8 12162024283236404448

Hour

Control

4HS

48HSL

ymph

ocyt

e/ul

Figure 4. Least square mean lymphocyte count relative to LA infusion.

Depressed lymphocyte populations indicate that LA infusion had a dramatic impact on

immune function. As suggested by Fontaine et al. (2001), lower counts of circulating

lymphocytes could be the result of increased tissue infiltration in the hoof.

Neutrophil counts demonstrated the same trends as WBCs. In fact, mainly

neutrophils populations are responsible for such large WBC counts (see Figure 5). By

2 hours after infusion, 4HS increased by 151%, and 48HS increased by 121%, and was

203% and 238% higher, respectively, compared to control at 4 hours after infusion.

48HS remained significantly elevated for the remainder of the trial.

Neutrophils are the first line of defense in the immune response; therefore, an

increase in circulating neutrophils clearly demonstrates a quick immune response after

LA infusion. This is likely due to damage of the epithelial lining of the rumen caused

by the acidic environment in the rumen.

44

0

5000

10000

15000

20000

25000

30000

35000

0 4 8 12 16 20 24 28 32 36 40 44 48Hour

control4HS

48HSN

eutr

ophi

ls/u

l

Figure 5. Least square mean neutrophil count relative to LA infusion.

Tissue Analysis Tissue PCR

PCR analysis resulted in interesting trends that , in some cases did not reflect

results from previous research. P-values, means and standard errors for all genes are

presented in Table 8.

Table 8. Tissue mRNA treatment means, standard errors and P-values. Control 4HS 48HS

Gene Mean 2-∆∆CT SE Mean 2-∆∆CT SE Mean 2-∆∆CT SE

Treatment P-value

COX-2 1.07 0.23 0.30 0.08 1.43 0.83 0.10 MIP-1 1.01 0.06 2.09 1.85 2.65 1.27 0.50

MMP-2 1.11 0.30 0.37 0.06 1.04 0.54 0.18 MMP-9 1.19 0.54 0.36 0.12 5.01 3.04 0.12 MMP-14 1.22 0.51 0.28 0.15 4.58 3.09 0.28

COX-2 mRNA expression did not differ significantly; however, with a P-value

of 0.10, it is possible that larger sample sizes could prove to be more definitive. There

was a large decrease in COX-2 expression at 4 hours, and at 48 hours was slightly

higher than the control group (see Figure 6). Waguespack et al. (2004) found COX-2

to be significantly up-regulated between 2.5 and 3.5 hours after induction of laminitis

which directly conflict with results presented here. It is possible that endotoxin

45

induction models elicit different responses in COX-2 expression and that COX-2 plays

a different role in such induction models.

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

Contol 4HS 48HS

CO

X-2

/β-a

ctin

mR

NA

Figure 6. COX-2 mRNA expression in tissue. Samples normalized with β-actin and presented as X-fold increase compared to control gene COX-2 expression. MIP-1α mRNA expression gives a slightly different picture than COX-2 even

though both are mediators of inflammation. By 4 hours after LA infusion, mRNA

expression was over 2.5 times higher than in control animals and remained elevated in

the 48HS group (see Figure 7). Significance was not found between any groups

(P>0.05). These results suggest MIP-1α may play a more important role in the

progression of laminitis than does COX-2.

46

0

0.5

1

1.5

2

2.5

3

Control 4HS 48HS

MIP

-1/β

-act

in m

RN

A

Figure 7. MIP-1α mRNA expression in tissue. Samples normalized with β-actin and presented as X-fold increase compared to control gene MIP-1α expression. MMP-9 mRNA expression reflected results from previous research MMP

function in laminitis, but did not result in significant differences between treatment

groups (see Figure 8).

0

1

2

3

4

5

6

Control 4HS 48HS

MM

P-9

/β-a

ctin

mR

NA

Figure 8. MMP-9 mRNA expression in tissue. Samples normalized with β-actin and presented as X-fold increase compared to control MMP-9 expression.

47

By 48 hours after LA infusion, MMP-9 mRNA expression was five times higher

compared to the control group. Unfortunately, large variances within 48HS resulted in

a large P-value.

Although MMP-2 mRNA expression was slightly lower at 4 hours, MMP-2

was not differentially expressed in treatment groups (see Figure 9). Like COX-2

mRNA expression, MMP-2 results conflict with previous research. Using a nutritional

induction model, Pollit et al. (2004) demonstrated a two fold increase in MMP-2

mRNA expression 48 hours after induction of laminitis.

0

0.2

0.4

0.6

0.8

1

1.2

Control 4HS 48HS

MM

P-2

/β-a

ctin

mR

NA

Figure 9. MMP-2 mRNA expression in tissue. Samples normalized with β-actin and presented as X-fold increase compared to control MMP-2 expression. MMP-14 acts in concert with other regulatory molecules called tissue

inhibitors of metalloproteinases (TIMPs) to regulate MMP-2 expression. By 48 hours

after LA infusion, MMP-14 mRNA expression was 4.5 times higher compared to the

control group, but once again, due to large variances, no significance was found (see

Figure 10). This suggests that MMP-2 activity in the ovine hoof may play a role after

48

48 hours of induction and not before. It is also possible that mRNA expression does

not change in laminitic lambs, but protein function is altered through MMP-14

activity.

0

1

2

3

4

5

Control 4HS 48HS

MM

P-1

4/β

-act

in m

RN

A

Figure 10. MMP-14 mRNA expression in tissue Samples normalized with β-actin and presented as X-fold increase compared to control MMP-14 expression. Tissue Histology Histopathological analysis of tissue samples was very compelling. All animals

in 4HS and 48HS showed evidence of marked vascular congestion, compared to only

one animal from the control group. This suggests possible vascular shunting and

blood perfusion into tissue. One animal from both 4HS and 48HS had acute

hemorrhaging in the corium as well as evidence of edema. Histologically, all animals

appeared normal, meaning no morphological changes were evident throughout the

tissue. Thrombi formation was found in all but one animal at time of slaughter.

Photographs were taken of each slide used for analysis. Representative slides from

each group are presented in Figure 11. There is a clear difference between 4HS and

the other two groups. The tissue appears dehydrated and lack of blood flow and

pressure throughout the hoof could explain the pale appearance of this tissue.

49

Figure 11. Tissue histology. a = Control b = 4HS c = 48HS. Feeding Trial Changes in White Line White line measurements were taken from photographs of each hoof. To

compensate for differences in distance and angle of the photograph when taken, a ratio

of the white line to the claw was used for analysis. Since the width of the claw does

not change in a mature cow, the ratio normalized the measurements regardless of

photograph angle and distance.

Due to camera and photographer error, most pictures had the bottom edge of

the hoof cut off. For this reason, pictures of the right front (RFH) and left back hooves

(LBH) are more pertinent than right back (RBH) or left front (LFH). White line

separation is more prone to occur on the weight bearing claw at the apex on the side of

the hoof (Greenough, 1997). Front hooves bear the weight on the outside claw, and

back hooves bear the weight on the inside claw. In most pictures, the weight bearing

claw on the left front and right back were cut off due to the orientation of the cow

when the photograph was taken. As can be seen from Figure 12, the white line on

a b c

Thrombus?

Vascular congestion

50

both claws is clearly visible, but the white line at the apex of the bottom claw is

obscured.

Figure 12. Photograph used for white line measurement. For data analysis, each set of hooves were analyzed separately. For example, all

measurements taken from the right front hoof were analyzed separately from

measurements taken from the left front hoof.

Right Front Hoof There was an outlier, an unusually large measurement, found in the day 0

measurement for the HE group that results in the day 0 average for the group to be

much larger than the other groups. Rechecking of the measurement showed it was not

a mis-measurement, and there are no clear explanations for the outlier. Analysis of

data with the outlier shows significance, and removal of outlier results in loss of

significance at P=0.05 (See Table 9). Analysis with the outlier included indicates

treatment effect was significant (P<0.05). Interaction terms were not significant

(P>0.05). Blocking was also found insignificant, but barely so (P=0.06). When

51

comparing control group to the HE group, significant differences were found in day 0

sampling (P<0.05), assumed to be due to the extremely large value in the HE group.

Table 9. RFH least square mean white line/claw ratio, standard errors and P values.

Control HE HEQ

LSM SE LSM SE LSM SE Treatment P-value P value Outlier 0.052 0.006 0.074 0.007 0.048 0.007 0.0489*

w/o Outlier 0.052 0.005 0.065 0.006 0.043 0.005 0.0779+ *Significant at P=0.05 +Significant at P=0.08

Data did not show significance at day 70 or day 140 (P>0.05). Comparison of the

control and HEQ groups did not result in significant differences across any sampling

periods (P>0.05), but differences were found between HE and HEQ. Again, at day 0

there was significance (P<0.05, see Figure 13). By day 140, all control and HEQ

animals returned to measurements recorded at day 0 (P>0.05). HE measurements at

day 140 are much smaller than day 0 values (P<0.05), but can be attributed to the

extremely high value found at day 0.

When data was analyzed without the outlier included, a slightly different

picture emerges (see figure 14). Treatment effect is no longer significant at P=0.05,

but treatment would result in significance at P=0.08. Blocking is not significant, as

well as interaction terms (P>0.08). The major distinction from the previous analysis is

comparison between groups on day 0 and day 70 sampling periods. Control and HE

groups are no longer significantly different (P>0.08); however, HE and HEQ are still

significantly different at day 0 (P=0.06). No differences were found at day 70

between control and HEQ (P>0.08). However, there is significance between

differences in HE and HEQ. HE and HEQ differences are found to be highly

52

significant at day 70 (P<<0.08). By day 140, all three groups have returned to levels

seen at day 0.

0

0.02

0.04

0.06

0.08

0.1

0.12

0 70 140

Day

Control

HE

HEQ

WL

/Wid

th

Figure 13. RFH least square mean white line/claw ratio over time with outlier.

0

0.02

0.04

0.06

0.08

0.1

0 70 140

Day

ControlHEHEQ

WL

/Wid

th

Figure 14. RFH least square mean white line/claw ratio over time w/o outlier.

53

Left Back Hoof As with the RFH, an unexplainable outlier was found in day 0 data as well.

The outlier was also in the HE group, but a different cow. Although there is no

significance found with the outlier included in the analysis (P>.05), removal of the

outlier results in significance (P<0.05, see Table 10).

Table 10. LBH least square mean white line/claw ratio, standard errors and P values. Control HE HEQ LSM SE LSM SE LSM SE

Treatment P-value P value Outlier 0.053 0.010 0.084 0.010 0.053 0.011 0.095

w/o Outlier 0.053 0.006 0.077 0.006 0.054 0.007 0.043 * *Significant at P=0.05

Since analysis with the outlier included results in a non-significant P value

(P>0.05), comparisons between sampling days cannot be made; however, removal of

the outlier yields a significant treatment effect (P<0.05). Comparisons made in this

analysis are similar to what was seen in the right front hoof. No differences were

found between HEQ and control across sampling periods (P>0.05). HE was

significantly higher than control at day 0 (P<<0.05), but not at day 70 or 140 (P>0.05).

Like the control group, HE white lines were much larger than HEQ at day 0 (P<0.05).

However at day 70, HE was still significantly higher than HEQ (P<0.05). By day 140,

no differences were found between groups (P>0.05, see Figure 15).

54

0

0.02

0.04

0.06

0.08

0.1

0 70 140

Day

Control

HE

HEQWL

/Wid

th

Figure 15. LBH least square mean white line/claw ratio over time w/o outlier. Right Back and Left Front Hooves The RBH showed no response to treatment (P>0.05). However, in the LFH, a

clear trend emerges. If significance is set at P=0.06, a response to treatment is seen

(see Table 11). Blocking and interaction terms were not significant (P>0.06).

Table 11. LFH and RBH least square mean white line/claw ratio, standard errors and P values. Control HE HEQ LSM SE LSM SE LSM SE

Treatment P-value P value LFH 0.046 0.0046 0.057 0.0048 0.037 0.0053 0.056*

RBH 0.074 0.019 0.084 0.020 0.063 0.022 0.79 *Significant at P=0.06

With significance set at P=0.06, comparisons between groups and sampling

periods can be made. At day 0, no differences were seen in any treatment groups

(P>0.06). At day 70, HE was significantly higher than both control (P>0.06) and HEQ

(P>>0.06). By day 140, as seen in other analyses, all groups had returned to previous

levels and no differences were found between groups (P>0.06, see Figure 16).

55

00.010.020.030.040.050.060.070.080.09

0 70 140

Day

Control

HE

HEQ

WL

/Wid

th

Figure 16. LFH least square mean white line/claw ratio over time. Hoof Evaluation

At day 70 and day 140, a physical examination was given to each cow

with the help of a hoof trimmer contracted by the OSU dairy. Tables 12 and 13 show

these observations. Statistical analysis of each symptom was performed with and

without hoof included into the model, but no significance was found in either analysis

(P>0.05, data not presented). Even though no significance was found, trends that were

seen in other data can still be seen. HEQ appeared to develop less physical symptoms,

and severity of these symptoms was less than HE.

At day 0 no ulcers or pronounced white lines were observed. At day 70, the

control group had no ulcers present and 3 ulcers were observed in HEQ, whereas 7

ulcers were observed in HE. By day 140, all ulcers observed in HE had healed, but

one ulcer developed since day 70. In HEQ, one ulcer observed at day 70 had healed

by day 140.

56 Table 12. Hoof evaluation at day 70.

Day 70 Sensitivity WL separation ulcers treatment cow LFH RFH LBH RBH LFH RFH LBH RBH LFH RFH LBH RBH control 783 839 827 828 833 844

HE 720 777 792 830 840 841

HEQ 774 790 791 832 834 sensitive Pronounced WL Ulcer Present required claw pad Bleeding WL

57 Table 13. Hoof evaluation at day 140. Day 140 Sensitivity WL separation ulcers Stress Grooves treatment cow LFH RF LBH RBH LFH RFH LBH RBH LFH RFH LBH RBH LFH RFH LBH RBH control 783 839 827 828 833 844

HE 720 777 792 830 840 841

HEQ 774 790 791 832 834 sensitive Pronounced WL Ulcer Present Stress Grooves

required claw pad Bleeding WL

58

Several pronounced white lines were observed across treatment groups. In the

control group, 6 pronounced white lines were observed with 1 having blood perfusion.

Eleven pronounced white lines were observed in HE, 4 of those having blood

perfusion. Seven pronounced white lines were observed in HEQ, but none had blood

perfusion evident. Although HEQ exhibited 2 bleeding white lines by day 140, overall

observances did not change much in number of manifestations.

By day 140, stress grooves were evident in several cows fed the high energy

ration. Stress grooves appear as lines in the horn of the hoof and can be caused by a

number of things (Greenough, 1997). Drastic changes in diet, such as the animals in

HE and HEQ were subjected to during the trial can cause stress grooves. Diseases

such as mastitis can also result in stress grooves. It is interesting to note that at day

70, the majority of white line disease and ulcers observed were in the rear hooves.

Not only are the weight bearing claws more susceptible to laminitis, but the rear

hooves are more prone than the front hooves (Greenough, 1997).

Locomotion Score, Feed Intake and Rumen pH Locomotion scores were taken three times through the course of the trial by an

evaluator with limited knowledge of treatment groups. No differences were found

between groups (P>0.05, data not presented). Due to chance, two of the cows

randomly assigned to the HEQ group ate approximately 20 pounds more every day

than any other cows, so a covariate was added into the model to compensate for the

large difference between groups at the beginning of the trial. The covariate was the

average daily intake for seven days before high energy diets and supplementation were

started. With the addition of the covariates, feed intake did not differ between HE and

59

HEQ groups (P>0.05, data not presented). However, the HEQ group still ate an

average of nine pounds more per day than the HE group which suggests the possibility

of increased palatability of ration with the feed additive.

Rumen pH was taken twice through the course of the trial to evaluate acidotic

events in the rumen. Rumen fluid taken via esophageal tube is likely to be

contaminated with excess saliva during extraction. Since saliva is one of the main

buffering systems for the rumen, fluid samples taken by this method are usually 0.5

points higher than actual levels. pH measurements were adjusted before analysis to

compensate for this phenomenon. No significant differences were found (P>0.05);

however, there were numerical differences between control and high energy groups

(see Figure 17). Both high energy groups had a lower rumen pH than the control

group, which is what is expected with a high carbohydrate diet.

5.8

5.85

5.9

5.95

6

6.05

pH

Control HE HEQ

Figure 17. Least square mean adjusted rumen pH.

60

Milk Yield and Composition Once again, milk yield differences between groups were skewed due to two

cows who were unusually high producers, the same two cows who skewed the feed

intake data. The average daily production seven days previous to leaving the main

herd was used as a covariate for analysis. Milk samples were taken three times during

the course of the trial to evaluate for quality. Protein and fat yield and somatic cell

count (SCC) were analyzed. In all analyses of milk data, no significant differences

were found between treatment groups and all fell within the normal range of values

(data not presented).

Discussion

CBC differentials from the LA infusion trial were quite informative and in

some cases, surprising. WBC counts differ from results presented by Hurley et al.,

(2006). Hurley reported an initial decrease in WBC counts within the first three hours

of laminitis induction, followed by a significant increase by twelve hours post-

induction. The LA induction study does not demonstrate an initial decrease followed

by an increase. By four hours after induction, WBC populations had increased by

99% and peaked at 24 hours. Neutrophils counts peaked by 24 hours after LA

infusion with an incredible 238% increase compared to hour 0 counts in 48HS. No

decreases below pretrial levels were evident at anytime throughout the trial. This

could be explained in a number of ways. Hurley used an endotoxin induction model,

whereas the LA induction is a nutritional induction model. It is possible that

endotoxins elicited a brief suppression of the immune system before WBCs began to

proliferate, whereas LA did not inhibit WBC production. In addition, species

61

differences or cell collection methods could account for conflicting results. Hurley

used flow cytometry for cells counts where as CBC differentials were used for this

project. Flow cytometry is much more sensitive and not as prone to human error as

CBC differentials.

Significant decreases in circulating lymphocyte populations could be explained

by LA infusion suppressing the adaptive immune system and resulting in a decrease in

lymphocyte production; however, given the role of lymphocytes in inflammation

during laminitis, an increase in lymphocyte numbers was expected. RBC counts and

hemoglobin were the same across treatment groups before LA infusion, but became

increasingly large throughout the trial in 48HS. Although fibrinogen was not

significantly different across treatment groups, the same trend was evident. This is

most likely explained by sampling technique and effects of LA in the blood stream.

Several sets of blood samples were taken from the jugular vein over a period of 48

hours. Repeated punctures in the vein, as well as likely dehydration as a result of the

LA are most likely responsible for these increases. Numerous punctures of the vein

undoubtedly activated blood clotting mechanisms, of which RBCs, fibrinogen and

hemoglobin all play a role. Dehydration from the LA more than likely exacerbated the

differences between the control and 48HS groups (Morrow et al., 1973).

PCR analysis of tissue samples was much less definitive, but still worth

exploring. MMP-2 and MMP-9 have both been implicated in normal hoof growth and

in equine and bovine laminitis. In this project, MMP-2 did not show any clear trends

indicating up-regulation of RNA expression. Species differences could explain these

conflicting results. Small sample size could have also influenced the results.

62

Although sheep can develop laminitis, they are much less susceptible to the

disease because production systems and nutrition programs for the species are not as

intensive as the dairy industry. However, sheep are often used as a model for

research due to smaller costs associated with acquisition and slaughter of the animals.

Anatomy of the sheep hoof differs slightly from bovine anatomy in that the white line

is not clearly visible from the underside of the hoof. It is possible that because of

these slight differences in anatomy, the ovine MMPs do not play as important of a role

in laminitis progression. Inflammation and changes in vasculature give clearer trends

in this induction model than do MMPs. Given the dramatic changes in WBC profiles

and trends in inflammatory molecule expression, it is clear the animals infused with

LA developed laminitis; however, since MMP-2 did not show any trends towards up-

regulation, species differences is a likely explanation for conflicting results.

Another possible explanation for conflicting results could be the age of the lambs used

in the trial. At 7 months, hooves are still growing. MMP activity could be drastically

different in young animals still in developmental stages of growth compared to adult

animals.

MMP-9 showed trends to support previous research presented in the literature

review even though significance was not found. At 4 hours, MMP-9 had a slight

decrease in expression, but increased five-fold at 48 hours compared to control

animals. Up-regulation at 48 hours was expected according to previous research, and

once again, an increase in sample size could bring significance.

MMP-14 was included in PCR analysis due to its role in normal hoof growth

even though it has not been specifically implicated in laminitis. The literature review

63

on MMPs did not uncover any possible decrease in expression in the early stages of

laminitis, therefore such dramatically low levels of MMP-14 at 4 hours was not

expected. Once again, small sample size could be a factor, but it is also likely that

MMP-14 does not play the same role in the early stages of ovine laminitis as in bovine

or equine laminitis. It is likely that MMP-14 regulates MMP activity through changes

in protein activity, not mRNA expression.

Similar to MMP expression, COX-2 also exhibited a depression of mRNA

expression at 4 hours and a slight increase in expression by 48 hours. These

conflicting results with previous research suggest that COX-2 does not play the same

role in nutritionally induced laminitis as it does in endotoxin induction models. Since

MIP-1α exhibited up-regulation by 4 hours after induction, it is possible that MIP-1α

plays a prominent role in the early stages of laminitis development.

The feed trial did not result in many concrete answers, but some interesting

trends had developed. Outliers and incomplete blocks confound the interpretation of

these trends, but further examination of the data gives credence to the possibility of

preventative effects of the feed additive as well as the effectiveness of the induction

model.

In the RFH, response trend with the outlier removed is clearly the response

expected. Unfortunately, removal of the data point results in loss of significance.

The clear difference between HE and the other treatment groups at the start of the trial

skews the rest of the analysis, which may explain why the blocking P value was so

different from the rest of the analyses and so close to significant (P=0.06). Removal

of the outlier resulted in a lack of response difference, but given that the P value was

64

close (P=0.078), it is likely an increase of sample size would increase the power of the

response and decrease the power of experimental error.

Examination of measurements taken from the LFH supports the trends seen in

RFH and LBH without the outliers included in the analysis. Much like the RFH, a

similar outlier at day 0 created a large gap between the other two groups in the LBH.

In this analysis, inclusion of the outlier removed significance, whereas the exclusion

of it resulted in a significant difference in response. Since there is no clear

explanation of either outlier, and removal of them resulted in different statistical

outcomes, they cannot be ignored. However, since analysis of the LFH demonstrated

a significant increase in response in the HE group compared to control and HEQ

groups without the complication of outliers, removal of the outliers is likely the more

valid approach.

When examining the data with the outliers removed, the RFH in the HE group

had a 14% increase in white line/claw ratio over the course of the trial compared to a

12% decrease in HEQ. At 70 days, HE white line was 40% larger than the control

group and 100% larger than HEQ. HEQ was 25% smaller than the control group at 70

days. In the LBH, similar trends were found. HE had a 49% increase in white line

over the course of the trial whereas HEQ had only a 5% increase. Compared to the

control group at day 70, HE was 37% larger than control and 84% larger than HEQ.

The key to improving the results of this experimental model is reducing

experimental and environmental error and increasing sample size. In most analyses,

variances within each group were relatively large, even for those with significant

results. Two obvious improvements that would very likely give significant P values

65

are increasing sample size and removing environmental variation. This project was

accomplished with extremely limited resources in terms of space and population size.

With only 90 Holsteins and several research projects going on at one time, the pool of

animals to select from was very small. Selecting lactating animals with no current

hoof health issues made that pool even smaller. A feed trial that required individual

feeding of animals also limited the scope of the trial. Because only twelve Calan®

gates were available for use, we were limited to six cows per treatment group and

forced to keep control cows in the regular herd. Environmental variation between

control and treatment groups makes any definitive conclusions impossible, but given

the clear trends between HE and HEQ groups, this experimental model and feed

additive shows promise. More gates to accommodate more cows and all treatment

groups would likely result in significance and eliminate the power extreme values in

the model.

Another factor to consider is length of trial. Treatment cows received high

energy diets and/or feed additive for 70 days. Leaders in the field of laminitis research

contend that it can take up to three months or more for laminitis to visibly manifest

itself (Greenough, 1997). It is possible that peak response to the high energy diet was

not reached by the conclusion of the feed trial. In both RFH and LBH analyses that

resulted in differential treatment response, HE and HEQ differed significantly by day

70, as well as in the LFH. The lack of response in the RBH suggests a longer trial

could prove to be more successful.

66

Conclusion

The LA infusion trial demonstrated that nutritional models of induction have

the potential to give the same results as endotoxin induction models popularly used in

laminitis research. Increasing sample size, and in turn reducing variation within

groups is necessary to bring definitive answers, especially with PCR analysis of gene

expression.

The vast majority of induction models use acute models of laminitis, but slow,

insidious forms of the disease have a much larger impact on producers and the

industry as a whole. Having a clear understanding of what happens in the hoof in sub-

acute forms of the disease will only help to fight against its progression. The

experimental model developed for this research shows potential, as long as unwanted

sources of variation can be eliminated.

Given the feed additive did not significantly impact the productivity of the

research animals and trends show improvements in white line separation, continued

research with these plant extracts is also justifiable. Potential increase in palatability

makes the additive even more intriguing. Future investigation into dose of each plant

extract with larger sample sizes is necessary to determine optimum results and cost

associated with the additive.

67

Bibliography

Ameer, B., R. A. Weintraub, J. V. Johnson, R. A. Yost and R. L. Rouseff. 1996. Flavanone absorption after naringin hesperidin, and citrus administration. Clin. Pharmacol. Ther. 60:34-60.

Bailey, S. R. 2004. The pathogenesis of acute laminitis: fitting more pieces into

the puzzle. Equine Vet. J. 36:199-203. Belknap, J.K., A. Blikslager, K. Jennings. 2004. Laminar COX-1 and COX-2

protein expression in the developmental stage of laminitis: A case for use of COX-2 selective inhibitors? Proc. Am. Assoc. Equine Pract. 50:341– 344.

Black, S. J., D. P. Lunn, C. Yin, M. Hwang, S. D. Lenz, and J. K. Belknap. 2006.

Leukocyte emigration in the early stages of laminitis. Vet. Immunol. Immunol-path. 109:161-166.

Blikslager, A. T., C. Yin, A. M. Cochran, J. G. Wooten, A Pettigrew, and J. K.

Belknap. 2006. Cyclooxygenase expression in the early stages of equine laminitis: A cytologic study. J. Vet. Intern. Med. 20:1191-1196.

Brovkovych, H., N. Vil, G. Weigel, C. Neumayer, L. Partyka, S. Patton, and T.

Malinski. 1998. Bioflavonoid quercetin scavenges superoxide and increases nitric oxide concentration in ischaemia-reperfusion injury: an experimental study. Brit. J. Surgery 85:1080-1085.

Castillo, J., O. Benavente, and J. A. del Rio. 1992. Naringin and neohesperidin

levels during development of leaves, flower buds, and fruits of Citrus aurantium. Plant Physiol. 99:67-73.

Choi, S. J., J. C. Cruz, F. Craig, H. Chung, R. D. Devlin, G. D. Roodman and M. Alsina. 2000. Macrophage inflammatory protein 1-alpha is apotential osteoclast stimulatory factor in multiple myeloma. Blood. 96:671 – 675.

Clarkson, M. J., D. Y. Downham, W. B. Faull, J. W. Hughes, F. J. Manson, J. B.

Merritt, R. D. Murray, W. B. Russell, J. E. Sutherst, and W. R. Ward. 1996. Incidence and prevalence of lameness in dairy cattle. Vet. Rec. 138:563–567.

Dinarello, C. A. 1993. The role of interleukin-1 in disease. N. Eng. J. Med.

328:106-113.

68

Dinarello, C. A. 1996. Biologic basis for interlerkin-1 in disease. J. Am. Soc. Hematol. 87:2095-2147.

Di Pietro, L. A., M. Burdick, Q.E. Low, S. L. Kunkel and R. M. Strieter. 1998.

MIP-1a as a critical macrophage chemoattractant in murine wound repair. J. Clin. Investigations 101:1693 – 1698.

Dougherty, R. W., K. S. Coburn, and H. M. Cook. 1975. Preliminary study of

appearance of endotoxin in circulatory system of sheep and cattle after induced grain engorgement. Am. J. Vet. Res. 36:831-832.

Eisenburg, D. M., R. B Davis, S. L. Ettner, S. Appel, S. Wilkey, M. Van Rompay, and

R. C. Kessler. 1998. Trends in alternative medicine in the United States, 1990- 1997. JAMA. 280:1569-1575.

Elmes, P. J., and P. Eyre. 1977. Vascular reactivity of the bovine foot to neurohormones, antigens, and chemical mediators of anaphylaxis. Am. J.

Vet. Res. 38:107-112. Enevoldsen, C. and Y. T. Gröhn. 1991. Sole ulcers in dairy cattle: Associations

with season cow characteristics, disease, and production. J. Dairy Sci. 74:1284-1298.

Erexson, G. 2002. Lack of in vivo clastogenic activity of grape seed and grape

skin extracts in an mouse micronucleus assay. Food Chem. Toxicol. 41:347-350.

Erkert, R. S., C. G. MacAllister, M. E. Payton, and C. R. Clarke. 2005. Use of

force plate analysis to compare the analgesic effects of intravenous administration of phenylbutazone and fluxinin meglumine in horses with navicular syndrome. Am. J. Vet. Res. 66:284-288.

Erlund, I, T. Kosonen, G. Alfthan, J. Mäenpää, K. Perttunen, J. Kenraali, J.

Parantainen, and A. Aro. 2000. Pharmacokinetics of quercetin from quercetin aglycone and rutin in healthy volunteers. Eur. J. Clin. Pharmacol. 56:545-553

Espejo, L. A., M. I. Endres, and J. A. Salfer. 2006. Prevalence of lameness in high-

producing Holstein cows housed in freestall barns in Minnesota. J. Dairy Sci. 89:3052-3058.

Evans, CB, S. Pillai, M. E. Goldyne. 1993. Endogenous prostaglandin E2

modulates calcium-induced differentiation in human skin keratinocytes. Prostaglandins Leukot. Essent. Fatty Acids. 49:777–781.

69

Fontaine, G. L., J. K. Belknap, D. Allen, J. N. Moore, and D. L. Kroll. 2001. Expression of interleukin-1β in the digital laminae of horses in the prodomal stage of experimentally induced laminitis. Am. J. Vet. Res. 62:714-720.

Formica, JV, and W. Regelson. 1995. Review of the biology of quercetin and

related bioflavonoids. Food Chem Toxicol 33: 1061-1080. French, K. R., and C. C. Pollitt. 2004. Equine laminitis: glucose deprivation and MMP activation induce dermo-epidermal separation in vitro. Equine Vet. J.

36:261-266. Fugh-Berman, A., and J. M. Cott. 1999. Dietary supplements and natural products as

psychotherapeutic agents. Psychosomatic Med. 61:712-728. Garner, M. R., J. F. Flint, and J. B. Russell. 2002. Allisonella histaminiformans gen. nov., sp. nov. A novel bacterium that produces histamine, utilizes histidine as its sole energy source, and could play a role in bovine and equine laminitis. Sys. Appl. Microbiol. 25:498-506. Greenough, P. R. Lameness in Cattle, 3rd ed. W. B. Saunders Co, Philadelphia: 1997. Hanyuda, M., T. Kasama, T. Isozaki, M. M. Matsunawa, N. Yajima, H. Miyoaka,

H. Uchida, Y. Kameoka, H. Ide and M. Adachi. 2003. Activated leukocytes express and secrete macrophage inflammatory protein-1α upon interaction with synovial fobroblasts of rheumatoid arthritis via β2-intrgrin/ICAM-1 mechanism. Rheumatology. 42: 1390-1397.

Hendry, K. A., C. H. Knight, H. Galbraith and C. J. Wilde. 2003. Basement membrane

integrity and keratinization in healthy and ulcerated bovine hoof tissue. J. Dairy Res. 70:19-27.

Hirst, W. M., A. M. Le Fevre, D. N. Logue, J. E. Offer, S. J. Chaplin, R. D.

Murray, W. R. Ward, and N. P. French. 2002. A systematic compilation and classification of the literature on lameness in cattle. Vet. J. 164:7-19.

Hurley, D. J., R. J. Parks, A. J. Reber, D. C. Donovan, T. Okinaga, M. L.

Vandenplas, J. F. Peroni, and J. N. Moore. 2006. Dynamic changes in circulating leukocytes during the induction of equine laminitis with black walnut extract. Vet. Immunol. Immunol-path. 110:195-206.

Jeon, S., S. Bok, M. Jang, M. Lee, K. Nam, Y. Park, S. Rhee, and M. Choi. 2001.

Antioxidative activity of naringin and lovastin in high cholesterol-fed rabbits. Life Sciences 69:2855-2866.

70

Johnson, P. J., S. C. Tyagi, L. C. Katwa, V. K. Ganjam, L. A. Moore, J. M.

Kreeger and N. T. Messer. 1998. Activation of extracellular matrix metalloproteinases in equine laminitis. Vet. Rec. 142:392-396.

Keiser, J. A., and H. Wang. 1998. Vascular endothelial growth factor upregulates the expression of matrix metalloproteinases in vascular smooth muscle cells: Role of flt-1. Circ. Res. 83:832-840.

Littell, R. C., G. A. Milliken, W. W. Stroup, and R. D. Wolfinger. 1996. SAS system

for mixed models. Cary, NC: SAS Institute Inc. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression

data using real-time quantitative PCR and the 2-∆∆T method. Methods, 25:402-408.

Mamani-Matsuda, M., J. Rambert, D. Malvy, H. Lejoly-Boisseau, S. Daulouede, D. Thiolat, S. Coves, P. Courtios, P. Vincendeau, and M. Mossalayi. 2004.

Quercetin induces apoptosis of Tryanosoma brucei gambiense and decreases the proflammatory response in human macrophages. Antimicrobial Agents and Chemotherapy 48:924-929.

Manach, C, C. Morand, O. Texier, M. Favier, G. Agullo, C. Demigne, F. Regergat,

and C. Remesy. 1995. Quercetin metabolites in plasma if rats fed diets containing rutin of quercetin. J. Nutr. 125:1911-1922.

Middleton, E, and C. Kandaswami. 1992. Effects of flavonoids on immune and inflammatory cell function. Biochem. Pharmacol. 43:1167-1179. Morrow, L., M. E. Tumbleson, L. D. Kintner, W. H. Pflander, and R. L. Preston.

1973. Laminitis in lambs injected with lactic acid. Am. J. Vet. Res. 34:1305-1308.

Mullenax, C. H., F. K. Keeler, and J. A. Allison. 1966. Physiological responses of ruminants to toxic factors extracted from rumen bacteria and rumen fluid. Am. J. Vet. Res. 27:857-868. NAHMS. 1996. Dairy Cattle Information Sheet. National Animal Health Monitoring System. Available at http://nahms.aphis.usda.gov/ NAHMS. 2002. Dairy Cattle Information Sheet. National Animal Health Monitoring System. Available at http://nahms.aphis.usda.gov/ National Research Council. 2001. Nutrient Requirements of Dairy Cattle. 7th rev.

ed. Natl. Acad. Sci., Washington DC.

71

Nijveldt, R., E. van Nood, D. van Hoorn, P. Boelens, K. van Norren, and P. van Leeuwen. 2001. Flavonoids: A review of probable mechanisms of action and potential applications. Amer J Clin Nutr 74: 418-425.

Nocek, J.E. 1997. Bovine acidosis: Implications on laminitis. J. Dairy Sci. 80:1005-1028. Özsoy, S., K. Altunatmaz, H. Horoz, G. Kaşikci, S. Alkan, and T. Bilal. 2005. The relationship between lameness, fertility and aflatoxin in a dairy cattle herd. Turk. J. Vet. Anim. Sci. 29:981-986. Pollitt, C. C., and M. Daradka. 2004. Epidermal cell proliferation in the equine hoof

wall. Equine Vet. J. 36:236-241. Raskin, Ilya. 1992. Salycylate, a new plant hormone. Plant. Physiol. 99:799-803. Robinson, Peter, Extension Specialist University of California, Davis. 2006.

Faculty website, http://animalscience.ucdavis.edu/faculty/robinson/ Rodgerson, D. H., J. K. Belknap, J. N. Moore, and G. L. Fontaine. 2001.

Investigation of mRNA expression of tumor necrosis factor-α, interleukin- 1β, and cyclooxygenase-2 in cultured equine digital artery smooth muscle cells after exposure to endotoxin. Am. J. Vet. Res. 62:1957-1963.

Rotelli, A, T. Guardia, O. Juarez, N. de la Rocha, and L. Peltzer. 2003.

Comparative study of flavonoids in experimental modes of inflammation. Pharmacol Res. 42:601-606.

Russell, A. M., J. G. Rolanda, R. S. Shaw, and A. D. Weaver. 1982. Survey of lameness in British cattle. Vet. Rec. 111:155-60. SAS User’s Guide: Statistics, Version 8 Edition. 2001. SAS Inst., Inc., Cary, NC. Singh, D., and K. Chopra. 2004. The effect of naringin, a bioflavonoid on

ischemia-reperfusion induced renal injury in rats. Pharmacol. Res. 50:187- 193.

Somers, J. G. C. J., K. Frankena, E. N. Noordhuizen-Stassen, and J. H. M. Metz.

2003. Prevalence of claw disorders in Dutch dairy cows exposed to several floor systems. J. Dairy Sci. 86:2082–2093.

Sprecher, D. J., D. E. Hostetler, and J. B. Haneene. 1997. A lameness scoring

system that uses posture and gait to predict cattle reproductive performance. Theriogenology 47:1179-1187.

72

Suber, R.L., J. F. Hentges, J. C. Gudat, and G. T. Edds. 1979. Blood and ruminal fluid profiles in carbohydrate-foundered cattle. Am. J. Vet. Res. 40:1005- 1008. Terpos, E., M Politou, N. Viniou and A. Rahemtulla. 2005. Significance of

macrophage inflammatory protein-1 alpha (MIP-1α) in multiple myeloma. Leuk. Lymph. 46:1699-1707.

Tomlinson, D. J., C. H. Mulling, and T. M. Fakler. 2004. Formation of keratins in

the bovine claw: Roles of hormones, minerals, and vitamins in functional claw integrity.

USDA. United States Department of Agriculture. 2007. Economic Research Service

Dairy Forecast. Available at http://www.ers.usda.gov/publications. van Hoorn, D., R. Nijveldt, P. van Leeuwen, Z. Hofman, L. M’Rabet, D. De Bont,

and K. van Norren. 2002. Accurate prediction of xanthine oxidase inhibition based on structure of flavonoids. Eur J Pharmacol 451:111-118.

Vane, J. R., Y. S. Bakhle, and R. M. Botting. 1998. Cyclooxygenases 1 and 2.

Annu. Rev. Pharmacol. Toxicol. 38: 97-120. Vermunt, J. J. 1992. Subclinical laminitis in dairy cattle. New Zeal. Vet. J. 40:133-

138. Vermunt, J. J., and P. R. Greennough. 1994. Predisposing factors of laminitis in

cattle. Brit. Vet. J. 150:151-162. Waguespack, R. W., A. Cochran, and J. K. Belknap. 2004. Expression of

cyclooxgenase isoformsin the prodromal stage of black walnut-induces laminitis in horses. Am. J. Vet. Res. 65:1724-1729.

Wells, S. J., A. M. Trent, W. E. Marsh, and R. A. Robinson. 1993. Prevalence and severity of lameness in lactating dairy cows in a sample of Minnesota and Wisconsin herds. J. Am. Vet. Med. Assoc. 202:78–82.

Whay, H. R., A. J. F. Webster, and A. E. Waterman-Pearson. 2005. Role of

Ketoprofen in the modulation if hyperalgesia associated with lameness in dairy cattle. Vet. Rec. 157:729-733.

Wu, K. K. 1996. Cyclooxygenase 2 induction: Molecular mechanism and

pathophysiologic roles. J. Lab. Clin. Med. 128:242-245.

73