Nature Medicine

PPAR- senses and orchestrates clearance of apoptotic cells to promote tolerance

Lata Mukundan, Justin I. Odegaard, Christine R. Morel, Jose E. Heredia, Julia W. Mwangi,

Roberto R. Ricardo-Gonzalez, Y.P. Sharon Goh, Alex Red Eagle, Shannon E. Dunn,

Jennifer U.H. Awakuni, Khoa D. Nguyen, Lawrence Steinman, Sara A. Michie, Ajay Chawla

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 1 Changes in macrophage gene expression after phagocytosis of apoptotic, necrotic or opsonized cells. (a) Apoptotic thymocytes were generated by serum starvation in RPMI for 16-18 hours. Staining for Annexin V and PI revealed that greater than 88% of thymocytes were apoptotic with a minor population (8.8%) displaying characteristics of late apoptosis. (b-d) Lymphocyte specific genes are undetectable in macrophages fed apoptotic cells. (b) Immunoblotting for Src kinase Lck, which is specifically expressed in lymphocytes, in unfed and fed macrophages. (c) Flow cytometric analysis of CD3 expression in apoptotic thymocytes. Intracellular flow cytometric analysis of CD3 expression in macrophages fed apoptotic thymocytes (d). Note thymocyte-derived CD3 is not detected in macrophages fed apoptotic thymocytes. Unfed:

gray histogram; fed: clear histogram. (e) Phagocytosis of latex beads does not induce PPAR- or -

mRNA expression in macrophages (n=3). (f, g) Expression of PPAR- protein after phagocytosis

of necrotic thymocytes or opsonized sRBCs. Isotype control: gray histogram; PPAR-: unshaded histogram.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 2 PPAR- regulates phagocytosis of apoptotic cells. (a-c) Decreased uptake of apoptotic cells by Ppard-/- macrophages, as assessed by microscopic analysis (a, c). Lower percentage of Ppard-/- macrophages contain ingested apoptotic thymocytes (b).

Representative data from 5-6 independent experiment are shown. (d-f) PPAR- does not regulate uptake of opsonized apoptotic thymocytes (d), opsonized sRBCs (e) or necrotic cells (f). (g) Macrophage cellular ATP content during the time course of phagocytosis. WT and Ppard-/- macrophages were fed apoptotic targets (5:1) and cellular ATP content was assessed over time (n=3). Data is presented as mean ± s.e.m. *P < 0.05.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 3 PPAR- regulates expression of opsonins. (a) PPAR- activates C1qb promoter in a ligand dependent manner. CV-1 cells were transfected with increasing amounts of C1qb promoter (C1qb-Luc) and luciferase activity was assayed 18 hours later.

(b) PPAR- is required for induction of opsonin gene expression by GW0742. Ppard-/-

BMDMs were stimulated with GW0742 for 8 hours (n=3-4). (c, d) PPAR- regulates opsonin expression in liver. Expression of opsonins is reduced in livers of Ppard-/- mice (n=3-4) (c), whereas treatment of wild-type mice with GW0742 (n=3-4/condition) induces opsonin gene expression in liver (d). (e) Decreased circulating levels of Mfge8 in sera of Ppard-/- mice as quantified by ELISA (n=7-8). Data is presented as mean ± s.e.m. *P < 0.05, **P < 0.01. Cycle time for the highest expressing gene is indicated inside its corresponding bar.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 4 Apoptotic cells transcriptionally activate PPAR-. (a) 293-T cells

were co-transfected with PPAR- and CD36, and activation of the PPAR reporter gene

(PPRE3-tk-Luc) was monitored after stimulation with PPAR--specific agonist GW501516 (100 nM) or 10 x 106 apoptotic cells (ACs) (1:10 ratio). (b) Apoptotic cells activate PPAR-

via the ligand binding domain. Gal-PPAR- LBD, CD36 and UAS-Luc were co-transfected into CV-1 cells, and luciferase activity was quantified after apoptotic cell feeding (1:10 ratio). (c, d) Opsonized sRBCs (1:10) or necrotic thymocytes (1:10) do not activate

PPAR- luciferase reporter in transfected 293-T cells (c). Similarly, both opsonized sRBCs

and necrotic cells fail to induce PPAR- target genes in thioglycollate-elicited macrophages (d).

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 5 Spontaneous development of autoimmunity in Ppard-/- mice. (a,

b) Perivascular inflammation in kidneys of mice lacking PPAR- (n=8/genotype). Inflammatory lesions were quantified (a) in hematoxylin and eosin stained sections (b). Data is presented as mean ± s.e.m. **P < 0.01.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 6 Spontaneous development of autoimmunity in an independent cohort of Ppard-/- mice. (a, b) Increased production of anti-ssDNA and anti-dsDNA antibodies in 11-13 month old wild-type and Ppard-/- female mice (n=8/genotype). (c, d) Development of autoimmune kidney disease in Ppard-/- mice, as evidenced by increased perivascular inflammation (c) and glomerular immune complex deposition (d). White arrowheads point to glomeruli. Data is presented as mean ± s.e.m. *P < 0.05, **P < 0.01.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 7 Absence of splenomegaly and lymphocyte activation in Ppard-/- mice. (a) Splenic composition of 13-week old WT and Ppard-/- female mice. Splenocytes were stained with various antibodies and analyzed by flow cytometry. T cells include: total CD4+, Tregs (CD4+CD25+FoxP3+), Mem (memory, CD4+CD44+CD62L-), Naïve (CD4+CD44-

CD62L+), and Act (activated, CD4+CD69+); activated B cells include CD19+CD69+ and CD19+CD80+; splenic macrophages (Macs) are CD11b+ and dendritic cells (Den) are CD11c+. (b, c) Absence of splenomegaly in older wild-type and Ppard-/- mice. (b) Spleen weights in 17-month old wild-type and Ppard-/- mice (n=4/genotype). (c) Lymphocyte composition of spleens of 18-month old wild-type and Ppard-/- mice. Splenocytes were stained with antibodies and analyzed by flow cytometry, as described in the supplementary methods.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 8 Characterization of T-cells present in spleens of 13-week old wild-type and Ppard-/- mice (n=3/genotype). (a) Flow cytometric analyses of total CD4+ and regulatory T cells (CD4+CD25+FoxP3+). Splenocytes from wild type and Ppard-/- mice were stained with various antibodies as described in methods, and analyzed by flow cytometry. (b) Analyses of memory (CD4+CD44+CD62L-), and naïve (CD4+CD44-CD62L+) T cells in the spleens of wild-type and Ppard-/- mice.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 9 B cell and cytotoxic T cell composition of spleens. (a) Equivalent numbers of total (CD19+) and activated (CD19+CD69+) B cells in spleens of wild-type and Ppard-/- mice. (b) Cytotoxic T cell (CD8+) composition of wild-type and Ppard-/- mice.

Nature Medicine: doi:10.1038/nm.2048

Supplementary Figure 10 Increased susceptibility of Ppard-/- mice to pristane induced autoimmune disease and glomerulonephritis. (a-d) Autoantibody production in vehicle and pristane treated mice. Levels of autoantibodies (anti-cardiolipin, ANA, anti-ssDNA and anti-dsDNA) were quantified in sera five months after injection with pristane. (e) Calculated penetrance of autoimmune disease in wild-type and Ppard-/- mice. (f) Increased IgG deposition in glomeruli of pristane treated Ppard-/- mice. (g) Hematoxylin and eosin stained kidney sections from pristane treated wild-type and Ppard-/- mice were assessed for glomerular pathology. Glomeruli of wild-type mice exhibited grade 1 mild mesangial expansion (arrow), whereas severe grade 3 glomerular sclerosis with hypercellularity and crescent formation (arrow) was present in Ppard-/- kidneys. (h) Grading of glomeruli in pristane-treated WT and Ppard-/- mice was performed in blinded fashion by a pathologist. One hundred glomeruli were counted in kidneys of each

mouse. Note PPAR- deficiency is associated with more severe glomerular pathology. Arrowhead denotes tubular casts. Bar=50 microns. Data is presented as mean ± s.e.m. *P < 0.05, **P < 0.01 (data analyzed by nonparametric Mann-Whitney U-test, whereas Student’s t-test was used for penetrance analysis).

Nature Medicine: doi:10.1038/nm.2048

Supplementary Methods Primary human macrophage culture. Human monocytes were isolated from buffy

coats using the Monocyte Enrichment Kit (Stem Cell Technologies), and plated at

density of 5×106 in 6-well plates in RPMI supplemented with 10% FBS and human

m-csf (20 ngml-1). Two days later non-adherent cells were removed and the medium

was replaced. Media was changed on day 7 to DMEM (low glucose; 1gl-1)

supplemented with FBS (1%) and m-csf (10 ngml-1). Macrophages were stimulated

with vehicle or GW0742 (100 nM) for 8h (opsonin expression) or 17h (phagocytosis

assays) in fresh low glucose DMEM media on day 8. All experiments were done in

triplicate and repeated four independent times. Gene expression analysis. Total

RNA was isolated from cultured cells or tissues using Trizol (Invitrogen) according to

the manufacturer’s protocols and evaluated by gel electrophoresis. 2 µg of total

RNA was treated with 1 Uml-1 DNase (Sigma) and reverse transcribed using first-

strand complementary DNA synthesis (Marligen). Relative cDNA copy number was

then assessed in triplicate using the DNA Engine Opticon 2 real-time quantitative

PCR detection system. PCR products were validated using melting curve analysis,

and expression levels relative to L32 (Rpl32) were determined using the comparative

CT method1,2. All primer sequences are available upon request. Microarray analysis

was performed as previously described3. Briefly, 25µg of total RNA was labeled with

fluorescent nucleotides and hybridized to mouse cDNA microarrays. Data from array

interrogation was normalized and analyzed with the statistical analysis of

microarrays software package4. Average linkage clustering of both genes and arrays

was performed using CLUSTER, and visualized using TREEVIEW. PPAR- ligand

studies were performed using previously reported methodologies2. For in vitro

analyses of macrophage gene expression, BMDMs were stimulated with GW0742

Nature Medicine: doi:10.1038/nm.2048

(100 nM, dissolved in DMSO) for 8h. For the in vivo studies, GW0742 (20 mgkg-1)

was administered via intraperitoneal injection once a day, and tissues were

harvested for molecular analyses 2d later. For both in vitro and in vivo experiments,

DMSO was used as vehicle control. Apoptotic cell feeding experiments were

performed with thioglycollate-elicited wild-type and PPARd–/– macrophages. Briefly,

macrophages were plated, fed apoptotic cells (5:1), and target gene expression was

quantified by qRT-PCR 24h later. Similarly, to assess the anti-inflammatory effects

of apoptotic cells, apoptotic thymocytes were fed to wild-type and PPARd–/–

thioglycollate-elicited macrophages (5:1; thymocyte:macrophage ratio) for 1 hour

prior to stimulation with lipopolysaccharide (50-100 ngml-1) for 6h. Cytokine

secretion was quantified 3-6h (Tnf and Il10) or 24h (IL12b) later in culture

supernatants using commercially available ELISA kits.

Protein analysis. Expression of C1qb and PPAR- were performed using wild-type

and PPARd–/– thioglycollate-elicited macrophages. For induction of these proteins by

apoptotic cell feeding, macrophages were fed apoptotic thymocytes and whole cell

lysates were prepared in RIPA buffer 24h later. Total lysate (50 g) was

immunoblotted for PPAR- (Santa Cruz, sc-1987) or C1qb (Santa Cruz, sc-27664).

For analysis of C1qb in sera, 2 mg of sera diluted in 2 ml of RIPA buffer was

immunoprecipitated with 2 g C1q antibody (clone JL-1, Hycult biotechnology) for

18h. Immunoprecipitates were captured on Protein G Agarose beads, washed to

remove unbound protein, and immunoblotted for C1qb (Santa Cruz, sc-27664).

Circulating levels of Mfge8 in sera were quantified using commercially available

ELISA as per manufacturer’s instructions (R&D Systems, DY2805). For intracellular

staining experiments, peritoneal macrophages were isolated from wild-type mice 12h

after injection of vehicle, 40×106 CMFDA-labeled apoptotic thymocytes, necrotic cells

Nature Medicine: doi:10.1038/nm.2048

or opsonized sRBCs. Intracellular staining was performed using protocol of Krutzik

and Nolan5. Briefly, cells were washed in PBS and fixed in PBS (1.4%

paraformaldehyde) for 20min. Following the fixation step, cells were washed and

resuspended in 1 ml of ice cold methanol for 20min at 4 °C. Fixed and

permeabilized cells were washed in FACS buffer and stained with 1l PPAR-

antibody (Santa Cruz # 1987) for 30min followed by donkey antibody to goat Alexa

fluor 647 (1:5000) for 30min. Stained cells were washed twice prior to flow

cytometric analysis.

Promoter studies. The proximal promoter region of C1qb promoter was analyzed

in silico for putative PPAR response elements, which revealed a consensus DR-1

site at -1612 to -1600 (AGGTCA A GGCTCA). To study this site in transient

transfection assays, promoter regions either encompassing or lacking the DR1 site

were amplified with the following primers: forward: C1qb (-1649bp) -

GCTTAGTACGCGTCAGGACGTGAAGGAAGCAGTAC; forward mutC1qb (-

1590bp)-GCTTAGTACGCGTCAGTGCCTGGTCCTGATGTATAG; reverse C1qb(-

18bp)-TTCGACTCTCGAGCAACAGGCTGACCCTCTCTC. The PCR products were

ligated into pGL3-Basic vector using MluI and XhoI. For reporter gene assays, CV-1

cells were transfected with C1qb promoter constructs, expression vectors encoding

PPAR-, RXR- and CMV- galactosidase using Lipofectamine 2000 (Invitrogen),

and allowed to recover overnight. Luciferase activity was determined 18h later, and

normalized to -galactosidase activity to control for transfection efficiency. For

reporter gene assays employing apoptotic cells, 293 cells cultured in low-glucose

DMEM and 5% FBS were transfected with the reporter construct PPRE3-tk-Luc, and

expression vectors encoding PPAR-, CD36 (to enhance uptake of apoptotic cells),

and -galactosidase using TransIT LT1 (Mirus Bio Corporation) at a ratio of 2:1

Nature Medicine: doi:10.1038/nm.2048

(DNA:reagent). Freshly prepared apoptotic thymocytes were then added (10:1), and

cells were harvested 16h later for analysis of luciferase and -galactosidase activity.

Ligand binding domain activation assays were similarly performed as previously

described6.

Analysis of autoimmunity in mice

Serologic titers of antibodies to dsDNA, ANA, and cardiolipin were determined using

commercially available ELISA kits (Alpha Diagnostic International). ssDNA antibody

titers were determined as previously described7. Penetrance was defined as the

composite proportion of animals demonstrating ssDNA antibody titers > 0.6 OD,

dsDNA antibody titers > 300 µgml-1, and ANA titers > 200 µgml-1. Threshold levels

were set based on the approximate average of saline-treated control animals plus

three standard deviations. Histological and immunohistochemical analyses were

performed on formalin-fixed and paraffin-embedded kidneys. Multiple sections were

stained with hematoxylin and eosin or periodic acid-Schiff, and examined by light

microscopy in a blinded manner. Renal pathology was assessed using a modified

histological grading scheme8: 0 = normal glomeruli; 1 = mild focal mesangial

hypercellularity; 2 = moderate mesangial hypercellularity and/or complex

endocapillary hypercellularity sometimes with mild sclerosis or necrosis; 3 = severe

glomerulonephritis with marked sclerosis and/or hypercellularity sometimes with

crescent formation. Inflammatory foci were counted in 9-12 separate levels

spanning > 300 m for each kidney. Lymphocyte analyses were performed on

spleens taken from 13-week (n=3) or 18-month (n=4) old female mice of both

genotypes. Briefly, dissociated splenocytes were stained with the following

antibodies after Fc blockade (Fc Block, BD Biosciences): CD4, CD8, CD11b, CD19,

CD80, CD69, CD11c, CD62L, CD44 (all from BD Biosciences), and analyzed by flow

Nature Medicine: doi:10.1038/nm.2048

cytometry. Analysis of regulatory T cells was performed using the Mouse Regulatory

T cell staining kit (eBiosciences).

Supplementary References

1. Odegaard, J.I. et al. Macrophage-specific PPARgamma controls alternative activation and improves insulin resistance. Nature 447, 1116-20 (2007).

2. Odegaard, J.I. et al. Alternative M2 activation of Kupffer cells by PPARdelta ameliorates obesity-induced insulin resistance. Cell Metab 7, 496-507 (2008).

3. Vats, D. et al. Oxidative metabolism and PGC-1beta attenuate macrophage-mediated inflammation. Cell Metab 4, 13-24 (2006).

4. Tusher, V.G., Tibshirani, R. & Chu, G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98, 5116-21 (2001).

5. Krutzik, P.O. & Nolan, G.P. Intracellular phospho-protein staining techniques for flow cytometry: monitoring single cell signaling events. Cytometry A 55, 61-70 (2003).

6. Chawla, A. et al. PPAR delta is a very low-density lipoprotein sensor in macrophages. Proc Natl Acad Sci U S A 100, 1268-1273 (2003).

7. Thibault, D.L. et al. IRF9 and STAT1 are required for IgG autoantibody production and B cell expression of TLR7 in mice. J Clin Invest 118, 1417-26 (2008).

8. Richards, H.B. et al. Interferon-gamma is required for lupus nephritis in mice treated with the hydrocarbon oil pristane. Kidney Int 60, 2173-80 (2001).

Nature Medicine: doi:10.1038/nm.2048