Rajguru et al.: Red rice ALS gene mutations • 567

Weed Science, 53:567–577. 2005

Mutations in the red rice ALS gene associated withresistance to imazethapyr

Satyendra N. RajguruCrop, Soil, and Environmental Sciences, 1366 WestAltheimer Drive, University of Arkansas, Fayetteville,AR 72704

Nilda R. BurgosCorresponding author. Crop, Soil, andEnvironmental Sciences, 1366 West AltheimerDrive, University of Arkansas, Fayetteville, AR72704; nburgos@uark.edu

Vinod K. ShivrainCrop, Soil, and Environmental Sciences, 1366 WestAltheimer Drive, University of Arkansas, Fayetteville,AR 72704

James McD. StewartCrop, Soil, and Environmental Sciences, PTSC115,University of Arkansas, Fayetteville, AR 72701

The introduction of Clearfield (CL) rice cultivars resistant to imidazolinone herbi-cides, acetolactate synthase (ALS) inhibitors, has raised concerns of gene flow toweedy rice genotypes collectively called ‘‘red rice’’ that infest rice-growing areas inthe southern United States. This experiment was conducted to study hybridizationbetween CL rice and red rice using simple sequence repeats (SSR) markers, identifymutations in the ALS gene of imazethapyr-resistant red rice, and to detect the in-trogression of the ALS-resistant gene from CL rice into red rice. Natural outcrossingexperiments between CL rice and strawhull (SH) red rice were set up in Stuttgart,AR, in 2002 and 2003. Putative red rice hybrids were detected among volunteerplants in the following year. Hybridization was confirmed using SSR markers, andintrogression of the resistant ALS gene from CL rice to red rice was detected byALS gene sequencing. The ALS gene sequences of U.S. rice cultivars ‘Bengal’ and‘Cypress’, SH red rice, CL rice (CL161), and imazethapyr-resistant red rice/CL ricehybrids were compared. Nucleotide sequences of the ALS gene from the rice cultivarswere identical. Three point mutations were present in the SH red rice ALS genecoding region relative to Bengal/Cypress. One of these resulted in the substitutionof Asp630 for Glu630. The ALS gene sequences of confirmed hybrids were identicalto that of the herbicide-resistant pollen source, CL161. We identified four ALS genemutations in the herbicide-resistant red rice hybrids relative to the susceptible ricecultivars. One point mutation, resulting in a substitution of Ser653 with Asn, waslinked to ALS resistance in callus tissue derived from a Kinmaze rice line from Japan.The other three mutations (Ser186—Pro, Lys416—Glu, and Leu662—Pro) are novel.This experiment confirmed that gene flow from imidazolinone-resistant rice resultedin herbicide-resistant red rice plants.

Nomenclature: Imazethapyr; red rice, Oryza sativa L. ORSAT; rice, Oryza sativa L.

Key words: ALS gene sequence, crop–weed hybridization, gene flow, herbicide-resistant crop, point mutation.

Acetolactate synthase (ALS)-inhibiting herbicides such asimidazolinones and sulfonylureas are widely used for weedcontrol in crop production. Biosynthesis of aryl amino acidssuch as valine, leucine, and isoleucine requires ALS catalyticactivity. These amino acids are essential for plant growth,and their absence results in plant death (Devine and Preston2000). The preference for ALS-inhibiting herbicides stemsfrom their sound environmental properties, safe use in manycrops, low dosage rates, and high efficacy.

The mechanism of resistance to ALS inhibitors is pri-marily attributed to an altered enzyme (Hinz and Owen1997; Saari et al. 1994; Tranel and Wright 2002) with oneto several point mutations that change the amino acid se-quence (Subramanian et al. 1996; Wright et al. 1998). Sev-eral point mutations conferring resistance to ALS-inhibitingherbicides have been identified in many plant species (Gres-sel 2002; Tranel and Wright 2002). Other mechanisms ofresistance include increased gene expression and herbicidemetabolism in the plant. Overexpression of the ALS genehas been reported in resistant corn (Zea mays L.) inbred linesand resistant Indian hedge mustard (Sisymbrium orientale L.)(Boutsalis et al. 1999; Forlani et al. 1991). Enhanced ratesof ALS herbicide metabolism have been reported (Prestonand Mallory-Smith 2001) in several plant species such asblackgrass (Alopecurus myosuroides Huds.) (Menendez et al.1997), late watergrass [Echinochloa phyllopogon (Stapf.)

Koss.] (Fischer et al. 2000), rigid ryegrass (Lolium rigidumGaudin) (Christopher et al. 1991, 1992; Cotterman andSaari 1992), and wild mustard (Sinapis arvensis L.) (Veldhuiset al. 2000).

Many major crops are sexually compatible with their wildrelatives, and this has led to crop-to-weed gene flow in theirsympatric regions (Arnold 1992, 1997; Arriola and Ellstrand1996; Rieseberg 1995). Gene flow from crops can add newgenes to wild relatives; the genes can reassort into novelcombinations and may have a substantial impact on theevolution of wild populations, which may result in moreaggressive weeds (Arias and Rieseberg 1994; Arriola andEllstrand 1996; Colwell et al. 1985).

With the introduction of herbicide-resistant crops(HRCs), concerns arose about flow of resistance genes towild relatives (Ellstrand et al. 1999). A classic example ofinterspecific hybridization occurred between commercialsorghum [Sorghum bicolor (L.) Moench] and wild sorghum[Sorghum propinquum (Kunth) Hitchc.], resulting in john-songrass [Sorghum halepense (L.) Pers], a major weed world-wide (Paterson et al. 1995). Other crops such as rice (Lan-gevin et al. 1990), barley (Hordeum vulgare L.) (Ritala et al.2002), and wheat (Triticum aestivum L.) (Seefeldt et al.1998) can hybridize with their wild relatives.

Rice is a staple food for . 50% of the world’s population(Zhi et al. 2003). To meet production demands, high-yield-

568 • Weed Science 53, September–October 2005

ing cultivars with enhanced pest resistance, tolerance to abi-otic stresses, and improved grain quality have been devel-oped. A major weed problem in rice farming in the southernUnited States is red rice, which is taxonomically classifiedin the same genus and species as cultivated rice. Low levelsof hybridization between rice and red rice have been re-ported (Estorninos et al. 2003; Shivrain et al. 2004b; Zhanget al. 2004). The imidazolinone resistance trait was obtainedby random mutation (Croughan et al. 1996) and has beenadded to cultivated rice (Clearfield [CL]) through conven-tional breeding. This allows the use of imazethapyr (New-path) in CL rice to control red rice. The commercial releaseof CL rice has resulted in the transfer of the herbicide re-sistance trait to red rice in some locations in the UnitedStates (Estorninos et al. 2003; Scott and Burgos 2004;Zhang et al. 2004).

The objectives of this research were to determine if hy-bridization occurs between CL rice and, if so, to detect thetransfer of the ALS-resistant gene from CL rice into red riceusing simple sequence repeats (SSR) markers. An additionalobjective was to identify mutations in the ALS gene asso-ciated with the resistance of imazethapyr-resistant red rice.This research is a precursor of further experiments, with theultimate goal of designing a gene-specific assay for the con-firmation of CL rice crosses with red rice in producers’ fields.

Materials and Methods

Source of Plant Materials

Seeds of rice (‘Bengal’ and ‘Cypress’), CL rice (‘CL161’),SH red rice, and red rice hybrids (SH hybrid) were used.Bengal (medium grain) and Cypress (long grain) were kindlyprovided by Dr. Karen Moldenhauer (rice breeder, Rice Re-search and Extension Center, Stuttgart, AR) and used asstandard susceptible rice cultivars. Resistant SH hybridswere obtained from rice bays set up to simulate natural out-crossing between CL1611 and SH red rice. Cypress is oneof the parents of CL161.

Natural outcrossing experiments between CL rice and SHred rice were established in Stuttgart, AR, in 2002 and 2003using an encircled population combination design with thepollen donor (CL161) planted in the middle (diameter 510 m) of a 22-m-diam circle and red rice located in theouter circle in three replications. The experiments wereplanted on April 25 and May 21, 2002. CL rice was drillseeded in the inner circle at 100 kg ha21, and a naturalpopulation of SH red rice was allowed to grow in the outercircle at a density of 20 to 30 plants m22. To keep the innercircle red rice free, imazethapyr (Newpath) was applied twiceat weekly intervals when red rice had two to three leaves.In addition, propanil and halosulfuron were applied to theentire experiment at 4.4 and 0.07 kg ai ha21, respectively,5 wk after planting to control other rice weeds. Permanentflood was established when plants were at the four- to five-leaf stage. Urea (46:0:0) was applied at 50 and 100 kg ha21

to the outer and inner circles, respectively. At maturity, CLrice was removed from the inner circle to minimize volun-teer CL rice in the following season. Red rice was allowedto shatter. The field was left undisturbed during the fall andwinter of 2002, except that the straw was burned in latewinter to remove physical impediments to red rice emer-gence in the spring. Heat from the burning straw was not

intense enough to kill the red rice seed, and the ground waswet when this was done, so only the dry debris was burned.SH hybrids were detected among volunteer plants in thefollowing year by three applications of imazethapyr at 0.07kg ai ha21. Plants that survived this herbicide treatment weresampled as putative hybrids. Some morphological traits ofthese plants, such as height, leaf color and texture, culmangle, and panicle length, were recorded.

Hybridization was confirmed with SSR markers, and in-trogression of the resistant ALS gene from CL rice to redrice was detected by a comparison of ALS gene sequences.Leaf tissues from resistant red rice plants were collected fromthe field for SSR analysis and for sequencing of the ALSgene. For the rice cultivars and the red rice parent, threeplants for each genotype were grown separately in 15-cm-diam pots in a greenhouse maintained at 30 6 2 C withregular subirrigation and fertilizer application. At the three-leaf stage, young leaf tissues were harvested, frozen in liquidnitrogen, and stored at 270 C until processed.

Genomic DNA Extraction

DNA from individual plants was extracted from 0.1 g oftissue using a modified CTAB (cetyltrimethylammoniumbromide) protocol (Doyle and Doyle 1987). Leaf tissueswere ground in liquid nitrogen in chilled mortars and thentransferred to chilled centrifuge tubes. Five hundred micro-liters of extraction buffer (100 mM Tris-HCl [pH 8.0], 20mM EDTA [pH 8.0], 2M NaCl, 2% CTAB, 2% PVP-40,1 mM phenanthroline, and 0.3% b-mercaptoethanol) wasadded to the tubes and vortexed vigorously until no tissueclumps were visible. The tubes were incubated at 65 C for45 min in a water bath. Following incubation, 500 ml ofchloroform:phenol:isoamylalcohol (25:24:1 by volume) wasadded to the tubes, mixed, and centrifuged at 12,000 3 gfor 20 min at 4 C. The supernatant was transferred to afresh tube and mixed with 500 ml of isopropyl alcohol andincubated at 220 C for 1 h. Tubes were centrifuged foranother 10 min at 12,000 3 g at 4 C, and the supernatantwas discarded. The DNA pellet was washed with 70% eth-anol, followed by 100% ethanol, and then dried and resus-pended in TE buffer (pH 8.0). Genomic DNA was quan-tified with a fluorometer (DynaQuant, Hoefer Scientific)and diluted to 20 ng ml21.

SSR Fingerprinting for Detection of Hybrids

Confirmation that resistant plants were hybrids was basedon the combined presence of SSR unique to cultivated riceand to red rice (Estorninos et al. 2003; Rajguru et al. 2002).Since SSR markers are co-dominant, hybrids of rice and redrice would have alleles from both parents. Four SSR primerpairs were used: RM180, RM215, RM234, and RM251.Rajguru et al. (2002) reported that rice SSR primer RM180produces DNA fragments that consistently differentiate ricecultivars from red rice. A similar result was reported for theother three primer pairs by Estorninos et al. (2003).

Primer Design for Sequencing of ALS Gene

For ease of sequencing, the ALS gene was amplified infive segments. Forward and reverse overlapping primers2

were designed for the five regions on the basis of the ALS

Rajguru et al.: Red rice ALS gene mutations • 569

TABLE 1. Primers used to amplify the Oryza ALS gene.a

Primers Sequence (59–39) Amplicon size (bp) Annealing temp. (C)

I ForwardI ReverseII ForwardII ReverseIII ForwardIII Reverse

CCCAAACCCAGAAACCCTCGCCGCCATTGTGCTTGGTGATGGAGCGGGTGCACCCGCTCCATCACCAAGCACAATTCTTGGCCCTGCTTGCAAAAGCCTCGAGGCTTTTGCAAGCAGGGCCAAGATTCACAGGGAGGTTCTCAATGCGGA

635

530

530

656555555555

IV ForwardIV ReverseV ForwardV Reverse

TCCGCATTGAGAACCTCCCTGTGAGATTAATACACAGTCCTGCCATCTGATGGCAGGACTGTGTATTAATCTTTTTGCATAGAAGTACTTTATTCTC

365

320

55555555

a Abbreviation: ALS, acetolactate synthase.

sequence of rice in the GenBank database (AB049822)(http://www.ncbi.nlm.nih.gov/). The primer pairs, alongwith the annealing temperatures, are listed in Table 1.

DNA Amplification and Sequencing

HotstarTaq DNA polymerase3 was used to amplify theALS gene fragments from genomic DNA in five separatepolymerase chain reactions (PCRs). The PCR cocktail con-sisted of 1 ml of genomic DNA (20 ng ml21), 1 ml of eachprimer (10 rmol), 2 ml of 10 3 PCR buffer, 4 ml of Q-solution, 5 ml of 100 mM dNTPs, 0.5 ml HotstarTaq, and6 ml of water. The reaction protocol consisted of a 15-minincubation at 95 C, followed by 40 cycles of 94 C for30 s; 65 or 55 C for 1 min, depending on the primer pairused; 72 C for 30 s; and a final extension cycle at 72 C for5 min. Amplification products were resolved on a 1% aga-rose gel containing 1 ml of ethidium bromide at 10 mgml21. PCR products were purified from the gel with a Qia-gen Gel Extraction kit,3 and the purified fragments werecloned into the pGEM-T Easy vector.4 Escherichia coli strainJM 109 was transformed with the plasmid vector harboringthe PCR products and plated on Luria-Bertani broth (LB)plus agar supplemented with 100 mg ml21 ampicillin, 80mg ml21 X-gal,5 and 0.5 mM IPTG (isopropyl-ß-D-thioga-lactopyranoside).6 Plates were incubated for 24 h at 37 C,after which individual white colonies were selected andgrown overnight in liquid LB medium amended with 100mg ml21 ampicillin under constant shaking. Plasmid DNAwas extracted using the Qiagen Miniprep kit.3 PlasmidDNA was quantified, and both strands of the DNA frag-ment were sequenced using the SP6 and T7 primers flank-ing the multiple cloning sites. Since SH hybrids are hetero-zygotes, the amplified ALS fragment could be either the wildtype or the introgressed gene. Sequences were obtained forseveral clones, and sequences with mutations that did notcorrespond to the wild-type sequence were used in con-structing the resistant ALS consensus sequence. The ALSsequences were compared with sequences in the GenBanknonredundant database using the BLASTX algorithm(http://www.ncbi.nlm.nih.gov/) to confirm similarity to pre-viously characterized ALS genes. Furthermore, the sequenceswere aligned using CLUSTALW 1.82 (http://www.ebi.ac.uk/clustalw) and MultAlin (Corpet 1988).

Results and Discussion

Detection of F1 plants

Red rice plants that survived three applications of ima-zethapyr at 0.07 kg ha21 were considered putative F1 plants.Morphologically, these plants were distinct from either par-ent, since these plants were, on average, 29 and 14 cm tallerthan CL161 (93 cm) and SH red rice (108 cm), respectively(Figure 1). In addition, the putative F1 plants had culmangles that were intermediate between the erect culms ofCL161 and the more open culms of SH red rice, and theyhad rough leaves like the red rice parent. These plants alsohad longer panicles (25 cm) than the CL161 (23 cm) andSH red rice (21 cm) parents. Morphological characteristicsof putative F1 SH hybrids obtained from the outcrossingsimulation experiments were identical to those of F1 SHhybrids (red rice 3 CL161) from manually generated recip-rocal crosses (N. Burgos, unpublished data). In this relatedexperiment, reciprocal crosses were made between CL161and red rice as well as between CL121 and red rice. Char-acteristics of F1 and F2 plants were recorded to determinesegregation of resistance and other traits that could affectthe weediness of resistant crosses. F1 plants were extremelylate in flowering compared with either parent. By mid-Oc-tober (fall season), all F1 plants had a few tillers with exertedpanicles but no mature seed. So, in terms of reproductivecapability in the field, several F1 plants were less fit than thered rice or CL rice parent. This reproductive barrier in thefirst generation may be the reason why we do not see asmany putative red rice crosses in producers’ fields as wouldbe expected from estimated outcrossing rates. Nevertheless,some F1 plants could produce seed in producers’ fields ifthe rice crop is planted and harvested early enough for theremnant red rice plants to have enough warm days to pro-duce viable seed. These plants would then generate F2 plantswith various morphologies and phenological traits, someflowering as early as, or earlier than, the red rice parent. Ofthe imazethapyr-resistant F2 plants (from red rice 3 CL 121cross), 10% flowered very early (77 d after planting), about60% flowered late (98 d after planting), and about 5% didnot flower at all during the growing season (Shivrain 2004).Succeeding generations that could get established would beas competitive as the red rice parent on the basis of plantsize.

The imazethapyr-resistant, putative F1 plants were con-firmed as hybrids using microsatellite markers RM180,

570 • Weed Science 53, September–October 2005

FIGURE 1. Phenotypic appearance of (A) CL161, (B) strawhull red rice, and (C) F1 plant. The photograph of strawhull red rice was taken at an earlierstage relative to CL161, before the red rice grains started shattering. F1 plants were very late in development, but they could still produce a few paniclesif warm days lasted until late October. Many F1 plants did not flower before freezing temperature occurred and so were not able to set seed.

RM215, RM234, and RM251 (Figure 2). On the basis ofprevious fingerprinting studies, RM180 was identified as asuitable marker to test for rice–SH hybridization (Rajguruet al. 2002), and RM215, RM234, and RM251 have beenused in other studies to detect gene flow from rice to redrice (Estorninos et al. 2003). Amplification of DNA fromCL161 and SH red rice with RM180 produced an ampli-fication product of ;150 and 200 to 300 base pairs, re-spectively (Figure 2a). The difference in PCR product sizesbetween red rice plants can be attributed to hypervariableloci, or to more than one loci, in red rice. Since SSR markersare co-dominant, two fragments are expected, one contrib-uted by each of the two parents. RM215, RM234, andRM251 also produced distinctive fragments in rice and redrice and showed DNA fragments from both parents in her-bicide-resistant plants (Figures 2b–d), indicating that theplants were hybrids. Figures 2b–d used the same subset ofhybrid plants from among those confirmed by RM180. Theplant in lane 4 of Figure 2 showed an ambiguous fingerprintfor a hybrid when using the marker RM215, but it wasconfirmed as a hybrid by markers RM234 and RM251.Although the resistant plants had been identified as hybridson the basis of their morphological traits, the SSR markersprovided molecular confirmation that they were, in fact, hy-brids. Whether the resistance trait came from CL rice orwas a result of natural genetic mutation was determined bythe sequence of the ALS gene. On average, more hybridswere detected in the May planting (25 plants) than in theApril planting (11 plants), primarily because more volunteer

plants emerged in the May planting date plots (about684,000 in 380 m2) than in the April planting date plots(435,800 in 380 m2). The outcrossing rates were similar(0.0025–0.0037%) across planting dates.

The Oryza ALS Gene Sequence

PCR amplification of ALS gene segments using DNAfrom the resistant and susceptible plants resulted in a singleDNA fragment from each amplification reaction with theexpected size, depending on the primer pair (Table 1). TheDNA fragments were sequenced from both the 59 and 39ends to confirm accuracy. The resulting sequences were thenarranged into a unified contig to reconstruct the entire ALSgene sequence. Overlapping sequences of amplified regionswere removed before assembling the sequences. Choosingprimers that yielded overlapping fragments greatly facilitatedthe arrangement of the contigs to obtain the full-length ALSgene. The sequences from Bengal, Cypress, SH red rice,CL161, and SH hybrids were aligned using ClustalW 1.82and compared to the herbicide-susceptible and -resistantJapanese rice (AB049822 and AB049823) and Arabidopsisthaliana ALS (NM114714) sequences in the GenBank da-tabase. The ALS sequences for the resistant (R) and suscep-tible (S) lines were from l gt11 rice callus cDNA derivedfrom Oryza sativa ‘Kinmaze’. The ALS sequence from theKinmaze rice lines is hereafter designated KS rice (suscep-tible) and KR rice (resistant), respectively. The total lengthof the Oryza ALS coding region was 1,935 nucleotides (Fig-

Rajguru et al.: Red rice ALS gene mutations • 571

FIGURE 2. Agarose gel electrophoresis of simple sequence repeats (SSR)products of CL161, strawhull (SH) red rice, and SH hybrids with RM180(A), RM215 (B), RM234 (C), and RM251 (D). (a) Lane 1 5 1-kb mo-lecular ladder, 2 5 Bengal, 3 to 4 5 SH red rice, and 6 to 10 5 SHhybrids. (b–d) Lane 1 5 1-kb molecular ladder, 2 5 Bengal, 3 5 SH redrice, and 4 to 8 5 SH hybrids.

ure 3). The sequences have been deposited in GenBank asAY885673 for SH red rice, AY885674 for Bengal, andAY885675 for SH hybrid. All amino acid positions for rice(Bengal/Cypress, CL161) and red rice were standardized tothe Arabidopsis sequence (NM114714). In regions of thealignment where there was no corresponding amino acid forthe Arabidopsis sequence (mostly toward the C-terminus ofthe protein), the amino acids were numbered according tothe sensitive O. sativa Japanese line sequence (AB049822).

Comparison of ALS Sequences fromImidazolinone-susceptible Rice and Red Rice

Nucleotide sequences from Bengal, Cypress, and SH redrice were compared with each other and with KS rice. Over-all, there was 99% identity at the nucleotide level in thecoding region for all ALS sequences. This indicates that theALS sequence is highly conserved among cultivated rice andin weedy red rice. The ALS genes from Bengal and Cypresshad identical nucleotide sequences and are denoted as B/Cin Figure 3. The ALS coding regions of SH red rice andCypress and Bengal showed 99% similarity. Comparisons ofthe sequences of the two genotypes showed four mutationsat nucleotide positions 1239, 1707, 1812, and 2087 (Figure3). Two of these were silent mutations, but the mutation atnucleotide position 1812 resulted in Asp630 in SH andGlu630 in Cypress/Bengal. The fourth mutation at 2087,located 153 base pairs downstream of the stop codon, wasoutside the coding region. Therefore, except for the oneamino acid, the ALS amino acid sequences of SH red riceand Bengal/Cypress rice were identical.

Additional genetic differences between cultivated rice andred rice are expected in other loci, especially in noncodingregions, to account for the phenotypic plasticity of theweedy species. The foregoing information indicates that nat-ural nucleotide mutations in the ALS gene exist betweenrice and red rice. Moreover, mutations in the ALS gene areexpected to exist between red rice genotypes, and some ofthese could lead to naturally herbicide-tolerant individuals.Preliminary research results support this theory (Shivrain etal. 2004a). Genome-wide intraspecific DNA sequence var-iations in rice have shown small nucleotide variations(SNPs) between indica and japonica varieties (Han and Xue2003). SH and blackhull red rice in the United States areclassified as crop mimics with indica characteristics (Tangand Morishima 1996). On the other hand, most rice cul-tivars in the southern United States, including Cypress andBengal, are of the japonica-type lineage. As rice and red riceare placed under the same genus and species, one wouldexpect to find extensive microlinearity in gene order andcontent. However, deviations from colinearity may occur asa result of rearrangements, insertions, and deletions. Someof these alterations both in the coding and noncoding re-gions of genes may result in intraspecific phenotypic varia-tions, including growth and developmental and environ-mental adaptations (Han and Xue 2003). The weediness ofred rice stems from environmental adaptation mechanismsconferred by slight genetic modifications relative to culti-vated rice.

A comparison of KS rice with Bengal/Cypress showed 27nucleotide mutations, which correspond to 98% identity atthe nucleotide level. Of these 27 point mutations, 25 wereneutral, while mutations at nucleotide positions 31 and

572 • Weed Science 53, September–October 2005

FIGURE 3. Aligned sequences of Bengal (B), Cypress (C), strawhull red rice (SH RR), and strawhull hybrid (SH hyb). The acetolactate synthase (ALS) genesequence for the SH hybrid is identical to that of CL161. Start and stop codons are in bold letters. Mutations in resistant Japonica type rice (AB049823),when compared to the susceptible Japonica rice (AB049822), are indicated by open triangles (D), followed by the corresponding change in nucleotidesequence. Differences observed between the Cypress and herbicide-susceptible SH RR are indicated by closed triangles (m), and differences observedbetween the susceptible SH RR and resistant SH hyb are indicated by closed squares (m), followed by the corresponding change in the amino acidsequence. Differences in amino acids/nucleotides follow the symbols indicated.

Rajguru et al.: Red rice ALS gene mutations • 573

FIGURE 3. Continued.

574 • Weed Science 53, September–October 2005

FIGURE 3. Continued.

Rajguru et al.: Red rice ALS gene mutations • 575

FIGURE 3. Continued.

TABLE 2. Nucleotide differences, along with amino acid changes,in SH red rice sequence compared with imidazolinone-sensitiveKinmaze (KS) rice ALS sequence (AB049822). Correspondingamino acid positions in Arabidopsis, where available, are in super-script.a

Nucleotidepositionb Nucleotide change Altered amino acid

293134

711717

ACC-ATCGCC-ACCCTG-TTGGCC-GCTCCG-CCA

NeutralAla to Thr13

Neutral14

Neutral263

Neutral265

744753867877894

CCA-CCGATC-ATTGAC-GATTGG-CGGACT-ACC

Neutral274

Neutral277

Neutral315

Trp to Arg318

Neutral324

897945948

10021029

GGT-GGCGAC-GATGAC-GATGCC-GCGGCG-GCA

Neutral325

Neutral341

Neutral342

Neutral360

Neutral369

103511191201, 120312391290

GGT-GGCGCA-GCGCAA-GACGCA-GCGAAA-AAG

Neutral371

Neutral399

Gln to Asp427

Neutral439

Neutral456

13231353138015641635

GCC-GCTGGT-GGGGGG-GGACTG-TTGGTG-GTT

Neutral467

Neutral477

Neutral486

Neutral548

Neutral571

16651695170717401812

GCG-GCACCG-CCAAGC-AGTAAG-AAAGAG-GAT

Neural581

Neutral591

Neutral595

Neutral606

Glu to Asp630

1815184820662150

ACT-ACCCCG-CCAGCT-GGTCTG-CCG

Neutral631

Neutral642

NeutralNeutral

a Abbreviations: ALS, acetolactate synthase; SH, strawhull.b Relative to start codon. Stop codon is at position 1966.

1201 resulted in alterations of the amino acid sequence fromAla13 to Thr and Gln427 to Asp, respectively. The mutationat Thr13 was consistently found in all the Arkansas rice andred rice genotypes, but it was absent from the Japanese KSand KR rice lines. Three additional single nucleotide differ-ences downstream of the stop codon were identified betweenthe Japanese and U.S. cultivars. Essentially, there was moresimilarity in the ALS gene sequence of Bengal/Cypress andSH red rice than between Bengal/Cypress and Kinmaze rice.

When the SH red rice als sequence was compared withthat of KS rice (T. Shimizu et al., unpublished data), 34SNPs were identified. Of the 34 mutations, 4 resulted in achange in the amino acid sequence, and 30 were neutral(Table 2). Two mutations at nucleotide positions 2066 and2150 were downstream of the stop codon. One mutation(C to T) was identified 9 nucleotides upstream of the ade-nine residue in the start codon. This mutation, althoughneutral, was consistently found in all Arkansas red rice, Cy-press, and Bengal sequences.

SH Hybrid ALS Sequence

The ALS-resistant SH hybrid sequence was similar to theSH red rice sequence, except at four nucleotides, wherepoint mutations resulted in alteration of the ALS amino acidsequence (Table 3), and at two additional neutral mutationsat positions 1696595 and 1956(651). There was 98% identitybetween the SH hybrid sequence and the KR line (T. Shi-mizu et al., unpublished data). Sequence comparisons of SHhybrids with the KR line showed 34 SNPs, of which 24were neutral. Some of these SNPs corresponded to the mu-tations found in comparisons of Bengal/Cypress with KRrice. The ALS gene sequences of SH hybrids were identicalto that of CL161, which confirmed that the imazethapyr-resistant trait of the SH hybrid was inherited from CL161.

Except for one mutation in the resistant SH hybrid atnucleotide position 1880 (Asn653), these mutations were dif-ferent from those reported by T. Shimizu et al. (unpublisheddata) between KS and KR rice lines. Two mutations in theKR rice als sequence were present at nucleotide positions1643 (Trp574 to Leu574) and 1880 (Ser653 to Ile653) com-

576 • Weed Science 53, September–October 2005

TABLE 3. Amino acid changes in SH hybrid ALS gene resultingfrom point mutations compared to herbicide-sensitive red rice andBengal/Cypress rice. Numbers in superscript represent the corre-sponding amino acid position in Arabidopsis. Nucleotide positions(np) are based on the susceptible Kinmaze rice ALS sequence(AB049822).a

ALS gene source

Amino acid differences at variousnucleotide positions

np 478 np 1,168 np 1,880 np 1,907

Bengal/CypressSH red riceb

SH red rice hybridc

SerSerPro186

LysLysGlu416

SerSerAsn653

LeuLeuPro662

a Abbreviations: ALS, acetolactate synthase; SH, strawhull.b Herbicide-susceptible strawhull red rice.c Survived three applications of imazethapyr, at 0.07 kg ha21 per appli-

cation, and confirmed hybrid between strawhull red rice and Clearfield rice‘CL161’ using simple sequence repeats (SSR) markers RM180, RM215,RM234, and RM251. The nucleotide sequence of the ALS gene from her-bicide-resistant red rice hybrids was identical to the ALS gene sequence ofCL161.

pared to KS. In SH hybrids (resistant), the mutation re-sulted in conversion from Ser653 to Asn653 compared withSH (susceptible) red rice (Table 3). The mutation at Asn653

is particularly interesting, because mutations close to thisposition have been reported in other studies on ALS inhib-itor-resistant species. In Amaranthus powellii S. Wats., apoint mutation resulting in a substitution of Ser653 with Thrwas found in plants resistant to imazethapyr with cross re-sistance to atrazine (Diebold et al. 2003). Additionally, Pat-zoldt and Tranel (2001) reported a mutation in Amaranthusrudis Sauer, where Ser653 was replaced by Asn, the sameconversion present in the imazethapyr-resistant SH hybrid.

In addition to Asn653, three other mutations, namely,Pro186, Glu416, and Pro662, were in SH hybrids when com-pared to the susceptible SH red rice (Table 3). Several stud-ies conducted on various plant species and organisms havereported mutations that are clustered close to the Pro186,Glu416, and Pro662 mutations. The Pro186 mutation is sig-nificant, because similar mutations were reported to occur11 amino acids downstream in natural selection experimentsin plants (Haughn et al. 1988) and in yeast (Bedbrook etal. 1995). Ott et al. (1996) also reported an Arg199 mutationthat is in close proximity to Pro186. Recently, a single aminoacid substitution resulting in a change from Pro197 to Glu197

was reported in common false pimpernel (Lindernia procum-bens Krock. Philcox) and was implicated in resistance to anALS inhibitor herbicide (Uchino and Watanabe 2002). Themutation at Glu416 may also be important in resistancemechanisms, as it is in proximity to mutations that havebeen implicated in resistance in yeast (Asp376) (Bedbrook etal. 1995), His352 in intentional plant selections (Oh et al.2001), and Met351 in yeast (Bedbrook et al. 1995).

The four amino acid alterations in resistant SH hybrids(Table 3) were consistent in all individuals. Although threeof these mutations (Pro186, Glu416, and Pro662) appear tobe novel, the extent to which these mutations contribute tothe resistant phenotype is unknown. Tranel and Wright(2002) concluded that several single amino acid substitu-tions are sufficient to convert ALS from a herbicide-sensitiveto a herbicide-resistant enzyme. One of the mutations im-portant for resistance is Ser653 (Tranel and Wright 2002),located at the carboxy-terminal, where we also observed an

alteration from Ser653 to Asn653 in the resistant SH hybrids.In ALS-resistant common cocklebur (Xanthium strumariumL.) and common ragweed (Ambrosia artemisiifolia L.), anAla, rather than a Ser residue, is found at position 653 (Ber-nasconi et al. 1995; Patzoldt and Tranel 2001). On the basisof several reported amino acid substitutions at this position,it seems that any deviation in the amino acid sequence atthis particular position results in a resistant phenotype. Oth-er als mutations observed in the SH hybrids could conferdifferent levels of resistance to imidazolinones or could causecross resistance to other ALS inhibitors such as sulfonylure-as. Additional research is needed to understand the impor-tance of these novel mutations in resistance to ALS inhibi-tors.

In summary, we found that medium-grain and long-grainrice cultivars (Bengal and Cypress) developed in the south-ern United States have identical genetic codes for the ALSenzyme, the target of imidazolinone herbicides. This mayhold true for most, if not all, tropical japonica rices to whichtypes Bengal and Cypress belong. However, the als in U.S.rice is not identical to that of the Japanese rice line. Breedingfor particular crop traits creates a high degree of homoge-neity within and among crop cultivars that share the samelineage. On the other hand, SH red rice is an indica-typerice, and it has genetic differences from the cultivated riceof Arkansas, even in the als gene sequence alone. Althoughnatural variations in ALS gene sequences occur between riceand red rice, cultivated rice and red rice can interbreed.Thus, gene flow confers the herbicide resistance trait to redrice, as shown by the genetic mutations observed in theimazethapyr-resistant hybrids that were inherited from theCL161 rice parent. The horizontal gene flow between CLrice and red rice, resulting in the appearance of resistant SHhybrids in the succeeding season, calls for consistent imple-mentation of effective strategies for management of weedyrice.

Sources of Materials1 Clearfield rice CL161, Horizon Ag., LLC, 1661 International

Drive, Memphis, TN 38103.2 Oligonucleotide primers, Sigma, P.O. Box 14508, St. Louis,

MO 63178.3 Qiagen Gel Extraction kit, Qiagen Miniprep kit, Qiagen Inc.,

28159 Avenue Stanford, Valencia, CA 91355.4 pGEM-T Easy vector systems, Promega Corporation, 2800

Woods Hollow Road, Madison, WI 53711.5 X-gal, Promega Corporation, 2800 Woods Hollow Road,

Madison, WI 53711.6 IPTG, Promega Corporation, 2800 Woods Hollow Road,

Madison, WI 53711.

AcknowledgmentsThis research was funded in part by the Arkansas Rice Research

Promotion Board and BASF Co., Inc.

Literature CitedArias, D. M. and L. H. Rieseberg. 1994. Gene flow between cultivated and

wild sunflowers. Theor. Appl. Genet. 89:655–660.Arnold, M. L. 1992. Natural hybridization as an evolutionary process.

Annu. Rev. Ecol. Syst. 23:237–261.Arnold, M. L. 1997. Natural Hybridization and Evolution. New York: Ox-

ford University Press.

Rajguru et al.: Red rice ALS gene mutations • 577

Arriola, P. E. and N. C. Ellstrand. 1996. Crop-to-weed gene flow in thegenus Sorghum (Poaceae): spontaneous interspecific hybridization be-tween johnsongrass, Sorghum halepense, and crop sorghum, S. bicolor.Am. J. Bot. 83:1153–1159.

Bedbrook, J. R., R. S. Chaleff, S. C. Falco, B. J. Mazur, C. R. Somerville,and N. S. Yadev, inventors. 1995. Nucleic acid fragment encodingherbicide-resistant plant acetolactate synthase. U.S. patent 5,378,824.

Bernasconi, P., A. R. Woodworth, B. A. Rosen, M. V. Subramanian, andD. L. Siehl. 1995. A naturally occurring point mutation confers broadrange tolerance to herbicides that target acetolactate synthase. J. Biol.Chem. 270:17,381–17,385.

Boutsalis, P., J. Karotam, and S. B. Powles. 1999. Molecular basis of resis-tance to acetolactate synthase-inhibiting herbicides in Sisymbrium or-ientale and Brassica tournefortii. Pestic. Sci. 55:507–516.

Christopher, J. T., S. B. Powles, and J.A.M. Holtum. 1992. Resistance toacetolactate synthase-inhibiting herbicides in annual ryegrass (Loliumrigidum) involves at least two mechanisms. Plant Physiol. 100:1909–1913.

Christopher, J. T., S. B. Powles, D. R. Liljegren, and J.A.M. Holtum. 1991.Cross-resistance to herbicides in annual ryegrass (Lolium rigidum). II.Chlorsulfuron resistance involves a wheat-like detoxification system.Plant Physiol. 95:1036–1043.

Colwell, R. K., E. A. Norse, D. Pimentel, F. E. Sharples, and D. Simberloff.1985. Genetic engineering in agriculture. Science 229:111–112.

Corpet, F. 1988. Multiple sequence alignment with hierarchical clustering.Nucleic Acids Res. 16:10,881–10,890.

Cotterman, J. C. and L. L. Saari. 1992. Rapid metabolic inactivation is thebasis for cross-resistance to chlorsulfuron in diclofop-methyl-resistantrigid ryegrass (lolium rigidum) biotype SR4/84. Pestic. Biochem. Phy-siol. 43:182–192.

Croughan, T. P., H. S. Utomo, D. E. Sanders, and M. P. Braverman. 1996.Herbicide-resistant rice offers potential solution to red rice problem.LA Agric. 39:10–12.

Devine, M. D. and C. Preston. 2000. The molecular basis of herbicideresistance. Pages 72–104 in A. H. Cobb and R. C. Kirkwood, eds.Herbicides and Their Mechanisms of Action. Sheffield, Great Britain:Sheffield Academic.

Diebold, R. S., K. E. McNaughton, E. A. Lee, and F. J. Tardiff. 2003.Multiple resistance to imazethapyr and atrazine in Powell amaranth(Amaranthus powellii). Weed Sci. 51:312–318.

Doyle, J. J. and J. L. Doyle. 1987. A rapid DNA isolation procedure forsmall quantities of fresh leaf tissue. Phytochem. Bull. 19:11–15.

Ellstrand, N. C., H. C. Prentice, and J. F. Hancock. 1999. Gene flow andintrogression from domesticated plants into their wild relatives. Annu.Rev. Ecol. Syst. 30:539–563.

Estorninos, L. E., D. R. Gealy, T. L. Baldwin, F. L. Baldwin, and N. R.Burgos. 2003. Estimates of outcrossing rates between IMI rice linesand red rice based on SSR fingerprinting and phenotypic character-istics. Pages 33–40 in B. R. Wells Rice Research Studies 2002. Re-search Ser. 504. Arkansas Agricultural Experiment Station.

Fischer, A. J., D. E. Bayer, M. D. Carriere, C. M. Ateh, and K. O. Yim.2000. Mechanism of resistance to bispyribac-sodium in an Echinochloaphyllopogon accession. Pestic. Biochem. Physiol. 68:156–165.

Forlani, G., F. Nielseren, P. Landi, and R. Tuberosa. 1991. Chlorsulfurontolerance and acetolactate synthase activity in corn (Zea mays L.) in-bred lines. Weed Sci. 39:553–557.

Gressel, J. 2002. Molecular Biology of Weed Control. London: Taylor andFrancis. 504 p.

Han, B. and Y. Xue. 2003. Genome-wide intraspecific DNA-sequence var-iations in rice. Curr. Opin. Plant Biol. 6:134–138.

Haughn, G. W., J. Smith, B. Mazur, and C. Somerville. 1988. Transfor-mation with a mutant Arabidopsis acetolactate synthase gene renderstobacco resistant to sulfonylurea herbicides. Mol. Gen. Genet. 211:266–271.

Hinz, J.R.R. and M.D.K. Owen. 1977. Acetolactate synthase resistance ina common waterhemp (Amaranthus rudis) population. Weed Technol.11:13–18.

Langevin, S. A., K. Clay, and J. Grace. 1990. The incidence and effects ofhybridization between cultivated rice and its related weed red rice(Oryza sativa L.). Evolution 44:1000–1008.

Menendez, J. M., R. De Prado, and M. D. Devine. 1997. Chlorsulfuroncross-resistance in a chlorotoluron-resistant biotype of Alopecurus myo-

suroides. Proc. Brighton Crop. Prot. Conf.—Weeds. Frnham, GreatBritain: The British Crop Protection Council. P. 319.

Oh, K. J., E. J. Park, M. Y. Yoon, T. R. Han, and J. D. Choi. 2001. Rolesof histidine residues in tobacco acetolactate synthase. Biochem. Bio-phys. Res. Commun. 282:1237–1243.

Ott, K. H., J. G. Kwagh, G. W. Stockton, V. Sidirov, and K. Kakefuda.1996. Rational molecular design and genetic engineering of herbicideresistant crops by structure modeling and site-directed mutagenesis ofacetohydroxyacid synthase. J. Mol. Biol. 263:359–368.

Paterson, A. H., K. F. Schertz, Y. R. Lin, S. C. Liu, and Y. L. Chang. 1995.The weediness of wild plants: molecular analysis of genes influencingdispersal and persistence of johnsongrass, Sorghum halepense (L.) Pers.Proc. Natl. Acad. Sci. USA 92:6127–6131.

Patzoldt, W. L. and P. J. Tranel. 2001. ALS mutations conferring herbicideresistance in waterhemp. Proc. N. Cent. Weed Sci. Soc. 56:67.

Preston, C. and C. A. Mallory-Smith. 2001. Biochemical mechanisms, in-heritance, and molecular genetics of herbicide resistance in weeds. Pag-es 23–60 in S. B. Powles and D. L. Shaner, eds. Herbicide Resistanceand World Grains. Boca Raton, FL: CRC.

Rajguru, S. N., N. R. Burgos, J. McD. Stewart, and D. Gealy. 2002.Genetic diversity in red rice using SSR markers. Proc. Weed Sci. Soc.Am. 55:115–116.

Rieseberg, L. H. 1995. The role of hybridization in evolution: old wine innew skins. Am. J. Bot. 82:944–953.

Ritala, A., A. M. Nuutila, R. Aikasalo, V. Kauppinen, and J. Tammisola.2002. Measuring gene flow in the cultivation of transgenic barley.Crop Sci. 42:278–285.

Saari, L. L., J. C. Cotterman, and D. C. Thill. 1994. Resistance to ace-tolactate synthase inhibiting herbicides. Pages 83–139 in S. B. Powlesand J.A.M. Holtum, eds. Herbicide Resistance in Plants: Biology andBiochemistry. Boca Raton, FL: CRC.

Scott, R. C. and N. R. Burgos. 2004 Nov 12. Clearfield rice/red rice out-cross confirmed in Arkansas field. Delta Farm Press: 18.

Seefeldt, S. S., R. Zemetra, F. L. Young, and S. S. Jones. 1998. Productionof herbicide-resistant jointed goatgrass (Aegilops cylindrica) 3 wheat(Triticum aestivum) hybrids in the field by natural hybridization. WeedSci. 46:632–634.

Shivrain, V. K. 2004. Phenotypic Characterization and Natural Variationin the ALS Gene of Red Rice. M.S. thesis. University of Arkansas,Fayetteville, AR. 180 p.

Shivrain, V. K., N. R. Burgos, K. A. Moldenhauer, and D. R. Gealy. 2004a.Phenotypic and morphological diversity of red rice in Arkansas. Proc.South. Weed Sci. Soc. P. 207.

Shivrain, V. K., N. R. Burgos, S. N. Rajguru, O. C. Sparks, and M. M.Anders. 2004b. Potential for gene flow between imidazolinone-resis-tant rice and red rice. Proc. Weed Sci. Soc. Am. 44:65.

Subramanian, M., P. Bernasconi, and F. D. Hess. 1996. Approaches toassess the frequency of resistance development to new herbicides. Proc.2nd International Weed Control Congress; Copenhagen, Denmark.Pp. 1–8.

Tang, L. H. and H. Morishima. 1996. Genetic characteristics and originof weedy rice. China Agric. University Press. Pp. 211–218.

Tranel, P. J. and T. R. Wright. 2002. Resistance of weeds to ALS-inhibitingherbicides: what have we learned? Weed Sci. 50:700–712.

Uchino, A. and H. Watanabe. 2002. Mutations in the acetolactate synthasegenes of sulfonylurea-resistant biotypes of Lindernia spp. Weed Biol.Manag. 2:104–109.

Veldhuis, L. J., L. M. Hall, J. T. O’Donovan, W. Dyer, and J. C. Hall.2000. Metabolism-based resistance of a wild mustard (Sinapis arvensisL.) biotype to ethametsulfuron-methyl. J. Agric. Food Chem. 48:2986–2990.

Wright, T. R., N. F. Bascomb, S. F. Sturner, and D. Penner. 1998. Bio-chemical mechanism and molecular basis of ALS-inhibiting herbicideresistance in sugarbeet (Beta vulgaris) somatic cell selections. Weed Sci.46:13–23.

Zhang, W., S. Linscombe, E. Webster, and J. Oard. 2004. Risk assessmentand genetic analysis of natural outcrossing in Louisiana commercialfields between Clearfield rice and the weed, red rice. 30th Rice Tech-nical Working Group Meeting, New Orleans, LA. P. 195.

Zhi, P. S., B. Lu, Y. G. Zhu, and J. K. Chen. 2003. Gene flow fromcultivated rice to the wild species Oryza rufipogon under experimentalfield conditions. New Phytol. 157:657–665.

Received June 15, 2004, and approved April 25, 2005.