Mutational Analysis of G Protein a Subunit Goa Expressed in ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 2, Iasue of January 15, pp. 1414-1423,1993 Printed in U. S. A.

Mutational Analysis of G Protein a Subunit Goa Expressed in Escherichia coZi*

(Received for publication, August 17, 1992)

Vladlen Z. Slepak, Thomas M. Wilkie, and Melvin I. Simon$ From the Biology Division, California Znstitute of Technology, Pasadena, California 91 125

G protein-mediated signal transduction is dependent on a subunit interactions with By subunits, receptors, effectors, magnesium ions, and guanine nucleotides. The interdependence of these interactions can be probed by mutational analysis. We developed large scale screening procedures in recombinant Escherichia coli to identify and characterize novel mutations in Goa. Random mutations were generated by polymerase chain reaction in the amino-terminal 56 amino acids of Goa. Guanine nucleotide binding properties of the mutants were assayed in situ and in crude extracts of recombinant E. coli. By interactions were assayed by pertussis toxin mediated ADP-ribosylation. Efficacy of the screening procedures was evaluated by studying properties of wild-type Goa and site-directed mutations that were characterized previously in other G proteins. Several novel mutants with altered GTP binding characteristics and reduced ability to interact with By had been isolated from the randomly generated mutant library. ADP-ribosylation of mutants RlOG, KZlN, and K35E was significantly reduced, whereas two of the mutants bearing multiple amino acid substitutions were refractory to modification. Mutant K35E also exhibited reduced affinity to guanosine 5’-(3-0- thio)triphosphate at submicromolar concentrations of magnesium. These experiments demonstrate the fea- sibility of using large scale random mutagenesis in the studies of G protein function.

G proteins’ couple ligand binding and activation of a variety of cell surface receptors to intracellular enzymes and ion channels. G proteins are heterotrimeric, composed of a (39- 52 kDa), 6 (35-36 kDa), and y (8-10 kDa) subunits. The a subunits contain a high-affinity guanine nucleotide binding site, intrinsic GTPase activity, and regions that interact specifically with receptor and effector molecules (for reviews see Refs, 1-4). In mammals, a t least 17 G protein a subunits and their corresponding cDNAs and genes have been identified (5 ,6) . The amino acid sequences that are thought to form the GTP-binding pocket are highly conserved and reveal clear

* This work was supported by National Institutes of Health Grant GM 34236. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3944; Fax: 818-796-7066. 2 To whom correspondence should be addressed. Tel.: 818-356-

The abbreviations used are: G proteins, guanine nucleotide-binding regulatory proteins; GTPrS, guanosine 5’-(3-0-thio)triphosphate; IPTG, isopropyl-P-D-thiogalactoside; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction. Mutant proteins are designated by the wild-type amino acid residue (single letter code), the position of this residue, and the residue used for the displacement.

homology with the other families of proteins that are regulated by GTP binding, such as Ras and elongation factor Tu. Existing models of the structure/function relationships in the G proteins (7-9) were developed on the basis of homology between conserved amino acid sequences and comparison with the available crystal structures of EF-Tu (10, 11) and Ras (12), as well as by the use of such techniques as limited proteolysis and mutagenesis. Site-directed mutagenesis has been based mostly upon analogy with the extensive mutagenesis of Ras (13), focusing primarily on the conserved amino acid regions that are involved in Ga subunit interaction with guanine nucleotides (14-18) or studies of chimeric G. and Gi a subunits (19, 20).

In order to further examine the relationship of specific amino acid sequences to the various functions of the G proteins we intend to develop a high resolution missense mutagenesis map of the a subunit that will cover the entire protein sequence. To reach this goal, it will be necessary to generate a large number of random mutations in different parts of the a subunit protein, express the mutated cDNA in Escherichia coli, and characterize recombinant mutant protein in crude extracts from isolated clones. Mutants with altered functional properties can be identified by screening their phenotypes in a series of in vitro assays and by DNA sequence determination. Assays for a variety of Ga functions will be included in the screening procedures. We have chosen Goa (21) as a model target protein for mutagenesis primarily because it can exchange bound GDP for GTP in the absence of activated receptor, thus simplifying biochemical analysis of the protein. In contrast to several other G proteins, Goa can be expressed in E. coli in an active form. Furthermore, it has been shown that many of the characteristics of the recombinant Goa protein are very similar to those of the protein isolated from bovine brain (22-25). The properties of Goa mutants will help to predict the nature of homologous mutations in other G proteins. This information can be applied to understanding the specific interaction of G proteins with receptors and effectors.

In the present study, Goa was mutated according to the strategy outlined in the Fig. 1. To develop the screening procedures, site-directed mutagenesis was used to introduce amino acids changes known to drastically alter the function of other G protein a subunits (14-18). These mutants and the wild-type protein were expressed in E. coli and characterized directly in crude bacterial extracts, without purification of the recombinant protein. The results demonstrated that the E. coli expression system could be used for systematic screening of biochemical properties of mutated Goa. To further test the efficacy of this approach, randomly generated mutations were incorporated specifically within the first 56 amino acids of the Goa protein. Several mutants that exhibited altered binding of GTP analogs and interaction with the subunit

1414

Mutagenesis of Go a Subunit 1415

complex were identified, isolated, and characterized in a series of functional tests.

EXPERIMENTAL PROCEDURES

Goa Expression Vector-The G,aA cDNA (26) was cloned into the expression vector pML 52 (derived from pBluescript/KS+, Strata- gene)' under regulation of the T7 promoter. The resulting vector was modified to generate several unique restriction sites without altering the amino acid sequence of Goa, including NcoI at the initiation codon and BstXI, AccI, PstI, AatII, and BglII at nucleotides 174, 217, 365, 604, and 815 of the Goa cDNA, respectively; this modified vector was termed pG,a.

Antibodies-Affinitv-Durified antibodv GO. raised aeainst COOH- " . " , - terminal decapeptide of Goa sequence was generously provided by Alan Spiegel (27). The a-common antibody generated against peptide GEGESGKSIVKQMK (28) was used as crude sera in dilution 1:lOOO. (37 Subunit-Retinal subunit complex that was used in most

experiments was provided by Raymond Mosteller (University of Southern California) or was a gift from James Hurley (University of Washington, Seattle). Bovine brain (37 subunit, used in several preliminary experiments, was a gift from Patrick Casey (Duke Univer- sity). Retinal and brain (37 were equivalent in supporting pertussis toxin-mediated ADP-ribosylation of both recombinant Go and Gi, a subunits. The molar amount of (37 was calculated from the protein concentration assuming a molecular mass of 45 kDa.

Expression of the Goa in E. coli-Recombinant Goa was expressed from the T7 promoter (29) in E. coli strain BL21/DE3, a T7 lysogen that expresses T7 polymerase from the lac UV-5 promoter (30). Myristoylated recombinant Goa was obtained from this strain co- transformed with a compatible plasmid pBB131 (31) that confers kanamycin resistance and expresses Saccharomyces cereuisae N-myristoyltransferase (NMT) gene from the tac promoter.

Conditions for growth and induction of the Goa-expressing cells were similar to those used by Casey et al. (32) for expression of G,a. The E. coli cultures were typically grown in Luria broth media containing ampicilin and kanamycin at 30 "C. Expression of recombinant protein was induced in bacterial cultures a t OD, 1.5 by addition of 0.5 mM IPTG and incubation for 2 h. Cultures were harvested by centrifugation at 4 'C, and the cell pellets were frozen at -70 "C. Cells were resuspended in TEDP buffer (0.10 of the culture volume), incubated on ice with 0.1 mg/ml of lysozyme for 30-40 min, followed by addition of DNAse (of 0.04 mg/ml) and MgC1, (2 mM) to reduce viscosity caused by E. coli chromosomal DNA. The suspension was then spun at 30,000 X g for 1 h at 4 "C. Cell lysis was essentially complete as the soluble fraction contained around 90% of total E. coli protein.

Site-directed Mutagenesis-Oligonucleotide-directed mutagenesis was used to introduce the Q205L mutation in Goa, to destroy the internal NcoI site, and to introduce the BglII site at position 815. The oligonucleotides GTTTGACGTCGGAGGCCTGCGATCTGAACG, GTCCGGGCTATGGACACT, and CAAGAAAGATCTCTTTG were hybridized to uracil-containing single-stranded DNA from the plasmid pG,a (33).

The single amino acid substitutions of G203T and G204A and the double mutant GG203,204TA were obtained by PCR amplification of Goa cDNA with oligonucleotide primers that contained these missense mutations. Two regions of Goa cDNA, between nucleotides 340-609 and 598-1048, were PCR-amplified in separate reactions. These PCR products were diluted 1000-fold, combined, and reampli- fied with oligonucleotides CT 200 (CTGAACCTGTCTCTGCA- GAAC) and CT 113 (26). The resulting PCR product was digested with PstI and BglII and cloned into the pG,a cDNA between these restriction sites. The carboxyl-terminal truncation of the Goa (mutant AC5) was obtained by PCR amplification of Goa cDNA from the oligonucleotides CT200 and CT204 (GTCGACG(AG)CACTAGTG- (TG)AG(AG)TT(GT)TTGGC). These products were cleaved with BglII and SalI and cloned into the pG,a vector. The DNA sequence of these mutants was confirmed by DNA sequencing over the PCR- amplified region.

Random Mutagenesis of the Goa cDNA-The Goa cDNA was mu- tagenized by nucleotide misincorporation during PCR (34). The reaction contained 0.5 mM MnC12 and 20 mM of dATP (dATP:dGTP ratio 1:5); 25 cycles of PCR were performed. Oligonucleotides TTTAAATAAGGAGGAATAATCCATGGandGGGCCCATACAG- GACAAGAGGTCA were used as the forward and reverse primers for

' M. Lochrie, unpublished data.

the mutagenic PCR. The PCR product was cleaved with NcoI and BstXI; the resulting 174-base pair fragment was recovered after agarose gel electrophoresis and ligated into the plasmid pG,a at these sites (Fig. 1). This ligation mixture was used for transformation of BL21(N-myristoyltransferase) cells, and the resulting library of mutant Goa cDNA was spread over kanamycin and ampicilin containing agar plates.

Screening of the Mutant Library for GTP-yS Binding-For induction of Goa and N-myristoyltransferase expression, bacterial colonies were lifted to nitrocellulose filters, transferred to agar plates containing 0.5 mM IPTG, and incubated at room temperature for 3 h. After cell lysis with chloroform vapor, the nitrocellulose replicas were washed with TEDP buffer for 1 h on ice and then incubated with 0.25 PM [35S]GTP7S (40,000 cpm/nmol), 100 PM ATP in TED buffer containing 0.1 mM MgC12. After incubation for 30-60 min at room temperature, filters were washed for 1 h with several changes of the same buffer without nucleotides. Filters were then dried and exposed to x-ray film. We did not observe binding of radioactivity on the control colonies (lacking Goa) under the described conditions.

A similar protocol can be used for in situ binding of -y[32P]GTP. The nucleotide was bound to bacterial colonies expressing the GTPase-deficient Q205L mutant, used as positive control, whereas the radioactivity was not detected on the other Goa clones, apparently,

P l 7

Nml BMXI

r h, Site-directed PCR mutagenesis mutagenesis

1 ( ) G203T

(-1 G204A

c-1 E::: c-) 0205L

NCOl BStXl

~ & & k j * f . ... f t .. 1 f .f

, ,(. ~ ,

. . ~ " ~ * ..-* , ' 4 NCO I +BstX I Ncol BstX I

Ei3 el E \ /

LIGATION

TRANSFORMATION

AC5

Study functional properties Screen mutant library

FIG. 1. Strategy for mutagenesis studies of Goa. The G,aA cDNA in plasmid pG,a was modified by two approaches. First, site- directed mutagenesis was used to substitute Leu for AsnZo5 which reduced the rate of GTP hydrolysis approximately 100-fold in other G protein a subunits (12) and to substitute Thr for GlyZo3 and Ala for GlyZo4, which have been reported to yield dominant negative mutations in other a subunits (16-18, 55). The double mutant GG203,204TA was also tested, as well as a carboxyl-terminal truncation of 5 amino acids (AC5) (52, 55). Second, numerous missense mutations were randomly incorporated by PCR between the oligonucleotide primers (short arrows) flanking the Goa cDNA. Mutations were confined to the amino-terminal portion of the Goa gene by transferring a region of the mutated cDNA between the NcoI site at the initiation codon and the unique BstXI site at position 174 of the nucleotide sequence to the remaining wild-type cDNA sequence. The mutated region was limited to the first 56 amino acids of the Goa protein. Mutated cDNA was used for transformation of the E. coli strain BL 21 DE3 (N-myristoyltransferase); the resulting library was screened by the series of functional tests. The solid black bar denotes wild-type Goa cDNA sequence, the stippled bar symbolizes the region that was PCR amplified under mutagenic conditions. Asterisks identify positions of missense mutations within the coding sequence of the cDNA.

1416 Mutagenesis of Go (Y Subunit

due to hydrolysis of GTP3 Therefore, this method can be used to screen for the GTPase-deficient mutants of Goa. However, the background of the GTPase reaction in crude bacterial extracts was too high, thus complicating the subsequent studies of such mutants (our data concerning Q205L mutation in Goa were obtained by the indirect assays, limited proteolysis and ADP-ribosylation, see “Results”).

Zmmunoscreening of the Mutant Library-After the nitrocellulose replicas were exposed to x-ray film and positions of the “GTPyS- positive ” clones were identified, the same filters were incubated with the antibody GO, generated against the carboxyl-terminal decapeptide of Goa. The usual Western protocol was used to visualize the position of colonies expressing the full-size recombinant Goa protein. Isolated clones were streaked on agar plates and retested for both GTPyS binding and recognition by the antibody GO. In most cases, the resuits of the secondary screen corroborated their phenotype.

Screening Mutants for ADP-ribosylution by Pertussis Toxin-After screening of the colony lifts with the GO antibody and in situ [35S] GTPrS binding assays, clones were divided into two pools: those that were positive in both assays (like the wild-type Goa expressing clones) and those that produced the full-size protein but were negative in the GTPyS binding assay. Clones from both pools were transferred from agar plates to 150-pl Luria broth/amp+kan cultures in 96-well microtiter dishes, grown, and induced by 0.5 mM IPTG. After induction, E. coli cells were lysed by freeze-thawing in the presence of lysozyme, and cell extracts (30 pl) were obtained by centrifugation. The extracts were transferred to a new 96-well plate to assay pertussis toxin- mediated ADP-ribosylation in the presence of added [32P]NAD and 45 ng of retinal By. After initial screen, “candidate” mutants were retested following growth and induction in 25-ml cultures under strictly controlled conditions. Extracts with the same concentration of recombinant Goa and total E. coli protein were obtained for comparative biochemical studies. Recombinant Goa in the assay was quantified by Western analysis and [35S]GTPrS binding under saturating conditions (30-60 min at room temperature).

Sequencing of the Goa Mutants-The DNA sequence of mutant Goa cDNAs was determined by the dideoxy chain-termination method (35). Missense mutations introduced by PCR were evenly distributed over the targeted region transitions and transversions being obtained in nearly equal proportion.

Determination of Bound Nucleotide-Determination of GTPrS binding activity of the recombinant G protein a subunits was performed by a modification of the method described by Sternweis and Robishaw (21); bacterial extracts were diluted 10-fold with the TED buffer (20 mM Tris-HC1, pH 8.0, 1 mM EDTA, 1 mM dithiothreitol), containing 0.25 p~ GTPyS (40,000 cpm/pmol) at 22 “C. In most experiments the final concentration of total E. coli protein was 0.5 mg/ml in a volume of 260 pl. For the time course experiments, 2 0 4 aliquots were withdrawn from the reaction, diluted 10-15-fold with ice-cold TED buffer containing 1 mM MgCl, in excess of EDTA, filtered through 45-pm nitrocellulose filters, washed three times with the same buffer, and dried. The amount of bound radioactivity was determined by scintillation counting.

Under standard assay conditions the background, determined as either the binding of GTPyS to control (without rG,a) cell extracts or at zero time, was less than 0.3% of the 36S in the assay. The background was not reduced by a 10-fold dilution of the radioligand with the unlabeled GTPyS; about one-third of the background was contributed by adsorption on the nitrocellulose filter. In extracts of the cells producing wild-type rG,a [35S]GTPyS binding was on the average 40-fold higher than in the control. This enabled us to study the GTPyS binding properties of the recombinant Ga directly in the crude extracts. Nonspecific protein of the E. coli extract had no significant influence on the GTPyS binding to rG,a at concentrations of E. coli protein up to 2.5 mg/ml? The variability in GTPyS binding did not exceed 5% when determined in the same extract. For the different extracts the the extent of specific binding varied from 500 to 1250 nmol/mg E. coli protein, reflecting the level of rG,a expression.

Guanine Nucleotide-dependent Limited Proteolysis with Trypsin- Bacterial extracts (100 pl, 1 mg/ml) were first preincubated with guanine nucleotides (100 p~ in most experiments) at room temperature for 30 min to promote complete binding. Trypsin (5 pl, 0.2 mg/ ml) was added to the incubation mixture, and the cleavage reaction was monitored by withdrawal of 2 0 4 aliquots at indicated times. Proteolysis was terminated by addition of an equal volume of 2 X SDS-PAGE sample buffer (50 mM Tris-HC1, pH 8.0,2% SDS, 2% p-

V. Z. Slepak, unpublished data.

mercaptoethanol, 20% glycerol) and heating for 5 min at 90 “C. The proteolytic pattern was subsequently analyzed by Western Blot.

ADP-ribosylation with Pertussis Toxin-Pertussis toxin-catalyzed ADP-ribosylation was performed by a modification of the method of Bokoch et al. (36). Typically, 10 pl of bacterial extract (2.0 mg/ml of protein) were mixed with retinal By subunit complex (10 p1, varying between 0.01 and 0.2 mg/ml) and incubated for 10 min at room temperature before addition of 10 pl of the reaction mixture (final concentration of 20 mM Tris-HC1, pH 8.0,l mM EDTA, 2 mM MgC12, 2 mM dithiothreitol, 10 p~ GDP, 0.5 p~ [32P]NAD (20,000 cpm/ pmol) and 10 pg/ml pertussis toxin (List Biologicals)). Reactions were incubated for 1 h at room temperature and terminated by addition of 10 pl of a 5 X SDS-PAGE sample buffer. Samples were then heated for 5 min at 90 ‘C and resolved on an SDS-polyacrylamide gel. Gels were stained with Coomassie Blue, dried, and exposed to x-ray film.

Pertussis toxin-mediated ADP-ribose incorporation was quanti- tated using PhosphorImager (Molecular Dynamics). To normalize the PhosphorImager data (arbitrary units, depending on time of the exposure) selected protein bands were excised from the dried gels and the incorporated radioactivity was determined by scintillation counting. Incorporation of ADP-ribose moiety into wild-type myristoylated rG,a reached 30-60% in most experiments.

Other Procedures-Construction of the expression vectors was as described by Sambrook et al. (33). SDS-polyacrylamide gel electrophoresis was performed according to Laemmli (37). Immunoblot analysis was as described previously (38). Protein concentration was determined by the method of Bradford (39) using bovine serum albumin as a standard.

RESULTS

Characterization of the Goa Expression System In order to obtain recombinant Goa protein (rGoa) that is

myristoylated at the amino terminus (40-43), wild-type and mutant Goa proteins were co-expressed in E. coli with S. cerevisae N-myristoyltransferase. Co-expression in E. coli results in the myristoylation of a significant portion of the recombinant G protein a subunit (43). We recovered up to 50% of the expressed G protein from the soluble fraction of the cell lysates. Extracts containing wild-type rGoa bound 0.1-0.2 nmol of [35S]GTPyS/mg of protein, whereas in control extracts (without rGoa) the radioligand binding was almost 100-fold less. Therefore, rGoa accounted for roughly 0.5% of protein in the soluble extract, in agreement with Western analysis of the extracts as well as with the yield of Goa in similar E. coli expression systems (22).

Binding of f5SJGTPyS Fig. 2 shows that [35S]GTPyS binding to wild-type rG,a in

crude bacterial extracts reached saturation within 30-40 min at 22 “C. The nucleotide remained bound for at least 2.5 h, indicating that no significant degradation of the G protein occurred under these conditions. The background GTPyS binding in the control extracts was very low compared with that in the clones expressing rGoa.

G protein a subunits bind GTPyS very tightly in the presence of magnesium. The Ga-GTPyS-magnesium complex is very stable; once it is formed, the bound nucleotide does not dissociate even if free magnesium is removed (44). AC- cordingly, recombinant Goa in the crude extract did not exchange prebound radioligand when excess nonradioactive GTPyS was subsequently added (Fig. 2). Consistent with previous observations that less than 0.1 pM of free magnesium is sufficient to promote high affinity binding of GTPyS (44, 45), addition of 1 mM EDTA to the crude extracts did not significantly alter the binding curve. In a separate experiment, the crude extract was depleted of residual magnesium by means of partial purification on DEAE (22). As expected, in this preparation we could detect relatively slow but distinct


exchange of the prebound [35S]GTPyS for the unlabeled nucleotide in the presence of 1 mM EDTA (data not shown).

The influence of magnesium on GTPyS binding can be used to characterize mutant Goa proteins in the crude extracts. The G226A mutation in Goa was recently shown to allow GTPyS exchange, even in the presence of millimolar magnesium (18). We tested the properties of the analogous mutations G204A and G203T in Goa (Fig. 3). The G203T and G204A mutant proteins exhibited several distinct changes relative to the wild-type rGoa protein. First, at submicromolar concentrations of free magnesium (excess of EDTA), the extent of [35S]GTPyS binding to the G203T and G204A mutants was significantly lower than in the presence of magnesium (Fig. 3, A and B ) . Second, even in the presence of 4 mM of free magnesium, binding of [35S]GTPyS to the G203T and G204A mutants was reversible, as shown by displacement upon addition of the nonradioactive GTPyS (compare Fig. 3, A and B, to Fig. 2). In the presence of 4 mM free magnesium, GTPyS bound to the G204A mutant with kinetics similar to

I - 40000 0

- 30000 .E I

U - 20000 .E

2 10000 & -

0 30 60 90 120 150 180 Time (min)

FIG. 2. Time course of GTPyS binding to wild-type rG,a in the crude E. coli extract. 25 p1 of the wild-type rG,a extract (protein concentration 4-8 mg/ml) was diluted 10-fold with TED buffer containing 0.25 p~ GTP-yS (40,000 cpm/pmol) and incubated at 22 ‘C. At the indicated times, 20-pl aliquots were withdrawn and assayed for bound [35S]GTPyS (black triangles, expressed as nano- moles/mg E. coli protein). A second aliquot of the same extract was initially incubated under identical conditions (white triangles) but after 50 min, 100 PM of unlabeled GTPrS was introduced. [35S] GTP+ binding is shown in a control E. coli extract that did not express Ga (black circles). The data shown are from a single experiment that was representative of eight experiments ( n = 8) performed with four independently prepared protein extracts.

those of the nucleotide binding to wild-type Goa; binding to the G203T mutant was somewhat faster, probably due to the faster dissociation of the prebound GDP (46). After 30-40 min at room temperature, we consistently observed a slow decrease in the level of bound nucleotide, which might be due to an instability of the two mutants in the crude extract. We have not observed this phenomenon with the wild-type rGoa or with the other mutants tested.

Binding of [35S]GTPyS the G203T and G204A mutants could be manipulated by addition of magnesium or EDTA to the crude extracts (Fig. 3, C and D). If after some time of incubation with EDTA an excess of magnesium was added to the assay, both mutants showed binding which nearly reached the level observed when magnesium was present initially. In the reciprocal experiment, addition of excess EDTA initiated a rapid dissociation of nucleotide from the a subunit. Thus, the biochemical properties of GTP and magnesium binding could be readily assayed in crude E. coli extracts.

Limited Proteolysis of rGoa and its Mutants with Trypsin in the Presence of Guanine Nucleotides

Guanine nucleotides protect G protein a subunits, including Goa, from proteolytic degradation (47-50). In the presence of trypsin unbound Goa is hydrolyzed into short peptides within minutes. In contrast, nonhydrolyzable analogs of GTP induce an active conformation that is resistant to proteolytic degradation. Trypsin releases a short peptide of 21 amino acids from the amino terminus of wild-type Goa, leaving the remaining 37-kDa polypeptide stable to further degradation (50). The “nucleotide protection” assay can be used not only to study the nucleotide binding to the G protein a subunits but also to monitor whether the protein acquires the “correct” proteolysis-resistant conformation (15, 51). Fig. 4 shows that limited proteolysis with trypsin in the presence of different guanine nucleotides can be used as another functional assay of recombinant Goa and its mutants in crude bacterial extracts. The pattern of the resulting proteolysis products was visualized by Western blotting with Goa-specific antibodies.

A time course of proteolytic digestion of wild-type Goa in the presence of GTPyS and GTP shows that the 37-kDa

FIG. 3. GTPrS binding to the G204A and G203T G,cr mutants. GTPrS binding was monitored as described in the legend to the Fig. 2. [%] GTP-yS was allowed to bind in the presence of 4 mM MgCL (black triangles) or 0.1 mM MgCl, plus 1.0 mM EDTA (open circles) ( A and B ) . After 50 min, either water or 100 p~ of unlabeled GTPrS (open triangles) was introduced to one of two identical aliquots containing 4 mM magnesium. In a separate experiment (C and D), EDTA or MgC12 was added after 50 min to the final concentrations of 4 mM.

100

0

A

0 20 40 60 80 100 120 140

Time (min)

C

i o0 / EDTA

50

25

n

0 20 40 60 80 100 120 140 Time (min)

B

0204A, Mg n-3

0 20 40 60 80 100 120 140

Time (min)

0

D r-

1 oo

0 20 40 60 80 100 120 140

mme (min)

1418 Mutagenesis of Go a Subunit

A - "

~ 39 kDa

TIME,min: 0 10 20 45 0 10 20 45 0 10 20 45 0 10 20 45 GTPF GTP GTPF GTP

I I I I \KT Q205L

B

0" m- -0" 39 kDa

G203T G204A G203T G204A

AC5

FIG. 4. Tryptic digestion of wild-type and mutant rG.a. Time courses of tryptic digestion are shown for wild-type rG.a ( WT) ( A ) and the activated mutant Q205L (Q205L) in the presence of GTP or GTP-yS and the other site directed mutants of Goa incubated with GTP-yS (B) . Bacterial extracts (100 pl, 150 pg of protein) containing recombinant a subunits were incubated with 100 pM nucleotide for 15 min at room temperature to allow the binding to occur. Trypsin (1.5 pg) was then added to initiate proteolysis. A t the indicated times, 20-pl aliquots were withdrawn and mixed with 20 pl of 2 X SDS- PAGE sample buffer to stop the reaction. The samples were then heated at 90 "C for 3 min and subjected to SDS-PAGE. The G proteins were visualized by Western analysis using the antibody GO, raised against the COOH-terminal decapeptide; the AC5 mutant was detected with the a-common antibody, raised against the peptide GAGESGKSTIVKQMK located between amino acid residues 40 and 54 of the protein. The alkaline phosphatase method ( A ) or Amersham ECL chemoluminiescent detection system ( B ) was used to detect the antigen-antibody complex. Representative data from a t least two independent experiments are shown for each mutant. Note: in the ["SS]GTPyS binding assay analogous to that shown in Fig. 2, the Q205L mutant bound GTP+ similarly to the wild-type protein (data not shown).

fragment is formed only with the nonhydrolyzable analog. In contrast, the Q205L mutant can be protected from digestion by either GTPyS or GTP, apparently due to inhibition of GTP-ase activity that is caused by this mutation (Fig. 4A). In the absence of nucleotides both proteins degrade to small peptides (not shown). When subjected to proteolysis with trypsin in the presence of GTPyS, the G203T and G204A mutants initially formed the 37-kDa polypeptide but were then rapidly degraded (Fig. 4B). We did not observe any significant difference in this proteolytic pattern when excess magnesium or EDTA was present in the assay (data not shown). The proteolytic assay demonstrates that GTPyS binding to the G203T and G204A mutants was insufficient to stabilize the active proteolysis-resistant conformation. Re- sistance of the AC5 mutant to proteolysis was similar to that of the wild-type Goa (Fig. 4B). This is consistent with the properties of the truncated protein recently described by Denker et al. (52) as well as with our data obtained in [35S] GTPyS binding assay (data not shown).

ADP-ribosylation with Pertussis Toxin ADP-ribosylation of Goa by pertussis toxin requires the

presence of the By subunit complex. Thus, the interaction of recombinant Goa and exogenous @y could be assayed as a function of a subunit modification with [32P]ADP-ribose in the presence of [32P]NAD and pertussis toxin (36, 53). The crude bacterial extracts supported this assay, but we also observed labeling of some nonspecific (i.e. +independent) proteins in the crude bacterial extracts, primarily a band with molecular mass approximately 60 kDa (Fig. 5A) and sometimes a protein with a molecular mass around 34 kDa. Label- ing of the nonspecific proteins varied in different experiments

FIG. 5. Pertussis toxin-mediated ADP-ribosylation of wild- type and mutant rG.a. G proteins were labeled with [32P]NAD, and pertussis toxin as described under "Experimental Procedures" and subjected to analysis by SDS-gel electrophoresis. Reactions for ADP- ribosylation contained 10 pl of the E. coli extract (1.0-2.0 mg/ml of protein), varying amounts of retinal j3-y subunit complex (added in the volume of 10 p l ) , and 10 pl of solution that contained pertussis toxin, [32P]NAD, and other necessary components of the reaction. After 45 min of incubation at room temperature (22 "C) the reaction was stopped by adding 10 pl of a 4 X SDS-PAGE sample buffer and heating for 3 min at 90 "C. The samples were then run over a 12% SDS gel, and the gel was stained, dried, and exposed for autoradiog- raphy. A, effect of guanine nucleotides on ADP-ribosylation of wild- type rGoa and the Q205L mutant. 200 ng of the P-y subunit complex (2-fold excess over the estimated amount of rG,a) is present in the assay. The concentration of GTP and GTP-yS was 100 p ~ ; GDP was present in all the reactions at 25 p ~ . B-D, effect of j3-y subunit on ADP-ribosylation of wild-type ( WT) rG,a and the G203T and G204A mutants. Approximately 2.5 pmol (100 ng) of the rG,a was present in each reaction. Different amounts of j3-y were added to each assay. Lanes, from left to right in B: 0, 10, 25, 50, 100, 250, 500 ng; C and D: 0, 25, 50, 100, 250, 400 ng. Effect of 100 p~ GTP-yS on pertussis toxin labeling of G203T ( C ) and G204A (D) mutants is shown adjacent to a control reaction containing 25 p~ GDP (100 ng of rG,a and 200 ng of P-y).

and sometimes incorporation of 32P into the 60-kDa band was equal to the labeling of the rGoa. Therefore, to quantify the modification of Goa after the pertussis toxin treatment we separated the proteins by SDS-PAGE and determined the amount of the radioactivity specifically in the 39-kDa band.

ADP-ribosylation of wild-type rGoa was the same in the presence of GTP or GDP, indicating that GTP was efficiently hydrolyzed to promote interaction of the recombinant a subunit with by. In contrast, the nonhydrolyzable analog, GTPyS, strongly inhibited labeling, apparently due to dissociation of the a/3y heterotrimer. The Q205L mutant was a substrate for pertussis toxin only in the presence of GDP (Fig. 5A); ADP-ribosylation was dramatically reduced by addition of either GTP or GTPyS, consistent with previous results, indicating that this mutation inhibits intrinsic GTPase. Significantly, ADP-ribosylation of recombinant a subunits was strongly dependent on the presence of exogenous Py subunit complex in the assay. The extent of labeling was a function of By concentration (Fig. 5, B-D); this provided an opportunity to evaluate the relative affinities of mutant Goa subunits to Py on the basis of dose-response experiments (see Fig. 8).

In Situ Binding of f6SJGTPyS

The results presented above demonstrated that mutants of Goa can be expressed in E. coli and rapidly characterized with respect to guanine nucleotide binding and interaction with By subunits. These assays were used to characterize randomly generated mutations in the amino terminus of Goa. To facilitate screening of mutant libraries, we developed an in situ GTPyS binding assay similar to that used to screen for the mutants of Ras protein (54). Following transformation of

Mutagenesis of Go a Subunit 1419 randomly mutated Goa cDNA, bacterial colonies were lifted similar to that of the wild-type rGoa. In the presence of 4 mM to nitrocellulose filters and transferred to IPTG-containing magnesium bound [3SS]GTPrS is not readily exchanged, i.e. agar to induce expression of recombinant proteins prior to binding is “pseudoirreversible.” A small portion of the protein lysis. Filters were then incubated with [36S]GTPrS to identify does exchange prebound nucleotide, but this fraction of the clones that were able to bind the nucleotide (see “Experimen- binding sites never exceeded 20%; most of the K35E protein tal Procedures”). The same filters were subsequently probed stably bound GTPrS for at least 1.5 h at room temperature. with affinity-purified polyclonal antiserum raised against the However, addition of EDTA to crude extract allowed pre- carboxyl-terminal decapeptide of Goa to distinguish those bound [36S]GTPrS to be exchanged within 1 h, showing that missense mutants that could not bind GTPrS from the non- affinity of the K35E mutant for magnesium was dramatically sense mutants that expressed truncated protein (Fig. 6). reduced compared with the wild-type Goa.

Preliminary experiments showed that colonies expressing wild-type Goa and Gia could bind [36S]GTPrS in the in situ Screening of the Random Library for Mutants Deficient in assay, whereas clones expressing Gta, Glia, GISa, and GIsa Interaction with py did not bind the ligand (data not shown). In situ binding was To apply the ADP-ribosylation assay to screening of the not detected with control cells that did not express Goa, nor mutant library, clones were grown and induced in 120-pl with clones producing G203T and G204A mutant proteins. cultures in 96-well microtiter dishes. A small volume (30-40

A significant number of clones from our first randomly pl) of cell extract containing rGoa was obtained after cell lysis. generated mutant library produced full-size rGoa but were The lysates were subjected to ADP-ribosylation by pertussis negative in GTPrS binding (Fig. 6). Some of these clones toxin in the presence of NAD and exogenous (retinal) /?r were grown and induced in a 25-ml liquid culture under subunit complex. In the initial screen (four 96-well dishes) strictly controlled growth conditions. Cell extracts were as- around 40 clones were found to be refractory to ADP-ribosyl- sayed for their GTPrS binding properties. These mutants ation. These clones were retested after growth and induction expressed Goa protein that was recognized by the carboxyl- under controlled conditions in 25-ml cultures. terminal antibody, but they did not bind GTP+ in solution. The efficiency of formation of the aPr heterotrimer with They were also negative in the other functional assays, namely the mutant a subunits was evaluated in a series of experiments protection from trypsin degradation and ADP-ribosylation where pertussis toxin-catalyzed ADP-ribosylation was carried with pertussis toxin. Each of these, classified as “null” mu- out as a function of increasing concentration of added &. tants, had multiple amino acid substitutions. Another group The amount of the Goa subunit determined by GTPrS bind- of mutant clones did bind [35S]GTPrS in the standard assay. ing and Western Blot was adjusted to be approximately equal For example, Fig. 7 illustrates the properties of the K35E in the different extracts. The total protein was also brought mutant, which has the only one amino acid substitution. The to equal concentration of approximately 1.5 mg/ml by addi- time course of GTPrS binding with the K35E mutant is tion of specific amounts of control (without rGa) extract.

Wild-type rGoa and a blank E. coli extract were present in every experiment as positive and negative controls. On the basis of these experiments we divided the mutants into three classes according to their ability to be ADP-ribosylated by pertussis toxin (see Fig. 8 and Table I).

Class I-Many of the mutants selected as negative in the

toxin, especially at high concentrations of &. These clones were misidentified in the initial screen, because it was not possible to coordinate growth and induction of all cultures in a 96-well microtiter dish. These mutants were subdivided into

FIG. 6. Screening of E. coli library expressing mutants. two groups; one group of these mutants was similar to the E. coli clones were lifted from agar plates on to nitrocellulose filters. wild-type and could be ADP-ribosylated to saturation when Expression of recombinant protein was induced by incubating on IPTG-containing agar prior to cell lysis. A, a nitrocellulose filter was the ratio Of was to Or even less than The incubated with the [%3]GTPyS as described under “Experimental other group of mutants could be labeled to nearly maximal Procedures,” washed, dried, and exposed to the x-ray film for 12-36 level only in an excess of Dr. For example, we never achieve h. B, the same filter was subsequently incubated with antibody raised saturation in the modification of G2D mutant, which lacks against Goa COOH-terminal decapeptide. The antigen-antibody com- the site for myristoylation (42) or with nonmfistoylated plex was visualized with the Amersham ECL chemoluminescence protocol. TWO clones expressing G , ~ that were positive in the [%SI rGoa. Several other mutants isolated from the random library GTPyS in situ binding assay (black arrows), and two negative clones also had Properties similar to those of nonmYrisbYlated a capable of producing full-size protein (open arrows) are shown. subunit. Careful quantitative study of the kinetics of ADP-

A .

i first screen turned out to be good substrates for pertussis

FIG. 7. GTPyS binding to the G& K3SE mutant. The extract was incubated with [35S]GTPyS in the presence of 4 mM M&12 ( A ) or 0.05 mM M&12 and 1.0 mM EDTA ( B ) . At the indicated times 20-pl aliquots were withdrawn and assayed for bound nucleotide. At 50 min, unlabeled GTPyS (50 JIM) was added to one of the two identical aliquots (white triangles); equal volume of water was added to the control (black triangles).

A B

100

75

50

25

0 0 30 60 90 120 150 180

Time (min) 0 30 60 90 120 150 180

T h e (min)

1420

A

Mutagenesis of Go a Subunit

B

39kD * K35E

” II

II

I

C Pya ratio

K21 N

I 39kD,

4812

FIG. 8. Classification of Goa mutants according to the effect of @T on the pertussis toxin-catalyzed ADP-ribosylation. The extracts were incubated with different amounts of @r ranging from 0.25 to 25 pmol. Each reaction contained 1.0-2.5 pmol of the rGoa. All the reactions were carried out in the presence of 25 p~ GDP, as described in the legend to Fig. 5. A, autoradiographs of the gels. Representative data is shown; each mutant was assayed in a t least in three independent experiments. WTf-NMT), wild-type rG,a, expressed in the nonmyristoylating BL21 cells. Positive control ( WT, 100 ng @r) is shown on the same gel fragment with the RlOG mutant ( l a n e 1 ) . B, quantitation of the pertussis toxin-catalyzed ADP-ribosylation. The dried gels containing labeled rG,a were exposed to the PhosphorImager excitation screen to quantitate the radioactivity. Data collected from all mutants is summarized in Table I (see text for explanations). The position of each symbol identifies the average extent of ADP-ribosylation in each reaction; the extremes are shown by error bars. Incorporation of [32P]ADP-ribose into the wild-type rG,a at the saturating concentration of j3r was defined as 100% (y axis). C, ADP-ribosylation of the wild-type rGoa and the 4Gll mutant. The mutant 4Gll was isolated from the random library; although it has 6 amino acid substitutions it was capable of high affinity binding of GTPrS (see text and Table I for details). 2.5 pmol of both wild-type rGoa ( WT) and the mutant were present in the reaction; amount of j3-y introduced WT-50, 100 and 200 ng; 4Gl1, 50, 100, 200, and 500 ng. The last two lanes to the right show an experiment where the wild-type extract was mixed with the 4Gll extract prior the incubation; for control, an equivalent amount of blank bacterial extract (without rGa) was tested (200 ng of j3-y was present in the assay).

ribosylation is required in order to ascertain the precise degree of change in their interaction with P-y complex. Nonetheless, we could clearly discriminate between the class I mutants, which were relatively good substrates for pertussis toxin, and two classes of mutants addressed below whose ADP-ribosylation was reduced dramatically.

Class ZZ-The level of the modification represents only a small fraction of the mutant a subunit in the assay, even with excess of P-y. The ability of these mutants to be ADP-ribosylated was reduced, most likely due to their lower affinity for P-y, since labeling increased with increasing amounts of P-y in the assay.

Class ZZZ-These mutants were extremely poor substrates for pertussis toxin. We could not detect any labeling of two mutants, “4Gll” and “4B12,” and incorporation of [32P]ADP- ribose into the mutant K35E was less than 5% of the wild- type rGoa, even at a 5-fold excess of 0-y over the a subunit. The extract from cells expressing the 4Gll rGoa had no inhibitory effect on the labeling of the wild-type Goa, i.e. its inhibitory effect was no more than that of the control extract (Fig. 8C).

DISCUSSION

In this study our primary goal was to develop functional assays for screening libraries of Goa mutant proteins that were expressed in E. coli. Simple assays allowed us to rapidly pinpoint clones with interesting phenotypes worthy of further detailed analysis. The level of Goa expression in E. coli was sufficient to support some of the common assays used in G protein biochemistry. In contrast to eucaryotic cells or in vitro translation systems (51) there was no background of endoge- nous a or B-y subunit activity in the soluble fraction of the bacterial cell lysate. In a series of preliminary experiments with extracts from clones expressing the wild-type Goa, we determined two basic functional assays that could be carried

out in the crude extracts: [35S]GTP-yS binding and ADP- ribosylation by pertussis toxin as an assay for interaction with the exogenous 0-y. Nucleotide-dependent limited proteolysis of recombinant G proteins was also used as a corroborative technique. Initially, these methods were tested on Goa mutants that were expected to have specific phenotypes based on previous studies of the G protein a subunit family. The procedures were subsequently used to screen a library of random mutations introduced in the portion of the Goa cDNA encoding the 56 NH2-terminal amino acids.

Mutations Altering the Guanine Nucleotide Binding-To test responsiveness of our assay system, we introduced in Goa mutations analogous to those that either inhibited the intrinsic GTPase or impaired GTP binding in a. (14, 15, 17, 18), (yi

(16), and yeast GPA 1 (55). In agreement with the previous studies of other G proteins, the Q205L mutation in Goa inhibited GTPase activity, (Figs. 4 and 5), whereas G203T, G204A, and the double mutant GG203,204TA affected the nucleotide binding (Fig. 3). The major feature of the latter mutants was that they do not maintain the “active” conformation upon binding of GTP-yS even at millimolar concentrations of free magnesium; at submicromolar concentrations of the cation the mutants lost their affinity for GTP-yS. Although each mutant a subunit exhibited changes in interaction with guanine nucleotides, they did not necessarily alter interaction with their effectors (14,15,56) or P-y. For example, G203T and G204A mutants of Goa could be ADP-ribosylated by pertussis toxin in the presence of exogenous P-y, and GTP-yS generally inhibits the reaction (Fig. 4, B and C). This indicates, that poor binding of the nucleotide can be overcome to achieve pertussis toxin resistance, apparently due to dissociation of aP-y complex in the presence of GTP-yS. Her- mouet et al. (16) reported that ADP-ribosylation of analogous mutants in Gia could not be prevented by GTP-yS. The contradiction is more likely due to the fact that Goa has a


TABLE I Functional properties of Goa mutants

Mutants that had one or two missense mutations are included in the table. The only exceptions are the carboxyl-terminal truncation (AC5) and mutants “4Gl1,” with 6 amino acid substitutions (E8G, E14V, K17A, I19T, K21N, and V50A), and “4B12,” with three substitutions (3CR, L13H, and E14G). The later two mutants are of specific interest because they have a very distinct negative phenotype in the ADP- ribosylation assay.

Stahilitvb Stability to

Mutation Binding of GTPyS“ EDTA Mg

trypsin in the

Dresence of

Affinity to BYd

GTPyS’

Wild-type rG,a + + + Stable I WT rG,a(-NMT) + + + Stable I 3D3 negative control - - - Unstable 111

G2D c 3 s C3S,L5P T4A E8K RlOG K21N T4K,K21N N22D V34A K35E I49M 4G11 4B12 G203T G204A G203T,G203A Q205L AC5

+ + + + + + + + + + + + + + + + + + +

+ + + + + + + + + + - +

ND +

+ + + + + + + + + + + +

ND +

Stable Stable Stable Stable Stable Stable Stable Stable Stable Stable Unstable Stable Stable Unstable

- - Unstable - - Unstable - - Unstable + + Stable + + Stable

I I I I I I1 I1 I1 I I I11 I 111 111

I I I I NA

GTPyS binding in solution. Assayed as described in legends to Figs. 2 and 3.

e Sensitivity of the mutants to tryptic digestion is illustrated in Fig. 4, with the exception of 3D3, which was hydrolyzed in seconds (not shown).

The extent of labeling with pertussis toxin in the presence of retinal @y (see Fig. 8 for classification).

lower affinity for By than Gia (57) than due to the difference in our assay systems.

To identify more mutations altering guanine nucleotide binding and to facilitate screening of the Goa expressing E. coli libraries, we developed an in situ [35S]GTPyS colony binding assay. A similar technique using a[32P]GTP allowed Feig et al. (54) to discover RAS mutants with decreased affinity for GTP. We found that [35S]GTPyS was more useful as the ligand for our screens than CX[~’P]GTP because it had a much lower background. Furthermore, GTPyS binds to the a subunits of trimeric G proteins very tightly, especially in the presence of magnesium. After the Ga-GTPyS complex had been exposed to magnesium, binding of GTPyS becomes “pseudoirreversible.” The triple complex Ga-GTPyS-magnesium is considered to represent the “active” conformation of Ga, which is characterized by stability to trypsin and an increased intrinsic fluorescence (45). Therefore, GTPyS can be used to assay not only the kinetics of binding but also to study the G protein’s affinity for magnesium and its ability t o assume the active conformation. Mutants that did not bind [35S]GTPyS in the in situ assay were not always completely inactive. For example, the mutants G203T, G204A, and K35E were negative in the colony-binding assay but showed specific binding of GTPyS when assayed in the bacterial extracts under certain conditions. Thus, our screen identified mutants that were deficient in the ability to bind the ligand in the pseudoirreversible manner. There are (at least) two magnesium binding sites with different affinities on the G protein a subunit (58). The low affinity binding site (millimolar magnesium) is associated with activation of holo-G proteins (dis-

sociation of a& heterotrimer). High affinity binding (nano- molar magnesium) correlates with the Ga active conformation (44, 45, 58, 59) as well as with intrinsic GTPase of the free a subunit (60, 61). This high affinity site for magnesium might be altered in the K35E mutant, since it did not require magnesium for GTPyS binding, as did the G203T and G204A mutants, but the “locked” active conformation could be as- sumed only if millimolar magnesium was present.

Mutations Altering Interactions with By-Association of a, with the By heterodimer can be easily assayed by the ADP- ribosylation reaction, since the free a subunit is not modified by pertussis toxin (53). We initiated mutagenesis of the Goa from the NH2 terminus, because previous studies (47-50) suggested that this region was essential for a subunit interaction with By.

We observed the expected effects of exogenous Py and guanine nucleotides on ADP-ribosylation of wild-type recombinant Goa and of the previously characterized mutants in crude E. coli extracts. This made it possible to apply the ADP- ribosylation reaction to screening large numbers of mutants from the randomly generated library. The method is very useful for screening if the differences between the mutants is significant. However, quantitative assays for ADP-ribosylation were, in general, less reproducible in our hands and more sensitive to inhibition by high concentrations of the bacterial extract than, for example, [35S]GTPyS binding. The efficiency of ADP-ribosylation was adversely affected by two systematic problems; first, a variable fraction of the recombinant Goa remained nonmyristoylated (43), and second, it was difficult to control growth rates of the clones on the 96-

1422 Mutagenesis of Go a Subunit

well plates. Therefore, concentration of total protein in the extracts varied greatly, as did the yield of myristoylated rG,a. Nonetheless, the screens revealed several clones that contained proteins that were poor substrates for py-dependent ADP-rihosylation, and two of them seem to be completely resistant to modification (see Fig 8, Table I). However, the mechanism of pertussis toxin resistance is unclear; these mutations could allow interaction with by but allosterically prevent interaction with the toxin itself. Additional methods, such as sucrose density gradient centrifugation (51, 52) or affinity chromatography on immobilized By (56) are required to determine whether the mutant a subunit can form a stable complex with Py.

It was found recently (51) that deletions of 3-6 residues in the first 21 amino acid of Ga, do not completely abolish interactions with By. Some of these mutants could be ADP- ribosylated through a transient interaction with &. Some of our mutants, for example, RlOG and K21N, might have a similar phenotype. It is possible that the interaction with Py cannot be abolished by a single amino acid substitution in the amino terminus of the a subunit and multiple changes or deletions might be necessary (51). Among approximately 200 mutants from our library, we found only two absolutely refractory to ADP-ribosylation, and both mutants had multiple amino acid substitutions in the NHz-terminal region. On the other hand, the only single amino acid substitution that dramatically inhibited ADP-ribosylation was K35E, located beyond the 21 amino acid “domain” shown previously to be required for Py binding. These data can be reconciled by the hypothesis that amino terminus of G protein a subunit is not the only site for interaction with Py. Indeed, cross-linking studies also implicate the carboxyl terminus residues in fly binding (62). The amino-terminal sequence may function to promote the “correct” orientation of the myristic acid with respect to the By complex. The real “face” of the a subunit that is involved in specific protein-protein interactions with Py could be located in another region or be composed of several distant allosterically regulated parts of the polypeptide chain.

Conclusions-Initial screening of E. coli libraries and rough characterization of isolated Goa mutants can be accomplished without their purification. Table I summarizes our data and illustrates the kinds of information that can be obtained from three assays: [3SS]GTPyS binding, limited proteolysis, and py-dependent ADP-ribosylation by pertussis toxin. We can now construct mutant libraries covering all regions of the G protein. Functional studies of the generated mutants can be carried out using a variety of assays. The same vector that we have been using for mutagenesis can be used as a template for the synthesis of mRNA that produces functional protein upon injection into Xenopus oocyte^.^ In addition, the coding sequence of G protein mutants can be easily transferred to mammalian expression vectors for in uiuo experiments. Ad- ditional methods of screening libraries can be developed in order to identify mutations responsible for interaction with receptors and effectors as well as temperature-sensitive, “dominant negative,” and other mutations that could be used as tools for studies of G protein functions.

Acknowledgments-We thank Drs. James Hurley, Ray Mosteller, and Patrick Casey for providing preparations of G protein 07 subunit complex. We also thank Dr. Maurine Linder for sharing the plasmids pBB131 and NpT7-Gil and Dr. Allen Spiegel and Susan Mumby for the antibodies. We thank Bruce W. Birren for reading the manuscript.

‘A. Aragay, unpublished data.

REFERENCES

2. Kaziro, Y., Itoh, H., Kozasa, T., Nakafuku, M., and Satoh, T. (1991) Annu. 1. Gilman, A. G. (1987) Annu. Reu. Biochem. 66,615-649

3. Birnbaumer, L., Abramowitz, J., and Brown, A. M. (1990) Biochim. Biophys.

4. Simon, M. I., Sthrathman, M. P., and Gautam, N. (1991) Science 262,

Reu. Biochem. 60,349-400

Acta 1031,163-224

un2-unu 5.

6.

7.

8.

9.

10. 11.

12.

13. 14.

15.

Wilkie, T. M., Gilbert, D. J., Olsen, A. S., Chen, X.-N., Amatruda, T. T.,

Jenkins, N. A., and Copeland, N. G. (1992) Nature Genet. 1,85-91 Korenberg, J. R., Trask, B. J., de Jong, P., Reed, R. R., Simon, M. I.,

McLaughlin, S. K., McKinnon, P. J., and Margolskee, R. F. (1992) Nature 367,563-569

Masters, S. B., Stroud, R. M., and Bourne, H. R. (1986) Protein Eng. 1 , 47-54

Holbrook, S. R., and Kim, S.-H. (1989) Proc. Natl. Acad. Sci. U. S. A. 8 6 , 1751-1755

Bourne, H. R., Sanders, D. A,, and McCormick, F. (1990) Nature 348, 125-132

”- -”

Jurnak, F. (1985) Science 230,32-36 La Cour, T. F. M., Nyborg, J., Thirup, S., and Clark, B. F. C. (1985) EMBO De Vos, A. M., Tong, L., Milburn, M. V., Maniatis, P. M., Jancarik, J.,

J. 4, 2385-2388

Noguchi., S., Nishimura, S., Muira, K., Ohtsuka, E., and Kim, S.-H. (1988) Science 239,888-893

Barbacid, M. (1987) Annu. Reu. Biochem. 6 6 , 779-828 Masters, S. B., Miller, R. T., Chi, M.-H., Chan , F H , Beiderman, B.,

Graziano, M. P., and Gilman, A. G. (1989) J. Bzol. Chem. 2 6 4 , 15475- Lopez, N. G., and Bourne, H. R. (1989) J. Bid. &em. 264,15467-15474

15487 16. Heimiiet, S., Merendino, J. J., Gutkind, J. S., and Spiegel, A. M. (1991)

17. Osawa, S., and Johnson, G. L. (1991) J. Biol. Chem. 266,4673-4676 18. Lee, E., Taussig, R., and Gilman, A. G. (1992) J. Biol. Chem. 267 , 1212-

19. Itoh, H., and Gilman, A. G. (1991) J. Biol. Chem. 266,16226-16231 20. Berlot, C. H., and Bourne, H. R. (1992) Cell 68,911-922 21. Sternweis, P. C., and Robishaw, J. D. (1984) J. Brol. Chem. 2 6 9 , 13806-

Proc. Natl. Acad. Sci. U. S. A. 88, 10455-10459

1218

22. Linder, M. E., Ewald, D. A., Miller, R. J., and Gilman, A. G. (1990) J. Biol.

23. Rubenstein, R. C., Linder, M. E., and Ross, E. M. (1991) Biochemistry 30 ,

24. Freissmuth, M., Schutz, W., and Linder, M. E. (1991) J. Biol. Chem. 2 6 6 ,

13813

Chem.. 266,8243-8251

10769-10777

17778-1778.1 25. Bertin, B., Freissmuth, M., Breyer, R. M., Schutz, W., Strosberg, A. D.,

26. Strathmann, M., Wilkle, T. M., and Simon, M. I. (1990) Proc. Natl. Acad.

27. Simonds, W. F., Goldsmith, P. K., Codina, J., Unson, C. G., and Spiegel,

28. Mumby, S., Pang, I.-H., Gilman, A. G., and Sternweis, P. C. (1988) J. Biol.

29. Tabor, S., Huber., H. E., and Richardson, C. C. (1987) J. Biol. Chem. 2 6 2 ,

30. Studier, F. W., and Moffatt, B. A. (1986) J. Mol. Biol. 1 8 9 , 113-130 31. Duronio, R. J., Rudnick, D. A., Johnson, R. L., Linder, M. E., and Gordon,

J. I. (1990) Methods 1,253-263 32. Casey, P. J., Fong, H. K. W., Simon, M. I., and Gilman, A. G. (1990) J.

Bioi. Chem. 266,2383-2390 33. Sambrook, J., Fritch, E. F., and Maniatis, T. (1989) Moleculor Cloning: A

Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

and Marullo, S. (1992) J. Biol. Chem. 267,8200-8206

Sci. U. S. A. 87,6477-6481

A. M. (1989) Proc. Natl. Acad. S a . U. S. A. 86,7809-7813

Chem. 263,2020-2026

16212-16223

34. Leung, D. W., Chen, E., and Goeddel, D. V. (1989) Techniqw 1.11-15 35. Saneer. F.. Nicklen. S.. and Coulson. A. (1977) Proc. Natl. Acad. Sci. U S A

36.

37. 38.

39. 40.

41.

42.

43.

44.

45.

46.

47. 48. 49.

, , 72,5463-5467

Bokoch, G. M., Katada, T., Northup, J. K., Hewlett, E. L., and Gilman, A. G. (1983) J. Biol. Chem. 268,2072-2075

Laemmli, U. K. (1970) Nature 227,680-685 Amatruda, T. T., Steele, D. A., Slepak, V. Z., and Simon, M. I. (1991) Proc.

Natl. Acad. Sci. U. S. A. 88,5587-5591 Bradford, M. M. (1976) Anal. Biochem. 72,248-259 Buss, J. E., Mumby, S. M., Casey, P. J., Gilman, A. G., and Sefton, B. M.

Mumby, S. M., Heukeroth, R., O., Gordon, J. I., and Gilman, A. G. (1990)

Duronio, R. J., Rudnick, D. A., Adams, S. P., Towler, D. A., and Gordon,

Linder, M. E,, Pang, I.-H., Duronio, R. J., Gordon, J. I., Sternweis, P. C.,

Higashijima, T., Ferguson, K. M., Sternweis, P., C., Smigel, M. D., and

Higashijima, T., Ferguson, K. M., Sternweis, P., C., Ross, E. M., Smigel,

Ferguson, K. M., Higashijima, T., Smigel, M. D., and Gilman, A. G. (1986)

Fung, B. K.-K., and Nash, C. R. (1983) J. Biol. Chem. 2 6 8 , 10503-10510 Navon, S. E., and Fung, B. K.-K. (1987) J. Biol. Chem. 262,15746-15751 N:efAFi J., Lok, J. M., and Wolf, L. G. (1984) J . Biol. Chem. 269 , 14222-

. . . -.

(1987) Proc. Natl. Acad. Scr. U. S. A. 84,7493-7497

Proc. Natl. Acad. Scr. U. S. A. 87,728-732

J. I. (1991) J. Biol. Chem. 2 6 6 , 10498-10504

and Gilman, A. G. (1991) J. Biol. Chem. 266,4654-4659

Gilman, A. G. (1987) J. Biol. Chem. 2 6 2 , 762-766

M. D., and Gilman, A. G. (1987) J. Biol. Chem. 262,752-756

J. Biol. Chem. 2 6 1 , 7393-7399

50. Hurley, J. B., Simon, M. I., Teplow, D. B., Robishaw, J. D., and Gilman,

51. Denker, B. M., Neer, E. J., and Schmidt, C. J. (1992) J. Bid. Chm. 2 6 7 ,

52. Denker, B. M., Schmidt, C., J., and Neer, E. J. (1992) J. Bid. Chm. 267,

14LLY

A. G. (1984) Science 226,860-862

6272-6277

9998-10002

611-616 53. Casey, P. J., Graziano, M. P., and Gilman, A. G. (1989) Biochemistry 2 8 ,

54. Feig, L. A,, Pan, B.-T., Roberts, T. M., and Cooper, G. M. (1986) PrOC.

55. 56.

57.

58.

Mutagenesis of Go CY Subunit 1423 Natl. Acad. Sci. U. S. A. 83,4607-4611

Hirsch, J. P., Dietzel C., and Kujan J. (1990) Genes & Deu. 5, $7-474 Wu, D., Lee, C. H., khee, S. G., an6 Simon, M. I. (1992) J. Btol. Chem. 267, 1811-lR17

Pan , LH., andSternweis, P. C. (1989) Proc. Natl. A C ~ . sei. U. S. A. 86,

Hagashijima, T., Burnier, J., and Ross, E. M. (1990) J. Biol. Chem. 265, 7&4-7818

14176-14186

59. Higashijima, T., Ferguson, K. M., Smigel, M. D., and Gilman, A. G. (1987)

60. Sunier, T., Codina, J., and Birnbaumer, L. (1984) J. Biol. Chem. 269, J. Biol. Chem. 262,757-761

15447-15451 61. Brandt, D. RI,and Ross, E. M. (1986) J. Biol. Chem. 261,1656-1664 62. Johnson, G. L., Dhaneskaran, N., Gupta, S. K., Launders, J. M., Villan-

court, R. R., and Rvohu, A. E. (1991) J. Cell. Biochem. 47,136-146

Mutational Analysis of G Protein a Subunit Goa Expressed in ...

Documents

Transcript of Mutational Analysis of G Protein a Subunit Goa Expressed in ...