Mutation, Evolution, and Natural Selection
description
Transcript of Mutation, Evolution, and Natural Selection
Mutation, Evolution, and Natural Selection
Http://www.youtube.com/watch?v=ZK6YP1Smbxk
DNA is found in the ______________ of the cell
Mutation A mutation is a ____________________________________.There are many different types of mutations and causes for
them.Some mutations are ______________, while others can be
______________.
Harmful Beneficial
How does mutations work?DNA is very accurate when making copies of
itself, however, sometimes it makes a mistake.
Here’s a DNA sequenceAGCCCTTATAGGCTCWhat are the corresponding base pairs?______________________________________________Now when it’s being copied it replaces the T with
a U. Rewrite the your answer with U’s instead of T’s.
______________________________________________What amino acids will this be coded for?______________________________________________
The Mutation Here’s our original DNA sequenceAGCCCTTATAGGCTCATCCCTTATAGGCTC we replaced the G with a
TNow what are the corresponding base pairs?______________________________________________Now when it’s being copied it replaces the T with
a U. Rewrite the your answer with U’s instead of T’s.
______________________________________________What amino acids will this be coded for?_______________________________________________ You can see how replacing 1 base will change
everything!
Who was Charles Darwin?
• British scientist that in 1859 published The Origin of Species
• Stated that all life come from a ___________________ called _______________
• This happens by a process called _______________________.
• http://www.youtube.com/watch?v=nMgLF8n4DnA
Voyage of H.M.S. Beagle, 1831 - 1836
90 feet of ship, 74 people living together for 5 years...
DarwinGalapagos
Evolution
Evolution is the _______________________________ (passed on from parents to offspring) of a population over ___________________________. These traits could be physical, chemical or behavioral.
This change is caused by ____________________________________.
http://www.youtube.com/watch?v=yVqJ_mQazik
AdaptationAdaptation is the evolutionary process where a
population becomes ____________________________.This process takes place over _____________________.The term adaptation may also refer to a ____________
which is ____________________________________. For example, the adaptation of horses' teeth to the grinding of grass, or their ability to run fast and escape predators.
Such adaptations are produced in a variable population by the better suited forms reproducing more successfully, which is ______________________________________________.
How does Evolution Work?
Natural Selection- ________________________________
Natural selection is simply the logical result of four features of living systems:
_________________- individuals in a population vary from one another (different genes caused by mutations)
_________________- parents pass on their traits to their offspring genetically
______________ - some variants reproduce more than others
___________ - successful variations accumulate over many generations
There are 2 variations of the beetles, _________________________________
The birds prefer eating the green beetles.
Over generations the ______ beetles increase in population because __________________________________
_________ survive to produce more offspring.
Over time the red beetles have been selected over the green beetles
Generations later….
Change through use and disuse
Why does this not work?
Natural Selection’s Explanation
Ancestors had different neck lengths
Through natural selection, longer necks survived and passed on their genes.
Eventually, all giraffes had only long necks
What are the different types?
What could cause all the variety?
ONE ancestor, many varieties