Musculoskeletal Research Center Department of Orthopaedic Surgery

University of Pittsburgh Medical Center Pittsburgh, PA

2001 Musculoskeletal Research Center Undergraduate Research Program

Editors : John Jolly and Allison Westcott Picture / Design : Brad Stokan

A Few Words from the Editors: This summer has been an exceptional one. Not only have we made new friendships and enjoyed good times, we have also benefited from unique and enlightening experiences at the MSRC that will stay with us forever. Working in the lab was educational to say the least. We learned a myriad of things from an ethnically diverse group, made up of people from many and varied backgrounds in medicine and engineering. The MSRC atmosphere is one in which hands-on experimentation takes the place of textbook learning, creating an environment for the best, most enriching internships on earth! The skills, techniques and research methods we have learned and developed will no doubt help us in furthering our education and careers.

- John Jolly, Brad Stokan, Allison Westcott A Few Thanks From the 2001 Summer Students: We would like to thank all the faculty advisors and lab mentors for selflessly giving their time and guidance (and thanks to Golden Palace China Buffet for providing excellent Chinese food ☺ ). We would also like to thank Dr. Gilbertson, coordinator of the summer research program, for extending the wonderful opportunity to work in the MSRC and for all of his assistance. We would especially like to thank Dr. Savio L.-Y. Woo for not only giving us years worth of superb guidance and advice, but also for raising our standards for excellence in research. Our experiences here in the MSRC will be of great value as we continue our education and careers.

This year, we have one of the largest groups of undergraduate students to join the Musculoskeletal Research Center - a major undertaking by our faculty, staff and post-graduate research fellows as well as graduate students. For the first time, we have asked our foreign research fellows to serve as mentors to some of the students. The range of research subjects that were covered this summer by the students is very wide - a reflection of the growing breadth in research at the MSRC. In particular, functional tissue engineering is a new area that has attracted added attention. Students have been involved in research projects ranging from cellular biology as well as gene therapy to functional assessments of joints as well as computer modeling. As can be seen from their abstracts, many have done outstanding scientific research. We are very gratified that their "switches" have been turned on, as some will continue to pursue their projects during the coming academic year. In the future, they will ask good scientific questions and perform excellent bioengineering investigations during their graduate studies or while attending medical schools. This year, the eleven students came to us from as far as Northwestern University and the University of Toledo. We continue to have our strong collaboration with the Bioengineering program at Carnegie Mellon University through Ms. Hilda Diamond. Our students from Pitt are all quite strong. They have all learned a great deal during this short stay of 13 weeks. They now understand the research process. I would like to thank all the mentors for doing an outstanding job for our summer students: Dr. Yasuhiko Watanabe, Dr. Yuhua Song, Ms. Susan Moore, Dr. John Loh, Dr. Fengyan Jia, Ms. Mary Gabriel, Dr. Yukihisa Fukuda, and Mr. Steve Abramowitch. The

faculty members, Drs. James Wang, Lars Gilbertson, Todd Doehring and Rich Debski deserve special credit for their leadership in this program. I would especially like to congratulate Dr. Gilbertson for spearheading our summer student research internship program as well as carrying out yet another crop of very successful students at the MSRC. I trust that after you have read this annual report, you will agree with us that we should be very proud of our summer students and their mentors for doing so well in such a short time. We thank the students for letting us help them to become future investigators and leaders in the field of bioengineering. Savio L-Y. Woo, Ph.D.,D.Sc. Ferguson Professor and Director Musculoskeletal Research Center Department of Orthopaedic Surgery P.S. I would like to acknowledge that all eleven students have helped in numerous

ways to make the symposium honoring my 60th birthday to be a huge success. Their energy and enthusiasm warms my heart and I thank each and every one of you. The fact that you were able to choose a great/classic California wine (1997 Far Nienta Cabernet Sauvignon) as a gift for me further attests to your good taste. I will treasure it and your autographs will help me to remember how wonderful you are!

MSRC Faculty

Pictured, left to right: Richard Debski, Ph.D.

James H-C Wang, Ph.D. Savio L-Y Woo, Ph.D., D.Sc.

Todd Doehring, Ph.D. Lars Gilbertson, Ph.D.

The 2001 MSRC Summer Students would like to extend our

thanks to all of the faculty for their constant help, support and guidance, and for presenting themselves as such good role models

to us, the future bioengineers.

Table Of Contents Kevin Bell PC Control of a Robotic/UFS Testing

System Applied to the Lumbar Spine James Chung Anterior and Posterior Displacement of the

Tibia when portions of the Medial Meniscus are Removed

Brian Civic & The Effect of Prostaglandin E2 on Tendon Nima Salari Fibroblast Proliferation and Collagen Synthesis:

Implication of Tendinitis Development Greg Frank Tensile Properties of the Healing Goat MCL After

a Combined MCL/ACL Injury John Jolly Dislocation Potential of the Shoulder Muscles in

Two Clinically Relevant Positions Jen Mercer Random Collagen Fiber Architecture in the

Axillary Pouch of the Inferior Glenohumeral Capsule

Brad Stokan Validation of a Method for Transforming and

Reproducing Kinematics of a Custom Device Using a Robotic Manipulator

Allison Wescott Determining an Antisense Effective Target Site:

Inhibition of the Synthesis of Collagen Types III and V Using Antisense Oligonucleotides in Human Patellar Tendon Fibroblasts

Charles Vukotich Three-Dimensional Geometric Modeling and

Analysis of the Human Anterior Cruciate Katie Yoder Calculating the Accuracy and Repeatability of

Reproducing the Rotational Center of the Tibia in Relation to the ACL

Kevin M. Bell University of Pittsburgh kmb7@pitt.edu Majors: Mathematics

Bioengineering Year: Senior Advisor: Dr. Lars G. Gilbertson Mentor: Dr. Todd C. Doehring Hometown: Oil City, Pennsylvania Birthdate: December 8, 1978

I was born in Oil City, PA, which was once the home of our nations oil industry,

but is now the home of about twelve people and their assorted farm animals. After

graduating from Cranberry High School in 1997, I entered the class of 2001 at

Westminster College as a Mathematics major.

I really enjoyed the three years that I spent at Westminster, where I was able to

become involved in various activities including Habitat for Humanity and Varsity

Baseball. But I soon realized that a career in mathematics wasn’t really for me, and that I

needed to move beyond the Amish filled Westminster community. After a great deal of

consideration I decided to transfer to the University of Pittsburgh to study

Bioengineering.

When I am not hard at work being the best Bioengineer I can be, I enjoy the

outdoors. My interests used to be in activities such as basketball and baseball, but as I

get along in years I have now converted to more leisurely activities like golf and horse-

shoes. These are all activities that I would normally participate in during the summer,

however I spend all my waking hours in the MSRC working on a stinking computer!

PC Control of a Robotic/UFS Testing System Applied to the Lumbar Spine

Kevin M. Bell, Todd C. Doehring, Ph.D., Lars G. Gilbertson, Ph.D.

Musculoskeletal Research Center, Department of Orthopaedic Surgery

University of Pittsburgh Medical Center Introduction The spine is a complex and multifaceted structure, not easily analyzed or modeled using standard biomechanical testing methods. This complexity has led to the use of advanced testing systems and control algorithms to more fully delineate its properties.

The Robotic/Universal Force-Moment Sensor (UFS) Testing System was originally designed to measure knee kinematics, but has recently been adapted for spine testing as well1. It consists of a 6 DOF robotic manipulator (PUMA 762), which is controlled by a Mark III controller, with a UFS attached to the end-effector. The UFS measures forces and moments along and about its 3 Cartesian axes, digitally communicating to the Mark III controller via a 12-bit interface. However, the Mark III controller was designed more than 30 years ago and therefore has several disadvantages and limitations, which this project seeks to overcome. The major hardware limitations of the controller are within the governing computer processor and storage devices. The computer is a DEC LSI-11 computer with a 16-bit processor with limited computational capabilities and only 32 KB of memory2. For programs and data, the system is equipped with 128 KB of additional memory, still a very small amount by today’s standards. A low capacity floppy drive is also used for storing and loading information, which is somewhat cumbersome and inefficient.

Val II is the programming language used by the Mark III controller. It enables programming of the basic functions necessary

for controlling robot motion, but more complex mathematical transformations and operations such as matrix inversion are difficult to perform efficiently1. These limitations make robotic testing of a spine slow, and may jeopardize the validity of the data. This can occur when executing the algorithm for finding the path of passive motion of a functional spinal unit (FSU). The body of this algorithm consists of an outer (displacement control) loop and an inner (load control) loop that minimizes coupled forces and moments using Hooke’s Law (F = Kx). The specimen stiffness is calculated using the load data from the UFS and the position data from the robot. The stiffness matrix is then inverted to form the flexibility matrix, and new positions to minimize the coupled loads are determined. However, due to the aforementioned limitations, this process is slow and only the diagonal of the matrix (as opposed to the entire matrix) is currently inverted. This algorithm requires that both loads and positions be available for the stiffness calculation. This project focused on redirecting this data to an external control PC to improve testing efficiency. Objective The objective of this summer research project was to develop a stand-alone PC based control system to operate the current Robotic/UFS testing system—taking advantage of more advanced programming tools, higher speed processors, and greater memory to improve control of the robot.

Materials and Methods

Figure 1: Current configuration of robotic/UFS testing system. Val II is high-level controller.

Figure 2: Proposed configuration. The control PC receives position and load data and acts as the high-level controller.

Current Configuration Figure 1 represents the current flow of data within the Robotic/UFS testing system. A supervisory PC is used to upload user written programs to the Val II system. In addition to being a programming language, Val II is also a complete robot control system, responsible for the high-level control of the robot arm. The Val II software interprets the uploaded operating instructions and puts them into a usable format to operate the robot arm.

The controller also receives the forces and moments from the UFS, and makes them available to the Val II programs. Once all the data are received and interpreted by Val II, commands are then passed to the Mark III control module, which controls robot arm movement and position (low-level control). The “weakest link” of this system is Val II. It executes the programmed instructions, interprets data, and also controls the flow of data to and from the memory/storage devices. Therefore, if the reliance on Val II can be minimized, many of the previously described limitations can be avoided. Proposed Configuration

Figure 2 represents the proposed configuration for the Robotic/UFS testing

system. The proposed system redirects the flow of data from Val II to a new external control PC, to reduce the reliance on Val II. Modern PC’s are faster, have greater memory, and can be equipped with advanced data processing software. The PC now acts as the high-level controller for the testing system. The new PC receives the end-effector position data from the robot as well as the forces and moments from the UFS. This data is then processed using Matlab1, mathematical programming software that can perform high-level mathematical operations. The processed data is then transmitted back to the control module so that only physical (low-level) control needs to be performed by the controller. The load cell data is currently received by Val II using a parallel communication line. The load cell has analog, discrete, serial, and parallel communication capabilities. For this project, the serial line is used to redirect the data to the control PC, since the other options would require additional modifications to the PC.

Currently, the robot is configured such that user written programs for directing path modification are uploaded from the supervisory PC and executed within the Val II system. But, the Val II system permits the

Mark III

RoboticController

Robot

UFS

FSU

UFSBlackBox

PCPositions

Loads

Programs/data

Supervisory PC

PC

Mark III

RoboticController

Robot

UFS

FSU

UFSBlackBox

PC

NEW

Loads

Positions

Programs/data

Positions

Supervisory PC

Control PC

robot to be operated under “real-time path control” wherein the initially prescribed path by Val II can be modified via an external computer interface3. Thus, only a short Val II program is needed to initiate motion and then Val II will enter “alter mode”, allowing all subsequent motions to be controlled by the external control PC.

In alter mode, data is exchanged between an external source and Val II through a serial connection, about 36 times a second or once every 28 ms. Data request messages are sent by Val II and the processed positions must be returned to Val II within the 28 ms time frame. This type of communication is described as “handshaking” and it has strict timing requirements.

It was initially desired to use Matlab for the data processing as well as establishing the serial connection for use in the alter mode. However, the available version of Matlab was not capable of receiving the data, processing the data, and returning a response to Val II within the required 28 ms time frame. Therefore a “driver program” was created to communicate with Val II. This allowed null responses to be sent to Val II within the time frame if the new load minimizing positions were not yet determined.

The driver program was written in Visual Basic. Visual Basic is sufficiently fast, has ample display features, and a user-friendly serial library, therefore it was selected for both receiving the Val II messages and to respond with the new load minimizing positions. Python and Visual C++ were also considered. Python is powerful (and free via the Internet), but certain difficulties prevented the creation of a stand-alone program. Visual C++ solved some of the problems presented by Python, but because it is an interpreted language, it proved difficult to create a stand-alone driver program.

Results

The following project goals have been completed and tested:

• The driver program is functional. • The serial connection is established

between Val II and the control PC. • Through the “alter mode”, an arbitrary

(square) path has been tested and it runs indefinitely.

• Load cell data is transmitted to Matlab via a serial line.

Discussion

Using an external control PC to process the end-effector positions and load cell data bypasses many of the limitations of the current robotic testing system. It is anticipated that these improvements will increase the speed and ease of testing and permit implementation of mathematical functions, such as matrix inversion—making the testing more accurate.

To complete stand-alone PC interface, current efforts are aimed at: • Establish communication between

Visual Basic and Matlab within control PC

• Writing Matlab programs to perform lumbar spine testing.

References 1. Doehring, Todd. Ph. D. Thesis, Univ.

Pitt., 2000. 2. Costescu et al., Q-Robot.

http://markus.eng.clemson.edu.research.html, 3-5. 1995.

3. Staubli Unimation, User’s Guide to Val II, Part 3 – Real-Time Path Control. 1986.

Acknowledgments

I would like to thank Dr. Savio L-Y. Woo, Dr. James Wang, and the Mentorship and Internship Program for the opportunity to work at the MSRC, and Dr. Todd C. Doehring and Dr. Lars G. Gilbertson for the help and guidance along the way.

James H. Chung Carnegie Mellon University jhchung@andrew.cmu.edu Major: Chemical Engineering, Biomedical Engineering Year: Sophomore Advisor: Yasuhiko Watanabe, M.D. Mentor: Andy Van Scyoc, B.S. Hometown: Duluth, GA Birth Date: December 21, 1980 Activities: Society of Chemical Engineers, CMU Men’s Soccer Team, Member of Pi Kappa Alpha Fraternity

Having played soccer all my life and accomplishing my goal of playing at the collegiate

level has been very fulfilling and exciting, but has also come with a heavy price. Since I have

played so long, the sport has begun to take its toll on my body and consequently I have

experienced many injuries resulting in two surgeries on my left knee.

Having gone through so many traumas, I have learned much about the knee and have

realized that my career goal is to do research in a major laboratory specializing in knees. My

thirst for knowledge will be fueled by my own experience with knee traumas. I know that I will

be very passionate in trying to understand the physiology and mechanics of the knee because I

can sympathize with the constant pain and frustrations that thousands of people are experiencing

with their problematic knees everyday.

Working for MSRC has been a very valuable experience for me. Not only have I been

able to apply the knowledge that I have gained in the classroom, but also have been introduced to

the current technological and methodological aspects of research. I am very grateful that

Dr.Woo and Dr. Gilbertson invited me to work at such a distinguished lab this summer and I

would like to give special thanks to my advisors Yasuhiko Watanabe and Andy Van Scyoc for

educating and showing me the correct research process.

Anterior and Posterior Displacement of the Tibia when portions of the Medial Meniscus are Removed

James Chung, Yasuhiko Watanabe, M.D., Andy Van Scyoc, B.S.

Musculoskeletal Research Center, Department of Orthopaedic Surgery

University of Pittsburgh Medical Center

Introduction:

The meniscus are two half moon shaped pieces of fibrocartilage that lie between the joint surfaces of the femur and the tibia. They are extensions of the tibia that serve to deepen the articular surfaces of the tibial plateau to better accommodate the condyles of the femur. Contradictory to previous beliefs that the menisci posses little or no purpose in the knee, research has now shown that the menisci greatly contribute to the proper functionality of the knee. Not only do the menisci aid in load transmission at the tibiofemoral articulation, they also provide shock absorption, stability and joint lubrication. Overall, the menici’s main objective is to protect the articular cartilage from degeneration. Therefore if portions of the meniscus are removed, there will be a decrease in the surface contact which increases the contact stress in the femoral condyles and the tibial plateau. A previous study demonstrates this by using a photoelastic model to evaluate the stress distribution on the surface of the tibia(1). It was found that when the medial meniscus is absent the stress magnitude increases in the femoral condyle 3 to 5 fold and in the tibial plateau 6 to 7 fold. This proves that the stresses are no longer well distributed but rather concentrated in areas where the medial meniscus is absent. This increase in stress can lead to progressive osteoarthritis of the articular cartilage in the knee. A long-term clinical follow up study was conducted after 11.5 years, with patients

who had undergone arthroscopic medial menisectomy in a knee with an isolated meniscal injury(2). Both clinical and radiological results show that there were degenerative changes to the knee especially involving joint space narrowing. Clinical Relevance:

The incidence of meniscal injury is 61 in 100,000 people(3). Of these injuries, about 80% involve the medial meniscus(3). In the instance that the injured meniscus cannot be repaired, a partial menisectomy may be necessary. This resection of the meniscus may cause an uneven distribution of stresses in the knee which may cause detrimental and irreversible changes to the knee. This study will not only quantify the amount of posterior medial meniscus(PMM) removed during a preplanned menisectomy, but will also examine the correlation between the percentage of PMM removed and the anterior–posterior displacement of the tibia. Thereby attaining a better knowledge for the meniscus involving knee kinematics.

Materials and Methods: Data and meniscus portions were taken from a previous study that involved the PMM. The PMM was defined in the previous study as the region of the meniscus posterior to an imaginary line from the posterior border of the medial collateral ligament to the anterior border of the ACL (fig 2). In this defined

region, portions of the meniscus were removed from seven fresh frozen cadaver knees (ages 51-72) using the following protocol: 1.)Meniscus intact 2.) 33% of PMM Removed 3.) 66% of PMM removed 4.) 100% PMM removed To quantify that the correct portions of the PMM were removed, the removed portions of the meniscus were scanned using a flatbed scanner. The portions of the PMM are defined in fig.2. Then using Canvas, the area of each portion of PMM was calculated by counting the pixels and converting them into “units” which was defined by the computer. To account for the different size of PMM in each cadaver knee, each portion was converted to percentages. The accuracy of Canvas also had to be validated. This was done by scanning a quarter, which the surface area was already known, and then comparing it to the area calculated by Canvas. Since the user must outline the area that is to be calculated, the repeatability must be verified. Having three different subjects calculate the area of three different portions of the removed PMM verified the repeatability.

Figure 1: posterior medial meniscus

Figure 2: defined portions of the PMM Results: The data obtained from the flatbed scanner and Canvas (fig.3) shows that there was great variance within the percentage of the PMM removed. The overall averages of the three portion:

1.)portion 1 = 31 +- 11.2%

2.)portion 2 = 36 +- 8.9% 3.)portion 3 = 32 +- 8.8%

The UFS data combined with the flatbed scanner showed that as greater percentages of the PMM are removed the greater amount of anterior tibia translation (ATT) occurred (fig. 4) in each individual specimen. Even though in individual specimens this trend was verified by fcalculating a R2 value of .792, this trend was only somewhat true when comparing all the specimens. (fig. 5). When all the specimens are compared and a linear regression line is computed, the R2 value is .293. This shows that there is no correlation, but if only four specimens are analyzed then the R2 value is .701 which shows that there is a trend correlating the percentage of PMM removed and ATT.

The area of the quarter calculated by Canvas was 461.214mm(n=5) and the actual area was 460.34mm. The percent error was found to be .06%. The results of the repeatability test concluded that the average standard deviation of each portion was .13(n=3).

Figure 3: percentages of removed PMM

Figure 4: trend of individual specimens

Figure 5: no trends involving all specimens

Discussion:

The average percentages of the portions removed are very close to 33% but the individual values have a large standard deviation. Since the method to determine the amount of each portion of PMM removed was to just measure 4mm from the central to the peripheral and cut, this was not very accurate. Not only is the meniscus incongruous shaped, but it is also different sizes in different knees. This may be the reason why there was such a large standard deviation in the results. The current data shows that as greater percentages of the PMM are removed the greater the tibia displaces anteriorly. This trend is verified when individual specimens are analyzed, but is true when only 4 specimens are analyzed instead of all 7. This may be due to many variables in the specimens such as age and sex which can be overcome by testing more specimens. . References: 1. Radin, Eric L., Clinical Orthopaedics and Related Research, May 1984, 290-4. 2. Chatain, F., Knee Surgery and Sports Trauma, 2001, Number 9,15-9. 3. Baker, J., American Journal of Biomechanics, 1982, 23-30. Acknowledgements: I would like to thank Yasu for the guidance and patient that he has given to me during my project. Also Andy for helping me with all my “engineering” questions. I would also like to thank Dr. Gilbertson and Dr. Woo for teach me how research is done.™

Percentage Of Removed Meniscus

0102030405060

Menisc

us 1

Menisc

us 2

Menisc

us 3

Menisc

us 4

Menisc

us 5

Menisc

us 6

Menisc

us 7

Perc

ent V

alue Portion 1

Portion 2

Portion 3

Perent of PMM Removed vs ATT

0

2

4

6

8

10

0 20 40 60 80 100

Percent (%)

ATT

(mm

) 0 deg30 deg60 deg90 deg

Percent of PMM Removed vs. ATT @ 60 deg

-2

0

2

4

6

8

10

0 20 40 60 80 100 120

Percent (%)

ATT

(mm

)

Specimen 1Specimen 2Specimen 3Specimen 4Specimen 5Specimen 6Specimen 7

Brian Civic

University of Pittsburgh bkcst7@pitt.edu Major: Biomedical Engineering Concentration: Biotechnology and Artificial Organs Year: Junior Advisor: Dr. James Wang Hometown: Allentown, PA Birth Date: October 17, 1980

I began this summer with a whole new identity – being known as “What’s His

Face” for nearly a month before the staff could distinguish me from Kevin Bell. That

was eventually changed to “Nima’s Assistant” and finally to “George Castanza.”

Anyway, for me, life began in a house in the middle of suburbia. I spent my time

growing up among friends and family, going to school, swimming and enjoying life.

And looking back, I realize “my childhood was typical, summers in Rangoon, luge

lessons. In the spring we'd make meat helmets. When I was insolent I was placed in a

burlap bag and beaten with reeds - pretty standard really. My father would womanize, he

would drink. He would make outrageous claims like he invented the question mark.

Sometimes he would accuse chestnuts of being lazy.” - Dr. Evil

This summer has allowed me to the opportunity to work with a talented group of

individuals who have challenged me to my fullest to make a meaningful contribution to

science, which hopefully I have achieved. Being a part of the MSRC has made me

realize that you do not have to do everything, just a few things perfectly. My work here

has hopefully brought me one step closer to attaining my goal of attending medical

school and eventually become an orthopaedic surgeon. In closing, I would like to thank

Dr. Wang for being my advisor and mentor, always there to help when we encountered

our many problems. I would also like to thank Dr. Woo for his continual support and

interest in my work, while instilling in me a goal of achieving perfection in all aspects of

my life.

Nima Salari University of Pittsburgh nisst22@pitt.edu Major: Bioengineering Concentration: Biotechnology and Artificial Organs Year: Junior Advisor: James Wang, Ph.D. Hometown: Norderstedt, Schleswig-Holstein, Germany Birth date: April 12, 1980

Out of all the major cities in the US (all the ones with better weather) I had to choose Pittsburgh. You may ask why. Well, actually there is a story behind my presence here, but that would exceed the few lines I have available. I moved to Pittsburgh in August of 1999 from Norderstedt, Germany. This small town to the north of Hamburg, which I call home, was the place of my residence for seven years covering my entire teenage life. I attended the German Gymnasium and graduated with 40 other students, an unimaginable number when compared with high schools here. My parents and siblings are still back home and hopefully I will still have time to visit them at the end of this summer. But anyway, where did I live before that? Dubai, United Arab Emirates. I lived with my family in this small, Arabic country in the Persian Gulf, which has now grown to be one of the biggest tourist attractions in the middle east (ever heard of the 7 star hotel that looks like a boat and stands on a man made island?) for a total of five years. But the country I actually originate from is Iran. I spent my childhood growing up in the post revolutionary Iran that was at war with Iraq at the time. But wait, it’s not quite over yet. My sacred place of birth; Oakland, California, where my parents had lived for a rather long time, before they decided to move back to Iran when I was about 3 months old.

The two years in Pittsburgh have been fun, at times exciting, and sometimes even a little lonely. I am not sure where my plans for medical school will take me, but I think in two years, it will be time to move on again, perhaps gain new experiences and meet new people. But nothing will beat the great experience I have had here at the MSRC. It has definitely been very rewarding. I have to thank Dr. Woo for the inspiration and motivation to do my best and also for providing me with the chance to meet other leading figures in the field of bioengineering, such as Dr. Fung. I would also like to thank Dr. Wang for his guidance and patience, everyone in the mechanobio lab for being so helpful, “The Team” for their support and of course everyone else at the MSRC for making every day so interesting.

The Effect of Prostaglandin E2 on Tendon Fibroblast Proliferation and Collagen Synthesis: Implication of Tendinitis Development

Brian Civic, Nima Salari, James Wang, Ph.D.

Musculoskeletal Research Center Department of Orthopaedic Surgery

University of Pittsburgh Medical Center, PA

Keywords: tendinitis, human patellar tendon fibroblasts, prostaglandin E2, cell proliferation, collagen synthesis

Introduction

Tendinitis is a generalized term for pain in the vicinity of the tendon. It describes an abnormality in tendon homeostasis, resulting in inflammation.12 Tendinitis is a common injury, constituting a large portion of non-traumatic injuries seen in occupational and sports medicine practices.1,2 According to the Bureau of Labor Statistics in 1988, 48% of reported occupational injuries were related to tendinitis.5 In sports, it comprises 30-50% of injuries.11 Tendinitis occurs most frequently in tendons near the more heavily used joints of the body, such as the patellar tendon of the knee.4 It is generally believed that repetitive loading placed on the tendon induces tendinitis.1,2,10,12,13 However, the cellular mechanism of tendinitis development is not clear.

Previous studies using in vitro models have shown that Prostaglandin E2 (PGE2) levels are increased after repetitive mechanical stretching of human tendon fibroblasts.1,2,13 PGE2 is known to be involved in tissue inflammation.2 Aside from their association to inflammation, studies have shown that PGE2 is responsible for down-regulating proliferation and collagen synthesis of human lung fibroblasts in a dosage-dependent manner.3,7,8 However, little is known about such possible effects on

human tendon fibroblasts. Therefore, we wish to determine the effect of PGE2 on cell proliferation and collagen synthesis of human patellar tendon fibroblasts (HPTFs). Based on the studies performed on human lung fibroblasts, we hypothesize that PGE2 will inhibit HPTF proliferation and collagen synthesis in a dosage-dependent manner. Materials and Methods Cell Proliferation

HPTFs derived from tendon samples of a healthy donor were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/ streptomycin (Invitrogen, Carlsbad, CA). Six-well plates were coated with 10 µg/ml of ProNectin-F (Biosource International, Camarillo, CA) in phosphate buffered saline to ensure rapid attachment of cells. Fibroblasts (6 x 104) were plated in each well of 6-well plates to attain a 50% confluency. The cells were incubated at 37°C in a humidified atmosphere of 95% air and 5% carbon dioxide for 24 hours in growth medium to allow them to attach and become evenly distributed in the wells. The medium was replaced with medium containing various concentrations of PGE2 (0, 1, 10, 100 ng/ml) (Sigma, St. Louis, MO). The cells were incubated in the presence of the PGE2 for 48 hours. Cells were then collected via

trypsinization and counted using a Coulter Counter (Beckman Coulter, Fullerton, CA). The Coulter Counter is a particle counter that can be used to count cells. It is based on the theory that cells of a sample that are evenly distributed in an electrolyte can be counted by passing them through an aperture for a given length of time. Cells are pulled through the aperture and displace an equal volume of electrolyte, meanwhile changing the resistance in the path of the current. This results in corresponding voltage changes. The number of changes within that specific length of time is proportional to the number of cells within the electrolyte based on a dilution factor of 1:500. Collagen Synthesis

HPTFs (105) were plated in each well of ProNectin-F coated 6-well plates. This larger cell number was used instead of that used in the cell proliferation experiment so that the cells were confluent at the time of plating, minimizing the rate of cell proliferation due to PGE2 exposure and thus allowing collagen synthesis to be the sole parameter. Cells were incubated for 24 hours to ensure their attachment to the surface of the coated wells. After the initial 24 hours of incubation, medium was replaced with fresh medium containing 10% FBS and 25 µg/ml ascorbic acid (Sigma), which essentially promotes collagen synthesis. The cells were incubated in this medium for another 24 hours. At 48 hours, the medium was changed to DMEM containing 1% FBS, 25 µg/ml ascorbic acid with four PGE2 dosages (0, 1, 10, 100 ng/mL). After an additional 48 hours of incubation in the medium containing PGE2, the cells in each well of the 6-well plate were lysed using lysis buffer and protein inhibitors (Antipain, Leupeptin Trifluoroacetate Salt, Chymostatin, Pepstatin A) (Sigma). Debris was removed from the collected

lysate by centrifugation. Approximately 30-40 µg of protein sample was added to wells of a pre-cast 1.5 mm gel (Novex, San Diego, CA). The gel was run for 110 minutes and then transferred to a membrane for 95 minutes. The membrane was exposed to a goat anti-human Collagen Type I primary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at a concentration of 1:1000 for 60 minutes. The secondary antibody used was a rabbit anti-goat conjugated with horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA) at a concentration of 1:5000 for 60 minutes. Prior to exposure of the membrane to film, ECL Plus Western Blot Detection System (Amersham Pharmacia Biotech, Piscataway, NJ) was used in catalyzing the fluorescence reaction. The targeted protein bands on the film were then scanned and analyzed using the densitometer, which quantifies the intensity of the bands via counting the number of pixels corresponding to each band. The intensity of Collagen bands was normalized against that of Actin bands, whereby the Actin represents the total amount of protein loaded into the wells.

Statistical Analysis Numerical values from cell counts obtained on the Coulter Counter were processed to determine the number of cells in each well. These numbers were analyzed using ANOVA with Duncan tests for multiple comparisons. N=13

0

0.4

0.8

1.2

1.6

0 1 10 100

Concentration of PGE2 (ng/ml)

Nor

mal

ized

Cel

l Num

ber *

b-actin (40 KD)

Collagen Type I (200 KD)

0 1 10 100

Figure 1: The effect of various concentrations of PGE2 on HPTF proliferation. Between the concentrations of 0, 1 and 10 ng/ml, there exists no significant difference in cell proliferation. The concentration of 100 ng/ml significantly differs from 0, 1 and 10 ng/ml. (p<0.0001) Results

Coulter Counter results revealed that at small concentrations of 1 and 10 ng/ml PGE2, there was no significant effect on cell proliferation as compared to the control. However, when the concentration of PGE2 increased larger than 10 ng/ml, cell proliferation decreased (see Figure 1).

Figure 2: The effect of various concentrations of PGE2 on collagen synthesis evaluated using western blots. Furthermore, the data from collagen synthesis experiments suggest similar results. Analysis of the densitometer data obtained from the protein bands on the film (see Figure 2) shows an apparent reduction in collagen synthesis in the presence of PGE2. Concentrations of 1, 10 and 100 ng/ml appear to reduce collagen synthesis, but show no significant difference amongst each other (see Figure 3).

Figure 3: Results of western blot analyzed using densitometer data normalized against b-actin control. In comparison to the control (0 ng/ml) the concentrations of PGE2 (1, 10, 100 ng/ml) appear to have reduced the synthesis of collagen. Discussion

The results show that PGE2 inhibits cell proliferation at concentrations higher than 10 ng/ml, i.e. 100 ng/ml (see Figure 1). This means that during the cell cycle, DNA synthesis is decreased due to the treatment with PGE2. The mechanism by which this occurs is not yet understood. There was no significant effect on cell proliferation due to PGE2 at smaller concentrations of 1 and 10 ng/ml. There appears to be a critical concentration that exists between 10 and 100 ng/ml of PGE2. At this point, PGE2 begins to inhibit cell proliferation. This decrease in results in a smaller number of cells in the area in which PGE2 acts and thus, a direct effect on collagen synthesis occurs because a smaller number of cells can synthesize collagen.

Comparison of band intensity in Figure 2 reveals that the darkest band corresponds to that of the control. As the concentration of PGE2 increases, the intensity of the bands decreases thereafter. However, these are only preliminary observations, more tests must be done to draw concrete conclusions. As it can be observed in Figure 2, there are 3 bands that correspond to collagen type I. The first two bands correspond to the α1 chain of collagen type I. Possible degradation of the protein is the result of this break up. The third band corresponds to the α2 chain of type I collagen.

Evidence has been accumulating from previous studies on possible explanations for this inhibition of collagen synthesis due to PGE2. Proposed mechanisms suggest a reduced uptake of proline7 and an increase in the intracellular degradation of collagen by PGE2

7 may contribute to

0

0.4

0.8

1.2

0 1 10 100

Concentration of PGE2 (ng/ml)

A.U

.

this phenomenon. Also, studies imply a possible interaction of PGE2 at pretranslational levels, inferred from decreased steady-state mRNA levels for α1 (I) procollagen.7 Future Directions

In future studies, we plan to perhaps better model the in vivo situation by first determining the effect of repeated exposure of PGE2 on human tendon fibroblast proliferation and collagen synthesis. We also want to determine the effect of PGE2 on proliferation and collagen synthesis of human tendon fibroblasts plated on microgrooved surfaces. Finally, we wish to study the effect of PGE2 on tendon biological and biomechanical properties in vivo. References 1. Almekinders LC, Banes AJ, Ballenger CA.

Effects of Repetitive Motion on Human Fibroblasts. Med Sci Sports Exerc. 25(5):603-607, 1993.

2. Almekinders LC, Baynes AJ, Bracey LW. An In Vitro Investigation into the Effects of Repetitive Motion and Nonsteroidal Antiinflammatory Medication on Human Tendon Fibroblasts. Am J Sports Med. 23(1):119-123, 1995.

3. Bitterman PB, Wewers MD, Rennard SI, Adelberg S, Crystal RG. Modulation of Alveloar Macrophage-driven Fibroblast Proliferation by Alternative Macrophage Mediators. J Clin Invest. 77(3):700-708, 1986.

4. Bunch B. The Family Encyclopedia of Disease: A Complete and Concise Guide to Illnesses and Symptoms. Scientific Publishing Inc, W. H. Freeman and Company, New York, http://www.medic-planet.com/MP_article/internal_reference/Tennis_elbow_and_related_problems 1999.

5. Bureau of Labor Statistics. Occupational Injuries and Illness in the United States by Industry 1988. Bulletin 2368, 1990.

6. Clancy WG. Tendon Trauma and Overuse Injuries. In Leadbetter WB. Buckwalter JA.

Gordon SL (ed): Sports Induced Inflammation AAOS. 609-18, 1990.

7. Diaz A, Munoz E, Johnston R, Korn JH, Sergio JA. Regulation of Human Lung Fibroblast α1(I) Procollagen Gene Expression by Tumor Necrosis Factor α, Interleukin-1β, and Prostaglandin E2. J Biol Chem. 268(14):10364-10371, 1993.

8. Elias JA. Rossman MD. Zurier RB. Daniele RP. Human Alveolar Macrophage Inhibition of Lung Fibroblast Growth - A Prostaglandin-Dependent Process. Am Rev Respir Dis. 131(1):94-9, 1985.

9. Elias JA. Zurier RB. Schreiber AD. Leff JA. Daniele RP. Monocyte Inhibition of Lung Fibroblast Growth: Relationship to Fibroblast Prostaglandin Production and Density-defined Monocyte Subpopulations. J Leukocyte Biol. 37(1):15-28, 1985.

10. Popp JE, Yu JS, Kaeding CC. Recalcitrant Patellar Tendinitis: Magnetic Resonance Imaging, Histologic Evaluation, and Surgical Treatment. Am J Sports Med. 25(2):218-222, 1997.

11. Renstrom P. Sports Traumatology Today: A Review of Common Current Sports Injury Problems. Ann. Chir. Gynaecol. 80:81-93, 1991.

12. Stone D, Green C, Rao U, Aizawa H, Yamaji T, Niyibizi C, Carlin G, Woo S L-Y. Cytokine-Induced Tendinitis: A Preliminary Study in Rabbits. J Orthop Res 17(2):168-177, 1999.

13. Wang, JH-C. Stone D. Jia F. Woo S L-Y.. Cyclic Stretching of Human Tendon Fibroblasts Induces High Levels of Prostaglandin E2: Implication for the Mechanism of Tendinitis, ORS Conference 2001.

Acknowledgments

Special thanks to Dr. Wang for being

our restless guide and mentor throughout this summer. We would also like to thank the mechanobiology group: Brian Campbell, Guo-guang Yang, Tom Gilbert, Fengyan Jia, Takatoshi Shimomura, and Alison Westcott. Finally, we would like to thank Dr. Woo for providing us with the opportunity to work in the Musculoskeletal Research Center.

Greg Frank University of Pittsburgh grfst5@pitt.edu Major: Bioengineering Year: Junior Advisor: Dr. Woo Mentor: Steve Abramowitch Hometown: Peters Township, PA Birth date: August 7, 1981

Engineering…I guess it’s in my blood. It’s what we Franks do best. I looked

around at other majors, but when it came down to it, I knew that it’s what I really want to

do. I was first introduced to the field of bioengineering while I was in high school

visiting the university. Dr. Michael Sacks showed me specifically what was being

studied in his lab and explained to me the directions in which the program hoped to grow.

From that point on I’ve known what it is that I want to be when...if...I grow up.

Specifically, I’m studying biomechanics. Upon graduating, I plan on either going to

graduate school to further study bioengineering and business or becoming the shortest

point guard in recent NBA history.

Though it’s hard for me to believe sometimes, I do have a life outside of

engineering. I enjoy music (all types) and film art. I love playing ice hockey when I get

the chance and mountain biking.

I’d like to thank everyone in the MSRC for the opportunity that they have given

me. Specifially, I’d like to thank Dr. Woo, Colleen, and the entire MCL group,

especially Steve Abramowitch.

Tensile Properties of the Healing Goat MCL After a Combined MCL/ACL Injury

Gregory Frank, Steven Abramowitch BS, Masayoshi Yagi MD, Eiichi Tsuda MD, Savio L-Y. Woo PhD, DSc

Musculoskeletal Research Center

Department of Orthopaedic Surgery University of Pittsburgh

Introduction Knee injuries occur commonly among athletes

and in the general population. The injured medial collateral ligament (MCL) in combination with the injured anterior cruciate ligament (ACL) accounts for 12.8% of acute knee ligament injuries (Miyasaka 1991). While non-operative treatment of the MCL along with surgical reconstruction of the ACL is common for this type of injury, there is little consensus as to the best treatment modality (Shirakura 2000). Regardless of method used to treat this injury, varus-valgus laxity of the knee remains increased, and early degenerative changes of articular cartilage often occur (Ohno 1995, Lundberg 1997). Animal studies have shown that the tensile properties of the healing MCL after an isolated injury remain inferior to the normal MCL for more than 2 years (Frank 1983, Weiss 1991). After a combined MCL/ACL injury, the tensile properties of the healing MCL are even worse (Yamaji 1996).

Using the rabbit model, Ohno et al. (1995) have demonstrated that 6 weeks after the combined MCL/ACL injury treated with ACL reconstruction the stiffness and ultimate load of the healing FMTC were 53.2% and 67.4% lower than those reported for the sham-operated (control) group, respectively. Further, mechanical properties including tangent modulus and tensile strength of the healing MCL were 84.7% and 91.3% lower than those reported in the isolated MCL injury model. However, Yamaji et al. (1996) demonstrated that a high occurrence (>50%) of ACL allografts failed after one year in the rabbit model, limiting its use for long-term studies of the combined MCL/ACL injury. Using the canine model, Woo et al. (1990) have shown similar results to those reported for the rabbit model at 6 and 12 weeks. However, severely deteriorated joint surfaces and osteophyte formation were observed at these early time periods.

Alternatively, ACL reconstructions in the goat model have demonstrated a high rate of success up to 3 years after injury with minimal osteoarthritic changes to articular cartilage (Ng 1995). The large size and robust activity level of the goat also make it an attractive model for studies of ligament healing. Thus, the objective of this study was to determine the structural properties (stiffness, ultimate load, ultimate elongation, and energy absorbed) of the healing goat

FMTC and the mechanical properties (modulus, tensile strength, ultimate strain, and strain energy density) of the healing goat MCL after an MCL/ACL combined injury treated with ACL reconstruction.

Methods/Materials Six skeletally mature female Saanen goats

(weight 36.7≤5.4 kg) were used in this study. Through an anteromedial incision, the ACL of the right knee was transected and removed. An ACL reconstruction was performed using an autograft consisting of the central 1/3 of the patellar tendon along with patellar and tibial bone blocks (Ma 2000). The graft and bone blocks were sized to 6mm and 5mm in diameter, respectively. Bone tunnels measuring 6mm in diameter were drilled through the ACL insertion sites in both the femur and tibia. Fixation in the femoral tunnel was achieved using an interference screw (Arthrotek, Warsaw, IN). Due to the length of the patellar tendon of the goat, the remaining portion of the graft was passed through the tibial tunnel and fixed to the anterolateral cortex of the tibia using a surgical staple and suture post with 35 N of tension applied to the graft. Subsequently, a mop-end tear was created in the right knee (Wiess 1991) by passing a 4 mm diameter rod under the mid-substance of the MCL at the jointline and rupturing the MCL by applying a force to the rod in the medial direction. The torn ends of the MCL were re-approximated but not repaired, and both the fascia and the skin were closed using standard suture technique. The contralteral knee served as a sham-operated control, whereby the central 1/3 of the patellar tendon was removed and the ACL was exposed but not touched. Additionally, the MCL was exposed and undermined but not ruptured.

The goats were allowed free cage activity after the surgery. At 6 weeks, they were euthanized, the legs were harvested, and they were immediately frozen in double plastic bags at -20ºC so that they could be tested at a later date (Woo 1986).

Prior to testing, soft tissues were removed, leaving a femur-MCL-tibia complex (FMTC). The femoral condyles and the tibial plateau were cut within 3mm of the distial and proximal insertions of the MCL, respectively (Scheffler et al. 2000). Using a laser micrometer, the cross-sectional area of the MCL was

measured at the proximal, mid-substance, and distal locations (Lee 1988). The average of these measurements was used to approximate the MCL’s cross-sectional area (Scheffler et al. 2000). In order to determine the strain in the midsubstance of the MCL, two reflective markers were placed approximately 1 cm apart and centered about the joint line. During testing, the distance between these markers was tracked continuously using a Motion AnalysisTM video tracking system (model VP320) so as to find the change in length (∆l) as well as the gauge length (l 0). Strain was defined as e = Dl / lo.

The FMTC was then positioned in custom designed clamps and fixed to a materials testing machine (InstronTM, model 4502) in a 37ºC saline bath. The FMTC was preloaded (2 N) and preconditioned by cycling it 10 times between 0 and 1 mm moving at 10 mm/min. Subsequently, the FMTC was loaded to failure at the same crosshead speed. Stress was defined as s = force/(original cross-sectional area). Load-elongation curves were plotted and used to determine the structural properties of the FMTCs, including stiffness, ultimate load, ultimate elongation, and energy absorbed. The stress versus strain plot was used to determine the mechanical properties of the MCL mid-substance, including modulus, tensile strength, ultimate strain, and strain energy density.

Statistical analysis was performed using an unpaired t-test since the experiment is ongoing, and the contralateral legs of some specimens still need to be tested. The tolerance used was p < 0.05.

Results All of the goats returned to full weight bearing within 3 to 4 weeks after surgery. After dissection, the knees were qualitatively examined noting the gross morphology. In each leg, the ACL graft was intact.

Each healing MCL had dark colored tissue at the injury site and was loosely covered in a white, fibrous tissue that was removed prior to testing. There was no gross observation of discoloration or damage to the articular cartilage or osteophyte formation in either the healing or the sham-operated knees. While 6 goats were operated on, the results of only 5 were examined due to a sham-operated specimen failing prematurely. The average cross-sectional area of the healing MCL (n = 4) was nearly 2.7 times larger than that of the sham-operated MCL (n = 5), however this result was not statistically significant (p = .102). A typical load-elongation curve for a pair of specimens is shown bellow (figure 1). The stiffness of the healing FMTC (31.68 ± 27.58 N/mm) was significantly lower than that of the sham-operated FMTC (73.66 ± 25.17 N/mm). It also had a significantly lower ultimate load (700.71 ± 84.72 vs. 161.39 ± 176.63 N). The sham-operated FMTC had a significantly higher elongation at failure (12.09±1.95 mm vs. 5.14±1.80 mm), and the energy absorbed was significantly higher in the sham-operated FMTC (4297.02±799.19 N-mm) than the healing FMTC (460.25±592.06 N-mm).

A typical stress-strain curve for a pair of specimens is shown below (figure 2). Of the nine legs tested, 4 failed between the reflective markers in the mid-substance of the MCL (3 healing, 1 sham-operated). Due to the high number of MCLs that did not fail between the markers, the tensile strength, ultimate strain, and strain energy density are not reported. The tangent modulus of the sham-operated MCL (941.94 ± 530.74 MPa) was significantly higher than the tangent modulus of the healing MCL (103.22 ± 88.18 MPa).

Discussion This study determined the structural properties of the healing FMTC and the mechanical properties of the healing MCL after a combined MCL/ACL injury in the goat model. Compared to the results reported for the healing MCL after isolated injury, the stiffness, ultimate load, and elongation at failure obtained within the sham-operated group are similar to those found by Scheffler. However, the energy absorbed of the sham-operated FMTC and the tangent modulus of the sham-operated MCL were 128% and 178% higher respectively than those found by Scheffler. This may be attributed to the central 1/3 of the patellar tendon being removed in our sham-operated knees or the post-operation activity level after this type of injury. In terms of the healing MCL after a combined MCL/ACL injury, this study demonstrated that the structural properties are lower in the healing FMTC than in the healing FMTC after isolated injury (stiffness: 40%, ultimate load: 51%, elongation at failure: 40%, energy absorbed: 68%). The tangent modulus of the healing MCL is also substantially lower than that of the healing isolated injury MCL (50%). These results may be attributed to the inability of the ACL graft to completely restore normal kinematics, causing high levels of stress in the healing MCL. Overall, the goat model appears to be suitable for studying the combined MCL/ACL injury, as the results are consistent with those observed in other animal models and this model didn’t display any of the morphologic problems that were noted using other model. Acknowledgements

I would like to acknowledge Dr. James Wang and Dr. Lars Gilberston for their efforts in helping with the summer student research program, my mentor, Steven Abramowitch, for his support throughout my entire summer experience, Dr. Masayoshi Yagi and Dr. Eiichi Tsuda for their help in this study, and Dr. Savio L-Y. Woo for his active participation in developing the field of bioengineering and his strong support of education in research.

References 1. Frank C., S. L-Y. Woo, D. Amiel, C. Harwood, M. Gomez and W.

Akeson: Medial collateral ligament healing. A multidisciplinary assessment in rabbits. American Journal of Sports

Medicine, 11(6):379-89, 1983.

2. Lee, T. Q. and S. L-Y. Woo: A new method for determining cross-sectional shape and area of soft tissues. Journal of

Biomechanical Engineering, 110(2): 110-4, 1988. 3. Lundberg, M. and D. Messner: Ten-year prognosis of isolated and

combined medial collateral ligament ruptures. A matched comparison in 40 patients using clinical and radiographic

evaluations. American Journal of Sports Medicine, 25: 2-6, 1997. 4. Ma C. B., C. D. Papageorgiou, R. E. Debski and S. L-Y. Woo:

Interaction between the ACL graft and MCL in a combined ACL+MCL knee injury using a goat model. Acta Orthopaedica

Scandinavica, 71(4): 387-93, 2000 5. Miyasaka, K. C., C. M. Daniel, M. L. Stone and P. Hirshman: The

incidence of knee ligament injuries in the general population. American Journal of Knee Surgery, 4: 3-8, 1991 6. Ng, G. Y., B. W. Oakes, O. W. Deacon, I. D. McLean and D.

Lampard: Biomechanics of patellar tendon autograft for reconstruction of the anterior cruciate ligament in the goat: Three

year study. Journal of Orthopedic Research, 13: 602-8, 1995. 7. Ohno, K., A. S. Pomaybo, C. C. Schmidt, R. E. Levine, K. J.

Ohland and S. L-Y. Woo: Healing of the medial collateral ligament after a combined medial collateral and anterior cruciate

ligament injury and reconstruction of the anterior cruciate ligament: Comparison of repair and nonrepair of medial collateral

ligament tears in rabbits. Journal of Orthopedic Research, 13: 442-9, 1995. 8. Scheffler, S. U., T. D. Clineff, C. D. Papageorgiou, R. E. Debski, C.

B. Ma and S. L-Y. Woo: Structure and function of the healing medial collateral ligament in a goat model. Annals of

Biomedical Engineering, 29: 173-80, 2001. 9. Shirakura, K., M. Terauchi , M. Katayama , H. Watanabe, T.

Yamaji and K. Takagishi: The management of medial ligament tears in patients with combined anterior cruciate and medial ligament

lesions. Int Orthopedics, 24(2):108-11, 2000. 10. Wiess, J. A., S. L-Y. Woo, K. J. Ohland, S. Horibe and P. O.

Newton: Evaluation of a new injury model to study medial collateral ligament healing: Primary reapair vs. nonoperative treatment.

Journal of Orthopedic Research, 9: 516-28, 1991. 11. Woo, S. L-Y., C. A. Orlando, J. F. Camp and W. H. Akenson:

Effects of postmortem storage by freezing on ligament tensile behavior. Journal of Biomechanics, 19: 399-404, 1986. 12. Woo, S. L-Y., E. P. Young, K. J. Ohland, J. P. Marcin, S. Horibe

and H-C. Lin: The effects of transection of the anterior cruciate ligament on healing of the medial collateral ligament. Journal of

Bone and Joint Surgery, 72-A: 382-92, 1990. 13. Yamaji, T., R. E. Levine, S. L-Y. Woo, C. Niyibizi, K. W.

Kavalkovich and C. M. Weaver-Green: Medial collateral ligament healing one year after a concurrent medial collateral ligament and

anterior cruciate ligament injury: An interdisciplinary study in rabbits. Journal of Orthopedic Research, 14: 223-7, 1996.

John T. Jolly University of Pittsburgh jtjst9@pitt.edu Major: Biomechanical Engineering Concentration: Biomechanics Year: Senior Advisor: Richard Debski, Ph.D. Mentor: Richard Debski, Ph.D. Hometown: Pittsburgh, PA Birthdate: May 1st, 1980

I was born in Amarillo, TX and lived there for my first nine years. I then moved to “the

‘burgh” and have stayed here since. Being adopted into an Italian family has been pretty

interesting, being the only Irish kid, but I must say that Italians are great cooks.

I started at the MSRC, via Dr. Richard Debski, about a year and a half ago. I volunteered

for the first few months, became a summer student last summer, worked this last spring, and

returned for another eventful summer. I worked with modeling the Robotic UFS Testing system and

the knee last summer, but now I am modeling the shoulder.

Outside the BST: I love sports, especially biking, running, skiing, lifting, kung fu, as well as

other extremist sports; I love to travel whenever I can; currently I am planning on traveling around

the world; I recently became the University of Pittsburgh’s chapter of Biomedical Engineering

Society’s president; and one of previous jobs that I performed was life guarding at Raccoon Creek

State Park. Future plans: attending graduate school for bioengineering, skiing K2, and trying new

extreme sports.

I would like to thank Dr. Debski, the Shoulder Group, Colleen O’Hara, Dr. Gilbertson, Dr.

Woo, and the rest of the MSRC for another great summer.

Dislocation Potential of Shoulder Muscles in Two Clinically Relevant Positions

John Jolly; Richard Debski, Ph.D.; Patrick McMahon, M.D.

Musculoskeletal Research Center

Department of Orthopaedic Surgery University of Pittsburgh Medical Center, PA

Introduction The high mobility of the shoulder complex comes with the consequence of being easily dislocated. In positions such as the apprehension position (abducted and externally rotated) or the cocked arm position of throwing motion, dislocation has a high occurrence.1 These dislocations can occur without an external load applied to the upper extremity.

The mechanism of shoulder dislocation without an external load being applied is still controversial. One hypothesis is that muscles take an active part in the dislocation of the shoulder complex.10

Modeling of the shoulder complex has provided insight into shoulder mechanics. Software such as Software for Interactive Musculoskeletal Modeling (SIMM) (Musculoskeletal Graphics, Santa Rosa, CA) has been used for musculoskeletal modeling.5 These models have examined the lower extremity4, the upper extremity3, the spine, the forearm6, and other musculoskeletal systems of the body. SIMM inputs surface models of bones, creates a serial linkage system with bony geometry, animates this system using kinematic data, and defines muscle origins, insertions, and paths. Muscle lines of action and/or moment arms can be displayed.

Objective

To create a model of the upper

extremity to examine the lines of action of shoulder muscles in the apprehension position and the cocked arm position of throwing motion. Methods

A standard set of low-resolution bone

geometry acquired from Musculographics Inc. was used for the relevant bones of the upper extremity. The relevant bones involved are the scapula, humerus, clavicle, ribcage, and the spinous processes. The hand, radius, and ulna were included to better illustrate these clinically relevant positions. Applying translational and rotational transformations to the geometry’s coordinate system assembled the kinematic linkage between the bony geometries to create bony joints (i.e. glenohumeral joint between the humerus and the scapula). Degrees of freedom (DOFs) (ranges and directions of rotation) for each joint were defined and the linkage system was set to the anatomical position.7 The relevant muscles are the infraspinatus, supraspinatus, subscapularis, teres minor, teres major, latissimus dorsi, deltoid, and pectoralis major.11 Because of their broad insertions and origins the muscles were broken up into several elements.12

Rotations of segment coordinate systems about their respective segment (i.e. humerus rotation about the scapula) were then defined based upon literature.7

Output parameters of this model are the lines of action of the relevant muscles, specifically in the apprehension position and the late cocking phase of throwing. Results The subscapularis muscle line of action with respect to the humerus coordinate system was found to be primarily in the medial direction throughout all of the shoulder orientations. In the apprehension position and cocked arm position the subscapularis muscle line of action is directed medially and inferiorly. The pectoralis major muscle line of action with respect to the humerus mainly directed anteriorly and medially in the resting position and inferiorly and medially in the apprehension and cocked arm positions, with a small component directed anteriorly in the anatomical and cocked arm positions.

-1

-0.5

0

0.5

1

Shoulder Orientation

Uni

t Vec

tor C

ompo

nent

anterior superior lateral

Anatomic Apprehension Cocked Arm

Figure 1: Subscapularis muscle line of action with respect to the humeral coordinate system

-1

-0.5

0

0.5

1

Shoulder Orientation

Uni

t Vec

tor C

ompo

nent

anterior superior lateral

Anatomic Apprehension Cocked Arm

Figure 2: Pectoralis Major muscle line of action with respect to the humeral coordinate system

Figure 3: Anterior view of a right glenohumeral joint with subscapularis muscle elements

Figure 4: Anterior view of a right glenohumeral joint with pectoralis major muscle elements Discussion Low-resolution geometry was positioned into a kinematic linkage via translation and rotation transformations. DOFs were defined and the reference position

was defined as the anatomic position. Ranges of motion of each coordinate system were set based upon literature findings. Relevant muscles were broken into elements and added based upon their respective origin and insertion sites. Muscle lines of action were recorded with the geometry in the anatomic position, the apprehension position, and the cocked arm position. The results of the subscapularis muscle line of action agree with past studies that the rotator cuff muscles11 provide the shoulder with stabilization. The results of the pectoralis major muscle line of action show a similarity to McMahon (2001) with the anterior component increase from the apprehension position to the cocked arm position. Depending upon the magnitude of the pectoralis major muscle throughout the two clinically relevant shoulder positions, this increase has the potential for shoulder instability or shoulder dislocation. These results aid in future experimental designs of EMG or cadaver models. References 1. Cave, E., J. Burke, et al. (1974). Trauma Management. Chicago, Yearbook Publishers. 2. Debski, R. E., P. J. McMahon, et al. (1995). “A new dynamic testing apparatus to study glenohumeral joint motion.” J Biomech 28(7): 869-74. 3. Debski, R. E., E. K. Wong, et al. (1999). “An analytical approach to determine the in situ forces in the glenohumeral ligaments.” J Biomech Eng 121(3): 311-5. 4. Delp, S. L., A. S. Arnold, et al. (1998). “Graphics-based modeling and analysis of gait abnormalities.” Biomed Mater Eng 8(3-4): 227-40. 5. Delp, S. L. and J. P. Loan (1995). “A graphics-based software system to develop and analyze models of musculoskeletal structures.” Comput Biol Med 25(1): 21-34.

6. Delp, S. L., W. M. Murray, et al. (1995). “Variation of muscle moment arms with elbow and forearm position.” J Biomech 28(5): 513-25. 7. Fung, M., S. Kato, et al. (2001). “Scapular and clavicular kinematics during humeral elevation: A study with cadavers.” J Shoulder Elbow Surg 10(3): 278-85. 8. Hughes, R. E. and K. N. An (1996). “Force analysis of rotator cuff muscles.” Clin Orthop(330): 75-83. 9. McMahon, P. J., V. C. Eberly, et al. (1999). “Effects of shoulder muscle forces on the glenohumeral joint force and translation.” Orthop Res Soc. 10. McMahon, P. J., T. Q. Lee, et al. (2001). “Effects of failure modes in repeated anterior inferior glenohumeral joint dislocations.” Bioengineering at the Dawn of the 21st Century, Symposium in Honor of Dr. Savio L-Y. Woo's 60th Birthday: 17. 11. Rockwood, C. A. J., F. A. I. Matsen, et al. (1998). The Shoulder. Philadelphia, PA, Saunders. 12. Van der Helm, F. C., K. Breteler, et al. (1999). “Measuring muscle and joint geometry parameters of a shoulder for modeling purposes.” J Biomech 32(11): 1191-7. Acknowledgments I would like to thank Drs. Debski, Gilbertson, and Woo for the opportunity of another great research experience. For the shoulder group I would like to thank Drs. McMahon, Jari, and Kandemir for the clinical aspects and Susan Moore and Ryan Costic with many technical engineering aspects. Of course I want to thank Colleen O’Hara and the rest of the MSRC for another wonderful summer.

Jennifer Mercer University of Pittsburgh jlmst147@pitt.edu Major: Bioengineering Concentration: Biomechanics Year: Junior Advisor: Dr. Richard Debski Mentor: Susan Moore Hometown: Mars, PA Birthdate: May 16, 1981

I was born in San Diego, CA and lived there for a mere 3 months before moving to

Maryland, where I stayed just long enough to gain a new baby sister. My family then moved to

London for 3 years before finally heading back to the states and taking up residency in Virginia,

where we lived for 7 years. We ultimately relocated to Mars, PA, where we have been ever since.

The summer before my senior year in high school, I stumbled across a tour of the MSRC

while visiting Pitt. It was then that I first realized I wanted to get involved in bioengineering. After

all, I was going to need a career that could support my concert addiction which is really starting to

become expensive. Of course, little did I know that working at the MSRC would mean that I would

be showing up at 5:45 AM so I could hold a humerus after enjoying a few bagels with the shoulder

group.

Overall I’ve enjoyed my experience as part of the Shoulder Group at the MSRC this

summer. I’ve been given numerous opportunities and worked with people from all over the world.

Everyone who works at the MSRC is great and has made my summer a lot of fun. Thanks to Dr.

Debski and Susan (even though she held me hostage in the shoulder lab for days at a time), as well

as everyone else, for teaching me all I needed to know to get through a summer at the MSRC. I

would also especially like to thank Dr. Woo for opening his laboratory to the undergraduate

students and in turn providing a fun learning environment.

RANDOM COLLAGEN FIBER ARCHITECTURE IN THE AXILLARY POUCH OF THE INFERIOR GLENOHUMERAL CAPSULE

Jennifer L. Mercer; Richard E. Debski, Ph.D.; Susan M. Moore B.S.; Patrick J. McMahon, M.D.

Musculoskeletal Research Center

Department of Orthopaedic Surgery University of Pittsburgh Medical Center, PA

INTRODUCTION The glenohumeral (GH) joint is the most commonly dislocated joint in the body, with recurrence following open and arthroscopic surgical repair as high as 12% and 23%, respectively. [1] Anterior dislocation results in injury of the anteroinferior capsulo-labral structures which include the inferior glenohumeral ligament (IGHL), the primary static restraint to anterior joint dislocation. [2] The organization of the collagen fibers in this tissue could yield information about its in vivo function. Additionally, it may improve surgical repair techniques as axillary pouch injury may be superior-to-inferior as well as medial-to-lateral. [3] The collagen fibers of the anterior band (AB-IGHL) were previously reported to be oriented parallel to its long axis but the collagen fiber orientation of the axillary pouch remains uncertain. [4,5] The purpose of this study was to quantify the collagen fiber orientation in the axillary pouch using the small angle light scattering (SALS) technique. We hypothesize that the collagen fibers in the axillary pouch of the IGHL are randomly oriented throughout the thickness of the tissue. MATERIALS AND METHODS Eight fresh frozen human cadaveric specimens (avg. age 50.8±8.6 years) were dissected. Six specimens were utilized in preliminary investigations to obtain a satisfactory method for acquiring and maintaining histological

samples as well as establish a method to quantify the fiber orientation using polarized light microscopy. However, due to the randomness of the fibers and subjectiveness of the results, polarized light microscopy was not an effective technique to obtain quantitative data. Three rectangular samples (approx. 11 x 6 mm) were excised from the axillary pouch of the two remaining specimens. Each sample was harvested with one edge parallel to the longitudinal axis of the AB-IGHL. Samples of the long head of the biceps tendon (LHBT) were also obtained as a highly aligned control. Each sample was immersed in a beaker of 2-methyl butane, which was surrounded by liquid nitrogen. Once frozen, the samples were stored at –80oC until sliced on a cryostat at 100 µm increments. Approximately 10 slices per sample were collected, allowing the variability of collagen fiber alignment to be compared throughout the depth of the tissue. The samples were then mounted on slides and kept in a cold room (5oC) until tested within 24 hours. Previous studies have utilized the birefringent optical properties of collagen in order to quantify the orientation of fibrous tissue using SALS. [6] The SALS device passes a 4 mW unpolarized HeNe laser beam, chosen because its wavelength (632.8 nm) is within an order of magnitude of the collagen fibril diameter, through the

tissue. [6] When the laser passes through the tissue, light is scattered perpendicular to each fiber axis, thus producing a scattered light intensity. The maximum intensity is achieved at the angle of greatest alignment of the collagen fibers. Each slide was placed individually on the SALS machine and the collagen fiber orientation was measured. The SALS device has previously been determined to have a spatial resolution of ± 254 µm and the ability to quantify the predominant collagen orientation to within 1o. [6] An orientation index (OI) can be defined as the angle containing 50% of the total number of fibers. An increase in OI is directly related to an increase in randomness. At three depths within each sample, the distribution of OI values in a 9.3 mm2 area was calculated and compared to the distribution of OI values in an area with the same dimensions for a slice of LHBT. [6] RESULTS The collagen fibers of the axillary pouch appeared to be randomly oriented for each slice and also throughout the thickness. Compared to the OI distribution of the highly aligned LHBT (Fig.1), the OI distributions of one representative sample of axillary pouch tissue are clearly more random (Figs. 2,3,4). The darker regions represent regions with higher OI values, and therefore regions of less organization. The predominant direction of collagen fiber alignment is shown by the black lines in the OI distribution figures. Within the axillary pouch tissue, there appear to be small regions of moderate organization within a largely unorganized tissue, as shown by the

darker appearance of the axillary pouch tissue (Figs. 2, 3, and 4) compared to the lighter appearance of the LHBT (Fig.1). The OI distributions show the lack of collagen fiber organization in individual slices and also throughout the depth of each sample. Averaging the results from both specimens, 45.3±9.6% of the area of the LHBT slices had an OI of 41 degrees or less, compared to the axillary pouch tissue slices which had 23.0±6.9% of the area with an OI of less than 41 degrees. The randomness of the tissue throughout the thickness was shown by comparing the percentage of area with an OI of less than 41 from slices near the bursal (24.4±9.4%), middle (23.5±5.1%), and articular (20.9±6.4%) portions of the capsule.

Figure 1: OI distribution (degrees) for LHBT tissue

Figure 2 : OI distribution (degrees)for axillary pouch tissue at 400 µm

Figure 3 : OI distribution (degrees) for axillary pouch tissue at 800 µm

Figure 4 : OI distribution (degrees)for axillary pouch tissue at 1200 µm

DISCUSSION The results obtained from SALS support our hypothesis that the resultant fiber architecture of the axillary pouch showed the collagen fiber orientation to be random throughout the thickness of the tissue. Although some regions of localized alignment were noted, no evidence of a pattern for an individual depth or throughout the thickness was present. Our findings disagree with previous studies regarding fiber orientation in the axillary pouch that were obtained using polarized light microscopy. [4,5] As expected, the LHBT demonstrated a high degree of alignment with respect to its longitudinal axis. However, due to its lack of collagen fiber alignment, the axillary pouch does not appear to have the morphological characteristics of a ligament. This random fiber orientation will affect the mechanical properties of the axillary pouch and implies that they would be

similar in the directions parallel and perpendicular to the capsular ligaments. This also suggests that capsular shift procedures should treat all components of the IGHL as a continuous sheet. Specifically, proper fixation to the rim of the glenoid, in both the medial-lateral and superior-inferior direction, is necessary to restore intact capsular function. ACKNOWLEDGEMENTS

The support of the Whitaker Foundation as well as the assistance from Michael Sacks, PhD and the Tissue Mechanics Laboratory is gratefully acknowledged.

REFERENCES 1) Sperber A, et al. J Shoulder

Elbow Surg, 10(2): 105-108, 2001.

2) Turkel SJ, et al. J Bone Joint Surg Am, 63:1208-1217, 1981.

3) Soslowsky L, et al. Third World Congress Biomech: 211, 1998.

4) O’Brien SJ, et al. Am J Sports Med, 18(5): 449-456, 1990.

5) Gohlke F, et al. J Shoulder Elbow Surg, 3(3): 111-128,1994.

6) Sacks MS, et al. Ann Biomed Eng, 25: 678-689, 1997.

Brad Stokan Carnegie Mellon University bstokan@andrew.cmu.edu Major: Mechanical Engineering, Biomedical Engineering Year: Junior Mentor: Mary Gabriel Hometown: Altoona, PA Birth date: November 19, 1980

It was with great enthusiasm that I accepted the opportunity to work at the

Musculoskeletal Research Center (MSRC) during the summer of 2001. I was anxious to start

working in a cutting-edge laboratory filled with new and innovative technology. Most of all, I

was eager to apply my classroom knowledge to real and important research in a top laboratory in

the field of bioengineering.

I currently study Biomedical and Health Engineering along with Mechanical Engineering

at Carnegie Mellon University in Pittsburgh. I grew up not far from Pittsburgh in Altoona, PA.

This coming year, however, I’ve decided to go to London to study abroad. I feel it’s the chance

of a lifetime to experience a new country and its culture, while I still have no strings attached. In

England, I plan to open my eyes to exciting methods of engineering, hear a lot of funny accents,

and meet attractive British women.

In my spare time I like to draw, read or write. I also love movies, sports (especially

hockey and skiing) and trying new things (like skydiving or caving). But I especially enjoy

spending time with my friends, just hanging out and relaxing.

My experience at the MSRC was great; it was fun, educational and unique. I learned a

great deal about research, and saw firsthand the hard work it requires as well as the integration

between different disciplines. I was exposed to a cross section of people from many backgrounds

and cultures. I met great people who were all too willing to help, and I made many new friends.

It was a truly enlightening experience, and I would like to thank Dr. Woo and Dr. Gilbertson for

giving me the opportunity to learn so much at the MSRC.

Validation of a method for transforming and reproducing kinematics of a custom device using a robotic manipulator

BRAD STOKAN, MARY GABRIEL. MS, JENNIFER ZEMINSKI. MS, RICHARD DEBSKI.

PhD, SAVIO L-Y WOO. PhD, DSc

Musculoskeletal Research Center, Department of Orthopaedic Surgery, University of Pittsburgh, Pittsburgh, PA

INTRODUCTION

Soft tissue injury, especially in joint

ligaments, calls for continued research toward accurate, repeatable diagnosis and treatment. The anterior cruciate ligament (ACL) of the knee is particularly susceptible to injury; it accounts for 90% of all knee ligament injuries in young active people (Miyasaka, et al., 1991).

An improved understanding of ACL function is needed to better diagnose and treat its injury. However, much testing is required to fully comprehend the forces and moments acting along the complex ligament under different conditions. New methods of research can elucidate the function and role of the ACL and other ligaments in joint kinematics, lending a better understanding of how best to treat an injured ligament.

One important testing protocol developed by this lab incorporates the use of a unique robot and universal force/moment sensor (UFS) system (Rudy, et al., 1996) to manipulate the knee, shoulder and other joints and compute forces in the ligaments non-invasively. This technique was used in recent thesis research to quantify the loads in the ACL under clinical diagnosis conditions. This study involved the measurement of knee kinematics and their reproduction on the robotic manipulator, using the UFS to find the forces in the ACL (Zeminski, 2001).

In order to replay the kinematics on the robot, however, the data first had to be transformed into a robot-compatible form. The kinematics used a coordinate system different from that of the robot/UFS. Hence, a system of transformations was needed in order to translate the raw kinematics data into a format relative to the coordinate

system of the robotic/UFS manipulator. It was deemed necessary that this transformation process be validated as an accurate, precise means of creating identical but robot-compatible kinematics data. This project was devised to validate that method.

The objective of this study was to validate a method for transforming kinematics data for input to the robot. To validate this transformation we devised a series of tests, using a custom device that we designed and built to act as a simple model of the knee joint. The procedure for our test consisted of three phases: 1) the custom device was rigidly mounted and subjected to arbitrary loads and torques while its kinematics were recorded; 2) this kinematics data was transformed into a robot-compatible form, using the transformation process that this study was designed to validate; 3) the custom device was mounted on the robotic/UFS testing system, on which the transformed kinematics were replayed and forces measured.

So, if the kinematics replayed on the robot had been properly transformed, then the forces found by the UFS would match those exerted in phase one. If this were so, our transformation process would be validated.

MATERIALS AND METHODS

We designed and built a custom device specifically for this study to be used in place of a real knee for all of our testing. This would ensure repeatability and eliminate unwanted variables arising from soft tissue behavior and deterioration. The device was comprised primarily of Plexiglas plates, with non-magnetic fixation devices, acrylic fasteners, and two predominantly plastic

spring scales (stiffness 1 N/mm). These materials were chosen to minimize interference with the Flock of Birds” (Ascension Tech.) magnetic tracking system we would use to record kinematics. Our custom device was modular as well, to facilitate its use both on and off the robotic manipulator.

For the first phase of testing, the device was rigidly mounted to a Plexiglas table. The device was constructed such that the lower tier (acting as the femur) was held rigid while the upper tier (tibia) could translate and/or rotate freely when subjected to loads and/or torques. We applied various arbitrary loads (20, 30, 40 and 50 N axial loads) and torques (twisting 90±) separately to the upper tier, moving it in two degrees of freedom (one in translation, one in rotation). For our test we applied separate 20, 30, 40 and 50 N axial loads, as well as two separate torques providing twist of 90± about the axial direction.

Fig. 1 - view of custom device, free of robot, during first phase of testing

As these arbitrary loads were applied, the kinematics of the device were recorded using the Flock of Birds (FOB) magnetic tracking system. Two FOB sensors rigidly

fixed to the device (one on the upper tier and one on the lower) recorded their ever-changing positions (kinematics data) as the device moved under the loads applied.

The kinematics data collected by FOB described the path of motion followed by the custom device during the first phase of testing. However, these kinematics could not readily be fed to the robot for reproduction, as the data was not in a format that could be understood by the robot. For phase two of testing, the kinematics would have to be transformed using the process that this study was designed to validate.

The actual transformation process was facilitated by a program written specifically for this purpose in Mathematica software (Wolfram Research, Inc.). It defined a procedure that transformed the raw kinematics data into a format that could be understood and utilized by the robot.

Following the data transformation, the custom device was transferred to the robotic/UFS system for the third and final phase of our test. The device was rigidly secured to the robot using clamps and fixation apparatus.

Fig. 2 - view of custom device on robot, during phase three replay of kinematics

Once the device was in place on the robot, MicroScribe (Immersion Corp.) was

Plexiglas handle

Upper tier

Spring scales FOB transmitter

Lower tier

UFS

Spring scales

Robot arm

Clamps

Lower tier

Upper tier

utilized to record the location of the upper tier and lower tier and relate the device’s position to the robot. To record this relative data, we used MicroScribe to digitize orthogonal faces on two Plexiglas cubes attached to the custom device (one to the upper plate and one to the lower plate). This provided additional data needed to replay the transformed kinematics.

Next the transformed kinematics data was fed to the robot system. The robotic/UFS system then replayed the kinematics of the transformed data. As the kinematics were replayed, the UFS sensor measured and recorded the forces/moments in the custom device. These forces would be compared with those we originally exerted during the first phase of testing (as the kinematics were being recorded). Also the forces in the two spring scales were measured. Finally, as the device moved through its range of motion, we used MicroScribe to digitize the changing positions of the registration blocks as yet another check of the kinematics.

If the forces determined by the UFS were equal to those originally exerted, then the kinematics on the robot would necessarily be equal to those of the original phase of testing. If the kinematics were the same in part one as part three then they must have been successfully transformed; thus the process would be validated.

FUTURE DIRECTIONS

So far we have successfully transformed

and replayed kinematics of the custom device on the robotic/UFS system to within a few millimeters. However, some error in recording forces was introduced due to a problem with the UFS. Once this problem is remedied in the near future, the kinematics can again be replayed to find correct forces and finally validate the kinematics transformation.

The next goal will be to quantify error in recording kinematics introduced by the FOB magnetic tracker. By mounting the device on an Instron materials testing device for true 1 DOF testing the exact translations

(under our prescribed loads) can be compared to those found by FOB to find the error. As an adjunct to this project, we designed and built clamps to attach our device to this Instron.

Additional goals are planned for the more distant future. While current research in joint kinematics and ligament forces is limited largely to ex vivo cadaver studies, the results of our validation project will hopefully further progression toward studies of in vivo joint kinematics and forces. For example, having validated our method for transforming kinematics, the following process can be applied toward in vivo study: 1) record in vivo joint kinematics, 2) transform kinematics, 3) replay kinematics on cadaver limb using robot to indirectly determine in vivo forces. In this way the function of the ACL and other ligaments can be evaluated non-invasively.

ACKNOWLEDGEMENTS

Special thanks to Dr. Woo, the faculty, the students and the staff for teaching us how to conduct focused and meaningful research. Also, all of the help from Dr. Richard Debski, Mary Gabriel and Jen Zeminski is gratefully appreciated. Finally, thanks to my peers at the MSRC for making the summer fun and educational.

REFERENCES Miyasaka, K.C., Daniel, D.M., Stone, M.L.,

and Hirshman, P. (1991) The incidence of knee ligament injuries in the general population. Am. J. Knee Surg. 4, 3-8.

Rudy, T.W., Livesay, G.A., Woo, S.L-Y., and Fu, F.H. (1996) A combined robotic/universal force sensor approach to determine in situ forces of knee ligaments. J. Biomechanics 29 (10), 1357-1360.

Zeminski, J. (2001) Development of a combined analytical and experimental approach to reproducing knee kinematics for the evaluation of ACL function. University of Pittsburgh.

Charles J. Vukotich Northwestern University c-vukotich@northwestern.edu Major: Biomedical Engineering Concentration: Biomechanics Year: Junior Advisor: Dr. Richard Debski Mentor: Dr. Yuhua Song Hometown: Pittsburgh, Pennsylvania Birthdate: October 4, 1981

Hi everybody. I’m a native Pittsburgher. I’ve lived in Mt. Lebanon for my entire life and until recently, had no desire to leave Pittsburgh, except on vacations. Nevertheless, a strong interest into BME caused me to leave the city and head for Northwestern, in Chicago. I find it to be an odd situation because when I’m there, I find myself wishing to be in Pittsburgh, and vice versa. In the end, though, I must say that the experience has made me happier, although slightly more confused. That’s an all-too-common occurrence. After I finish college, I intend to go to either graduate school or med school. I haven’t made up my mind where I would like to do yet, but I am fairly certain that I would like to return to Pittsburgh.

While I’m home, I live with my parents. I’m an only child, so its just me, my mom, my dad, and three cats. In my spare time I like to play computer games or ultimate Frisbee, or watch cartoons. I like to sit around and watch movies or listen to music. I need to find some time every day to just sit and do nothing. I just try to make sure that I do it whenever I’m not at work.

I first came to the MSRC in December hoping to find some research experience to supplement my knowledge from class. Dr. Gilbertson showed me around, and I was very impressed with the lab. Now that I am working here, it is not nearly what I expected, although I feel that the experience has been a beneficial. I would like to thank everybody at the MSRC for their help, especially Dr. Woo, for allowing me the opportunity to work here, and the rest of the summer students, for making the summer so much fun.

Three-Dimensional Geometric Modeling and Analysis of the Human Anterior Cruciate Ligament

Charles Vukotich, Yuhua Song Ph.D., Richard Debski Ph.D.,

Savio L.-Y. Woo Ph.D. D.Sc.

Musculoskeletal Research Center Department of Orthopedic Surgery

University of Pittsburgh Medical Center Introduction The anterior cruciate ligament (ACL) is one of the most damaged ligaments in the knee. Between 75 and 100 thousand ACL reconstructions per year are performed in the United States [1]. However, more data is needed to better treat an ACL injury. A validated model of the ACL would be useful for analyzing the kinematics and forces in the ACL under complex loading conditions that are difficult to realize experimentally. Such a model would be able to be used to analyze the stress-strain distribution of the ACL under different loading conditions, and for designing the reconstruction protocol for the ACL. For this model, the three dimensional geometry of the ligament must be determined. Previously, other work has dealt with the ACL only as a series of five cross-sections (one near each insertion and three in the midsubstance) when looking at the solid geometry of the ligament [3]. These cross sections were measured using a laser micrometer to determine cross sections. Another study concentrated on determining the area of the ligaments’ insertion sites on both the femur and tibia by digitizing the area around the insertion sites [2]. These surveys produce data on the rough shape of the ligament and its insertions, but the data fails to sufficiently describe the

cross sections throughout the ligament and while the ligament is anatomically positioned. This data is necessary for the purposes of highly accurate finite element modeling. The aim of my project is to create a full three-dimensional model of the entire ligament substance, and to gather data from it. The gathered data will be compared with literature values to evaluate the success of the modeling process. Materials and Methods Geometric Modeling of the ACL Six fresh-frozen cadaver knees were thawed overnight (Mean Age = 64.7 ≤ 10.8 years). CT scans were obtained of all of the knees at two millimeter per image and included approximately ten centimeters above and below the joint. The CT scans were then imported into the MIMICS computer software (Materialise, Ann Arbor, MI). The ACL, tibia, and femur were all identified and masked separately, so that three-dimensional images of all three could be viewed separately. The fibula was modeled as being attached to the tibia. Lastly, a surface mesh was created of the ACL to further smooth out its features.

Geometric Analysis Using the MIMICS program, the length of the ligament was determined by finding the distance between the approximate center of the tibial insertion site and the approximate center of the femoral insertion site. Additionally, the area of the tibial insertion site was determined by assuming that the insertion was oval in shape, and then measuring the long and short axes. These results were compared with earlier studies on the insertion site area [2]. Results In figure 1, the mask of the ACL is shown in detail. The femur and tibia were masked similarly, and then were brought into the three dimensional environment along with the surface mesh of the ligament. This can be seen in figure 2. Additionally, a close-up of the ligament surface can be seen in figure 3. From the surface mesh, the length of the ACL was determined to be 32.28 ≤ 2.63 mm. Additionally, the area of the tibial insertion site was found to be 117.84 ≤ 13.31 mm2. Discussion

The measured insertion site area did not deviate by a large amount with data from the literature. Harner et al. found the tibial ACL insertions to have an area of 136 ≤ 33 mm2. The deviations between the two values might be accounted for based on the fact that an oval insertion site was assumed, while Harner assumed a polygonal insertion site [2].

This method has several large advantages over older methods for

Figure 1: The masking of the ACL on the CT scan. The femur and tibia are also visible.

Figure 2: The modeling of the tibia, femur, fibula, and ACL.

determining cross sectional area and proportions of ligaments. Its first advantage is that it is non-contact, so there is no chance of the ligament damage by touching it. Furthermore, it allows the tissue to be visualized without damaging other tissue around it. No other method allows the ligament to be visualized without cutting tissue. Because no tissue has been cut, it can be ensured that the ligament is in its in vivo environment, and that geometry determined is the actual in vivo geometry.

Figures 3: A Close-up image of the ACL. Clearly visible in this photo is the insertion into the medial femoral condyle.

Future Directions

In order to add to this project, there are three things that need to be done. Firstly, although the MIMICS software can measure distances accurately, it cannot directly measure areas or volumes. The geometry needs to be imported into another program in order to directly measure areas and volumes. Secondly, although the CT scan provides useful data, it does not visualize the soft tissue as well as other scans, such as an MRI. Although my model seems to have the correct geometry, the scans from which it was taken do not show the outline of the ACL as clearly as an MRI. To get more accurate results and more clear proof that the models are correct, a similar study would need to be performed using that type of scan. Lastly, the sample size is small and the error in the program is not

accounted for. The repeatability of the masking process and the length determination process must be accounted for. More samples need to be done by more people, to minimize the error from that source. References 1.) Clancy WG, et. al.(1982). J Bone

Joint Surg Am, 64(3): 352-9. 2.) Harner CD, et al.(1999).

Arthroscopy, 15(7): 741-9 3.) Harner CD, et al.(1995). J

Orthop Res, 13(3): 429-34 Acknowledgements I would like to thank Dr Savio L-Y Woo and Dr. Lars Gilbertson for helping me learn about research this summer. I would also like to thank Dr. Yuhua Song for her guidance in the lab and the rest of the faculty, staff, and students at the MSRC for their time and patience in working with us.

Allison M. Westcott University of Toledo karazorel@hotmail.com Major: Bioengineering, Pre-Med Concentration: Year: Junior Advisor: Fengyan Jia, M.D. Mentor: Taka Shimomura, M.D. Hometown: Berlin Heights, Ohio Birth date: July 13, 1981

I grew up in Berlin Heights, Ohio, a small town near Cedar Point. I attended Edison High

School where science and math were my favorite subjects. I used to stay up late at night

watching those surgeries on TLC, so I knew that someday I would pursue a career in this field.

At school, I am active in my Engineering Fraternity, Theta Tau, as well as BMES, CSA and a

Resident Advisor position. I chose Toledo because they have an excellent bioengineering

program, it’s only an hour from home, tuition is cheaper than many other schools, and it’s only

45 minutes from everyone’s favorite place, Windsor-Detroit!! Upon finishing my undergraduate

studies, I will attend medical school and follow a career in Traumatology and Neurology.

I have had many great experiences here at the MSRC, and I feel my time here has been well

spent. I would like to thank Dr. Gilbertson for contacting me about this experience, my advisors

Fengyan Jia and Taka Shimomura for their guidance, and Colleen O’Hara for all that she’s done.

I would especially like to thank Dr. Woo for extending to me this wonderful opportunity.

Determining an Antisense Effective Target Site: Inhibition of the synthesis of Collagen α1 Types III and V Using Antisense Oligonucleotides in Human Patellar Tendon Fibroblasts

Allison M, Westcott, Fengyan Jia MD, Takatoshi Shimomura MD, Savio L-Y Woo PhD, DSc

Musculoskeletal Research Center, Department of Orthopaedic Surgery, University of Pittsburgh Medical Center,

Email: awestcot@eng.utoledo.edu

Keywords: antisense oligonucleotides, collagen types III and V, gene therapy, target sites

Introduction Antisense gene therapy is a strategy used for regulating gene expression [1]. In fact, it has already been used in orthopaedics in a rabbit model to enhance ligament healing [2]. Antisense oligonucleotides (ODNs) are complementary strands of DNA, 15-20 bases long [3,4], that specifically bind to target mRNA sequences. Sense and Missense are used as controls where Sense is the target sequence, Antisense is the complement of Sense and Missense is the bases from Antisense organized randomly. Once the ODN-mRNA binding takes place, RNase H is activated and sequentially degrades the mRNA, decreasing protein synthesis (Figure 1).

Figure 1: Antisense mechanism, blocking the protein translation [perso.club-internet.fr/ajetudes/nano/antisense.htm]. The most important factors for effective antisense ODNs are their specificity to the gene, affinity for the target mRNA, and stability and self dimerization (Figure 3) [4,5]. Although the method for determining these ODNs is still indefinite, previous studies suggest that the start codon (AUG) region [4], because it prevents ribosomal assembly [3], exon-intron boundaries, to prohibit splicing [1], and loop and stem regions of the mRNA's secondary structure, (Figure 2), are potentially successful sites [3,4,6].

Figure 2: The secondary structure of a section of mRNA, showing several single stranded loops (a) connected by double stranded stems (b) [from Zuker’s mfold]. 5' TGACCCGCGCCCCTGTGCGT 3' | |||| | 3' TGCGTGTCCCCGCGCCCAGT 5' Figure 3: Self-dimerization of a 20 base antisense ODN [from PrimerFinder analysis]. The goal of this study is to compare the effect of several antisense ODNs with different target sites for α1 types III and V collagen in human patellar tendon fibroblasts (HPTFs).

Materials & Methods

ODN Determination and Synthesis The gene sequences for α1 types III and V collagen were obtained from the National Center for Biotechnology Information (NCBI). The secondary structure analysis was performed using the mfold software, where 500 bases were input for an immediate output [6,7,8]. The target sites were chosen using the PrimerFinder program to avoid hairpin and self-dimer formation [9]. Also for each ODN, BLAST was used to determine gene specificity [10]. For each type of collagen, 4 target sites were chosen; two from the start codon region, one as a loop and one as a stem. Missense and Sense were used as controls against Antisense. The ODNs were synthesized by Intergrated DNA Technologies, Inc., (IDT) with phosphorothioate backbone modifications, followed by RP-HPLC purification.

In Vitro ODN Transfection Human Patellar Tendon Fibroblasts (HPTFs), obtained from surgical sample (male, 38) were maintained in Dulbecco's Modified Eagle Medium (DMEM) with 10% Fetal Bovine Serum (FBS), 100 units/ml penicillin, and 100 µg/ml streptomycin (Invitrogen). The cells were plated in 6 well plate (Falcon) to 90% confluence and incubated overnight at 37±C. Then the cells were washed twice with DMEM. Then the cells were treated with either 0.4 µM Antisense (AS) ODN, Sense (S) ODN or Missense (MS) ODN with 10 µg/ml Lipofectamine (Life Technologies) in 1% FBS in DMEM; the Control and Negative Control were treated only with 1% FBS in DMEM and all were allowed to incubate for 6 hours at 37±C. After the initial 6 hours, all cells were then treated with 50 µg/ml ascorbic acid and 50 µg/ml Beta-APN in 10% FBS in DMEM; they were incubated far an additional 42 hours at 37±C. Evaluation of Effects of ODNs To estimate the procollagen synthesis, the cells were subjected to immunohistological staining. After the 48 hour incubation period, the cells were fixed with precooled (-20±C) methanol, allowed to soak in 0.5% Triton-X-100 in Dulbecco’s Phosphate Buffered Saline (PBS) solution for 6 minutes at room temperature, then blocked with 10% Bovine Serum Albumin for 1 hour at room temperature. After this, the cells were treated with the primary antibody (1:400 of a mouse-anti human type III, Oncogene; 1:20 of a goat –anti human type V, Chemicon International) for 2 hours at room temperature. Once the primary antibody was washed away with 0.05% Tween-20 in PBS, 1:400 of the secondary antibody, (type III: Cy3 conjugated goat-anti mouse, Jackson ImmunoResearch; type V: Cy3-conjugated rabbit –anti goat antibody, Jackson ImmunoResearch), for 30 minutes. After the secondary antibody was washed away with the same Tween-20 solution, the cells were then observed with a fluorescent microscope and pictures were taken. Results Genes 30057, Human mRNA for pro-alpha-1 type 3 collagen and 4502956 homo sapiens collagen type V alpha 1 (COL5A1) mRNA were used. Type III bases 1-499 were used where 103-105 is the start codon; and type V bases 51-550 were used where 127-129 is the start codon.

Table 1 Type III Sequences Name Bas

es Sequence Effect

Start: SIII1

101-119

ACATGATGAGCTTTGTGCA

ASIII1 TGCACAAAGCTCATCATGT Some MSIII1 CTGCAGCTATAAGCACTAT Start: SIII2

101-117

ACATGATGAGCTTTGTG

ASIII2 TGCACAAAGCTCATCAT None MSIII2 GTACTCATAACCAGCTA Loop: SIII3

133-152

CTACTTCTCGCTCTGCTTCA

ASIII3 TGAAGCAGAGCGAGAAGTAG None MSIII3 AGTAGGACAGACGAAGTGAG Stem: SIII4

210-229

TCAGTCCTATGCGGATAGAG

ASIII4 CTCTATCCGCATAGGACTGA Large MSIII4 AGTCAGGATACGCCTATCTC Table 2 Type V Sequences Name Bas

es Sequence Effect

Start: SV1

128-147

CGCTGCTGCCCCCGCTGCTG

ASV1 CAGCAGCGGGGGCAGCAGCG None MSV1 ---- Start: SV4

139-158

CCGCTGCTGCTGCTGCTGCT

ASV4 AGCAGCAGCAGCAGCAGCGG ? MSV4 AGTCAGGATACGCCTATCTC Loop: SV8

341-360

AGCTGTACCCTGCGTCTGCA

ASV8 TGCAGACGCAGGGTACAGCT ? MSV8 CGAGTGAGACATTCGCTGTA Stem: SV9

483-502

CTACAACGAGCAGGGTATCC

ASV9 GGATACCCTGCTCGTTGTAG ? MSV9 CCATGATCGTGTAGTCGGTC Immuno staining pictures from Type III sequence 4 (SIII4, ASIII4, MSIII4 and control):

Antisense

Control

Missense

Sense

Discussion The immunostaining pictures from type III show that: the loop region tends to be most effective, the start region is variably effective and the stem region tends to be uneffective. This corresponds to another study (Laptev, 1994), which also observed that the loop region seemed to be the most effective [6]. The first sequence for type V (ASV1) was tested for cell uptake efficiency in transfection, similar to all others, but the results showed lack of cell uptake. So because prohibition of collagen synthesis was unlikely, the Sense, Antisense, and Missense were never tested. All other sequences for type V (ASV4, ASV8, and ASV9) are in the process of being tested. References 1.Wang et al., Antisense Oligonucleotides Selectively Suppress Expression of the Mutant α2(I) Collagen

Allele in Type IV Osteogenesis Imperfecta Fibroblasts. J. Clinical Investigation 97(2):448-454, 1996. 2.Nakamura et al.,Decorin Antisense Gene Therapy Improves Functional Healing of Early Rabbit Ligament Scar with Enhanced Collagen Fibrillogenesis. J Ortho Research 18:517-523, 2000.

3. Phillips et al., Basic Principles of Using Antisense Olidonucleotides In Vivo. Methods in Enzymology 313:46-56, 1999.

4. Francois et al., Design of Antisense and Triplex-Forming Oligonucleotides. Methods in Enzymology, 313:74-95, 1999. 5. Crooke, Progress in Antisense Technology: The End of the Beginning. Methods in Enzymology, 313:3-45, 1999. 6. Laptev et al., Specific Inhibition of Expression of a Human Collagen Gene (COL1A1) with Modified Antisense Oligonucleotides. The Most Effective Target Sites are Clustered in Double-Stranded Regions of the Predicted Secondary Structure for the mRNA. Biochemistry 33(36):11033-39, 1994. 7. Zuker et al., Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide. RNA Biochemistry and Biotechnology 11-43, 1999. 8. Mathews et al., Expanded Sequence Dependence of Thermodynamic Parameters Improves Prediction of RNA Secondary Structure. J. Mol. Biol. 288:911-940, 1999. 9. Primerfinder program: http://eatworms.swmed.edu/~tim/primerfinder. Tim Niacaris, Department of Molecular Biology University of Texas Southwestern Medical Center, 6000 Harry Hines Blvd. Dallas, TX 75390-9148, tim@eatworms.swmed.edu 10. Altschul et al., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402, 1997. Acknowledgements I would like to thank the whole MSRC for all of their support, Fengyan and Taka for their expert guidance, and especially Dr. Woo for extending to me this opportunity. Thanks also to the NIH for funding the lab.

Kathleen Yoder

Carnegie Mellon University kyoder@andrew.cmu.edu Major: Material Science Engineering, Biomedical Engineering Year: Senior Advisor: John Loh, M.D. Mentor: Yukihisa Fukada, M.D. Hometown: Grosse Pointe, MI Birthdate: April 14, 1980

I am originally from a small town in Ohio. I then lived in Michigan, Portugal, Singapore, and New

Zealand. I have returned to Michigan, where I am currently living. I love traveling to experience and

learn about the many different cultures and places in this world.

I have been interested in both medicine and engineering since I was a child. I put band-aids on

my friends’ scrapped knees and fixed anything that didn’t work. I am currently at Carnegie Mellon

University with a double major in Material Science Engineering and Biomedical Engineering.

Last summer I studied biomedical engineering from the cardiac perspective at University of

Pittsburgh Medical Center (UPMC) as an intern. This summer I am studying biomedical engineering

from an orthopedic perspective as an intern at the Musculoskeletal Research Center (MSRC) at UPMC in

the Anterior Cruciate Ligament (ACL) group. My future aspirations are to go into the field of orthodics,

designing hip and knee implants. In my free time I plan to travel to as many places in the world as I

possibly can.

I would like to thank Dr. Woo for the opportunity to work in MSRC as well as Dr. Loh and Dr.

Fukada for their encouragement and advice during my internship at MSRC.

Calculating the Accuracy and Repeatability of Reproducing the Rotational Center of the Tibia in Relation to the ACL

Kathleen E. Yoder, Yukihisa Fukuda, M.D., John C. Loh, M.D.

Musculoskeletal Research Center, Department of Orthopedic Research

University of Pittsburgh Medical Center

Keywords: pivot shift, anterior cruciate ligament, rotational center, tibial axis INTRODUCTION: The pivot shift phenomenon is characterized by an anterior subluxation of the lateral tibial plateau followed by a spontaneous reduction. Subluxation is the partial or incomplete dislocation of the joint. During the pivot shift subluxation, coupled anterior translation and internal rotation of the tibia with respect to the femur occurs. Our laboratory demonstrated, using joint motion description (JMD) [6], the kinematics changes of the intact and ACL-deficient knee in response to combined valgus-internal torque [3]. JMD is a method relating the 3 dimensional knee motions with the physiological terms consisting of 3 positions and 3 rotations. We defined the tibial axis as the y-axis, exhibiting internal-external rotation. The x-axis was defined as the flexion-extension axis, intersecting both femoral condyles. The z-axis was defined as the valgus-varus axis, the cross product of the x- and y-axes (Figure 1). Previous research utilized the proximal cross-sectional view of the tibia for describing the tibial motion and the rotational center of the tibial axis [1,2,4] during the pivot shift. Therefore, relating our JMD to the proximal cross-sectional view of the tibial motion was necessary. We developed a new method to utilize the JMD with the proximal cross-sectional view of the tibia to determine the rotational center of the tibial axis. The objective of this study was to determine the accuracy and repeatability of calculating the rotational center of the tibia for an intact and ACL-deficient knee.

Figure 1 - Image defining the physiological directions, axes and clinical center of the tibia. MATERIALS AND METHODS: We used 4 fresh-frozen human cadaveric knee specimens in this study. Four pins of known length were inserted into a common plane of the tibia, perpendicular to the y (tibial)-axis (Figure 2). Prior to testing, we determined the constant relationship between the tibial plate and the UFS, using a 3-D mechanical digitizer device (Microscribe, Inmersion Corp.). We attached the femur to the base cylinder then fixed the tibia through the tibial clamp to the tibial plate. The positions of all the pins and the clinical center (CC), which was fixed to the tibia throughout the test, were measured using the microscribe from three different locations. The CC was the location of the application of load as well as the reference position of the tibia relative to the femur. Using the constant relationship between the UFS and the tibial plate, the positions of the pins and the CC were transformed with respect to the UFS. The repeatability was determined to know the variability of each tibial pin position, with respect to the UFS.

After the path of passive flexion-extension was determined by the robotic/ UFS testing system in 5 degrees of freedom [5], 10 Nm of valgus torque was applied to the intact knee at each increment of flexion (0°, 15°, 30°, 45°, 60°, 90°), while recording the kinematics. After the ACL was transected, the previous force-moment sequence was repeated with the ACL-deficient knee and the kinematics recorded. The relationship between the tibial and the femoral coordinate system was determined, i.e. JMD. After the robotic test, the tibia was cut perpendicular to the tibial axis, as close to the articular surface as possible, leaving in the four pins. The proximal section of the tibia was then radiographed with a reference bar of known length. With the scanned image of the radiograph, the lengths of the reference bar and the four tibial pins were measured in an imaging program (Canvas 5, Deneba Systems Inc.). The real length of the reference bar and the length measured in Canvas resulted in the conversion factor (Figure 2). The accuracy was defined as the difference between the real and predicted length of the tibial pins. The sources of error were from the magnified tibial pins in the radiograph image, the microscribe itself, as well as the Canvas program itself. The relationship between each tibial pin position and the CC, defined by the UFS coordinate system, was used to determine the location of the CC on the image as well as both the x and the z axes (Figure 2). The new location of the center of rotation after flexion was measured with the JMD data in terms of the lateral-medial and anterior-posterior translations, then rotated about the internal-external axis. The rotational center of the tibial axis was determined from the intersection of the perpendicular bisectors of the before and after motion of the tibial pins (Figure 3).

Figure 2 - Image of a radiograph of a knee with the hand drawn reference lines, axes, and clinical center.

Figure 3 - Image of a radiograph of an ACL-deficient knee with necessary lines drawn for calculating a center of rotation at 90° of flexion. RESULTS: For the repeatability of the entire study: x was 0.25 ± 0.11 mm (mean ± SD), y was 0.10 ± 0.03 mm, and z was 0.14 ± 0.06 mm.

Repeatabilit y

0.00

0.10

0.20

0.30

0.40

0.50

1 2 3 4

Test Number s

Repe

atab

ility

(mm

) xy

z

Figure 4 – Repeatability of Tests 1-4. The standard deviation of each axial component for the vector between the UFS and the tibial pins. The accuracy for the entire study was 0.24 ± 0.19 mm.

Accurac y

0.00

0.10

0.20

0.30

0.40

0.50

0.60

2 3 4

Test Numbe r

Avg

Diff

eren

ce(m

m)

Figure 5 – Accuracy of Tests 2-4. Averages of the difference between the predicted length of the tibial pins and the real length. The rotational centers moved to the area of the MCL location after the ACL transection.

(A) (B) Figure 6 – (A) Test 3, intact rotational centers. (B) Test 3, ACL-deficient rotational centers DISCUSSION: The error for the microscribe was 0.1 mm for each axial component. The repeatability for each axial component of our study was less than 0.25 mm. Considering the average length of the vector between the UFS and the tibial pins was greater than 100 mm, the error was less than 0.25 percent. Our method was repeatable. Calculating the accuracy for Test 1 was not possible since we did not use a reference bar to determine the conversion factor. The accuracy of the method was limited by how the magnification size stretched the pixels of the image in Canvas. The accuracy of the biplanar photography ranged from 0.27 mm to 0.52 mm [4]. Our results were comparable.

Matsumoto showed, in response to a valgus torque, the rotational center of the tibia for the ACL-deficient knee was located at the medial collateral ligament (MCL) [4]. Future directions of this study are to apply different loading conditions and to relate the magnitude of the tibial torque to the pivot shift grading. REFERENCES: 1. Noyes FR, et al. An Analysis of the Pivot Shift Phenomenon. Am J Sports Med 1991;19(2):148-155. 2. Noyes FR, et al. The Diagnosis of Knee Motion Limits, Subluxations, and Ligament Injury. Am J Sports Med 1991;19(2):163-171. 3. Kanamori A, et al. The Forces of the ACL and Knee Kinematics During Simulated Pivot Shift Test. Arthroscopy Sept 2000;16(6):633-639. 4. Matsumoto H, Seedhom BB. Three-Dimensional Analysis of Knee Joint Movement with Biplanar Photography, with Special Reference to the Analysis of ‘Dynamic’ Knee Instabilities. Proc Instn Mech Engrs 1993;207:163-173. 5. Rudy TW, et al. A Combined Robotic/ Universal Force Sensor Approach to Determine In-Situ Forces of Knee Ligaments. J Biomechanics 1996;29(10): 1357-1360. 6. Grood ES, Suntay WJ. A Joint Coordinate System for the Clinical Description of Three-Dimensional Motions: Application to the Knee. J Biomech Eng 1983;105:136-144. ACKNOWLEDGEMENTS: Richard Debski, Ph.D. ACL Group Savio L-Y Woo, Ph.D., D.Sc. NIH Grant AR#39683

Summer 2001 – A Picture Anthology

Summer Students In the Lab.

Kevin stares down the robot.

Some John Jolly. Greg Frank, a.k.a. Mr. T.

Some Summer Students.

Greg, Brian, Nima, and Katie.

All work and no play makes the MSRC a dull lab.

Revenge of the Biohazard Waste.

James, after ACL reconstruction goes horribly wrong.

Nima’s Angels.

The Men of the MSRC. Eat your heart out, ladies.

Chaz and Brian. Kids on the

wall … chillin’.

Summer students in action at Dr. Woo’s picnic.

Free food at the 2001 Bioengineering summer picnic.

Brian and Brad.

Hangin’ with

Papa.

The gang celebrates at Dr. Woo’s

birthday bash ….

… and

celebrates…

… and

celebrates.

Brian raids the

fridge

Finally, from all the 2001 summer students at the MSRC, thanks for the great research experience. We had a great time and learned a lot!

(standing, left to right) : Jen Mercer, Brian Civic, Brad Stokan, James Chung. (seated, left to right) : Katie Yoder, Kevin Bell, John Jolly, Allison Westcott, Nima Salari, Greg Frank. (center) : Chaz Vukotich

Jen and Susan really enjoy their work.

Please Direct All Inquiries

to

Richard Debski, Ph.D. at genesis1@pitt.edu or

Patrick J. McMahon, M.D. at mcmahonp@msx.upmc.edu

Musculoskeletal Research Center Department of Orthopaedic Surgery

University of Pittsburgh 210 Lothrop St. – E1641 BST

P.O. Box 71199 Pittsburgh, PA 15213 www.pitt.edu/~msrc