M.Phil Thesis of Asma Sohail

GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS

AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN

A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF

MASTER OF PHILOSOPHY

IN

BIOTECHNOLOGY

By

ASMA SOHAIL

FEBRUARY - 2011

INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY

MULTAN, PAKISTAN

Page | ii

GLUTATHIONE-S-TRANSFERASES (GSTT1 & GSTM1) GENE DELETIONS

AND SUSCEPTIBILITY TO BREAST CANCER IN PAKISTAN

A THESIS SUBMITTED TO BAHAUDDIN ZAKARIYA UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMNT FOR THE DEGREE OF

MASTER OF PHILOSOPHY

IN

BIOTECHNOLOGY

By

ASMA SOHAIL

SESSION 2008-10

INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY

MULTAN, PAKISTAN

Page | iii

READ IN THE NAME OF ALLAH

Page | iv

Page | v

CERTIFICATE It is certified that the research work described in this thesis is the original work of ASMA

SOHAIL and has been carried out under my direct supervision. I have personally gone

through all the data reported in the manuscript and certify their correctness/authenticity. It

is further certified that the material included in this thesis have not been used in part or

full in a manuscript already submitted or in the process of submission in partial/complete

fulfillment of the award of any other degree from any other institution. It is also certified

that the thesis has been prepared under my supervision according to the prescribed format

and we endorse its evaluation for the award of M.Phil degree through the official

procedures of the University.

In accordance with the rules of the Institute, her data book is declared as unexpendable

document that will be kept in the registry of the Institute for a minimum of three years

from the date of the thesis defense examination.

SIGNATURE OF SUPERVISOR: _________________ NAME OF THE SUPERVISOR: PROF. DR. MUHAMMAD ALI

DIRECTOR, INSTITUTE OF BIOTECHNOLOGY BAHAUDDIN ZAKARIYA UNIVERSITY, MULTAN, PAKISTAN.

Page | vi

The Controller of Examination, Bahauddin Zakariya University, Multan. We the supervisory committee, certify that the contents and form of thesis submitted by

ASMA SOHAIL has been found satisfactory and recommend it for the award of degree of

M.Phil Biotechnology.

Supervisory Board

Supervisor ……………………… (Prof. Dr. Muhammad Ali) External Examiner ……………………… (……..........................) Director ……………………… (Prof. Dr. Muhammad Ali)

Page | vii

INDEX CERTIFICATE __________________________________________________________ v

SUPERVISORY BOARD ________________________________________________ vi

TABLE OF CONTENT __________________________________________________ vii

LIST OF TABLES ______________________________________________________ ix

LIST OF FIGURES ______________________________________________________ x

ACKNOWLEDGMENT __________________________________________________ xi

SUMMARY ___________________________________________________________ xii

INTRODUCTION ............................................................................................................... 1

OVERVIEW OF CANCER DISEASE ............................................................................... 3

Normal Cells & Tissues ....................................................................................................... 3

Control of Growth in Normal Tissues ................................................................................. 4

The Cell Cycle ..................................................................................................................... 5

The Process Of Tumor Growth & Carcinogenesis .............................................................. 6

CLASSIFICATION OF TUMORS ..................................................................................... 8

ETIOLOGY OF CANCER (CAUSES OF CANCERS) ..................................................... 8

Chemical Carcinogens ......................................................................................................... 9

Physical Carcinogens ........................................................................................................... 9

Biological Carcinogens ...................................................................................................... 10

Endogenous Processes ....................................................................................................... 10

EPIDEMIOLOGY & TYPES OF CANCERS .................................................................. 11

Leukemia & Lymphomas .................................................................................................. 13

Colon Cancer ..................................................................................................................... 13

Wilms Tumor (Nephroblastoma) ....................................................................................... 13

Cancers of Skin .................................................................................................................. 13

Bladder Cancer ................................................................................................................... 14

Renal Cell Carcinoma ........................................................................................................ 14

Liver Cancer ....................................................................................................................... 14

Stomach Cancer ................................................................................................................. 14

Prostate Cancer .................................................................................................................. 15

BREAST CANCER ........................................................................................................... 15

ETIOLOGY OF BREAST CANCER ................................................................................ 17

Factors Under Our control ................................................................................................. 17

Factors Which can’t Be controled ...................................................................................... 18

Page | viii

ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS .............................. 18

Tumor Suppressor Genes ................................................................................................... 19

Proto-Oncogenes ................................................................................................................ 20

DNA Repair Gene .............................................................................................................. 20

Carcinogen Metabolism Genes .......................................................................................... 21

CELL PROTECTION MECHANISMS IN CANCER ...................................................... 21

Enzyme Systems Involved in Detoxification ..................................................................... 21

Regulation of Detoxification Activities ............................................................................. 23

Induction ............................................................................................................................ 23

Inhibition ............................................................................................................................ 25

EFFECT OF POLYMORPHISMS .................................................................................... 25

GLUTATHIONE CONJUGATION .................................................................................. 26

GLUTATHIONE-S-TRANSFERASES ............................................................................ 26

GSTM (µ)........................................................................................................................... 28

GSTT (Θ) ........................................................................................................................... 28

GST GENOTYPES & CANCER RISK ............................................................................ 29

MATERIAL AND METHODS ......................................................................................... 31

FIELD WORK ................................................................................................................... 31

Institutional Review Board (IRB) ...................................................................................... 31

Enrolment Of Subjects ....................................................................................................... 31

Collection Of Blood Samples ............................................................................................ 31

BENCH WORK ................................................................................................................. 32

DNA Extraction ................................................................................................................. 32

Quantification Of DNA ...................................................................................................... 32

GSTT1/GSTM1 Multiplex PCR & Analysis ..................................................................... 32

STATISTICAL ANALYSIS ............................................................................................. 34

RESULTS .......................................................................................................................... 35

DISCUSSION .................................................................................................................... 41

REFERENCES .................................................................................................................. 45

Page | ix

LIST OF TABLES

Table 1: Types and Examples of Human Carcinogens ____________________________ 9

Table 2: Stages of Breast Cancer ___________________________________________ 16

Table 3: Tumor Suppressor Genes: Their Role and Chromosomal Location __________ 19

Table 4: Proto-Oncogene: Function and Chromosomal Location __________________ 20

Table 5: Functions and Chromosomal Location of DNA Repair Genes _____________ 20

Table 6: Carcinogen Metabolism Genes: Function and Chromosomal Location _______ 21

Table 7: Oligonucleotides Primers Used In Amplification ________________________ 33

Table 8: Ingredients For Multiplex PCR Reaction Mixture _______________________ 34

Table 9: Selected Characteristic for Case & Controls Individuals __________________ 37

Table 10: Cross Tabulation of GSTM1 & GSTT1 with Breast Cancer _______________ 38

Table 11: Cross Tabulation of GSTM1 & GSTT1 Combination with Breast Cancer ____ 39

Table 12: Cross Tabulation of Gene Combinations of GSTM1, GSTT1 & Menopause with

Breast Cancer __________________________________________________________ 40

Table 13: Cross Tabulation of Gene Combinations of GSTM1, GSTT1 & Pesticide

Exposure with Breast Cancer ______________________________________________ 44

Table 14: Comparative frequency distribution of GSTM1 and GSTT1 in various

populations ____________________________________________________________ 44

Page | x

LIST OF FIGURES Figure 1: A typical tissue showing epithelial and mesenchymal components __________ 4

Figure 2: Cell Cycle ______________________________________________________ 6

Figure 3: Checkpoints control the ability of the cell to progress through the cycle ______ 7

Figure 4: Tumor development showing progression from normal to invasive tumor ____ 7

Figure 5: World Wide Incidence and Mortality Rate of Most Frequent Cancers _______ 12

Figure 6: Liver Detoxification Pathways & Supportive Nutrients __________________ 22

Figure 7: Cytochrome P450 in Human Liver __________________________________ 23

Figure 8: Major Phase II Detoxification Activities in Humans ____________________ 24

Figure 9: Mono & Multi Functional Inducers __________________________________ 25

Figure 10: 3D Structure of Glutathione S-Transferase ___________________________ 27

Figure 11: The GSTM1 gene cluster ________________________________________ 28

Figure 12: The GSTT1 gene cluster _________________________________________ 29

Figure 13: Profile of Multiplex PCR ________________________________________ 33

Figure 14: Ethidium bromide-stained electrophoresed PCR products samples ________ 35

Figure 15: Graph representing frequency of different age groups among affected and

normal subjects _________________________________________________________ 39

Figure 16: Graph representing frequency of menopause in different age groups among

affected and normal subjects _______________________________________________ 39

Page | xi

ACKNOWLEDGEMENTS

In whatever state we are, whatever the consequences we facing, if we are true Muslims

thank Allah. Definitely it will have to be compulsory for us to thank ALLAH, who gave

us ability to explore the things in the universe .This is only the because of Allah’s

blessings that I successfully completed this project and PROPHET MUHAMMAD

(P.B.U.H) is the source of all kinds of knowledge to me.

I would like to express my acknowledgements to Prof. Dr. Muhammad Ali my

supervisor and Director, IBT, who helped me a great for the completion of this project. I

am very thankful to my supervisor for providing me all the facilities required and for

sympathetic and encouraging behavior.

I would like to express my deepest gratitude to my husband Dr. Rehan Sadiq Shaikh. It

is well known to me that the completion of this project was not possible in any way

without his continuous guideline, assistance and inspiration.

I also express my gratitude to my teachers Dr. Zahid Mahmood, Dr. Babar, Mr.

Shahzad Anjam who always encourage me and help me during lab work.

I am thankful to my all class fellows especially Ms Sobia, Ms Nazia, Ms Farah, Ms

Sadia, Mr Imran Maqsood for their assistance in the field work as well as in lab work.

I am also thankful to my lab fellows for their co-operation.

I am also thankful to all the staff members of IBT for their assistance.

At the end, I am also thankful to all the volunteers who participate in this study by giving

their blood samples.

Last but not the least I am also thankful to all my family members especially my parents

for their prayers and continuos support.

I DEDICATE THIS WORK TO MY LOVELY FAMILY, ESPECIALLY TO MY

BETTER HALF.

ASMA SOHAIL

Page | xii

SUMMARY

Breast, cervical and colorectal cancers are among the major health issues all over the

world. According to GLOBOCAN 2008 cancer fact sheet it was found that breast cancer

is the most common cancer found in the women. Epidemiological figures showed that

most of human cancers are mainly caused by environmental exposure to genotoxic agents.

Human body constitutes a special mechanism of detoxification against these carcinogens.

Glutathione-S-transferases (GSTs), is a group of important enzymes having the basic

function of detoxification of several known and assumed carcinogens, including probable

breast carcinogens. Research has shown that a substantial proportion of different

populations have shown a homozygous deletion (null) of the GSTM1 or GSTT1 gene,

resulting in the less production of these isoenzyme. Pakistan being the agricultural and

over populated country provides more chances of people to be exposed to the

environmental carcinogens and hence there are more chances of them to be effected by

diseases like cancer.

Studies have shown that GSTM1 and GSTT1 null genotypes are involved in breast cancer

so a case control study was conducted, constituting 204 controls and 100 patients of

different age groups. A questionnaire was filled having different information of the

patients and controls. DNA was collected from blood samples and analysis of the GSTT1

& GSTM1 was performed by using a standard multiplex PCR protocol with some changes

to describe the presence or absence of GSTT1 and GSTM1.

Results have shown that null genotypes of both the studied gene had no significant role

towards breast cancer in our population. Only significant results are obtained with relation

to menopause showing that women with menopause are more prone towards breast

cancer. Our study also provided the frequency distribution of GSTM1 and GSTT1 in

women of southern Punjab (45.7% and 25.98% respectively). This was the first study of

its type to be conducted in Pakistan.

Glutathione‐S‐Transferases Gene Deletion & Breast Cancer Risk

Page | 1

INTRODUCTION

Human are exposed to the risk of several diseases and due to which the incidence and

death rates are increasing rapidly. Attempts are being made to decrease the incidence of

diseases, to minimize the death rates, to enhance the awareness of the people regarding

the causes of these diseases and to suggest various types of treatments. With the help of

medical research we are able to cure many major diseases but cancer is still considered to

be one of the fatal diseases and has become a constant physical and mental agony to a

great part of our population. The oncologist, statisticians, and medical research workers

all of them are required for their combined effort in diagnosing and analyzing the etiology

of cancer and to apply the results for the better health of mankind.

Cancer is one of the leading causes of death in U.S. Breast, cervical and colorectal

cancers are major health issues in all over the world. According to GLOBOCAN 2008

Cancer Fact Sheet it was found that breast cancer is the most common cancer found in the

women. It is estimated that about 23% of all the cancer cases are of breast carcinoma and

with this figure it ranks second among all the types. Breast cancer is most prevailing

cancer in both the developing and developed regions of the world. Incidence rate fluctuate

from 19.3 per 100,000women in Eastern Africa to 89.9 per 100,000 in Western Europe. It

is high in developed regions of the world (except for Japan) and low (less than

40/100,000) in under developed regions.

As per data of Karachi and Armed Forces Institute of Pathology (AFIP) tumor

registries breast carcinoma is among one of the common type of cancer in women of

southern and northern Pakistan. 26% and 42% of all malignancies reported during the last

decade at AFIP tumor registry and Shaukat Khanum Memorial Cancer Hospital showed

to be breast cancer, respectively (Jamal et al. 2006; Bhurgri et al. 2002; Cancer Registry

and Data Management, Shaukat Cancer Hospital and Research Center).

Breast cancer can be cured if detected at its earliest stage (Dollinger et al. 1991) and

for early diagnosis and prevention from it, knowledge regarding its risk factors and

genomic profiling is necessary. Major risk factors are categorized as family history of

breast cancer, age, hormones (endogenous and exogenous), socio-demographics factors,

and diet, biological and environmental factors (Hulka et al. 1995). But the total

prevention from this disease is difficult because many associated factors are endogenous

and thus difficult to control.

Research and epidemiological data show that most of human cancers are mainly

caused by the exposure to environmental genotoxic and carcinogenic agents such as


Page | 2

polycyclic aromatic hydrocarbons (PAHs) found in tobacco, smoke, pesticide and urban

air etc. Moreover, incomplete burning of fuels such as gasoline, wood and diesel produce

PAHs which are known to form covalent adducts with DNA to cause permanent damage

leading to cancer (Guengerich 2003; Peluso et al. 2004; Tariq et al. 2007). Nature has

developed a cellular detoxifying system, comprised of Phase I and Phase II enzymes,

which protects the cells from DNA damage from various reactive substances. Phase I

enzymes (including cytochromeP450) are involved in the biotransformation of PAHs into

electrophilic intermediates, which are further detoxified by phase II enzymes, including

cytosolic glutathione S transferases (GSTs) (Guengerich 2000, Haydes & Pulford 1995).

Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective

enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents.

The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide range of

endogenous and exogenous chemicals having the electrophilic functional groups (e.g.

carcinogens, environmental pollutants and products of oxidative stress), they neutralize

their electrophilic sites, and make the products more water-soluble (Haydes & Pulford

1995). On the basis of the immunological cross reactivity and sequence homology, human

cytosolic GSTs have been categorized into eight gene families, with each family encoded

by a separate gene (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000).

Single nucleotide polymorphisms (SNPs) affecting genes function are commonly

observed but complete absence or deletion of a gene in form of a null allele is rarely

observed. That is why GSTM1 and GSTT1 null allele (-/-) genotypes have attracted much

consideration and over 500 publications on the subject have been published in recent

years. Moreover, considering the significance of GSTs in detoxification mechanism of

carcinogens, null genotypes of GSTM1 and GSTT1 are expected to weaken the ability to

eliminate carcinogenic compounds and may therefore placing individuals with GSTM1

and/or GSTT1 null alleles at higher cancer risk. Previously, studies have shown

relationship of GST genotypes with breast, lung, colon, brain, and various other types of

cancer in different populations (Rebbeck 1997; Dunning et al. 1999; Landi 2000, Strange

et al. 2000; Mohr et al. 2003; Bajpai et al. 2007; Hatagima et al. 2008).

Keeping in view the vital role of GSTM1 and GSTT1 in detoxification of carcinogens

and availability of no information on these null polymorphisms of GSTM1 and GSTT1 in

Pakistani population in relation to breast cancer, we intended to analyze the effect of

these null polymorphisms of GSTT1 and GSTM1 in our population. Further link between

GSTT1 and GSTM1 null alleles and breast carcinoma have been stated with contradictory

results. Therefore, in order to assess the influence of these GSTs genotypes in breast


Page | 3

carcinoma, we planned to conduct this study for the first in Pakistan. Since Pakistan is a

thickly populated agricultural country and Southern Punjab population is highly exposed

to pesticides, so analysis of these deletion polymorphisms in GSTM1 and GSTT1

detoxifying enzymes are crucial for us as lack of a helpful detoxification system might

prove to be a risk factor for breast carcinoma in our population.

OVERVIEW OF CANCER DISEASE The term cancer basically depicts disorder of cells and it usually appears as a tumor

made up of a mass of cells, the tumor is visible after many years due to the chain of

reactions that might have taken place for long.

Cancer has been known since human societies first recorded their activities. It was

well known to the ancient Egyptians and to succeeding civilizations but, as most cancers

develops in the latter decades of life, until the expectation of life began to increase from

the middle of the nineteenth century onwards, the number of people surviving to this age

was relatively small. Now as infectious diseases, the major causes of death in the past

have been controlled by improvements in public health and medical care, the proportion

of the population at risk of cancer has increased significantly. Although diseases of the

heart and blood vessels are still the main cause of death in our ageing population, cancer

is now a major problem. For this reason, cancer avoidance and control are major health

issues. History tells us that a German microscopist, Johannes Mueller, about 140 years

ago, found that cancers were made up of cells, a discovery which began the search for

changes which would help to identify the specific distinction between cancer and normal

cells. In the intervening period a huge amount of information has been acquired about the

cancer cells. Particularly in the past two decades, rapid scientific progress has allowed us

to begin to dissect the cancer genome, transcriptome, and proteome in unparalleled detail

and today there seems no limit to the amount of information that can be achieved.

NORMAL CELLS & TISSUES The human body is comprised of four different main types of tissues:

1. The general supporting tissues jointly known as Mesenchyme.

2. The tissue-specific cells called as Epithelium.

3. The defense cells called as the Haemato-lymphoid system.

4. The Nervous system.

The mesenchyme comprised of connective tissue (fibroblasts) which make collagen

fibers and associated proteins, bone, cartilage, muscle, blood vessels, and lymphatics. The

epithelial cells are the specific, specialized cells of the different organs, for example, liver

glands skin, intestine, etc. The haemato-lymphoid system contains a wide group of cells,

mostly derived from precursor cells in the bone marrow giving rise to all the red and


Page | 4

white blood cells. The nervous system is comprised of the central nervous system (spinal

cord and the brain) and the peripheral nervous system, which is comprised of nerves

leading from these central structures.

Thus, each tissue has its own specific cells, usually several different types, which

maintain the structure and function of the individual tissue. The specific cells are grouped

in organs which have a typical pattern (Fig: 1). There is a layer of epithelium, the tissue-

specific cells, separated from the supporting mesenchyme by a semi-permeable basement

membrane. The supporting tissues (or stroma) are made up of connective tissue (collagen

fibers) and fibroblasts (which make collagen), which may be supported on a layer of

muscle and/or bone depending on the organ. Blood vessels, nerves and lymphatic vessels

go through the connective tissue and provide nutrients and nervous control among other

things for the specific tissue cells.

Figure 1: A typical tissue showing epithelial and mesenchymal components. (Adopted from: Introduction to the cellular and molecular biology of cancer)

CONTROL OF GROWTH IN NORMAL TISSUES One of the most intensively studied areas in biology is the research on mechanism of

control of cell growth and proliferation. It is important to make the distinction between

the terms ‘growth’ and ‘proliferation’.

Growth refers to an increase in size of a cell, organ, tissue, or tumor and by means of

cell division the increase in number of cells is called proliferation. ‘Growth’ is frequently

used as a loose term for both of these processes but the difference is particularly

important now that factors controlling both of these processes are becoming obvious.

In normal development and growth there is a very defined mechanism that allows

individual organs to reach a particular size, which for all practical purposes, is never

exceeded. The surviving cells in most organs begin to divide to replace the damaged ones

if the tissue gets injured. When normal position is achieved, the process stops, this is the

normal control mechanism that persists throughout life. Although most cells in the


Page | 5

embryo can proliferate, but not all of the adult cells preserve this ability. In most organs

there are special stem cells, which have the ability to divide in response to a stimulus such

as an injury to replace organ-specific cells. The highly differentiated cells like that of

muscle or nerve cells are more likely to have lost their ability to divide. In some organs,

particularly the brain, the nerve cells (highly differentiated), can only proliferate in the

embryo; while the special supporting cells in the brain continue to be able to proliferate.

That is why tumors of nerve cells are only found in the very young and tumors of the

brain in adults are derived from the supporting cell

Control of organ or tissue size is achieved by means of a fine balance between

stimulatory and inhibitory stimuli. When the tissue is damaged and repair is needed, that

is when the balance is shifted and a specific physiological stimulus is applied (for

example, hormonal stimulation), the component cells may respond in one of two ways to

attain these objectives. Either by hypertrophy, that is, an increase in size of individual

components, usually of cells which do not normally divide (example is the increase in

size of particular muscles in athletes) or by hyperplasia, that is, an increase in number of

the cells. When the stimulus is removed, commonly the situation returns to the status quo

as shown by the rapid loss of muscle mass in the lapsed athlete. Some of the stimuli

resulting in these compensatory responses are well-known growth factors and hormones.

THE CELL CYCLE All somatic cells increase in numbers in the same way which involves the growth of

all cell components (increase in cell mass) followed by division to generate two daughter

cells. The cell cycle is comprised of all the structural changes that take place during this

process have been known for many years. Four stages are recognized: G1, S, G2, and M

(Fig: 2).

G1 is a gap or pause after proliferative stimulation where little action occurs.

However, if the cell is defined to divide, there is much biochemical activity in G1 for

DNA replication (preparation). The second phase S is of DNA synthesis, which is meant

for chromosomes replication and increase. G2 is a second gap period following DNA

synthesis and thirdly M is the stage of mitosis leading to the breakdown of nuclear

membrane and as a result the condensed chromosomes can be visualized as they pair and

divide prior to division of the cytoplasm to produce two daughter cells. The last cell cycle

phase is recognized, G0, which is a resting phase in which non-cycling cells rest with a

G1 DNA content.


Page | 6

Figure 2: Cell Cycle

Progression through the cell cycle is now known to be restricted at specific

checkpoints, one in G1 and others in S and G2/M (Fig: 3). These provide a chance for

cells to be diverted out of the cycle or to programmed cell death (apoptosis) if, for

example, there is DNA damage or inappropriate expression of oncogenic proteins. In

many of the cancers interruption of these cell cycle checkpoints or alterations to key cell

cycle proteins are found.

THE PROCESS OF TUMOR GROWTH & CARCINOGENESIS Carcinogenesis is a multistage process. In animals, the exposure to the carcinogen

(cancer-producing agent) does not lead to the immediate production of a tumor. Cancers

arise after a long latent period and after the multiple carcinogen effects. At least three

major stages are involved:

1: The first stage known as initiation, involves mutagenic effects of the carcinogen on

skin stem cells.

2: The second stage called promotion is stimulated by type of agents that are not

directly carcinogenic in their own right.


Page | 7

3: Finally in the third stage, progression, some of these benign tumors either

spontaneously or following additional treatment with carcinogens, progress to malignant

tumors.

Ample time is required between the initiation and appearance of tumor. In man, it may

take over 20 years before tumors develop after exposure to industrial carcinogens. Even

in animals it may take up to a quarter or more of the total lifespan before tumors appear.

In the tumor that finally observed, most of the genetic and epigenetic changes seen are

clonal, that is they are present in the entire population of cells (Fig: 4).

Figure 3: Checkpoints control the ability of the cell to progress through the cycle by determining whether earlier stages have been completed successfully A horizontal red bar indicates the stage at which a checkpoint blocks the cycle.(Adopted from : Genes viii)

Figure 4: Tumor development showing progression from normal to invasive tumor via accumulation of heritable changes over a long period of time. The rate of acquisition of these changes will be influenced by environmental exposures and host response (Adopted from: Introduction to the cellular and molecular biology of cancer).


Page | 8

CLASSIFICATION OF TUMORS The term tumor cannot be defined in absolute terms. Tumors have the quality that

these cells in contrast to the normal cells lack the response to normal control mechanism

and hence they show abnormal proliferation. As different factors are concerned with

tumor formation, but the abnormal cells may respond to some but not to others. Another

complication is that after transforming from normal cells, some of the tumor cells stop

their division.

So tumors can be classified into three main groups:

1: Benign Tumors which can arise in any tissue and grow locally. Damage is caused

by exerting local pressure or obstruction. They have the common character that they don’t

spread to distant areas.

2: In Situ Tumors, they are usually but not always small in size. They develop in

epithelium. Morphologically they resemble cancer cells but they remain in epithelium and

do not invade the basement membrane and mesenchyma.

3: Malignant Tumors, they are fully developed cancer and have specific capacity to

attack and destroy the underlying mesenchyma layer. These cells produce a range of

proteins via the nutrients obtained from blood stream, which stimulate the growth of

blood vessels into the tumor thus allowing the continuous growth. The new vessels are

not well developed and are easily injured so the invading tumor cells may penetrate these

and lymphatic vessels. Tumor fragments may be carried in the newly developed vessels to

local lymph nodes or to distant organs where they may grow into secondary tumors.

Cancers may arise in any tissue. Although benign tumors can develop into malignant,

this is far from invariable. Many benign tumors never become malignant. In order to

understand the confusion regarding these definitions we should have the knowledge of the

whole process of tumor induction and development.

ETIOLOGY OF CANCER (CAUSES OF CANCERS) The genetic makeup of mankind barely changes in hundred years and differs

somewhat due to geographical locations between human populations. Environmental

effects and geographical deviation are responsible for the changes in the individual

cancers incidences over time. Mainly Cancers are caused by are chemical, physical,

biological (exogenous) carcinogens and endogenous processes (Table 1). They act on

every human but due to diversity in human’s genetic makeup; differ in their ability to

show their results. Secondly because of the social, economic and psychological

conditions, different trends are shown by the human towards the exposure to carcinogens.


Page | 9

TABLE 1: TYPES AND EXAMPLES OF HUMAN CARCINOGENS

CHEMICAL CARCINOGENS Human chemical carcinogenesis is a multistage process that results from exposures,

usually in the form of complex chemical mixtures, often encountered in the environment

or through our lifestyle and diet ( Poirier et al. 2000) Tobacco smoke is the major

example, which causes cancers of the head, neck, lung, and bladder (Peto et al. 2000;

Vineis et al. 2001). Most chemical carcinogens do not respond readily to nucleophilic

biochemicals, but metabolic processes activate them to carcinogenic and mutagenic

electrophiles. Electrophilic chemical species have natural attraction towards nucleophiles

like DNA and protein, and they covalently get bonded to deoxyribonucleic acid (DNA) as

a result genetic damage occurs. Once carcinogens become the part of the body they are

subject to challenge the processes of metabolic activation and detoxification, although

some chemical species can act directly. Variation among the human population in these

metabolic processes, as well as the capacity for repair of DNA damage and cellular

growth control results in inter individual distinction in cancer risk, and is an indication of

gene-environment interactions, which embodies the concept the effects of chemical

carcinogen exposure is modified due to genetic constitution of individuals (Shields &

Harris 2000). For example, among the tobacco smokers only 10% develop lung cancer.

PHYSICAL CARCINOGENS Energy-rich radiation having different dose and absorption rate, can work like a

carcinogen. On the other hand visible light is can't behave carcinogenic, except if

absorbed by photosensitizing agents, producing reactive oxygen species. Generally,

physical carcinogens constitute: mechanical traumas, electromagnetic radiations of

different kinds, low and high temperatures, alpha and beta radiations, solid and gel

materials, hard and soft materials, fibrous & non fibrous particles. Physical carcinogens

mainly produce effects not because of their chemical properties and actions, rather due to

their physical properties and effects. It was found for the first time scientifically by


Page | 10

Turner that when Bakelite disks were set in rats, they motivated local fibro sarcomas

(Turner 1942).

UVA increases the effect of UVB irradiation which is a main carcinogen in the skin.

Radiation from industrial, natural, and iatrogenic sources like that of used in X-ray

diagnostics penetrates into the body. Its carcinogenicity depends on the amount absorbed,

which damages the DNA and cells either directly or by producing reactive oxygen species

The amount of radioactive isotopes distributed in the body, determines its effect on

that body. For example, radioactive iodine causes only thyroid cancers because it is

accumulated in the thyroid gland, while radioactive cesium isotopes deposit mostly the

urinary bladder. The probable carcinogenicity caused by microwave and radio

wavelength electromagnetic radiation of course is debatable.

BIOLOGICAL CARCINOGENS Certain viruses and bacteria's are the main biological carcinogens in human. HPV16

and HPV18 are the particular strains of human papilloma viruses which are recognized as

the cause of cervical and other genital cancers. Moreover they also manipulate the cancers

of the head, neck and the skin. Epstein-Barr virus in lymphomas and Human herpes virus

8 in Kaposi sarcoma behave as carcinogens (Kieff & Rickinson 2001).

The viral etiology of infectious hepatitis had been recognized as early as 1885. The

hepatitis B virus and hepatitis C virus with their DNA and RNA genome, respectively, are

certainly concerned with the cause of liver cancer. HIV the human retrovirus assists the

growth of cancers most of the time by hindering the immune system, but on the other

hand human T-cell leukemia virus (HTLV1) is the basis of a rare leukemia and it shows

the effect by T cells' direct growth stimulation.

ENDOGENOUS PROCESSES Endogenous processes can also be the main cause of cancers. Carcinogenic

compounds such as aromatic amines, nitrosamines, reactive aldehydes and oxygen

species and quinones are generated by normal metabolism. Factors like diet or physical

activity vary the amount of these potential carcinogens. Several mechanisms like potent

protective and detoxification are working for many of these compounds but not perfectly.

The risk of cancer growth can be increased by some patho physiological conditions. In

particular chronic inflammation in many organs like stomach and colon might be linked

with increased risk of cancer. Numerous factors that favor the spread and growth of

tumors include secretion of cytokines, growth factors and proteases by different cell types

and raised production of reactive oxygen species (mutated) by inflammatory cells. So,

regeneration of tissues is generally linked with an elevated risk of cancer. Few of the


Page | 11

carcinogens are supposed to act basically by provoking tissue growth and without being

mutagenic, rebuild themselves.

So we can conclude that both exogenous and endogenous factors are responsible for

the development of human tumors. In most of the cancers, their interaction is so

complicated that it is difficult to distinguish their contributions. Study of mutations can be

helpful in diagnosing the part played by some of the carcinogens. It is estimated that 5%

of all human cancers are because of occupational carcinogens.

EPIDEMIOLOGY & TYPES OF CANCERS Cancer is one of the basic threats to people's health and life, resulting in 13% of all

disease-causing deaths in the world (WHO Data & Statistics 2006). In 2007 about 7.6

million people expired of cancer in the world and over 1.4 million new cancer cases each

year were accounted in U.S in past years, hence it is reported to be the second leading

fatal disease after cardio vascular diseases.

According to the records of GLOBOCAN 2008 it was suggested that higher ratio of

cancer occurs in under developed regions, both in terms of cancer mortality (63% of

cancer casualties) and cancer incidence (56% of new cancer cases diagnosed in low

developed areas in 2008)

The majority of the prevailing cancers worldwide are lung (12.7% of the total), breast

(10.9% of total) and colorectal cancers (9.7% of total). The most fatal cancers are lung

(18.2% of the total), stomach (9.7% of total) and liver cancers (9.2% of total).

Remarkable differences in the prototype of cancer from area to area are found, like liver

and cervix are frequent in under developed regions of the world, on the other hand

prostate and colorectal cancers are more reported in developed areas.

Cancers can be categorized into three large groups. Those originating from epithelia

are known as carcinomas. These are among the widespread cancers overall (Fig: 5). Four

carcinomas are worth mentioning with reference to their occurrence as well as mortality

i.e. cancers of the lung and the large intestine (both genders), breast cancer in females and

prostate cancer in males. Second category of cancers is not as widespread as the above

mentioned cancers it includes carcinomas of the stomach, bladder, liver, pancreas, kidney,

ovary, cervix and esophagus. They contribute to the less percent of total mortality and

incidence of cancers. The most widespread cancers are of the skin. Only melanoma is

fatal among them. The third group is of rare cancers including tumors of brain, soft

tissues, bone, testes and other organs. They can direct to a noteworthy disease in specific

regions and age groups. Example is that of testicular cancer which affects the young adult

males having a rate of >1% in Switzerland


Page | 12

Here are some main types of cancer which lead to overall cancer mortality each year:

Figure 5: World Wide Incidence and Mortality Rate of Most Frequent Cancers among Both Sexes


Page | 13

LEUKEMIA & LYMPHOMAS These cancers are termed as hematological cancers because they arise from

hematopoetic lineage cells. Leukemias initiate from hematopoetic stem cells and spread

in the whole body. On the other hand Lymphomas arise from lymphoid cells in lymphoid

system and observed as localized cell masses. Hematological cancers can be categorized

according to their origin either from erythroid, myeloid, or lymphoid cells or they can be

only evident genetic aberration (comprising of chromosome gains and losses, but

distinctly translocations).

COLON CANCER Carcinomas of the rectum and colon are most common cancers in Western

industrialized countries. They are one of the lethal cancers and major health problem to

the population. Life style factors play an important role in the cause of the disease.

Dietary factors are one of the main reasons of disease. The cancer development ranges

from hyperplasia, benign adenomas and locally invasive carcinoma to systemic metastatic

disease. Colon cancer also spreads as a result of the chronic inflammatory bowel diseases

like that of ulcerative colitis.

WILMS TUMOR (NEPHROBLASTOMA) Wilms' tumor is also known as nephroblastoma. It is the most common kidney tumor

in children and is linked to various syndromes and hereditary anomalies. A lot of research

done in molecular biology and genetics has helped to increase our knowledge about this

disease, and side by side paving the way to discover the genes playing critical role in

cancerous process. Genetically the disease is heterogeneous and occurs rarely in 1:10,000

children, but it occurs more in patients with syndromes disturbing genitourinary tract

development such as the WAGR, Denys-Drash, and Beckwith- Wiedemann syndromes.

CANCERS OF SKIN The skin being the largest organ is the most common site for cancers development in

humans. Fair-skinned individuals are at about 40% of more risk to develop skin cancer.

Epidermis of the skin is an actively proliferating tissue due to which apoptosis-like event

are often found, as seen in the falling off of hair follicles (Sieberg et al. 1995; Lindner et

al. 1997) and in terminal differentiation (McCall & Cohen 1991; Haake & Polakowska

1993; Polakowska et al. 1994). When the epidermis is exposed to UVB, sun burn cells are

frequently observed. They have apoptotic quality of condensed nuclei (Young 1987;

Schwarz et al. 1995). When the body fails to repair this DNA damage, or fails to remove

the damaged cells by apoptosis, toxic mutations are replicated as a consequence and it

may lead to skin carcinogenesis (Griffiths et al. 1998). Other factors involved are genetic

disposition, immune response and viral infections such as HPV (Proby et al. 1996). Types


Page | 14

of the skin cancers are squamous cell carcinoma, basal cell carcinoma (both are rarely life

threatening and common) and melanoma which is rare but increasing alarmingly.

BLADDER CANCER Another name for bladder cancer is urothelial cancer. Factors often involved are

chemical carcinogens (mainly aromatic amines). Genetic polymorphisms in carcinogen

metabolism genes alter risk of bladder cancer depending on exposure, while no high-risk

is evaluated showing it heritable predisposition. Urothelial cancers grow successively at

different sites. Important factors involved are true oligoclonality, spreading through urine

and migration of cancer cells within the epithelium.

RENAL CELL CARCINOMA Renal cell cancer (RCC) consists of highly heterogeneous epithelial tumors both

clinically and morphologically. They have the same origin of the renal tubule, having

similar antigenic phenotype, but they differ in genetic mutations. A number of factors are

reported and associated with elevated risk for example cellular, genetic, dietary, hormonal

and environmental factors while etiology of RCC is still not known. It is the most

widespread malignant tumor of the kidney, representing 85% all primary renal neoplasm

in elders. RCC is diagnosed more in males than in females and rarely it occurs in

adolescents and children. Geographical or ethnic preference is not observed (Muphy et al.

1994; Motzer et al. 1996).

LIVER CANCER Liver cancer is one of the major fatal malignancies all over the world. Hepatocellular

carcinoma is its subtype which is derived from hepatocytes which are the predominant

epithelial type of cells in the liver. It is due to the chronic inflammation and liver cirrhosis

caused by the hepatitis viruses HCV or HBV, by chronic alcohol use, or rarely by

hereditary diseases like hemochromatosis. Chemical carcinogens like aflatoxin B1

obtained from the mold Aspergillus flavus which activate the causes of inflammation, in

particular with chronic HBV infection is also one of the factors.

STOMACH CANCER Stomach cancer due to its low healing tendency and severe effect on quality of life,

causes a serious health problem. For several decades its incidence is decreasing in many

industrialized states fortunately. Altered diet, improved hygiene and extensive use of

antibiotics reducing the prevalence of Helicobacter pylori infection are responsible for the

reduction of this dilemma. Most of the cases of stomach cancer are associated with

Helicobacter Pylori infection. About 50% of the world population hold strains of the

bacterium, but <10% grow inflammatory disease and ulcers, and even fewer stomach

cancer.


Page | 15

PROSTATE CANCER Prostate cancer is clinically noteworthy in about 10% of males in Western countries. It

is age related, rare in younger males, and its incidence increases with age. Clinically it

varies from minor tumors growing slowly for many years to chronic cancers spreading

locally and effecting the bones and organs leading to the death in few years. Androgens

and the androgen receptor (AR) have represented as major tool for treatment purposes.

Prostate cancers when treated with androgen receptor and depletion respond well. Genes

involved in ancestral prostate cancer are not same as classical tumor suppressors. Risk of

the prostate cancer is altered by the polymorphisms of the genes which are involved in

nucleotide metabolism, to hormone metabolism and action and cell protection.

BREAST CANCER

Breast cancer is one of the frequent ailment in women of developed and under

developed countries and it deals with the malignant tumor developed from cells in the

breast (Parkin et al. 2005). Besides being fatal disease, it affects the women’s quality of

life and society at large with reference to economic burden, such as premature death and

reduced productivity. The usual 5-year rate of survival for breast cancer in developing

and developed countries is 57% and 73% respectively (IARC Handbook on Cancer

Prevention). As a result of better techniques and awareness regarding the diagnosis and

treatment, in developed countries the breast cancer (age adjusted) death rate has declined

and unluckily due to lack of public and professional knowledge, attitudes and practice, it

is higher in under developed countries (Wilson et al. 2004).

Studies have shown that most cases are found in postmenopausal women, but a large

number of younger women are also seen affected, mostly in families having hereditary

tendency. The risk of breast cancer is about 10% for females, and almost 30% of all the

cases prove to be fatal. When talking about the Western countries, 50 yrs is the mean age

at menopause, all women between 45 and 55 have to face menopause. In women between

40-60 years of age, breast cancer is the common fatal disease. Its incidence rate is rising

in many countries.

Incidence rate of breast cancer ranges from 19.3/100,000 females belonging to Eastern

Africa to 89.9/100,000 in Western Europe and except for Japan its high in other

developed areas and its rate is low in less developed areas about 40/100,000 women. Due

to the survival of breast cancer patients in developed regions because of early diagnosis

and public awareness, the range of mortality rates is much less (Fig: 5).

Among the Asian populations, Pakistan has the highest rate of breast cancer

accounting to 40,000 deaths per year. It is estimated that 1 in 9 of Pakistani women will


Page | 16

suffer from this disease at age in their lives. In Pakistan due to the lack of awareness most

of the times the cases are reported at a very complex stage (Sadiqui 2006). If breast

cancer is diagnosed at early stage than the chances of survival of patient are almost 90%.

Its incidence has been increasing alarmingly, due to the area, community, socio-economic

conditions, life-style, hereditary factors, especially eating habits. In Pakistan the peak age

range of breast cancer onset is between 35- 50 years, about 10 years earlier than in

Western populations. 20% of all breast cancer cases are diagnosed in women less than 40

years of age in Pakistan (Bhurgri et al. 2007). Hence it is important to screen the young

women for breast as a prime need of time. The studies reported that Asian women are

highly at risk to breast cancer, and therefore the genetic constitution that may influence

young Pakistanis women towards breast cancer needs to be explored

The types of breast cancer include invasive ductal carcinoma (IDC), ductal carcinoma

in situ (DCIS), invasive lobular carcinoma (ILC), male breast cancer, inflammatory breast

cancer, metastatic breast cancer, recurrent breast cancer, and more. Generally breast

cancer either initiates in the lobular cells, which are the milk-producing glands, or the

passages that drain milk from the lobules to the nipple. Rarely it can initiate in the stromal

tissues, including the fatty and fibrous connective tissues of the breast. As the time

passes, cancer cells attack healthy breast tissue making their way into the underarm

lymph nodes. Once they enter the lymph nodes, then they can extend into other parts of

the body.

The stages of breast cancer refer to how far the cancer cells have spread beyond the

original tumor (Table 2).

TABLE 2: STAGES OF BREAST CANCER

STAGE DEFINITION

STAGE 0 Cancer cells remain within the breast duct, it is not spread to normal adjacent breast tissue.

STAGE I Cancer is 2 cm or less and is restricted to the breast (lymph nodes are not affected).

STAGE IIA Cancer cells are diagnosed in axillary lymph nodes (under arm), tumor is not found in breast. OR the tumor size is less than or equal to 2cm and has spread to the axillary lymph nodes. OR the tumor size is 2-5cm and has not spread to the axillary lymph nodes.

STAGE IIB The tumor is 2-5cm big and has spread to the axillary lymph nodes. OR the tumor size is greater than 5 centimeters but has not spread to the axillary lymph nodes.

STAGE IIIA No tumor is found in the breast. Cancer is found in axillary lymph nodes that are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone. OR the tumor is any size. Cancer has spread to the axillary lymph nodes, which are sticking together or to other structures, or cancer may be found in lymph nodes near the breastbone.


Page | 17

STAGE IIIB The tumor may be any size and has spread to the chest wall and/or skin of the breast. AND may have spread to axillary lymph nodes that are clumped together or sticking to other structures or cancer may have spread to lymph nodes near the breastbone. Inflammatory breast cancer is considered at least stage IIIB.

STAGE IIIC There may either be no sign of cancer in the breast or a tumor may be any size and may have spread to the chest wall and/or the skin of the breast. AND the cancer has spread to lymph nodes either above or below the collarbone. AND the cancer may have spread to axillary lymph nodes or to lymph nodes near the breastbone.

STAGE IV The cancer has spread — or metastasized — to other parts of the body. ETIOLOGY OF BREAST CANCER

A “risk factor” is anything that increases your risk of developing breast cancer. Many

of the most important risk factors for breast cancer are beyond your control, such as age,

family history, and medical history. However, there are some risk factors you can control,

such as weight, physical activity, and alcohol consumption.

FACTORS UNDER OUR CONTROL Weight: Increased weight is linked with elevated risk of breast cancer especially on

post menopausal women. The ovaries discontinue the production of estrogen hormone

after menopause, so the fatty tissues are the only source of that hormone. Increased

deposition of fatty tissues means higher level of estrogen and hence increased risk of

breast cancer.

Diet: Although diet is known to be involved in several cancer types including breast

cancer, but still research has not proved the type of the risky food involved in the

occurrence of cancer. We should control the usage of red meat, animal fats including

dairy fats in milk, ice cream and cheese, as they may have certain hormones or other

growth factors which influence cancer. Some studies have reported that increased

consumption of cholesterol and other fats have proved to be the risk factors for cancer,

while few researchers have shown that too much use of red/processed meats is linked

with elevated breast cancer risk.

Exercise: It has been proven that exercise can play a vital role in reducing the risk of

breast cancer. The American Cancer Society recommends that one should engage

him/herself in 45-60 minutes of physical exercise for at least 5 or more days a week.

Alcohol Consumption: It has been reported in studies that alcohol consumption is

associated with increased breast cancer risk in women. As alcohol has the ability to

Alcohol can limit your liver’s ability to control blood levels of the hormone estrogen,

which in turn can increase risk.


Page | 18

Smoking: Few studies have shown the association of smoking with the increased

breast cancer risk.

Exposure to Estrogen and Oral Contraceptives: Breast cell growth is stimulated by

the estrogen hormone; more exposure to estrogen for long periods increases the risk of

having breast cancer. When oral contraceptives are used by the women the risk is slightly

increased but if she has stopped taking the pills for more than 10 years the risk is almost

diminished.

FACTORS WHICH CAN’T BE CONTROLED Gender: Among the most significant risk factors linked with breast cancer is being a

female. Though we can also find a minute ratio of breast cancer in males also but due to

the activity of estrogen and progesterone hormones in women, the breast cell are under

constant change, this leads them towards the higher risk of having the breast carcinoma.

Age: Aging is another uncontrollable risk factor for mammary tumor. The risk is

0.43% in the age ranging between 30-39 years, while it increases to almost 4% when the

age reaches 60.

Family History of Breast Cancer: A woman is at higher risk of breast cancer if she

has a first degree relative (mother, daughter, sister) or multiple relatives suffering from

either breast or ovarian cancer.

Race: Fair women are slightly more likely to develop breast cancer than are African

American women. Hispanic, Native American and Asian women have a lower risk of

developing and dying from breast cancer.

Radiation Therapy: If someone has exposed to radiations especially to the chest area

as a child or adolescent, is more prone towards breast cancer. The risk increases when the

developing breasts are exposed to radiations for any other treatment.

Pregnancy and Breast Feeding: Breast feeding and pregnancy is known to be

negatively associated with breast carcinoma risk. Women getting pregnant after 30 years

of age or never having any pregnancy are at higher risk for breast cancer. Breast feeding

for 1.5-2years lowers the chances of getting breast cancer.

ROLE OF DIFFERENT GENES IN BREAST CARCINOGENESIS A cycle of genetic mutational actions that begin in a single cell are supposed to be

responsible for the development of breast cancer. Initially the number of normal cell is

increased by increased cell proliferation, then it is followed by additional mutations

which allow development of hyperplasia, dysplasia, carcinoma and ultimately, metastatic

disease. It is anticipated that 5–10% of all mammary tumor cases are inherited, and the

possibly associated genes i.e. BRCA1 and BRCA2 are responsible for about 21-40% of the

cases. Rests of the cases are sporadic and among them 70% of breast tumors are PR, ER


Page | 19

and/or HER /neu positive. Genetic composition of every individual is responsible for the

wide variation in behavior and growth of cancer cells.

The genes involved in the breast carcinogenesis can be divided into four classes. These

are: (1) DNA repair genes (2) carcinogen metabolism genes (3) tumor suppressor genes

and (4) Proto-oncogenes

TUMOR SUPPRESSOR GENES Tumor Suppressor Genes are highly diverse and categorized as gate keepers because

they directly regulate the cell growth (RB1) or can be called as care takers as they are

responsible for the repair of DNA damage and maintenance of cell integrity (BRCA1/2).

When both alleles of the gene loss their function, the risk of cancer is increased. Breast

cancer is basically due to the genetic changes of normal cells which include either the loss

of heterzygosity or the point mutations. On the other hand not only the mutations but the

mechanisms such as methylation also interfere with the normal functioning of cell.

Mechanism of methylation is supposed to be the first step in carcinogenesis process

resulting in the silencing and activation of tumor suppressor genes and oncogenes

respectively and promoting the growth of abnormal cells.

Inherited genetic mutations of tumor suppressor genes involved in most common

hereditary cancer syndromes which are also associated in breast cancer are described in

the Table 3.

TABLE 3: TUMOR SUPPRESSOR GENES: THEIR ROLE AND CHROMOSOMAL LOCATION


Page | 20

PROTO-ONCOGENES Proto-oncogenes basically promote cell division. Any genetic modification in them

can cause the proliferation of cells resulting in the growth of tumor. These mutant forms

of proto-oncogenes are known as oncogenes which are responsible for the induced or

continued uncontrolled cell division. Some of these genes are given in Table 4.

DNA REPAIR GENE The process by which a cell identifies and corrects damage to the DNA molecules is

referred to as DNA repair. Deficient function of DNA repair enzymes as a result of the

polymorphism of the DNA repair genes has been inconsistently associated with the risk

of familial breast cancer. Some the genes involved in DNA repair are listed in the Table

5.

TABLE 4: PROTO-ONCOGENE: FUNCTION AND CHROMOSOMAL LOCATION

TABLE 5: FUNCTIONS AND CHROMOSOMAL LOCATION OF DNA REPAIR GENES.


Page | 21

CARCINOGEN METABOLISM GENES

These are of two types, firstly that who activate the carcinogens efficiently and gets

them into the cell like that of genes of phase I enzymes and secondly the ones which are

involved in the detoxification of carcinogens such as the genes for phase II enzymes some

of them are described in Table 6.

CELL PROTECTION MECHANISMS IN CANCER Specific cellular protections mechanisms (complex system of detoxification enzymes)

are involved in preventing the DNA from encountering the exogenous carcinogens

(xenobiotics) and potential mutagens arising from endogenous processes. These highly

diverse mechanisms serve as a further stage of cancer avoidance in addition to DNA

repair and apoptosis. They not only protect DNA, but cells in general from damage.

When talking about cancer, they are particularly important during carcinogenesis and

cancer therapy. This system is very complex showing variability in different individuals

and is extremely responsive to the individual's lifestyle, environment and the genetic

makeup. Detoxification is a chain of reactions involving methylation, conjugation and

sulfonation.

TABLE 6: CARCINOGEN METABOLISM GENES: FUNCTION AND CHROMOSOMAL LOCATION

ENZYME SYSTEMS INVOLVED IN DETOXIFICATION A set of enzymes is being used by the body having broad specificity to meet the

challenge of detoxification. At present, about 10 families of Phase I enzymes have been


Page | 22

discovered including at least 35 different genes. Phase II reactions also involve multiple

gene families and are equally difficult to understand (Fig: 6).

The Phase I Detoxification System: Cytochrome P450 supergene family of enzymes

is the basic member of this system, and the first enzymatic defense against foreign

compounds. Most of the medications and carcinogens are metabolized by the process of

Phase I biotransformation. Oxygen and NADH is being used as a cofactor by cytochrome

P450 in a typical phase I reaction, to add a reactive group, such as a hydroxyl radical.

This step leads to the production of those reactive molecules which are more toxic than

the parent compound, and if these are not further treated by the phase II conjugation can

cause damage to DNA, RNA and proteins within the cell (Vermeulen 1996). Cyp1A1,

Cyp3A4, Cyp1A2, Cyp2C and Cyp2D6 are the main P450 enzymes involved in

metabolism of drugs or exogenous toxins (Fig: 7). The amount of these enzymes presents

in liver show the importance in the metabolism of different drugs (Vermeulen 1996;

Iarbovic et al. 1997; Benet et al. 1996)

Figure 6: Liver Detoxification Pathways & Supportive Nutrients

It has been proved by several studies that there lies an association between the induced

phase I and/or decreased Phase II activities and elevated risk of ailments such as

Parkinson's disease, cancer and systemic lupus erythematosus (Meyer et al. 1990; Ritchie

et al. 1980; Daly et al. 1993; Kawajiri et al. 1990; Nebert et al. 1991; Bandmann et al.


Page | 23

1997). Adverse drug responses have also been reported due to compromised Phase I

and/or PhaseII activity (Meyer et al. 1990; Iarbovic et al. 1997; Lee. 1995).

The Phase II Detoxification System: Phase I activation is followed by the phase II

conjugation reactions, which converts the reactive molecule formed in phase I reaction to

a water-soluble compound which can be excreted out of body through urine or bile.

Sulfation, glucuronidation, glutathione and amino acid conjugation are among the types

of conjugation reactions which are present in the body (Fig: 8). Cofactors are required for

these reactions which must be replenished through dietary sources.

REGULATION OF DETOXIFICATION ACTIVITIES Specific detoxification pathways may be induced or inhibited depending on various

factors including the genetic polymorphisms, age, gender, dietary habits, and life style

habits like smoking, environment and diseases (Meyer et al. 1990; Benet et al. 1996; Park

et al. 1996; Vesell 1979; Goldberg 1996; Guengerich 1995).

Figure 7: Cytochrome P450 in Human Liver

INDUCTION

When a high xenobiotic load is faced by the body, the detoxification mechanism can

be fastened by the induction of phase I and/or phase II enzymes. Inducers can be mono-

functional or multi-functional (Fig: 9). Mono-functional inducers only affect one enzyme

or one phase of detoxification while a multi-functional inducer affects multiple activities

(Park et al. 1996).


Page | 24

Induction of the Cyp1A1 and Cyp1A2 enzymes is done by mono-functional inducers,

leading to a substantial increase in phase I action such as polycyclic hydrocarbons from

cigarette smoke and aryl amines from charbroiled meats, and with little or no effect on

phase II activity (Kall & Clausen 1995; Joeres et al. 1988; Parsons & Neims 1978; Smith

& Yang 1994; Guengerich 1984). Initiation of Phase I enzymes activities without co-

induction of Phase II enzymes activities results in the disconnection of the Phase I and

Phase II balance of activity. As a result, reactive intermediates are produced in large

amounts, leading to the injury to DNA, RNA, and proteins (Elangovan et al. 1994).

Multifunctional inducers can be produced by the flavonoid molecules found in fruits

and vegetables. For example, ellagic acid present in garlic oil, red grape skin, rosemary,

cabbage, soy and brussels sprouts all contain compounds responsible for the induction

several Phase II enzymes and reduction of Phase I activity (Manson et al. 1997; Barch et

al. 1994; Barch et al. 1995; Pantuck et al. 1979; Offord et al. 1995; Ip & Lisk 1997;

Appelt & Reicks 1997).

The enzymes glutathione S-transferase and glucuronyl transferases are commonly

stimulated by multi-functional inducers. The increase n the amount of these enzymes is a

healthy sign for better detoxification in an individual and this increase also helps in

maintainence of a balance among the activities of both phases. That is why it is reported

in several studies that fruits and vegetables can perform the specific role to protect

various cancers.

Figure 8: Major Phase II Detoxification Activities in Humans


Page | 25

Figure 9: Mono & Multi Functional Inducers

INHIBITION Whenever a competition is arose between two or more compounds for the same

enzyme for detoxification, inhibition can take place. Increased noxious load leads to

inhibition of detoxification of a number of compounds by devastating the systems and

competing for detoxification enzyme activities. Moreover, a few compounds selectively

inhibit only one detoxifying activity; for example Cimetidine is a compound that attaches

directly to the heme iron of the cytochrome P450 reactive site and slows down all

cytochrome- dependent Phase I enzyme activities (Benet et al. 1996).

The reduction of necessary cofactors is a common mechanism of inhibition for phase

II enzymes. Sulfation is more prone towards inhibition due to compromised cofactor

status in humans. Concentration of serum sulfate in the body is maintained by the balance

between absorption of inorganic sulfate and its production from cysteine, and its

excretion by urination and insertion into low molecular weight substrates of sulfation. Its

amount varies in humans throughout 24 hours (Levy & Yamada 1971; Slattery et al.

1987). Humans excrete about 20-25 mm of sulfate in 24 hours; so balance of sulfate

reserves should be maintained through dietary intake of sulfur containing amino acids or

inorganic sulfate.

EFFECT OF POLYMORPHISMS Variations in the genetic makeup of an individual to metabolize the toxic compounds

are associated with the presence of genetic polymorphisms. Cyp2D6 is the key example

showing the effect of genetic polymorphism on phenotype. This gene exists in several

forms in different populations. Some people have slow Cyp2D6 activity and hence are


Page | 26

slow metabolizer and don't detoxify the carcinogens as fast as the persons with faster

acting enzyme. Another example is of polymorphism in N-acetyltranferases leading to

slow metabolism through its pathway and hence proved to be a risk factor for some types

of cancers and parkinson's disease (Meyer et al. 1990; Daly et al. 1993; Bandmann et al.

1997).

Detoxification enzyme's activity and expression are also affected by other factors like

that of age, sex and hormones. Examples related to influence of hormones on detoxifying

enzymes is of Cyp3A, which is sensitive to hormones, similarly 30-40% more Cyp3A

activity is shown by premenopausal women than postmenopausal or men (Wacher et al.

1995; Gustavson & Benet 1994; Maurel 1996).

Health status of an individual also influences the detoxification mechanism. Liver is an

organ responsible for major detoxification activities, so if it is not functioning properly

due to any liver disease such as biliary cirrhosis, hepatocellular carcinoma etc, the

detoxification activity is slowed down (Lee 1995; Benet et al. 1996).

GLUTATHIONE CONJUGATION Glutathione is known as a defensive compound within the body for the elimination of

potentially toxic electrophillic compounds. Many pharmaceuticals either are, or can be

metabolized by phase I reactions to, strong electrophiles, and these in turn react with

glutathione to form non-toxic conjugates generally. The compounds conjugated to

glutathione include epoxides, haloalkanes, nitroalkanes, alkenes, and aromatic halo-and

nitro-compounds. The enzymes working as catalysts of above reactions are the

glutathione-S-transferases which are found in the cytosol of liver, kidney, gut and other

tissues. The glutathione conjugates may be excreted directly in urine, or more usually

bile.

The tripeptide glutathione (Gly—Cys—Glu), when attached to the acceptor molecule,

is attacked by a glutamyl transpeptidase & peptidase, which helps in removing the

glutamate and glycine respectively, and as a result the cysteine conjugate of xenobiotic is

formed. Afterwards the N-Acetylation of the cysteine conjugate occurs by the normal N-

acetylation pathway to produce the N-acetylcysteine conjugate or mercapturic acid. The

glycylcysteine and cysteine conjugates and the mercapturic acids all are found in

excretion products.

GLUTATHIONE-S-TRANSFERASES Glutathione S-transferases (GSTs) constitute a super family of omnipresent,

multifunctional enzymes, which play a vital role in cellular detoxification mechanisms,

and protect macromolecules from attack by reactive electrophiles (Strange et al. 2001).


Page | 27

Glutathione S transferases (GSTs) and glutathione peroxidase (GPx) are cell protective

enzymes that alter the action of different exogenous (xenobiotics) and endogenous agents

(Fig: 10). The conjugation of tripeptide glutathione (GSH) is catalyzed by GSTs to a wide

range of endogenous and exogenous chemicals having the electrophilic functional groups

(e.g. carcinogens, environmental pollutants and products of oxidative stress), they

neutralize their electrophilic sites, and make the products more water-soluble (Haydes &

Pulford 1995).

Human cytosolic GSTs have been grouped into eight gene families: GST- alpha (GST-

α), GST-mu (GST-μ or GSTM),GST- pi (GST-π), GST-theta (GST-θ or GSTT), GST-

zeta (GST-ζ),GST-sigma (GST-σ), GST-kappa (GST-κ) and GST- omega (GST-Ω) , with

each family encoded by a separate gene based on sequence homology and immunological

cross reactivity (Mannervik et al. 1992; Pemble & Taylor 1992; Board et al. 2000).

Figure 10: 3D Structure of Glutathione S-Transferase

All the genes present in GSTs super family have probably begun from the same

precursor. On the other hand all the forms are diverse and specified from each other due

to the gene recombination, duplication and accumulation of mutations. As the GSTs have

a very vital role in the process of detoxification of xenobiotics, therefore because of their

genetic variation the scientist have been attracted towards them and several studies have

been conducted to observe their association with cancer risk. Various studies have shown

relationship of GST genotypes with lung, breast, brain, colon and various other types of

cancer (Rebbeck 1997; Dunning et al. 1999; Landi 2000).

GSTM1 and GSTT1 are the most commonly examined genes so we will discuss them

in detail only.


Page | 28

GSTM (µ) The sub family GSTM is subfamily is represented by a 100Kb gene cluster at

chromosomal site 1p13.3 arranged as 5'-GSTM4-GSTM2-GSTM1-GSTM5- GSTM3-3'

(Pearson et al. 1993; Xu et al. 1998). Both the allels are affected when the gene is

deleted, which results in the null genotype, GSTM1-/-. When the detailed mapping is

studied, it was found that GSTM gene is flanked by two almost alike 4.2-kb regions (Fig:

11). Homologous recombination involving the left and right 4.2-kb repeats is responsible

for the GSTM1 null genotype (Xu et al. 1998). Similarly a missense SNP also occurs in

the GSTM1 gene, i.e. nucleotide 534 G/C (172 Lys/ Asn, resulting to GSTM1*A and

GSTM1*B, respectively), which does not appear to affect the enzyme function (Widersten

et al. 1991).

Numerous studies have analyzed the GSTM1 genotype using a PCR-based assay

designed to identify the wild-type allele of GSTM1 (Seidegard et al. 1988).

Figure 11: The GSTM1 gene is part of the Mu-class GST gene cluster at 1p13.3, which is arranged as 5`-GSTM4-GSTM2-GSTM1-GSTM5-GSTM3-3` (top of diagram). The GSTM1 gene (black box) consists of 8 exons, which range in size from 36 to 112 bp, while the introns vary from 87 to 2641 bp. GSTM1 is embedded in a region with extensive homologies and flanked by two almost identical 4.2-kb regions (gray boxes). The GSTM1 null allele arises by homologous recombination of the left and right 4.2-kb repeats, which results in a 16-kb deletion containing the entire GSTM1 gene (bottom of diagram). The point of deletion cannot be precisely localized because of the high sequence identity between the repeats. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)

GSTT (Θ) Two genes GSTT1 and GSTT2 are present in GSTT subfamily, which are positioned at

chromosomal site 22q11.2 and distance between them is about 50 kb (Landi et al. 2000;

Coggan et al. 1998; Whittington et al. 1999). Both genes consist of five exons with the

same intron/exon boundaries but share only 55% amino acid identity (Fig: 12). It has been

reported that about 20% of Caucasians are homozygous for a GSTT1 null allele (GSTT1-/-

). The GSTT1 null genotype is more common in Asians, with frequencies 47-64% (Grate

et al. 2001; Nelson et al. 1995).


Page | 29

Figure 12: The GSTT1 gene is part of the Theta-class GST gene cluster at 22q11.2 (top of diagram). GSTT1 and GSTT2 are separated by approximately 50 kb. GSTT2 lies head-to-head with a gene encoding the D-dopachrome tautomerase (DDCT). The GSTT2 and DDCT genes have been duplicated in an inverted repeat. The duplicated GSTT2 is a pseudogene (named GSTT2P) because an abnormal exon 2/intron 2 splice site causes a premature translation stop. The GSTT1 gene (black box) consists of five exons, which range in size from 88 to 195 bp, while the introns vary from 205 to 2363 bp. The GSTT1 gene is embedded in a region with extensive homologies and flanked by two 18 kb regions, HA3 and HA5 (gray boxes), which are more than 90% homologous. In their central portions HA3 and HA5 share a 403-bp sequence with 100%identity. (Adopted from: Mini review on GST genotypes and cancer risk by Fritz F.Parl)

The GSTT1-/- deletion similar to GSTM1-/- is probably due to a homologous

recombination event involving the left and right 403-bp repeats. Similar to GSTM1,

numerous studies of the GSTT1 genotype employed a PCR-based analysis that identified

the wild-type allele (Pemble et al. 1994).

GST GENOTYPES & CANCER RISK Carcinogen metabolism genes are commonly affected by the single nucleotide

polymorphisms (SNPs). The complete deletion of a gene in form of a null genotype is

rare. That is why GSTM1 and GSTT1 null genotypes have attracted so many concerns of

scientists and become the spotlight in more than 500 publications in the field molecular

epidemiology. Basically all the studies are conducted on the hypothesis that the activity of

GST enzymes either normal or increased is responsible for defending the susceptible cells

from DNA mutations by the attack of electrophilic carcinogens with the help of

detoxification mechanism. So because of their active role in the detoxification

mechanism, the homozygous deletions of both GSTT1 and GSTM1 are expected to have

disability to eliminate the carcinogens from the body therefore placing the persons with

GSTM1 and GSTT1 Null genotypes at higher cancer risk.

It is well known that GSTs have overlapping substrate specificities therefore

deficiency of an individual GST iso enzyme is supposed to be compensated by other

isoforms. This is the reason that assessment of all GST genotypes is a basic requisite for

reliable analysis of the role of the GSTs in cancer growth. A number of molecular studies


Page | 30

have reported the association between genotypes of one, two, or three GST subtypes and

breast carcinoma risk (Dunning et al. 1999; Mitrunen et al. 2001,). Nothing can be

concluded on the results obtained. An association among GSTs and cancer if found in one

study is negated by the other studies (Ambrosone et al. 1995; Kelsey et al. 1997; Bailey et

al. 1998; Coughlin et al. 1999; Garcia-Closas et al. 1999; Zhao et al. 2001). The

differences in results of these studies may be because of the variations among the studied

populations and the exposure of the individuals to different environmental and dietary

factors. GSTM1 and GSTT1 are not truly genotyped in any of the previous studies. Roodi

et al. and Sprenger et al. described the positive identification of the wild-type and null

alleles for GSTM1 and GSTT1 respectively, which allowed the exact explanation of the -/-

, +/+ and +/- genotypes and diversity among low, high and none conjugator phenotypes.

Associations between GSTM1 and GSTT1 null genotypes and breast cancer have been

reported with inconsistent results (Gudmundsdottir et al. 2001; Helzlsouer et al. 1998;

Mitrunen et al. 2001, Millikan et al. 2000) Therefore; we planned to conduct this study

for the first time in Pakistan to evaluate the influence of these GST genotypes in breast

cancer susceptibility in Pakistani population.


Page | 31

MATERIAL AND METHODS

The proposed study was conducted according to the work plan essentially divided into

two phases and further sub divided as depicted below:

ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES

FIELD WORK BENCH WORK A)APPROVAL OF STUDY FROM INSTITUTIONAL REVIEW BOARD. A) DNA EXTRACTION

B)IDENTIFICATION AND ENROLLMENT OF SUBJECTS B)QUANTIFICATION OF DNA

C)COLLECTION OF BLOOD SAMPLES C)ANALYSIS OF GSTT1 AND GSTM1 NULL ALLELES BY MULTIPLEX PCR

FIELD WORK INSTITUTIONAL REVIEW BOARD (IRB)

Approval for this study was obtained from the Institutional Review Board (IRB) of

Institute of Biotechnology, Bahauddin Zakariya University, Multan. Informed consent

forms had been designed containing risks, facts and discomforts that might be anticipated

to influence an individual’s willingness to participate as a volunteer in a research project.

ENROLMENT OF SUBJECTS The present study consisted of 100 case subjects (females) with pathologically

confirmed breast cancer that were recruited from Department of Radiology and

Oncology, Nishter Hospital, Multan. A total of 204 healthy volunteer females were

included in the study as controls samples. The volunteers that took part in this study

belong to Multan, Layyah, and D. G Khan and Rajanpur areas of Southern Punjab

(Pakistan) belonging to different ethnic groups, and age ranges. The nature and purposes

of this study were presented to all the subjects and a proper informed consent was

obtained from them. Each subject (patients and controls) was asked to provide

information regarding age, marital status, menopause, age at menopause, smoking status,

family history of cancer, pregnancies, nature of work etc.

COLLECTION OF BLOOD SAMPLES Blood sampling of controls samples was performed during May to August, 2009 and

that of case samples from May, 2009 to March, 2010 visiting Department of

Radiotherapy and Oncology, Nishter Hospital, from different areas of the Southern

Punjab. 5ml of blood from all subjects was collected using sterilized disposable syringes

in 15 ml Sterilin® falcon tubes having 400µl EDTA (Ethylene Diamine Tetra Acetic

Acid) as anticoagulant, stored at -70°C till further processing.


Page | 32

BENCH WORK DNA EXTRACTION

The genomic DNA was extracted by using a standardized non organic method

(Grimberg et al. 1989). With this method, DNA was extracted from white blood cells

(WBC) because the white blood cells are the only blood cells which are nucleated. The

protocol for DNA extraction is as follows: In 15 ml Sterilin® falcon tubes, 3-5 ml blood

samples were collected containing 400µl of 0.5 M EDTA. Samples were freezed at -70°C

for at least 20-30 minutes before processing. Samples can also be stored at -20°C for long

duration. The blood samples were thawed before processing to lyses the red blood cells

(RBC). TE buffer (10 mM Tris Hcl, 2mM EDTA, pH8.0) was added to fill the falcon

tubes volume for washing of blood samples. Samples were centrifuged at 3000 rpm for 20

minutes and supernatant was discarded for washing out lysed RBCs. Washing was

repeated three to four times till the white blood cells are free of hemoglobin and pellet

appears whitish . Proteins in the pellets of WBC were digested by adding the 0.5 mg of

proteinase k along with 200µl of SDS buffer in the presence of 6 ml TNE buffer (10mM

Tris HCl, 2mM EDTA, 400mM NaCl). Samples were left in shaking water bath for

overnight at 37°C and at a speed of 250rpm. By this, mixing takes place and ultimately

proteins digested. These digested proteins can be precipitated by adding 1ml of

supersaturated NaCl, followed by vigorous shaking and chilling on ice for 15 minutes and

then centrifuged at 2400 rpm. Supernatant is shifted to another Sterilin® falcon tube and

DNA was extracted from the supernatant by adding equal volume of Isopropanol. Wash

the DNA pellet with freshly prepared 70% ethanol. Dissolved the DNA in TE (10mM

Tris HCl, 2m M EDTA) buffer and heat it on 70°C for one hour in water bath. By this any

remaining nucleases and proteins inactivated. DNA can be stored at-20°C for long time.

QUANTIFICATION OF DNA Concentration of DNA was measured using Spectrophotometer by following method:

The optical Density (OD) was measured by spectrophotometer (Perklin Elmer Ltd,

UK) at 260nm.

50µG /ML X OD 260NMX200

After calculation of DNA concentration, working dilutions were prepared with final

concentration of 25ng/ul conc. and 2-4ul of each DNA dilution was used for setting up a

PCR reaction.

GSTT1/GSTM1 MULTIPLEX PCR & ANALYSIS Analysis of the GSTT1 & GSTM1 was performed by using a standard multiplex PCR

protocol with some changes to describe the presence or absence of GSTT1 and GSTM1

(Shaikh et al. 2010). This technique does not distinguish between the heterozygosity or


Page | 33

homozygosity in genotypes of GSTT1 and GSTM1, but identifies the null genotypes i. e.

homozygous deletion. β-globin used as internal control to confirm the PCR amplification.

100ng of DNA was amplified in a total volume of 25 µl reaction mixture containing

8pmol of each primer (Table 7). Primers of GSTT1, GSTM1 and β-globin were got

synthesized commercially from Centre for Applied Molecular Biology (CAMB) Lahore,

Pakistan (Table 8). Multiplex PCR was performed with initial denaturation at 95°C for 5

minutes followed by 40 cycles of 94°C for 45 sec, annealing at 60°C for 45 sec and

extension at 72°C for 45 sec. Final extension was at 72°C for 7 mins (Fig: 13). PCR

products were electrophoresed on 2% agarose gel, stained with ethidium bromide and

visualized it on UV light. Presence and absence of bands represent the presence or

absence of null alleles of GSTT1and GSTM1. GSTT1 has a product size 473bp, β-globin

has 260bp product while the third GSTM1 has 210bp size. If β-globin band is absent it

means PCR reaction has failed.

TABLE 7: OLIGONUCLEOTIDES PRIMERS USED IN AMPLIFICATION

Figure 13: Profile of Multiplex PCR

GENES PRIMER TYPE SEQUENCE PRODUCT SIZE

GSTT1 FORWARD 5’TTCCTTACTGGTCCTCACATCTC3’ 473BP

REVERSE 5’ TCACCGGATCATGGCCAGCA 3’

GSTM1 FORWARD 5’GAACTCCCTGAAAAGCTAAAGC3’ 210BP

REVERSE 5’GTTGGGCTCAAATATACGGTGG3’

B-GLOBINS FORWARD 5’ CAACTTCATCCACGTTCACC3’ 260BP

REVERSE 5’ GAAGAGCCAAGGACAGGTAC3’


Page | 34

TABLE 8: INGREDIENTS FOR MULTIPLEX PCR REACTION MIXTURE

INGREDIENTS CONCENTRATION VOLUME TAKEN FOR MULTIPLEX PCR REACTION (µL)

10X PCR BUFFER 10MM 2. 5

MAGNESIUM CHLORIDE 50MM 1.25

DNTPS 2. 5MM 0. 8

PRIMERS GSTT1 FORWARD 8µM 0. 5

REVERSE 0. 5

GSTM1 FORWARD 0. 5

REVERSE 0. 5

Β-GLOBIN

FORWARD 0. 5

REVERSE 0. 5

TEMPLATE DNA 25NG 4.0

TAQ DNA POLYMERASE 5U 0. 4

DISTILLED WATER 13.05

TOTAL REACTION MIX 25

STATISTICAL ANALYSIS Null allele frequency of GSTM1and GSTT1 in case and control subjects from Southern

Punjab was determined according to the Hardy–Weinberg equilibrium. Chi-Square test

was applied to evaluate the relation between null alleles of GSTM1 and GSTT1 with

disease, smoking, and age groups, pesticide, menopause etc using the SPSS 17 statistical

package for Windows.


Page | 35

RESULTS

For the present study 204 healthy individual and 100 female patients of breast cancer

were enrolled. GSTM1 and GSTT1 genetic polymorphisms were analyzed using a

multiplex PCR procedure. The presence or absence of the genes was detected by the

presence or absence of 473 bp, 260bp and 210 bp bands corresponding to GSTT1, β-

globin and GSTM1 genes respectively. Β-globin was used as internal control to document

the successful PCR amplification. A picture of multiplex PCR products run on 2%

agarose gel stained with ethidium bromide is given below (Fig: 14).

Figure 14: Ethidium bromide-stained electrophoresed PCR products samples: 1 kb ladder (lane 9); GSTM1 and GSTT1 wild type (lanes 3, 4, 12 and 13, representing individuals BC 04, 06, 10, 12); GSTM1 null (lanes 5, 6, 14 and 15, representing individuals BC 07, 08, 11 ,25); GSTT1 null genotype (lanes 7, 8, 16 and 17, representing individuals BC 14, 15, 16, 17); concomitant deletion of both GSTM1 and GSTT1 (lanes 1, 2, 10 and 11, representing individuals BC 21, 30, 40, 49).

Different biological/physiological and environmental factors, thought to play some

role in breast cancer predisposition were considered and analyzed during the study (Table

9). Among the biological factors, age was firstly considered and individuals were

distributed in five age groups. It was observed that females belonging to the age group

36-45 years are more prone towards the breast cancer. Although age is significantly

related to breast cancer (p=0.00, Table 9, Fig: 15) but we cannot conclude any strong

association between age and disease as random sampling was done.

Results have shown that 49% of the patients had menopause, which are almost three

folds that of controls samples with menopause (11.3%, p=0.00). It was also observed that

more breast cancer patients (24%) belonged to same age group (36-45years) as mentioned

above (Table 9, Fig: 16). 20% of the patients reported a history of cancer in their family.

Our data suggest that individuals who have more than 3 pregnancies are exposed to a

higher risk of getting breast cancer (p=0.018, Table 9). Statistics show that marriage,

breast feeding, etc has no significant association with the genes and breast cancer.

However a weak association of breast cancer was observed with environmental factor

like smoking (p=0.078) and a significant association with pesticides exposure (p=0.042),


Page | 36

though on further analysis of pesticides exposure along with GSTM1, GSTT1 genes and

breast cancer no significant evidence was observed (p=0.559, Table 13).

It was observed that null genotype of GSTT1 is present in 25.98 % (79) of individuals

while 225 of the total 304 individuals (74.01%) carry the wild type genotype. GSTT1 wild

genotype was present almost in the same ratio in normal and affected persons i.e. 74.5%

and 73% respectively, while its null genotype was found at a little higher percentage

(27%) in breast cancer patients as compared to (25. 5 %) in control individuals (Table

10). Above allele frequencies and statistical analysis clearly depicts that GSTT1 is not

associated with breast cancer (p=0.08, Table 10).

GSTM1 wild type allele was present in 54.27% (165) individuals while its null allele

was found in 45.7% (139) individuals. Presence of the GSTM1 wild type allele among the

control and case was found to be 52.9% and 57% respectively, while 46.1% and 43% of

normal and affected individuals, respectively, carry null allele of GSTM1 (Table 10).

Statistically no significant relationship was found between the patient’s phenotype and

different categories of GSTM1 (p=0.445) and hence we may conclude that distribution of

GSTM1 null genotype remains the same for normal as well as affected individuals.

Cross tabulation of GSTT1 and GSTM1 with the disease represents that 9.86% (30) of

the all the individuals showed null mutation for both GSTM1 and GSTT1 genes and

38.15% of the individuals had both the wild type GSTT1 and GSTM1 genes, while

51.97% of individuals have either any one of the both genes deleted. As frequency of null

alleles of GSTM1 and GSTT1 genes is almost similar in patients and control so no

significant association of these genes was detected with the breast cancer, moreover, it is

proved that presence and absence of one gene has no effect on the occurrence of other

gene (Table 11).

Statistical analysis between the two genes (GSTM1 & GSTT1), menopause and the

breast cancer show significant results, that with null mutation of both the genes the

percentages of patients either having menopause or no menopause was similar i.e. 50%.

On the contrary, percentage of null mutations of both the genes in normal individuals

having menopause or no menopause are 10% and 90%, respectively, showing a

significant association with the disease either due to genes deletion or combination with

menopause. While when only GSTM1 or GSTT1 was deleted the percentage of patients

having menopause is 54.5% and 58.5%, respectively, which is more than those without

menopause, 45.5% and 41.2%, respectively (Table 12).


Page | 37

TABLE 9: SELECTED CHARACTERISTIC FOR CASE & CONTROLS INDIVIDUALS OF SOUTHERN PUNJAB, PAKISTAN.

CHARACTERISTICS CATEGORY NORMAL N=204

AFFECTED N=100

CHI SQUARE TEST /P-VALUE

AGE 15-25Y 65 (31.9%) 1 (1%) 65.27/P<0.001*** 26-35Y 68 (33.3%) 19 (19%) 36-45Y 8 (3.9%) 24 (24%) 46-55Y 15 (7.4%) 20 (20%) 60+Y 1 (0.5%) 5 (5%)

MENOPAUSE NO 181 (88.7%) 51 (51%) 52.839/ P<0.001*** YES 23 (11.3%) 49 (49%)

AGE AT MENOPAUSE

N/A 181 (88.7%) 52 (52%) 54.992/ P<0.001*** 26-35 0 (0) 4 (4%) 36-45 8 (3.9%) 24 (24%) 46-55 15 (7.4%) 20 (20%)

MARRIAGE NO 40 (19.6%) 3 (3%) 15.241/ P<0.001*** YES 164 (80.4%) 97 (97%)

MARRIAGE AGE NO 41 (20.1%) 4 (4%) 17.138/ P=0.001*** 10-20Y 119 (58.3%) 60 (60%) 21-30Y 42 (20.6%) 34 (34%) 31-40Y 2 (1%) 2 (2%)

BREAST CANCER AGE

NO 204 (100%) 0 (0%) 304.0/ P<0.001*** 15-25Y 3 (3%) 26-35Y 23 (23%) 36-45Y 43 (43%) 46-55Y 22 (22%) 56+ Y 9 (9%)

HISTORY OF BREAST CANCER

YES 0 (0%) 20 (20%) 43.673/ P<0.001*** NO 100 (100%) 80 (80%)

AGE AT FIRST PREGNANCY

NO 53 (26.0%) 13 (13.0%) 12.573/P=0.014*** 10-15Y 10 (4.9%) 3 (3%) 16-20Y 74 (36.3%) 32 (32%) 21-30Y 63 (30.95%) 48 (48%)

TOTAL NUMBER OF PREGNANCIES

NO 53 (26%) 14 (14%) 13.169/P=0.018** 1-3 TIMES 62 (30.4%) 22 (22%) 4-6TIMES 52 (25.5%) 44 (44%)7-9TIMES 28 (13.7%) 16 (16%) 10-12TIMES 7 (3.4%) 3 (3%)

BREAST FEEDING NO 78 (38.2%) 18 (18%) 12.717/P<0.001*** YES 126 (61.8%) 82 (82%)

LAST BREAST FEEDING AGE

NO 57 (27.9%) 16 (16%) 12.897/P=0.005*** 15-25Y 35 (17.2%) 8 (8%)26-35Y 79 (38.7%) 52 (52%) 36-45Y 33 (16.2%) 24 (24%)

SMOKING NO 184 (90.2%) 96 (96%) 3.109/P=0.078NS YES 20 (9.8%) 4 (4%)

EDUCATION NO 94 (46.1%) 62 (62%) 7.071/P=0.132NS UP TO MIDDLE

52 (25.5%) 17 (17%)

UP TO 10TH 38 (18.6%) 13 (13%) UP TO 12TH 9 (4.4%) 3 (3%)

PESTICIDES NO 150 (73.5%) 84 (84%) 4.151/P=0.042* YES 54 (26.5%) 16 (16%)

***: Highly Significant, **: Significant, *: Marginally Significant, NS: Non Significant

Hence collectively we can say that though data has shown that the percentage of

women having GSTM1 null mutation (43%) are more sufferers of breast carcinoma than

those with the GSTT1 null mutation (27%) but due to non significant results obtained it


Page | 38

cannot be concluded that deletion of these genes is associated with breast cancer in our

population (Table 10). Although it can be concluded that menopause and gene deletions

are collectively increasing the tendency of women to be exposed to breast cancer (Table

12).

TABLE 10: CROSS TABULATION OF GSTM1 & GSTT1 WITH BREAST CANCER

TABLE 11: CROSS TABULATION OF GSTM1 & GSTT1 COMBINATION WITH BREAST CANCER


GENES NORMAL

N=204

AFFECTED

N=100

TOTAL

N=304

STATISTICAL TESTS

CHI SQUARE

STATISTIC/P-

VALUE

LIKELIHOOD

RATIO

STATISTIC/P-VALUE

GSTT1

(+/+ , +/-)

152 (74.5%) 73 (73%) 225 (74.01%) 0.782/P=0.080NS 0.778/0.079

GSTT1

(-/-)

52 (25.5%) 27 (27%) 79 (25.98%)

GSTM1

(+/+ , +/-)

108 (52.9%) 57 (57%) 165 (54.27%) 0.541/P=0.445NS 0.504/0.446

GSTT1

(-/-)

96 (46.1%) 43 (43%) 139 (45.7%)

GENES NORMAL

N=204

AFFECTED

N=100

TOTAL

N=304

GSTM1-/GSTT1- 20 (9.8%) 10 (10%) 30 (9.86%)

GSTM1-/GSTT1+ 76 (37.25%) 33 (33%) 109 (35.85%)

GSTM1+/GSTT1- 32 (15.68%) 17 (17%) 49 (16.11%)

GSTM1+/GSTT1+ 76 (37.25%) 40 (40%) 116 (38.15%)


Page | 39

Figure 15: Graph representing frequency of different age groups among affected and normal subjects

Figure 16: Graph representing frequency of menopause in different age groups among affected and normal subjects

TABLE 12: CROSS TABULATION OF GENE COMBINATIONS OF GSTM1, GSTT1 & MENOPAUSE WITH BREAST CANCER

TABLE 13: CROSS TABULATION OF GENE COMBINATIONS OF GSTM1, GSTT1 & PESTICIDE EXPOSURE WITH BREAST CANCER


GENE COMBINATION

POST MENOPAUSE PRE MENOPAUSE TOTAL STATISTICAL TESTS

CHI-SQUARE LIKELIHOOD RATIO

NORMAL AFFECTED NORMAL AFFECTED STATISTIC/P-VALUE

STATISTIC/P-VALUE

GSTM1-/GSTT1- 2(10%) 5(50%) 18(90%) 5(50%) 30(9.86) 5.963/P=0.015** 5.73/0.017 GSTM1-/GSTT1+ 7(9.2%) 18(54.5%) 69(90.8%) 15(45.5%) 109(35.8) 26.755/P=0.00*** 25.196/0.00 GSTM1+/GSTT1- 5(15.6%) 10(58.8%) 27(84.4%) 7(41.2%) 49(16.11) 9.754/P=0.002*** 9.592/0.002

GSTM1+/GSTT1+ 9(11.8%) 16(40%) 67(88.2%) 24(60%) 116(38.15) 12.29/P=0.00*** 11.779/0.001

GENE COMBINATION

PESTICIDE EXPOSED PESTICIDE NOT EXPOSED

TOTAL STATISTICAL TESTS

CHI-SQUARE LIKELIHOOD RATIO

NORMAL AFFECTED NORMAL AFFECTED STATISTIC/P-VALUE

STATISTIC/P-VALUE

GSTM1-/GSTT1- 6(20%) 2(6.7%) 14(46.7%) 8(26.7%) 30(9.86) 0.341/P=0.559NS 0.330/0.566 GSTM1-/GSTT1+ 17(15.6%) 5(4.6%) 59(54.1%) 28(25.7%) 109(35.8) 0.744/P=0.388 NS 0.775/0.379GSTM1+/GSTT1- 10(20.4%) 4(8.2%) 22(44.9%) 13(26.5%) 49(16.11) 0.342/P=0.569 NS 0.331/0.569 GSTM1+/GSTT1+ 21(18.1%) 5(4.3%) 55(47.4%) 35(30.2%) 116(38.15) 3.451/P=0.063* 3.71/0.054


Page | 41

DISCUSSION

We know that GSTs (GSTT1 & GSTM1) belong to the group of low penetrance genes,

which might be involved in the process of carcinogenesis. Primary reason to study

GSTM1 and GSTT1 polymorphisms and their possible correlation to breast cancer is

based on the fact that Southern Punjab is an agricultural and highly populated areas and

lack of an efficient detoxification system might increase the risk of getting breast cancer

in this population. The GST family catalyzes reactive carcinogenic intermediates,

produced through the phase I metabolism of environmental toxins. The genes of the GST

families are under the control of the aryl hydrocarbon receptor, which binds toxic

chemicals such as dioxin, an environmental pollutant thought to be involved in breast

cancer development (Perera et al. 1995). The influence of these deletion polymorphisms

has already been determined in other cancers such as lung cancer, ovarian cancer (Perera

et al. 1995), bladder cancer (Song et al. 2009), Colon cancer (Huang et al. 2006), oral

cancer (Sreelekha et al. 2001), Acute Lymphoblastic Leukemia (Chacko et al. 2004), lung

cancer (Sreeja et al. 2005) in various populations, which lead us to hypothesize that

GSTM1 and GSTT1 null mutations may also contribute to the origin of breast cancer in

our population.

In the present study, it is found that frequency of GSTM1 null genotype in Southern

Punjab women of Pakistan is 45.7%, which is significantly higher than all Indian

populations (Table 14). Similarly, GSTT1 null genotype frequency (25.98%) is also

higher than North and South Indian populations, whereas it is lower than that of Delhi

population (Table 14). While our results are found to be in line with the results of a

previous study on frequency distribution of GSTT1 and GSTM1 in Pakistani Population

(Shaikh et al. 2010). From these results, it is suggested that Population of Southern

Punjab is distinctive and are not descendant of migrants from India during 1890–1947.

These opinions are further supported by some previous studies in which researchers

compared Indian populations and some populations of Singapore based on frequencies of

GSTM1 and GSTT1 null genotypes, suggesting that Singapore populations were

descendants of migratory Indian population (Lee et al. 1995; Zhao et al. 1995). Similar

results were also observed in frequency distribution of CYP2D6 gene in Malaysian

Indians and South Indians (Adithan et al. 2003). However, to confirm this hypothesis

genotyping of more individuals is necessary. In addition, frequency of GSTM1 and

GSTT1 null allele is higher in Chinese and Japanese populations than that in population

from Southern Punjab indicating that population from Southern Punjab is distinct from


Page | 42

both these racial groups (Table 14). Although Polish and Italian populations are

comparable in frequency distribution of GSTM1 null allele but Southern Punjab

population has a significantly higher frequency of GSTT1 null allele, suggesting that

Southern Punjab population is distinct from both Polish and Italian populations (Table

14).

Our case control study of South Punjab population showed that GSTM1 and GSTT1

null genotypes were not associated with breast cancer among the Pakistani women. But a

higher risk was observed for either the deletions of both GSTT1 and GSTM1 or only one

of them, with menopause, depicting that the post menopausal women are more prone

towards the breast cancer either due to gene deletions or any hormonal effect. Previous

studies conducted on post menopausal women of Iowa showed that the null genotypes of

GSTM1 or GSTT1 are associated with an elevated risk of breast cancer compared with

women who had both genes (Zheng et al. 2001).

Previous studies on the role of these genotypes in breast carcinoma had shown

discrepant results (Ambrosone et al. 1995; Chacko et al. 2005; Curran et al. 2000; Egan

et al. 2004; Garcia et al. 1999; Gudmundsdottir et al. 2001; Helzlsouer et al. 1998;

Mitrunen et al.2001). The first possible link between GSTM1 deletion and breast cancer

risk was suggested from a hospital based case-control study, in which 47.7% of cases and

41.8% of controls were found to have the null GSTM1 genotype (Zhong et al.1993).

Several successive case-control studies (Charrier et al.1999; Ambrosone et al.1995;

Zheng et al.2001) also found a weak to moderate positive association. The strongest

association was reported by Helzlsouer et al.1998 they found a 2.5-fold elevated breast

cancer risk among postmenopausal women with the null GSTM1 genotype. In another

study done on Southern Taiwan's women, poor detoxification ability in the GST group

was hypothesized to contribute to an increased risk of breast cancer, and women

harboring putative high-risk alleles ( GSTM1 and GSTT1 deletion alleles) were considered

to be at higher risk of cancer (Wang et al. 2006).

In contrast to above findings and analogous to our results, several other studies

including the nurses' health study (Bailey et al. 1998; Milikan et al.2000; Garcia et al.

1999) showed no association between the GSTM1 genotype and breast cancer risk.

Another report based on a study in breast cancer cases irrespective of family history in

South Indian population also showed no significant role for GSTM1 in breast

carcinogenesis (Samson et al.2007).

Although not as extensively investigated as the GSTM1 polymorphism, GSTT1

deletion has also been evaluated in relation to the risk of breast cancers in five


Page | 43

epidemiologic studies with conflicting results. A positive association between GSTT1

polymorphism and breast cancer was found by two previous studies (Gudmundsdottir et

al. 2001; Helzlsouer et al. 1998). While our findings were supported by the three other

studies, in which, GSTT1 deletion was not related to the risk of breast cancer (Garcia et

al. 1999; Curran et al. 2000; Milikan et al. 2000). In fact, the risk was even reduced in

certain subgroups of women who had the GSTT1 null genotype (Garcia et al. 1999;

Curran et al. 2000).

Thus our results are in line with the results of the previous studies on South Indian

populations (Samson et al.2007) as well as that of another case-control study conducted

on women in urban Shanghai which was the largest and most comprehensive examination

of GST polymorphisms in relation to breast cancer risk which also indicated no overall

relationship of the GSTM1 or GSTT1 deletion variants with breast cancer risk in

premenopausal or in postmenopausal women (Kathleen et al.2004).

To end with we can conclude that the frequency of GSTM1 and GSTT1 null genotype

in Southern Punjab population is different from those found in other populations as well

as the deletion of these genes is not associated with breast cancer in our population. The

reason behind can be postulated as, because Southern Punjab population differs

considerably in the rate of metabolism, activation/deactivation of xenobiotics than other

populations of the world. We suppose that this data will provide a basic record for the

future clinical and genetic studies related to variability in the response or toxicity to

xenobiotics/drugs known to be substrates of glutathione-S-transferases. It is suggested

that comprehensive and vast studies are highly recommended in order to expose the

genetic as well as environmental factors in cancer disposition.


Page | 44

TABLE 14: COMPARATIVE FREQUENCY DISTRIBUTION OF GSTM1 AND GSTT1 IN VARIOUS POPULATIONS

Population/Country N GSTM1 Null % GSTT1 Null % Reference Pakistan 304 45.7 25.98 Present Study Southern, Pakistan 111 45 23 Shaikh et al. 2010 North India 370 33 18.4 Mishra et al. 2004 South India 517 30.4 16.8 Naveen et al. 2004 Delhi, India 309 21 27.4 Singh et al. 2009 Newcastle, England 178 50.8 16.9 Welfare et al. 1999 Turkish 133 51.9 17.3 Ada et al. 2004 Italians 273 46.9 19 D’Alo et al. 2004 Polish 233 47.6 16.3 Kargas et al. 2003 Chinese 477 51 46 Setiawan et al. 2000 Caucasian 166 48.8 19.9 Gsur et al. 2001 Japanese 150 51.3 54 Naoe et al. 2000 Slovenia 102 52 25.5 Garte et al. 2001 Spain 312 49.7 20.5 Garte et al. 2001 Greek 165 38.8 18.8 Stavropoulou et al. 2007 Finnish Caucasians 478 41.8 13.2 Mitrunen et al. 2001 African Americans 271 28 17 Millikan et al. 2000 Whites (USA) 392 52 16 Millikan et al. 2000 Brazilian non Whites 272 34.2 25.7 Rossini et al. 2002 Brazilian Whites 319 48.9 25.1 Rossini et al. 2002 Ovambos (Namibia) 134 11.2 35.8 Fujihara et al. 2009 Mongolians (Ulaanbaatar)

207 46.6 25.6 Fujihara et al. 2009


Page | 45

REFERENCES

Ambrosone CB, Freudenheim JL, Graham S, Marshall JS, Vena JE, Brasure JR et al

(1995) Cytochrome P4501A1 and glutathione S-transferase (M1) genetic polymorphisms

and postmenopausal breast cancer risk. Cancer Res 55: 3483–3485

Appelt LC, Reicks MM Soy feeding induces Phase II enzymes in rat tissues. Nutr

Cancer 28(3): 270-275

Bailey LR, Roodi N, Verrier CS, Yee CJ, Dupont WD, Parl FF (1998) Breast cancer

and CYP1A1, GSTM1, and GSTT1 polymorphisms: evidence of a lack of association in

Caucasians and African Americans. Cancer Res 58: 65–70

Bandmann O, Vaughan J, Holmans P et al (1997) Association of slow acetylator

genotype for Nacetyltransferase 2 with familial Parkinson’s disease. Lancet 350:1136-

1139

Barch DH, Rundhaugen LM (1994) Ellagic acid induces NAD(P)H:quinone reductase

through activation of the antioxidant responsive element of the rat NAD(P)H:quinone

reductase gene. Carcinogenesis 15:2065-2068

Barch DH, Rundhaugen LM, Pillay N (1995) Ellagic acid induces transcription of the

rat glutathione S-transferase-Ya gene. Carcinogenesis 16:665-668

Benet LZ, Kroetz DL, Sheiner LB (1996) Pharmacokinetics: The dynamics of drug

absorption, distribution, and elimination. In: Molinoff PB, Ruddon RW, Goodman

Gilman A (eds) The Pharmacological Basis Of Therapeutics. 9thedn. New York,

McGraw-Hill, pp 3-27

Bhurgri Y, Bhurgri A, Hasan SH, Usman A, Faridi N, Malik J et al (2002) Cancer

pattern in Karachi division (1998-1999). J Pak Med Assoc 52: 244-6

Board PG, Coggan M, Chelvanayagam G, Easteal S, Jermiin LS, Schulte GK et al

(2000) Identification, characterization and crystal structure of the omega class glutathione

transferases. J Biol Chem 275: 24798–24806

Chacko P, Joseph T, Mathew BS et al (2005) Role of xenobiotic metabolizing gene

polymorphisms in breast cancer susceptibility and treatment outcome. Mutat Res 581:

153–163

Chang TW, Wang SM, Guo YL, Tsai PC, Huang CJ, Huang W. (2006) Glutathione S-

transferase polymorphisms associated with risk of breast cancer in southern Taiwan.

Breast 15 (16): 754–761


Page | 46

Charrier J, Maugard CM, LeMevel B, Bignon YJ (1999) Allelotype influence at

glutathione S-transferase M1 locus on breast cancer susceptibility. Br J Cancer 79: 346–

353

Coggan M, Whitbread L, Whittington A, Board P (1998) Structure and organization of

the human theta-class glutathione Stransferase and D-dopachrome tautomerase gene

complex. Biochem J 334: 617–623

Coughlin SS, Piper M (1999) Genetic polymorphisms and risk of breast cancer.

Cancer Epidemiol Biomark Prev 8: 1023–1032

Curran JE, Weinstein SR, Griffiths LR (2000) Polymorphisms of glutathione S-

transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility. Cancer

Lett 153: 113–120

Daly AK, Cholerton S, Gregory W, Idle J (1993) Metabolic polymorphisms. Pharmac

Ther 57:129-160

Dunning AM, Healey CS, Pharoah PDP, Teare MD, Ponder BAJ, Easton DF (1999) A

systematic review of genetic polymorphisms and breast cancer risk. Cancer Epidemiol

Biomark Prev 8: 843–854

Egan KM, Cai Q, Shu XO et al (2004) Genetic polymorphisms in GSTM1, GSTP1,

and GSTT1 and the risk for breast cancer: results from the Shanghai Breast Cancer Study

and meta-analysis. Cancer Epidemiol Biomarkers Prev 13: 197–204

Egan KM, Cai Q, Shu XO, Jin F, Zhu TL, Dai Q, Gao YT, Zheng W. (2004) Genetic

Polymorphisms in GSTM1, GSTP1, and GSTT1 and the Risk for Breast Cancer: Results

from the Shanghai Breast Cancer Study and Meta-Analysis Cancer Epidemiology

Biomarkers & Prevention 13(2): 197–204

Elangovan V, Sekar N, Govindasamy S (1994) Chemopreventive potential of dietary

bioflavonoids against 20-methylcholanthreneinduced tumorigenesis. Cancer Lett 87:107-

113

Garcia CM, Kelsey KT, Hankinson SE, Spiegelman D, Springer K, Willett WC et al

(1999) Glutathione S-transferase mu and theta polymorphisms and breast cancer

susceptibility. J Natl Cancer Inst 91: 1960–1964

Garte S, Gaspari L, Alexandrie, Ambrosone C, Autrup H, Aurup JL et al (2001)

Metabolic gene polymorphism frequencies in control populations. Cancer Epidemiol


Goldberg RJ (1996) The P-450 System: Definition and relevance to the use of

antidepressants in medical practice. Arch Fam Med 5: 406-412


Page | 47

Gudmundsdottir K, Tryggvadottir L, Eyfjord JE (2001) GSTM1, GSTT1, and GSTP1

genotypes in relation to breast cancer risk and frequency of mutations in the p53 gene.

Cancer Epidemiol Biomarkers Prev 10: 1169–1173

Guengerich FP (1984) Effects of nutritive factors on metabolic processes involving

bioactivation and detoxification of chemicals. Ann Rev Nutr 4:207-231

Guengerich FP (1995) Influence of nutrients and other dietary materials on

cytochrome P450 enzymes. Am J Clin Nutr 61 (3 Suppl): 651S-658S.

Gustavson LE, Benet LZ (1994) Menopause: Pharmacodynamics and

pharmacokinetics. Exp Gerontol 29: 437-444

Haydes JD, Pulford DJ (1995) The glutathione S-transferase supergene family:

regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and

drug resistance. Crit Rev Biochem Mol Biol 30: 445–600

Helzlsouer KJ, Selmin O, Huang H, Strickland PT, Hoffman S, Alberg AJ, Watson M,

Comstock GW, Bell D (1998) Association between glutathione S-transferase M1, P1, and

T1 genetic polymorphisms and development of breast cancer. J Natl Cancer Inst 90: 512–

518

Huang K, Sandler RS, Milikan RS, Schroeder JC, North KE (2006) GSTM1 and

GSTT1 polymorphisms, cigarette smoking, and risk of colon cancer: a population-based

case-control study in North Carolina (United States). Cancer Causes Control 17: 385–394

Hulka BS, Stark AT (1995) Breast cancer: Causes and Prevention. Lancet 346:883-

887

Iarbovici D (1997) Single blood test might predict drugs’ effects on patients. J NIH

Res 9: 34-45

International Agency for Research on Cancer (IARC) (2002) IARC Handbook on

Cancer Prevention No. 7: Breast Cancer Screening. Lyon, France: IARC Press.

Ip C, Lisk DJ (1997) Modulation of Phase I and Phase II xenobiotic-metabolizing

enzymes by selenium-enriched garlic in rats. Nutr Cancer 28: 184-188

Jamal S, Moghal S, Mamoon N, Mushtaq S, Luqman M, Anwar M (2006) The pattern

of malignant tumours: Tumour registry data analysis, AFIP, Rawalpindi Pakistan. J Pak

Med Assoc 56: 359-62

Joeres R, Klinker H, Heusler H et al (1988) Influence of smoking on caffeine

elimination in healthy volunteers and in patients with alcoholic liver cirrhosis.

Hepatology 8: 575-579


Page | 48

Joseph T, Kusumakumary P, Chacko P et al (2004) Genetic polymorphism of

CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic

leukaemia in Indian children. Pediatr Blood Cancer 43: 560–567

Kall MA, Clausen J (1995) Dietary effect on mixed function P450 1A2 activity

assayed by estimation of caffeine metabolism in man. Hum ExpToxicol 14: 801-807

Kawajiri K, Nakachi K, Imai K et al (1990) Identification of genetically high risk

individuals to lung cancer by DNA polymorphisms of the cytochrome P4501A1 gene.

FEBS Lett 263: 131-133

Kelsey KT, Hankinson SE, Colditz GA, Springer K, Garcia-Closas M, Spiegelman D

et a (1997) Glutathione S-transferase class m deletion polymorphism and breast cancer:

results from prevalent versus incident cases. Cancer Epidemiol Biomark Prev 6: 511–515

Kieff E, Rickinson AB (2001) Epstein-Barr virus and its replication. In: Knipe DM,

Howley PM (ed) Fields virology. Philadelphia: Lippincott Williams & Wilkins. pp 2511-

73

Landi S (2000) Mammalian class theta GST and differential susceptibility to

carcinogens: a review. Mutation Res 463: 247–283

Lee WM (1995) Drug-induced hepatotoxicity. N Engl J Med 333: 1118-1127

Levy G, Yamada H (1971) Drug biotransformation interactions in man III:

Acetaminophen and salicylamide. J Pharmaceut Sci 60: 215- 221

Mannervik B, Awasthi YC, Board PG, Hayes JD, Ilio CD, Ketterer B et al (1992)

Nomenclature for human glutathione transferases. Biochem J 282: 305–308

Manson MM, Ball HWL, Barrett MC et al (1997) Mechanism of action of dietary

chemoprotective agents in rat liver: induction of phase I and II drug metabolizing

enzymes and aflatoxin B1 metabolism. Carcinogenesis 18: 1729-1738

Maurel P (1996) The CYP3 Family. In: Ioannides C (ed) Cytochromes P450:

Metabolic And Toxicological Aspects. Boca Raton, FL: CRC Press, Inc, pp: 241-270

Meyer UA, Zanger UM, Skoda RC et al (1990) Genetic polymorphisms of drug

metabolism. Prog Liver Dis 9:307-323

Millikan R, Pittman G, Tse C-K, Savitz DA, Newman B, Bell D (2000) Glutathione S-

transferases M1, T1, and P1, and breast cancer. Cancer Epidemiol Biomark Prev 9: 567–

573

Mitrunen K, Jourenkova N, Kataja V, Eskelinen M, Losma V-M, Benhamou S, Vainio

H, Uusitupa M, Hirvonen A, GlutaW Zheng et al (2001) thione S- transferase M1, M3,

P1, and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol



Page | 49

Monks TJ, Anders MW, Dekant W, Stevens JL, Lau SS, van Bladeren PJ (1990)

Glutathione conjugate mediated toxicities. Toxicol Appl Pharmacol 106: 1–19

Motzer RJ, Bander NH, Nanus DM (1996) Renal-cell carcinoma. The New England

journal of medicine 335 (12): 865-875

Murphy WM, Beckwith JB, Farrow GM (1994) Tumors of the kidney, bladder, and

related urinary structures. Armed Forces Institute of Pathology, Washington, DC.

Nebert DW, Petersen DD, Puga A (1991) Human AH locus polymorphism and cancer:

inducibility of CYP1A1 and other genes by combustion products and dioxin.

Pharmacogenetics 1: 68-78

Nelson HH, Wiencke JK, Christiani DC, Cheng TJ, Zuo ZF, Schwartz BS et al (1995)

Ethnic differences in the prevalence of the homozygous deleted genotype of glutathione

S-transferase theta. Carcinogenesis 16: 1243– 1245

Offord EA, Mace K, Ruffieux C et al (1995) Rosemary components inhibit

benzopyrene induced genotoxicity in human bronchial cells. Carcinogenesis 16: 2057-

2062

Pantuck EJ, Pantuck CB, Garland WA et al (1979) Stimulatory effect of brussels

sprouts and cabbage on human drug metabolism. Clin Pharm Ther 25: 88-95

Park BK, Kitteringham NR, Pirmohamed M, Tucker GT (1996) Relevance of

induction of human drug-metabolizing enzymes: pharmacological and toxicological

implications. Br J Clin Pharmacol 41: 477-491

Parkin, DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA: A

Cancer Journal for Clinicians 55(2): 74-108

Parsons WD, Neims AH (1978) Effect of smoking on caffeine clearance. Clin

Pharmacol Ther 24: 40-45

Pearson WR, Vorachek WR, Xu SJ, Berger R, Hart J, Vannais D, Patterson D (1993)

Identification of class-mu glutathione transferase genes GSTM1–GSTM5 on human

chromosome 1p13. Am J Hum Genet 53: 220–233

Pemble S, Schroeder KR, Spencer SR, Meyer DJ, Hallier E, Bolt HM et al (1994)

Human glutathione Stransferase theta (GSTT1): cDNA cloning and the characterization

of a genetic polymorphism. Biochem J 300: 271–276

Pemble SE, Taylor JB (1992) An evolutionary perspective on glutathione transferases

inferred from class-theta glutathione transferase cDNA sequences. Biochem J 287: 957–

963


Page | 50

Perera FP, Estabrook A, Hewer A, Channing K, Rundle A, Mooney LA, Whyatt R,

Phillips DH (1995) Carcinogen-DNA adducts in human breast tissue. Cancer epidemiol

Biomarkers and Prevention 4: 233-238

Peto R, Darby S, Deo H et al (2000) Smoking, smoking cessation, and lung cancer in

the UK since 1950: combination of national statistics with two case-control

studies. BMJ 321: 323–9

Poirier MC, Santella RM, Weston A (2000) Carcinogen macromolecular adducts and

their measurement.Carcinogenesis 21: 353–9

Rebbeck TR (1997) Molecular epidemiology of the human glutathione S-transferase

genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomark Prev

6: 733–743

Ritchie JC, Cloan TP, Idle JR, Smith RL (1980) Ciba Foundation Symposium 76:

Toxicological implications of polymorphic drug metabolism. Excerpta Medica 219-244.

Roodi N, Dupont WD, Moore JH, Parl FF (2004) Association of homozygous wild-

type glutathione S-transferase M1 (GSTM1) genotype with increased breast cancer risk,

Cancer Res 64: 1233–1236

Samson M, Swaminathan R, Rama R et al (2007) Role of GSTM1 (Null/Present),

GSTP1 (Ile105Val) and P53 (Arg72Pro) genetic polymorphisms and the risk of breast

cancer: a case control study from South India. Asian Pac J Cancer Prev 8(2): 253–257

Seidegard J, Vorachek WR, Pero RW, Pearson WR (1988) Hereditary differences in

the expression of the human glutathione transferase active on trans-stilbene oxide are due

to a gene deletion. Proc Natl Acad Sci USA 85: 7293–7297

Shields PG, Harris CC (2000) Cancer risk and low-penetrance susceptibility genes in

gene-environment interactions. J Clin Oncol 18: 2309–15

Slattery JT, Wilson JM, Kalhorn TF, Nelson SD (1987) Dose-dependent

pharmacokinetics of acetaminophen: Evidence of glutathione depletion in humans. Clin

Pharmacol Ther 41: 413-418

Smith TJ, Yang CS (1994) Effects of food phytochemicals on xenobiotic metabolism

and tumorigenesis. In: Food Phytochemicals I: Fruits and Vegetables. Washington, DC.

American Chemical Society Press 17-48

Sprenger R, Schlagenhaufer R, Kerb R, Bruhn C, Brockmoller J, Roots T, Brinkmann

U (2000) Characterization of the glutathione S-transferase GSTT1 deletion:

discrimination of all genotypes by polymerase chain reaction indicates a trimodular

genotype–phenotype correlation. Pharmacogenetics 557–565


Page | 51

Sreeja L, Syamala V, Hariharan S et al (2005) Possible risk modification by CYP1A1,

GSTM1 and GSTT1 gene polymorphisms in lung cancer susceptibility in a South Indian

population. J Hum Genet 50: 618–627

Sreelekha TT, Ramadas K, Pandey M et al (2001) Genetic polymorphism of CYP1A1,

GSTM1 and GSTT1 genes in Indian oral cancer. Oral Oncol 37: 593–598

Strange RC, Spiteri MA, Ramachandran S, Fryer A (2001) Glutathione-S-transferase

family of enzymes. Mutat Res 482: 21–26

Turner FC (1941) Sarcomas at sites of subcutaneous implanted Bakelite disks in rats. J

Natl Cancer Inst 2: 81

Vermeulen NPE (1996) Role of metabolism in chemical toxicity. In: Ioannides C (ed).

Cytochromes P450: Metabolic And Toxicological Aspects. Boca Raton, FL: CRC Press,

Inc. pp 29-53

Vesell ES (1979) Pharmacogenetics: Multiple interactions between genes and

environment as determinants of drug response. Am J Med 66: 183-187

Vineis P, Marinelli D, Autrup H et al (2001) Current smoking, occupation, N-

acetyltransferase-2 and bladder cancer: a pooled analysis of genotype-based studies.

Cancer Epidemiol Biomarkers Prev 10: 1249–52

Wacher VJ, Wu C-Y, Benet LZ (1995) Overlapping substrate specificities and tissue

distribution of cytochrome P450 3A and P-glycoprotein: Implications for drug delivery

and activity in cancer chemotherapy. Mol Carcinog 13: 129-134

Whittington A, Vichai V, Webb G, Baker R, Pearson W, Board P (1999) Gene

structure, expression and chromosomal localization of murine theta class glutathione

transferase mGSTT1-1. Biochem J 337: 141–151

Widersten M, Pearson WR, Engstrom A, Mannervik B (1991) Heterologous

expression of the allelic variant mu-class glutathione transferases mu and psi. Biochem J

276: 519–524

Wilson CM, Tobin S, Young RC (2004) The exploding worldwide cancer burden: the

impact of cancer on women. International Journal of Gynecological Cancer 14: 1-11

Xu SJ, Wang YP, Roe R, Pearson WR (1998) Characterization of the human class mu

glutathione S-transferase gene cluster and the GSTM1 deletion. J Biol Chem 273: 3517–

3527

Zhao M, Lewis R, Gustafson DR, Wen WQ, Cerhan JR, Zheng W (2001) No apparent

association of GSTP1 A313 G polymorphism with breast cancer risk among

postmenopausal Iowa women. Cancer Epidemiol Biomark Prev 10: 1301–1302. 34–39


Page | 52

Zhong S, Wyllie AH, Barnes D, Wolf CR, Spurr NK (1993) Relationship between the

GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer.

Carcinogenesis 14: 1821–1824

Web Resources:

Cancer Registry and Data Management (CRCDM). Shaukat Khanum Memorial

Cancer Hospital and Research Center (SKMCH & RC) Report based on cancer cases

registered at SKMCH &RC in 2004 and from Dec 1994- Dec 2004. Available from URL:

http://www.shukatkhanum.org.pk/research.html.

WHO.Data and statistics. World Health Organization; 2006. Globocan 2008 IARC

Books:

M.Phil Thesis of Asma Sohail

Documents

Transcript of M.Phil Thesis of Asma Sohail