MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR …

MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OF COMMON PEA (

AS SUMMER CROP AT RAWALAKOT AZAD KASHMIR

Thesis submitted for degree of

University of

MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OF COMMON PEA (Pisum sativum L


By

Uzma Arif

(Regd. No. 2012-Agri-271)

Thesis submitted for degree of Ph.D

In

Horticulture

Session 2015-2018

Department of Horticulture Faculty of Agriculture

University of The Poonch Rawalakot Azad Jammu and Kashmir

MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR L.) GROWN


ii

MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR

CHARACTERIZATION OF COMMON PEA (Pisum sativum L.) GROWN AS SUMMER CROP AT RAWALAKOT AZAD KASHMIR

By

Uzma Arif (Regd. No. 2012-Agri-271)

A thesis submitted in partial fulfilment of the requirement for the degree of

Doctor of Philosophy

In

Horticulture

Session 2015-2018

Department of Horticulture Faculty of Agriculture

University of The Poonch Rawalakot Azad Jammu and Kashmir

iii

CERTIFICATION

Certified that the contents and form of thesis entitled “Morphological, biochemical and

molecular characterization of common pea (Pisum sativum L.) grown as summer crop

at Rawalakot Azad Kashmir” submitted by Uzma Arif (Reg. No. 2012-Agri.-271)

have been found satisfactory for the award of degree of Doctor of Philosophy in

Horticulture.

SUPERVISORY COMMITTEE

i. Supervisor ---------------------------------------------------- ------------------------

(Dr. M. Jamil Ahmed, Prof. of Horticulture) Signature

ii. Co- Supervisor -------------------------------------------------- -----------------------

(Dr. Malik Ashiq Rabbani, PSO, PGRI, NARC) Signature

iii. Member ----------------------------------------------------- ------------------------ (Dr. Abdul Hamid, Prof. of Horticulture) Signature iv. Member ----------------------------------------------------- ------------------------- (Dr. Shahid Iqbal Awan, Assist. Prof. in PB&MG) Signature v. External examiner ------------------------------------------------------- ------------------------- (Dr. Aman Ullah Malik, UAF) Signature vi .External examiner ------------------------------------------------------ ------------------------- (Dr. Muhammad Saleem Jilani, GU, KPK) Signature

Chairman

Department of Horticulture

Dean Director

Faculty of Agriculture Advanced Studies and Semester Affairs

iv

DECLARATION

I say publicaly that, this thesis is entirely my own work and has not been presented in any way

for any degree to any other university.

May, 2018 Signature___________________ Uzma Arif

v

DEDICATIONDEDICATIONDEDICATIONDEDICATION

This dissertation is dedicated to my

Dear Father

Arif Ijaz

Ever-Loving Mother

Kulsom Arif

&

Sweet and Loving

Brothers, Sister, Sister in Law

and my

Cute Niece “Maryam”

who always

done a lot to see me

glittering high on the

skies of success

vi

CONTENTS

CHAPTER No.

TITLE

PAGE No.

LIST OF TABLES vii

LIST OF FIGURES ix

LIST OF ABBREVIATION xi

ACKNOWLEDGEMENT xiii

ABSTRACT

xv

1

INTRODUCTION

01

2

REVIEW OF LITERATURE

14

3

MATERIAL AND METHODS

48

4

RESULTS AND DISCUSSION

67

CONCLUSION AND RECOMMENDATION 150

SUMMARY 152

5

LITERATURE CITED 156

APPENDICES

182

vii

LIST OF TABLES

Table No. Title Page

3.1.1 List of pea landraces used in morphological studies 51

3.2.1 Genotypes selected for biochemical and molecular study 56

3.3.1 Layout for PCR Master Mix

62

3.3.2 SSR primers along with forward and reverse sequence used in this study

64

4.1.1 Means values of germination percentage in pea genotypes 74

4.1.2 Means values of plant height (cm) in pea genotypes 76

4.1.3 Means values of number of leaves in pea genotypes 77

4.1.4 Means values of leaf area (cm2) in pea genotypes 79

4.1.5 Means values of leaf length (cm) in pea genotypes 80

4.1.6 Means values of leaf width (cm) in pea genotypes 81

4.1.7 Means values of days to flowering initiation in pea genotypes 83

4.1.8 Means values of days to flowering completition in pea genotypes 84

4.1.9 Means values of days to pod formation in pea genotypes 85

4.1.10 Means values of number of pods per plant in pea genotypes 87

4.1.11 Means values of pod length (cm) in pea genotypes 88

4.1.12 Means values of pod width (cm) in pea genotypes 89

4.1.13 Means values of number of seed per pod in pea genotypes 91

4.1.14 Means values of 100-seed fresh weight (g) in pea genotypes 92

4.1.15 Means values of yield kg/ha in pea genotypes 94

4.1.16 Simple correlation cofficient for morphlogical traits among 75 pea

landraces

96

4.1.17 Eigen values for 15 traits of Pisum sativum L. Landraces 100

4.2.1 Means values of moisture content (%)among 46 genotypes of pea 103

4.2.2 Means values of crude fat (%)among 46 genotypes of pea 104

4.2.3 Means values of crude fibers (%)among 46 genotypes of pea 106

4.2.4 Means values of crude protein (%)among 46 genotypes of pea 108

4.2.5 Means values of carbohydrate (%)among 46 genotypes of pea 110

viii

4.2.6 Means values of ash (%)among 46 genotypes of pea 111

4.2.7 Means values of phenolics mg/g among 46 genotypes of pea 113

4.2.8 Means values of chlorophyll content mg/g among 46 genotypes of pea 115

4.2.9 Means values of pH among 46 genotypes of pea 116

4.2.10 Means values of total soluble solid (TSS) % among 46 genotypes of

pea

118

4.2.11 Simple correlation cofficient for biochemical traits among 46 pea

landraces

125

4.2.12 Eigen values for 10 traits of Pisum sativum L. Landraces 125

4.3.1 Polymorphism among pea genotypes generted by 20 primers

144

ix

LIST OF FIGURES

Figure No. Title Page

4.1.1 Dendrogram based on average linkage distance for 75 peas genotypes

98

4.1.2 Dendrogram based on average linkage distance for 15 traits

99

4.1.3 Scatter biplot diagram of 75 landraces of pea on the basis of morphological characterization

101

4.2.1 Dendrogram based on average linkage distance for 46 peas genotypes

120

4.2.2 Dendrogram based on average linkage distance for 10 traits

122

4.2.3 Scatter biplot diagram of 46 landraces of pea on the basis of biochemical characterization

123

4.2.4 Factor loadings 01 for biochemical traits of 46 pea landraces

126


127


128


129


130


131

4.2.10 Scree plot diagram of various factors 132

4. 3.1 PCR amplification products of AD51 primer among 46 pea landraces

133

4.3.1(b) PCR amplification products of AD51 (b) primer among 46 pea landraces

134

4.3.2 PCR amplification products of AA163.2 primer among 46 pea landraces

134

x

4.3.2 (b) PCR amplification products of AA163.2 (b) primer among 46 pea landraces

135

4.3.3 PCR amplification products of AA285 primer among 46 pea landraces

135

4.3.3 (b) PCR amplification products of AA285(b) primer among 46 pea landraces

136

4.3.4 PCR amplification products of D21 primer among 46 pea landraces

136

4.3.4 (b) PCR amplification products of D21(b) primer among 46 pea landraces

137

4.3.5 PCR amplification products of AD83 primer among 46 pea landraces

137

4.3.5 (b) PCR amplification products of AD83(b) primer among 46 pea landraces

138


138

4.3.6 (b) PCR amplification products of AA92(b) primer among 46 pea landraces

139


139

4.3.7(b) PCR amplification products of AA72 (b)primer among 46 pea landraces

140

4.3.8 Dendrogram based on average linkage distance of 20 SSR primers

147

xi

List of Abbreviations

Abbreviations Description AOAC Association of Official Analytical Chemist

ARA Acetylene-Reduction-Assay bHLH Basic Helix–Loop–Helix bp base pair oC Degree Celsius Ca Calcium

Cm Centimeter CF Crude Fiber CP Crude Protein CH Check DM Dry Matter D- water Distilled water dd H2O Double Distilled Water DNA Deoxy Ribonucleic Acid DNTPs Deoxy nucleotide tri phosphates

EAI Emulsion Activity Index EE Ether Extract ESI Emulsion Stability Index EST Expressed Sequence Tag GA Gallic Acid Gp Green-Pods G Gram GCV Genotypic-Coefficients of Variation g/L Gram per Litre H2O Water IRAP Inter-Retrotransposon Amplified Polymorphism 0 Absent K Potassium Kg Kilogram MDL Matured-Dry Legumes ME Metabolizablesenergy MgCl2 Magnesium Chloride mm Millimetre L Litre 1 Present N Nitrogen

xii

NaOH Sodium hydroxide NARC National Agricultural Research Centrer OM Organic Matter P Phosphorus PARC Pakistan Agricultural Research Council PCA Principal Component Analysis PCR Polymerase Chain Reaction PCV Phenotypic-Coefficients of Variation PGRI Plant Genetic Resource Institute pH Potential of Hydrogen PIC Polymorphism Information Content ppm Parts Per Million RBIP Retrotransposon- Based Insertionspolymorphism SSGL Shelf StablesGreen Legumes SSR Simple Sequence TPC Total PhenolicsContent TSS Total Soluble Solid UPGMA Unweighted Pair Group Method with Arithmetic

Averages UPOV Union for the Protection of New Varieties of Plants USDA United State Department of Agriculture UV Ultra Violet

xiii

ACKNOWLEDGEMENT

All praises and thanks are for Almighty Allah, The Compassionate, The Merciful, The

Only Creator of Universe, The source of all knowledge and wisdom, Who blessed me with

health, thoughts, talented teachers, caring brothers and sisters and opportunity to make some

contribution to already existing ocean of knowledge. I offer my humblest thanks from the core of

my heart to the Holy Prophet (Peace be upon him), who is forever a torch of guidance for

humanity.

First of all, I would like to thank my supervisor, Dr. Muhammad Jamil Ahmed, Professor

in Horticulture for accepting me as his student, for his keen interest, most valuable and inspiring

guidance, constructive criticism throughout the research work and preparation of manuscripts

and this dissertation. In general, without his help, the thesis would not have been possible to

present by now. I have learned not only science, but also the attitude of doing science from him.

I always say Thank you very much “Sir” for your unreserved and unflagging help.

I would like to express my deep and sincere gratitude to Dr. Malik Ashiq Rabbani,

Principal Scientific Officer, Plant Genetic Resources Institute, NARC, Islamabad who gave me

strong support and guidance throughout my research program.

Thanks to Syed Zulfiqar Ali Shah, Chairman Department of Horticulture for his valuable

comments, skillful suggestions and attentive teaching helped me a lot to improve my skills in

Horticulture.

Thanks to my committee members; Prof. Dr. Hamid and Dr. Shahid Iqbal Awan

Assistant professor in Plant Breeding and Molecular Genetics, who helped me a lot to finalize

this dissertation.

xiv

It is my pleasure to convey my appreciation for my best friends Andleeb Akbar, Nosheen

Kabir and Anisa Intikhab for their contributions in my study in various ways. Without their

support and encouragement, this dissertation would not have been possible.

I present my special thanks from core of my heart to Aqsa, Saba, Rida, Zeeshan, Sohail

bhai, Ishaq bhai, Ilyas bhai, Nazma and Maryam for their various help

in completing the research work. I am highly appreciative to all my colleagues and well wishers

for their support, constructive criticism and friendly behavior, they rendered during the whole

span of this study work. I will remember their cheerful company, immeasurable support and help

throughout my research program.

Special thanks for My Dear Brothers Azhar Arif, Ayaz Ahmed Arif, Fayyaz Ahmed

Arif, Loving Sister Aasma Arif, Sister in Law Samina Farooq and cute niece Maryam who had

never left me to walk alone in this journey of seeking knowledge. Thanks for their constant love

and support to help me walk through a lot of frustrations.

Thanks also to my lab members for helping me in many ways during my research.

My Special Prayer for my Grand Parents, whom I miss a lot because they are no more

with me but their prayers for me had never left me alone or felt me discouraged at any moment.

(May their souls rest in heaven Ameen).

Last but not least, I offer my gratitude and prayers to affectionate parents (May they live

long), who inspired me to higher ideals of life and sacrificed their comforts for my brightest

future. Whatever I am today could never have been without their efforts, prayers, good wishes

and sympathetic attitude.

Uzma Arif

xv

ABSTRACT

Study0for the0morphological, biochemical0and molecular characterization0of

summer grown pea landraces to select high yielding landraces for future commercial

production was conducted at experimental farm of University of the Poonch

Rawalakot, Food Technology Laboratory and Plant/Genetic/Resource Institute (PGRI),

National0Agriculture Research/Center (NARC)/Islamabad, during the year 2015 and

2016. The seeds of seventy-five landraces of pea were collected from four districts of

Azad Jammu Kashmir (Poonch, Bagh, Sudhnoti, and Mirpur) and NARC,

Islamabad. Most of the characters revealed significant differences among important

agro economic traits. Correlation1coefficients computed0among all0the quantitative

traits1revealed that0yield was showed0maximum positive0and highly significant

correlation with seed weight (g) (1.000). Pod length was showed maximum positive

and highly significant correlation with seed weight and yield (0.912). Based on

average linkage distance between genotypes, computed from morphological data,

following genotypes showed maximum variability, Meteor, L-10, L-50, L-57, L-

34, M-07, L-47, M-86, M-83, L-33, L-24, L-71 and L-64. Cluster based on

biochemical analysis revealed that maximum variability was contributed by

carbohydrates and total soluble solids, while genotypes L-13, L-21, L-25, L-7,

L19, L-27, L-31, L-32, L-34 and L-26 were also diverse and contributing

maximum toward variation. Dendrogram constructed on the basis of molecular

studies revealed these genotypes M-39, L-29, L-32, L-1, L-5, L-8, L-11, L-24, L-

19, L-17, L-25, L-23, M-102 and M-83 showed maximum diversity. Out of 20

amplification product scored, 595 were found out of which 357 were monomorphic

xvi

and 257 were polymorphic. PCA for morphological, biochemical and morphological

studies revealed 79%, 77% and 74%, respectively. Based on the results computed

through morphological, biochemical and molecular studies, it is clear that the present

germplasm has a rich source of variation. These genotypes0can be used in1future for

breeding/and producing high yielding/cultivars for off season growing of peas.

1

Chapter 01 INTRODUCTION

Pea (Pisum sativum L.), a leguminous crop, belongs/to family Leguminoseae. It

has an important ecological advantage because it contributes to the development of

low-input farming systems by fixing atmospheric nitrogen and it serves as a break

crop1which/further0minimizes/the/need0for externals1inputs. Legumes1constitute the

third/biggest group of flowering-plants, involving in excess of 6500genera and 18,000

species (Lock et al., 2005). Economically, legumes-represent the second most the

second0most essential-group of0crop1plants after/Poaceae (grass/family), representing

around1approximately 27% of the world's crop production (Graham and Vance, 2003).

Peas contain higher amount of protein1having fundamental1amino1acids0especially

lysine (Nawab et al., 2008).

1.1.1 Origin and Domestication

The origin0and0progenitors of Pisum sativum are not0well1known. The

Mediterranean1region, western1and central1Asia and/Ethiopia have1been indicated/as

centers-of0origin. Recently1the Food0and Agriculture/Organization (FAO) designated

Ethiopia1and western1Asia as centers of/diversity, with secondary1centers in/southern

Asia1and the Mediterranean/region. Archaeological1evidence of/the use/of/peas/dating

from080001BC has1been found/in the Fertile1Crescent. The first1cultivation/of 1peas

appears to have been in western Asia, from where it spread to Europe, China and India.

In/classical1times, Greek and Roman1authors mentioned1its cultivation as a pulse1and

fodder1crop. Pea0was already1known in the mountain0regions/of/Central/and/East

Africa1before the0arrival1of the Europeans1and was a0well-established/and/important

2

food0crop in Rwanda1and southwestern0Uganda/by 1860. The0use1of the/edible/pods

was/first described/in/the Netherlands0and France0during the/16th0century, whereas, the

use/of0immature0seeds1as/a/vegetable0began in0Europe a century1later. At1present,

Pisum0sativum is found9in all0temperate/countries and in most/tropical/highlands. In

Africa, garden0pea/and sugar1pea/are/mostly0considered/exotic/products. Those are

originally/of/some/importance, sugar/pea/2 more/in/Francophone countries, garden pea

more0in Anglophone0countries. Imported canned garden pea seeds are available

everywhere0in food0shops. Pea (Pisum0sativum L.) is/one0of the0world’s0oldest

domesticated1crop. Its zone of origin and initial domestication lies in the

Mediterranean, essentially in0the Middle0East. Before development, pea’s0together

with0vetches and0chickpeas were part0of/the/everyday1diet/of0hunter-gatherers toward

the0end/of0the last0Ice-Age0in/the/Middle0East and0Europe (Ambrose et al., 2011).

The range1of wild1representatives of P.0sativum stretches out from0Iran/and

Turkmenistan0through1Anterior/Asia, northern0Africa and/southern/Europe. In any

case, because of the early development/of0pea it0is difficult0to distinguish the exact area

of the center of its diversity, especially considering that large parts of the

Mediterranean1region and/Middle1East have0been substantially1modified by1human

activities1and changing1climatic-conditions. In addition, reliable1and thorough

passport0data are/often missing0or0incomplete for/the early/accessions0that0were

collected. The genus0Pisum contains0the wild0species P. fulvum found in0Jordan, Syria,

Lebanon0and/Israel; the cultivated1species P./abyssinicum0from Yemen1and1Ethiopia,

which1was likely domesticated1independently1of P. sativum and a large1and1loose

3

aggregate of both1wild (P./sativum0subsp./elatius) and cultivated forms0that0comprise

the1species P.0sativum in/a broad1sense (Ambrose et al., 2011; Ellis et al., 2011).

1.2. Morphology and Genetics of Pea

Pea0is one/of/the prominent winter vegetables grown in Pakistan. P. sativum is

an annual plant, with0a life0cycle/of one0year. It/is/a cool-season0crop/grown0in many

parts0of/the0world; planting0can take0place from/winter0to/early0summer, depending0on

location.0The plant is a diploid (2n=14). Flowers are fundamentally self-pollinating,

which0empowers reproducers to0make true0breeding/lines (Gill and Vear, 1980;

Hancock, 2004). Peas0are adapted0to numerous kinds of soil1types, but perform0best

on0fertile, light-textured, well-drained0soils (Hartmann et al., 1988; Elzebroek0and

Wind,02008). Peas0are sensitive0to soil0salinity and0extreme0acidity. The ideal0soil0pH

range0for/pea0production is/5.5 to 7.0 (Hartmann0et al., 1988). According to Janzen/et

al. (2014), pea0can fix0atmospheric/nitrogen through0symbiosis and/therefore does/not

need/nitrogen/fertilizer particularly since0it provide0nitrogen for0the crop0following it.

Pea also0tolerates drier0growing season0conditions and/limited0rainfall.

Pea1is a cool-season annual1vine that is1smooth and has a1bluish-green1waxy

appearance. Vines/can be/up to/9 ft/long, however/modern cultivars have shorter vines,

about/2 ft/long. Stem1is hollow1and/the/taller1cultivars cannot climb1without1support

(Elzebroek and Wind, 2008). Peas1have required1a1cool, relatively0humid/climate0and

are/grown0at/higher0altitudes/in tropics0with/temperatures from 7 to 30°C (Duke, 1981;

Davies, 1985). As a1winter1annual, pea1tolerates1frost1to -2°C at the1seedling1stage,

although1top growth1may be0affected/at -6°C. Winter0hardy peas0can withstand -10°C

and/with1snow cover0protection, tolerance1can be1increased to -40°C (Slinkard/et al.,

4

1994). Before blooming, crop can withstand some frost but flowers and pods are

susceptible to freezing temperature. A regular water supply promotes high yield but

excessive0rainfall induces0root rot (Hussain and Badshah, 2002).

1.3. Production and status of Pea

Pea is cultivated during winter in plains and during summer in highlands. In

Pakistan, pea/is an1important1crop, which plays a major r0le in farmer's econ0my. It is

cultivated1under an1extensive1range of agricultural1regions, but the1average yield per

hectare1is very1low as1compared to its1potential and yield1obtained in many1other

countries. Pea was1planted1about 45.4 th0usand/hectares/with/t0tal/producti0n of 29.8

thousand1tonnes of dry1peas (MNFSR, 2017). Pea/is/an/important/crop, which/plays a

major1role in1farmer's-economy. It is the1most1common1crop and enjoys1a great

commercial demand due to its nutritive value (Habib and Zamin, 2003). It represents

ab0ut040% of/the t0tal trade1in1pulses. In Pakistan, it is cultivated0below a wide range

of agricultural1regions, but1the average1yield per1hectare is quite1low as compared to

its potential1and yield1obtained in several1other1countries. In 2011-12, the crop was

grown over an1area of 15.8 thousand1hectares with0105 thousand1tones production0of

green0pea and average0yield was 166 mounds ha-1 (Anonymous, 2012).

Dry1pea is produced1in more than 87 countries1worldwide with1around one-a

large portion of the world's production occurring in Canada, France, China and Russia.

Other1leading pea1producing1countries include India, Germany, Australia, United-

Kingdom and United1States. Among1legumes, pea is a1critical product1with a rich

history in hereditary research going back to the traditional work by the father of

genetics, Gregor J. Mendel. It is grown1on an area of 528.71 thousand1hectares in

5

world and ranks fourth in production (441.530thousand0tons) among grain legume

after0soyabean, groundnut0and beans (Ashraf et al., 2011).

Though1the ancestral1pea/is0extinct, c0nsequent/wild0pea varieties0still exist in

the Middle1East (Weaver, 2003). As a rich1source of1proteins, carbohydrates1and

vitamins, peas are1important in0human nutriti0n. Consumed mostly as green peas, total

production/worldwide/is around 9.3 million tons. Pea is one1of the/6 major pulse crops

cultivated1globally1and is the second1highest yielding1legume in the world2after

common bean (Phaseolus vulgaris L.) Average green pod yield/of/peas in Pakistan is

quite2low (7.2/t/ha) compared1to that of several1other1countries. Dry pea1currently

ranks-second only-to common1bean as the most1widely grown1grain legume0in the

world0with primary1production in temperate1regions and global1production of 10.4 M

tones (FAO, 2016).

1.4. Nutritional Importance

Pea0seeds/are/rich0in protein (23–25%), slowly0digestible0starch (50%), soluble

sugars (5%), fiber, minerals1and-vitamins0(Bastianelli0et al., 1998). On an1overall

premise, vegetables contribute around 33% of mankind's immediate protein

consumption, while0additionally0filling in as an essential0wellspring of9grain and

scavenge-for creatures/and0of palatable0and mechanical0oils. One0of the most0important

attributes of legumes is their capacity for symbiotic nitrogen fixation, underscoring

their importance as a source of nitrogen in both natural and agricultural ecosystems

(Phillips, 1980). Legumes1also1accumulate1natural1products (secondary0metabolites)

such as iso-flavonoids that are considered helpful to human/health through anticancer

and1other0health-promoting0activities (Sumner and Dixon, 2003).

6

The fat9substance1of beans, peas, and lentils is generally very low, and there is

no0cholesterol. Protein0content is-high, more-than the amount of protein that is found in

cereal9grains (USDA 2015).

Another0imperative0segment of beans, peas, and lentils-is fiber. Fiber is a part

of plant1foods that0cannot0be1digested. Beans, peas, and lentils-have about 7 g of

dietary9fiber in a 1/2-cup serving and are particularly high in insoluble-fiber. Insoluble

fiber1bulks stool1and decreases transit1time through1the colon, thereby1preventing

constipation. The soluble fiber in beans, peas, and lentils is very fermentable in the

colon, which is1thought to being1health1enhancing. However, fermentation1also

produces1some gas (flatulence) that may cause1discomfort for some1individuals.

Enzyme preparations containing alpha-galactosidases may prevent some of the gas

production. Beans, peas, and lentils-are additionally-rich sources of some vitamins and

minerals, such as1folate, iron, potassium, and magnesium (USDA 2015).

The dietary0fiber found9in beans, peas, and lentils1may help to1reduce the

danger1of specific kinds0of cancer (Dahl et al., 2012). Beans, peas, and lentils-also

contain significant levels of antioxidants /and photochemical, which are substances

related1with preventing chronic diseases like1cancer (Sanchez-Chino et al., 2015). Pea

has also1been a model1system in plant/biology0since the work0of Gregor Mendel (Ellis

et al., 2011; Ross et al., 2011). Fundamental0discoveries1of Mendel1and1Darwin

established/the scientific1basis/of modern1plant-breeding in the1start of 20th century.

Similarly, current-progress in molecular1biology, genetic1and biotechnology1has

revolutionized plant breeding, allowing a shift toward molecular plant breeding and

adding to its interdisciplinary-nature (Mumm and Moose, 2008). In any1case, in spite

7

of the fact that the1techniques have been accessible for over 10 years, there is as yet an

extensive-gap0between/plant0biologists/engaged0in basic0research and plant0breeders.

1.5. Uses of Peas

Pea is a multipurpose crop, used for its chemicals, aesthetic value, forage crop,

pasture1crop, cover crop, green-manure, for feed and food (Nisar et al., 2007).

Recent studies have highlighted the potential health benefits of pulses in human

diet/including1a/reduced/risk/of/type II and cardiovascular1disease (Boye et al., 2010).

An increased demand for protein-rich food and feed has directed to renewed

commercial1importance in/pulse/crops/as a protein1source (Santalla/et al., 2001).

Field peas are principally1utilized for human1consumption or as0domesticated

animals feed. It is a major1source of0proteins (20 to025%) and potential1alternative to

soybean in1Europe (Barac/et al., 2010). It contains1high-levels/of1carbohydrates/and

total0digestible1nutrients (860to087%), which0makes it0an excellent1livestock feed

(Enderes0et al., 2016). Peas0are full0of nutrition1because its9grain-is rich in1protein

(27.8%), complex carbohydrates (42.65%), vitamins, minerals, dietary fibers and

antioxidant1compounds (Urbano/et al., 2003).

Peas are cultivated1for the/fresh/green/seeds, delicate1green-pods, dried/seeds

and0foliage (Duke, 1981). Green0peas are0eaten-cooked0as a/vegetable, and are

marketed0fresh, canned, or0frozen while/ripe-dried/peas are used/whole, split, or made

into0flour (Davies0et al., 1985). Green foliage of garden/pea is additionally1utilized/as

vegetable1in parts/of/Asia and/Africa. A few cultivars1are developed for their-delicate

green pods, which are eaten cooked or raw. Oil from matured seed has

8

antisexhormonic impacts; produces sterility and antagonizes effect of male hormone

(Duke, 1981).

Peas is either eaten as a vegetable1or utilized1as a part of the preparation of

soups. Also, it is also-used as animal1feed. Kevin McPhee, (2003) has revealed1that

pea-seed is exceedingly1nutritious and around a large-portion of the world1production

is fed to livestock1while the rest-of the bit is utilized for human-nourishment, basically

in developing1counties.

Increasing1demand of1protein-rich1raw-materials1for feed and food has led to a

greater1interest/in this1crop as1a protein1source (Santalla et al., 2001). It/is a/cheap

source1of protein that is known as poor-man meat in the developing1world and used in

rotation1with cereals1and oil seed0crops. It/provides balance0diet in-combination/with

wheat, rice/and other/cereals. Another1product/is prepared/by finely1grinding the/peas

and extruding1them under/pressure to create/different1shapes. The different/shapes are

then/fried, seasoned and packaged (Jambunathan et al., 1994). Seeds are thought to

cause dysentery1when eaten raw. In Spain, flour is considered/emollient and/resolvent,

applied as a cataplasm. It has been reported that seeds contain trypsin and

chymotrypsin which could be used for contraceptive, ecbolic fungistatic and

spermicide (Duke, 1981). Smart (1990) reported that there are no significant1amounts

of toxicity1or anti-metabolites in peas.

Protein0convergence of0peas ranges from015.5-39.7% (Davies0et al., 1985;

Bressani0and0Elias, 1988). Fresh0green-peas0contain per0100 g: 440calories, 75.6%

water, 6.20g/protein, 0.40g fat, 16.9 g carbohydrate, 2.4 g crude-fiber, 0.9 g ash, 32 mg

Ca, 102 mg P, 1.2 mg Fe, 6 mg Na, 350 mg K, 0.28 mg thiamine, 0.11 mg riboflavin,

9

2.8 mg niacin, and 27 mg ascorbic acid, while dried-peas contain: 10.9% water, 22.9%

protein, 1.4% fat, 60.7% carbohydrate, 1.4% crude-fiber, and 2.7% ash (Duke, 1981;

Hulse, 1994).

1.6. Landraces

Landraces are the major-source to cope the recent1problems (Zeven, 1998). Global

seed companies are providing new cultivars with high and uniform production,

significantly with reference1to maturity and seed size. These motives1mainly started

replacement1of landraces by these-cultivars, leading to landraces-erosion. Therefore,

identification and preservation of these landraces as genetic resources is most

important for the1future (Lioi et al., 2005). Still1no well-defined-variety has been

developed and provided1to the farmers by exploiting the natural-diversity (Landraces)

of the crop within Azad Kashmir. The proper0understanding of0genetic diversity0among

the0genotypes which0are already0adaptable to local0conditions is pre0requisite of0any

breeding1program of any1crop (Graham and Ranalli, 1997).

1.7. Molecular Markers

Molecular markers, based on polymorphism of DNA sequences, provide

information, which are independent of environmental conditions or the plant

development1phase. Several1methods, such0as/isozymes, restriction0fragment0length

polymorphisms/(RFLP), randomly0amplified polymorphic0DNA (RAPD), amplified

fragment1length0polymorphism (AFLP) and0SSR (simple/sequence/repeat) have/been

used0in the0analyses of/pea0genetic0diversity. Applicability0of SSR0markers in/plant

organisms0has been confirmed0for pea/corn, soybean, rice, barley, wheat etc. In/pea,

SSR1markers were/used/to/assess genetic/diversity (Baranger et al., 2004; Taran et al.,

10

2005) in evolutionary-studies (Ford et al., 2002) and to map locuses responsible for the

resistance0to diseases1or another0important1traits (Loridon et al., 2005).

Marker-assisted selection (MAS) may contribute to improve these complex,

polygenic1traits and9reduce/the need/for costly1field selection1trials. However, the

identification of quantitative trait0loci0(QTL)0and0linked0markers0exploitable0for

selection0is hindered1by the/fact that/the pea0genome is very0large (Ellis0&/Poyser

2002) and0not yet0sequenced.00,Several0pea0molecular linkage maps0have0been

constructed by integrating different types of markers, such as RFLP, AFLP, STS, SSR,

RAPD and/or CAPS. Taran et al. (2005) used AFLP, RAPD, STS, CAPS and ISSR

markers0to localize0QTL for yield components0and protein0content of two0sets of

recombinant/inbred/lines (RIL), reporting0loci/with consistent0or inconsistent0effects.

Single0nucleotide/polymorphisms (SNP) have0now become/the preferred/markers/due

to0their abundance0and uniform0distribution1throughout genomes1as confirmed by

molecular1linkage maps-produced. However, investigations0on the linkage1of SNP

markers with pea production, phenology or grain quality traits are relatively few

Burstin/et al. (2008) and/the/QTL/ability/to explain0sufficient phenotypic/variation/for

use in MAS is0controversial. One reason for that is the complex0and polygenic control

of/most/of these0traits, which/results/in/only moderate0cumulative QTL/effect.

Among0the0most broadly used0markers in crop0species are simple0sequence

repeats (SSRs) or0microsatellites (Blair0et al., 2007; Sarıkamiş0et al., 2009). They/are

highly reliable because they are reproducible, co-dominant in inheritance and

exceptionally highly polymorphic. In any case, SSR markers require a substantial

11

investment0of time and money to1develop, and henceforth, sufficient numbers for

high- density0mapping are not accessible for some crop-species.

1.8. Diversity

Envisaging the importance of this crop, there is a requirement for

improvement and to develop varieties suited to specific agro-ecological

conditions and also for specific end use. Genetic diversity is a important factor

that/determines/expectation of yield0improvement in0future. Knowledge0of0genetic

diversity within a crop and correlation among the yield contributing characters is

fundamental0for the0long-term/prevalence0of a breeding0program and maximizes0the

investigation/of germplasm-resources (Rahman et al. 2014). In order-to enhance yield,

genetic variability is the main factor since it is the source of variation and raw material

for yield0advancement0work (Mahbub/et al., 2015). Moreover, evaluation0of genetic

diversity is important to identify the source of genetic materials for an

individual trait within the available germplasm. Diversity analysis acts as an

effective tool to identify the degree of divergence among the biological materials

at genotypic level and to determine the relative contribution of various components to

the whole0divergence both0inter and0intra cluster/levels (Mahbub et al., 2016).

Rawalakot is a0sensational-city located in Azad-Kashmir, offering semi-tropic

flat area0of ground due to its upward0altitude. Rawalakot climate0restrain hot1and

moisture in summer-season, while at the same-time distant and cool in winter-season.

The temperature might rise up to 38 0C or 100 0F in the mid summer season and may

fall1down lower than -3 0C or 27 0F in the winter0season. Average-rainfall1during the

year 2018 was 983.19 mm.

12

Cultivars perform differently under various agro-climatic conditions and

different0cultivars of same0species grown0even in same condition and0environment

often have yield differences. Yield and quality of crop are very complex

characteristics0depending on certain biological0alignments between0environment and

heredity. The characteristics of a cultivar as well as combination of traits differ

according0to climatic0conditions of the0localities (Khokar/et al., 1998). Unimproved

varieties, local populations, show high degree of genetic diversity, thus, great

differences0occur0with respect to morphological0traits, time0to maturity, pod/size and

type, seed attributes, and yield (Santalla et al., 2001). These properties can be

improved0by selection0so0that yield0performance0can be increased. Pea crop has

promising future and attempt should be made to improve yield through the

development of high yielding landraces which are adaptable to local climatic

conditions.

Growing0vegetables during the0off-season has a lot of prospect0for export as

well as a good1earning by the1farmers. Among different-offseason vegetables, pea

(Pisum sativum L.) has prime importance as its demand1persists throughout1the year.

To the best of the authors’ knowledge, pea genotypes were never screened during

summer-season in agro-climatic-conditions of Rawalakot.

Keeping1in view the importance0of pea-crop and the importance of its genetic

diversity, the available1germplasm was evaluated1for economically important-traits,

phenotypic elaboration and their further utilization in the breeding programs. The

current study/was designed to/select some-morpho-physiological and yield0parameters

13

responsible0for higher yield of peas that could be helpful to0develop high1yielding off

season varieties in future.

These studies0were carried with following0objectives:

• To evaluate the landraces of pea cultivated in Azad Kashmir at morphological,

biochemical and molecular levels.

• To investigate genetic diversity through physico-chemical traits and SSR

markers.

• To identify suitable and high yielding summer landraces of pea to be used for

further crop improvement.

14

Chapter 02

REVIEW OF LITERATURE

2.1. MORPHOLOGICAL STUDIES

Fie1d0Pea (Pisum sativum L.), a commercia11y0imp0rtant crop0for food0and feed,

be1ongs0to fami1y0Fabaceae (former1y Leguminosae), sub0fami1y Papilionoideae. Fie1d

pea, c1assified0as Pisum sativum L. is a0coo1-season01egume or pu1se0crop. Pea is one of

the wor1d’s0o1dest0crops, cu1tivated as0ear1y as 9,000 years0ago. The adaptive0behavior

of exotic0pea (Pisum sativum L.) varieties0under 1oca10condition of Peshawar0studied

by Hussain0and Badshah, (2002) and found0that “C1imax” produced0more/number0of

pods0per0p1ant (19.3) whi1e01ess number0of pods/per0p1ant (13.8) was obtained0in P-42.

Variety C1imax out yie1ded fundamenta11y (5290.1 kg ha-1).

Agronomic0eva1uation/of0crop is important0for detecting0genetic/variabi1ity0and

for0genetic/improvement0of any crop0species. Performance0of nine pea0cu1tivars i.e.

AM-I, Samrina Zard, 226-Y/B, P-48. O1ympia, P-42. Meteor, Knight and P-I was

checked0under/Faisa1abad0conditions. Numerous0quantitative-attributes0qua1ities, for

examp1e, seed germination, p1ant height at the time of first f 1owering, fina1 p1ant

height, number0of 11eaves0p1ant-1, number0of days taken0to first0f1owering, number0of

pods per p1ant, pod 1ength, green pod weight, number of seeds per pod, green pod

yie1d and crop duration were examined. Every one of the parameters had all the

earmarks of being abso1ute1y hereditary characters, in 1ight of the fact that the

cu1tivars possessed high1y significant-difference among them, with the exception of

seed germination, which re1ies on physio1ogica1 period of seed at harvesting and

subsequent hand1ing, and crop duration which was significant on account of other

15

quantitative0characters. The cultivars0Knight, Meteor0and Samrina0lard followed0by

Olympia0were found high0yielding when compared0with different cultivars0due to their

ability0to create the higher0green pod0yields, while the performance0of AM-I and P-48

was poorer (Amjad0and Anjum, 2002).

Some morphological characters such as main stem length (cm), number of

branches per plant, leaf length (cm), number of leaves per main stem, number of

leaflets0per-leaf, diameter0of main0stem (mm), pods0main-stem-1 and seeds0pod-1 as

well as0agricultural-herbage0yield (t ha-1), dry0matter0yield (t ha-1), seed0yield (t ha-1),

crude0protein (%) were investigated0in Turkey, during the 1999-2002. The maximum

main0stem-length (124.38 cm), leaf0length (24.80 cm), number0of pods per0main stem

(16.53), herbage0yield (27.88 t ha-1), dry-matter0yield (7.32 t ha-1) and seed0yield (2.59

t ha-1) were determined0from the 16-K and 16-DY field pea0lines. K line has given

higher0values than four0lines for the number of0branches per-plant (5.57). Main0stem-

diameter ranged from 3.07 to 4.30 mm. Leaves/ main-stem (23.02), leaflets/leaf (6.83),

seeds/pod (7.69) and crude 0protein (17.55%) were noticed0in case of0various-pea0lines

(Tekeli and Ates, 2003).

Another study conducted0by Atta et al. (2004) to revealed0that pea seed0protein

content (SPC) and seed dry weight (SDW) are both impacted by hereditary and

ecological0factors or variables. To0assess the differences0of these within-plant0traits

between0seeds, six0genotypes were tried. The sequential0seed development at0nodes

along the main stem was determined. Nitrogen fixation was measured by the

acetylene0reduction0assay (ARA). At0maturity, protein0content and dry0weight were

measured according to seed position on the plant. Individual protein content were

16

determined by near-infrared0transmission0spectroscopy. The outcomes demonstrated a

critical0difference in protein0content between nodes0of the0genotypes Solara, L765 and

L833. Protein0content tended to0diminish from0the base to0the top0of the plant0for these

genotypes. The distinction0in protein0content between the0lowest and the0uppermost

node was around026 g kg–1 for0Solara, 40 g kg–1 for L765 and 49 g kg–1 for0L833.

There were likewise0critical differences0in dry-weight0between plant0nodes for0all

genotypes, aside from0Finale. Also, the trange0of difference in dry0weight between

plant0nodes was higher0than that0for protein0content.

Genetic0variability and character0association in 26 advanced lines of0vegetable

pea (Pisum sativum L.) in view of eight characters. The field experiment was

conducted at the research0farm, Bangabandhu0Sheikh Mujibur0Rahman Agricultural

University, Gazipur, Bangladesh. Analysis0of variance showed0significant differences

among0the genotypes0for all0characters. Phenotypic0coefficients of0variation (PCV)

were close0to genotypic0coefficients of0variation (GCV) for0all the parameters0except

branches per0plant, seeds per0pod, pods0per-plant, 100-seed0weight and0seed yield0per

plant. High0heritability related with0high hereditary progress was watched for0plant-

height, pod0length and seed yield per0plot. Critical0positive genotypic0and0phenotypic

relationship0between's seed yield0per plant and0days to 50% harvest, pod0length, pod-

breadth and0seeds per0pod were watched. Path0coefficient analysis0revealed that0days

to 50% blossoming, days0to 50% harvest, number0of branches per0plant, pods0per-

plant, seeds-per0plant and 100-seed0weight had positive0direct impact0on seed0yield

per0plant (Siddika et al., 2007).

17

The effect of agro-management0practices like, irrigation0and nutrition0on0two

pea (Pisum sativum L.) cultivars0named Climax and Meteor was studied at

Horticultural1Research0Area, U.A.F. Growth0parameters like0Main-stem0length (cm),

number0of leaves per0plant, leaf0Area (cm2), number of0pods per0plant, length of0pod

(cm), number0of seeds per0pod and reproductive0attributes like01000 seed0weight, seed

yield/hectare were contemplated. Climax gave maximum0seed0yield (2.24 tons) as

compared0to Meteor0with 2.33 tons0ha-1seed0yield. Irrigation0up to0seed0filling + P120

kg ha-1+ K100 kg ha-1 (T3) showed0better-performance0for vegetative0and0reproductive

parameters0comparatively most0astounding seed0yield 2.63 tons0ha-1 were found in T3

for0the two0cultivars of0pea when0contrasted with different0combinations (Ashraf et al.,

2011).

Gatti et al. (2011) characterized 13 accessions0of dry peas0of different0origins

from various growing regions in Argentina with the target of choosing those with

positive0qualities for0use in breeding0programs. Significant0differences were found0for

length0and width0of stipule and0pod, length0of the0internodes and0leaflets, plant0height,

total0number of0nodes, number0of nodes0at the first0pod, number0of days to0flowering

and0to harvest, number0of0pods and0seeds per0pod, 100-seed0weight and0grain

diameter, exhibiting a0high level0of hereditary0fluctuation. Phenotypic0relationship

examination exhibited that large pods delivered more seeds per pod, but the seed

weight decreased. Assessments0of genotypic0correlation-coefficients showed a0solid

natural0relationship among0the distinctive0attributes. Clustering0methods grouped0the

accessions into five0clusters. Cluster05 included0two-accessions0and demonstrated0the

most0astounding esteems0for length0and width0of0stipules (4.9 and 4.5 cm,

18

respectively), length0of0leaflets (7.43 cm) and0days to0flowering (122.6), while0cluster

3, with one accession, and cluster 4, with two accessions, demonstrated the most

noteworthy0esteems for0number of0seeds-per0pod (3.78 and 4.39), number0of pods0per

plant (5.330and05.70), length0of0pods (5.540and 5.720cm), and0width of0pods (1.210and

1.200cm, respectively). They presumed that0clusters 3 and 40would be helpful0for

crosses0with different cultivars0in pea breeding0programs.

An analysis was led on0botanical-characteristics0of chickpea0genotypes (Cicer

arietinum L.). In the0exploration, plant0height, first pod0height, number0of first0branch,

number0of second0branch and stem0diameter varied0between 38.330to 47.730cm, 23.87

to 34.270cm, 2.070to 2.800number0plant-1, 0.730to 2.030number0plant-1 and 4510to0584

µm, respectively. Results0demonstrated0that0genotypes were essentially0differing in

plant height and stem diameter while no significant differences were resolved in

alternate0parameters-measured (P < 0.05) (Cokkizgin, 2012).

The study was design0to screen the pea0material collected0from 61 different

locations0in order0to assess yield0and its0contributing traits (Mustafa et al., 2012). They

identified remarkable varieties with best traits and said that Avcilar and Ortakent

ecotypes0could be considered0for varietal0development as theses0ecotypes were high

yielding.

The performance0of 13 peas0genotypes for0higher-yield0and drought0tolerance

under0rainfed0conditions was studied by (Khan et al., 2013). Their0outcome

demonstrated0that in most0extreme case0yield was noted0in 2001-55 (10.43 t/ha) and

genotype 2001-55 exceeded expectations in number of seeds per pod (8.56) and pod-

length (9.330cm) while highest plant0height was seen in0Shareen (125.7 cm). Most

19

extreme 100-seed fresh0weight (49.50 g) was noted in0FS-21-87. Toward0the end they

suggested0genotypes 2001-550and FS-21-870for further0evaluation.

Likewise, Tolessa et al. (2013) assessed fourteen0field-pea0genotypes at 16

environments0in Ethiopia. Genotype × environment0interaction and yield0stability were

assessed0utilizing the additive main effects and multiplicative0interaction and site

regression0genotype plus0genotype × environment- association biplot. Pooled

examination0of fluctuation for0grain yield indicated significant (P<0.01) differences

among0the0genotypes, environments0and the0genotype × environment0interaction

effects. This demonstrated0that the genotypes0differentially reacted0to the changes in

the test0environments or the test-environments0differentially separated by the

genotypes0or0both. No single0assortment demonstrated0superior performance0in every

one0of the situations0however0genotype EH02-036-2, trailed by Co ll.026/01-4,

exhibited0top positioning0at five of0the sixteen0environments.

Another0analysis was directed0to assess the chick-pea-varieties for0yield

performance and adaptability under research and farmer managed conditions and

assess0farmer’s0preferences. Five0varieties Arerti, Shasho, habru, chefe0and0Dz-10-4

were planted0on 4.8m20plots0at spacing0of00.1m×0.3m. The0varieties Arerti0and0Habru

were selected0both by Researcher0and farmers0because of0its large seed0size, long0pod-

length, number of pod0per-plant, earliness0in maturity0and high0yield. The0best

yielding0varieties Arerti and Habru delivered01358.850kg ha-1, 1326.840kg ha-1 of

grain, 39.2 %0and 35.9%0more than0the standard0check (Dz-10-4), respectively at0on

farm0trials. Likewise more0than two0stations 1630.750kg ha-1, 1542.20kg ha-1 of0grain,

45.6 % and 37.7% more than Dz-10-4 was recorded by those two best yielding

20

varieties. It is therefore0recommended that0Arerti and0Habru which0had higher0yields

be adapted for cultivation in the study area and similar agro ecological zones of the

south0Ethiopia (Goa, 2014).

The objective0of this investigation was to0examine the genetic0diversity exhibit

in twelve Algerian pea genotypes utilizing 240agro-morphological0traits. The

experiment was done0in three growing0seasons (2013 to 2014, 2014 to 2015 and 2015

to 2016). ANOVA analysis revealed the presence of hereditary fluctuation for all

characters0contemplated. Additionally, expression of characteristics is very affected0by

the0environment. For0quantitative0traits, correlation studies showed that weight of 100-

seeds was significantly and0positively-correlated0with leaflet0length. Number of0pods

per 1 m² has a positive0significant-correlation0with leaflet-width. Weight of0pods-per 1

m² was correlated0with three0characters: Stipule0length, leaflet length and leaflet-

width. The principal component analysis revealed that three components clarified

85.92% of0variation. Two0groups were noted0by0dendrogram. The first0group (demchi

1, p069, bouch1, p539, p593, p595 and p596) was characterized by a high pod0yield;

the other0group comprises0the less productive genotypes (p071, sefrou, p072, p073 and

p350). Something else, the genotype p593 produced the best results for pods yield

(Ouafi et al., 2016).

21

2.2. BIOCHEMICAL STUDIES

Pea (Pisum sativum L.), faba bean (Vicia faba L. spp. minor), and lentil (Lens

culinaris Medik.) meals, protein-concentrates0and-isolates were analyzed for

proximate composition, oligosaccharides, and amino acid composition. Protein

quality was evaluated1using a mouse-bio-assay. The concentrates contained 59.2 to

70.6% and0the isolates086.7 to 90.8% protein (N × 6.25) on1moisture-free0basis.

Glucose, sucrose, raffinose, stachyose and verbascose were present in the highest

concentrations in the protein concentrates (7.1 to 11.1%), the pea protein concentrate

contained 8.7% sugars0and0faba0bean0and0lentil0protein0concentrates 7.1% and 6.6%

respectively. The protein isolates were almost free (containing less than 0.79%) of

the sugars. Amino acid0composition0of the0meals, concentrates0and isolates0showed,

as expected, sulfur-amino0acid deficiency, which was probably0largely0responsible

for1the0low0protein0efficiency0ratios (0.75 to 1.18), and net protein ratios (0.25 to

0.73) of the three products, compared to values of 2.56 and 2.18n respectively

obtained for casein. The protein0digestibility0of0the0meals, concentrates0and0isolates

(81 to 90%) were similar to that of0casein (87%). The poor0growth-promoting

abilities0of1the0meals, concentrates0and0isolates0were possibly-also0due0to0growth-

depressing factors0such as0tannins, trypsin inhibitors0and0hemagglutinins0present,

particularly0in0faba0bean0and0lentil (Bhatty and Christison, 1984).

The performance of twelve0pea0cultivars (yellow-, green- and0brown-seeded)

that were evaluated for chemical composition and digestibility in poultry studied by

(Igbasan et al.,1997). The evaluation involved analyses for protein, amino acids

(AAs), fat, starch, dietary fibre, ash, calcium, phosphorus and tannins. True

22

metabolizable0energy [nitrogen corrected (TMEn) and uncorrected (TME)] and true

AA bioavailability values were also determined with adult cockerels. The cultivars

demonstrated an extensive variety of0protein (207.5– 264.00g kg– 1) and0starch (385.3–

436.80g kg– 1) substance which were not identified with the seed coat colours. The

concentrations0of0several0AAs0varied0among0the0cultivars. With the exception of

arginine, the0concentrations of0all1other essential0AAs on a protein0basis-decreased1as

protein0levels increased. Out0of 100essential0AAs0including0cystine, only1arginine0had

a positive0correlation (r = 0.79) with protein0content. The0dietary-fibre0contents varied

between 190.7 and 223.1 g0kg–1 and the values were slightly higher in the brown-

seeded cultivars. The brown-seeded cultivars contained appreciable quantities of

tannins, while the0yellow-0and0green-seeded0cultivars0were devoid of tannins. The

cultivars were almost devoid of fat and calcium but relatively high in phosphorus.

Starch0and0dietary0fibre0were0negatively0correlated0with0protein0content (r = –0.78 and

–0.46, respectively), and0accounted0for0the0greatest-difference0in0protein0content. The

TME0values ranged from 11.60to 13.30MJ kg–1 while the TMEn0values ranged from

11.0 to 12.90MJ kg–1. The mean availabilities of AAs ranged0from a high of 89.6 to a

low of 75.9%, with total sulphur0AAs (cystine0and0methionine) having the0lowest

value and glutamic0acid1having the highest0value. There was a trend (P ≤ 0.05)

towards1lower0AA0bioavailability0values0in0the0brown-seeded0cultivars. It0can0be

concluded0that0these0cultivars0varied0in0chemical0composition, metabolizable0energy

content0and bioavailability0of AAs.

23

It has been documented that a physico-chemical properties of Beach pea

(Lathyrus maritimus L.) seeds were evaluated1and their proximate composition were

determined. Results were also0compared0with0those0of0green0pea (Pisum0sativum L.)

and field0pea (Lathyrus sativus L.) Beach-pea0seeds0had0a0very0low0grain0weight,

density, hydration0capacity, hydration0index, swelling0capacity and swelling0index as

compared0to0green0pea0and0field0pea. The contents0of1crude0protein (29.2%), crude

fibre (12.0%), reducing0sugars (0.2%), total0phenolics (1.2%) and ash (3.0%), and0total

free amino acids (0.6%) of beach pea were substantially higher than other pea

varieties0examined. The contents of cysteine (1.6%), methionine (1.1%), and

tryptophan (0.3%) in beach pea0proteins were low, but higher0than those0in green0pea

and0field0pea0varieties0from0Canadian0and0Indian0cultivars. Beach0pea0lipids0were

dominated by linoleic acid (69.1%) and were similar to green pea (45.1%) and

Canadian0grown0field0pea (57.0%). The macroelements0of beach0pea were dominated

by potassium (476 mg/100 g), phosphorus (413 mg/100 g), magnesium

(1180 mg/100 g) and calcium (144 mg/100 g). The contents of0microelements, namely

manganese, zinc, and0iron in beach0pea were 3.5, 3.0 and 9.4 mg/100 g, respectively

(Chavana et al., 1999).

Amarteifio et al. (2002) investigated the raw seeds of six varieties that were

analyzed0forsdry0matter, crude0fat, protein, fiber, and ash, using Association0of

Official0Analytical0Chemists0procedures. Major0minerals, Ca, K, P, Mg, Na and

trace minerals, Cu, Fe and Zn were also assessed. The ranges1of nutrient

contents0obtained were: dry smatter 86.6–88.0%, crude0protein 19.0–21.7%, crude

fat 1.2–1.3%, crude fiber 9.8–13.0%, and1ash 3.9–4.3%. Minerals0ranges (mg/100 g

24

dry matter) were: K 1845–1941, P 163–293, Ca 120–167, Mg 113–127, Na 11.3–

12.0, Zn 7.2–8.2, Fe 2.5–4.7 and Cu 1.6–1.8. There were1no significant1differences

in Na among the six varieties (P>0.05). For the other components, varietal

differences (P < 0.05) were observed. The values0obtained0for0the0dry0matter, crude

protein, fat, ash, Ca, Cu, Fe, and Mg were similar to those in pigeon peas grown

elsewhere, while1those for crude fiber and Zn were-higher. In general, the

composition0of0pigeon0peas0compared0favorably0with0those0of0other0legumes0such0as

Bambara-groundnut (Vigna subterranea).

Pulses (pea, chickpea, lentil and bean) are an0important0source of0food

proteins. They contain0high amounts0of lysine, leucine, aspartic0acid, glutamic0acid

and arginine and provide well balanced essential0amino acid profiles when consumed

with cereals1and other foods rich in sulphur-containing amino2acids and tryptophan.

The protein content of most pulse legumes fall within the range of 17–30%. Apart

from0their nutritional0properties, pulse proteins also possess1functional1properties

that play an important role in food formulation and0processing. Examples of such

functional0properties include solubility, water and fat binding0capacity and0foaming.

Pulses, especially when blended with cereal proteins, may offer a promising

alternative0source for0nutritional and functional0proteins. This review0provides an

overview of the characteristics of pulse proteins, current and emerging techniques for

their fractionation, their major functional properties and opportunities for their use in

various applications (Boye et al., 2003).

El-Adawy et al. (2003) performed0an experiment to0check the response0of

mung0bean, pea and lentil0seeds that were germinated0for 72 hr and 120 hr at0room

25

temperature (25 ± 2 ◦C) and to determine0the changes0in their0chemical0composition,

antinutritional factors, in vitro digestibility and functional properties. Germination

caused0a significant (P<0.05) decrease0in total0protein, fat0and carbohydrate0contents

with increased0germination time in all0legume-seed0flours while non-protein nitrogen,

ash0and fiber0contents were significantly (P<0.05) increased. Mineral0contents (Na, K,

Ca, P, Mg, Fe and Mn) increased during germination of legume seed flours.

Significant (P<0.05) decreases were observed0in carbohydrate0fraction0contents

(starch, reducing sugars, stachyose and raffinose) of legume0seed flours

during0germination. Germination resulted in a significant (P<0.05) decrease in the

antinutritional0factors of all0germinated1legume0seed0flours. The levels of0trypsin-

inhibitors and tannins decreased in the first stage of germination (72 hr) then

increased0gradually in the last1stage of germination (120 hr) but0remained lower than

the0controls. Reduction0in phytic0acid and hemagglutinin0activities increased1with

increased germination0time. Germination significantly (P<0.05) improved in vitro-

protein0digestibility. Protein0solubility0indexes, water0absorption and0emulsification

capacities, foam capacity and foam stability were significantly (P<0.05)

improved0with increase in germination0time while fat0absorption0decreased.

This study0investigated the composition of pigeons peas (Cajanus cajan),

grown0at Sebele, Botswana. The raw0seeds of six0varieties1were analyzed for dry

matter, crudes fat, protein, fiber, and ash, using1Association0of0Official

Analytical0Chemists0procedures. Major0minerals, Ca, K, P, Mg, Na and0trace

minerals, Cu, Fe and Zn were also0assessed. The range0of nutrient0contents0obtained

was: dry matter 86.6–88.0%, crudes protein 19.0–21.7%, crudes fat1.2–1.3%, crudes

26

fiber 9.8–13.0%, and ash 3.9–4.3%. Minerals1ranges (mg/100 g dry matter)were: K

1845–1941, P 163–293, Ca 120–167, Mg 113–127, Na 11.3–12.0, Zn 7.2–8.2, Fe2.5–

4.7 and Cu 1.6–1.8. There were no significant differences in Na among the six

varieties (P>0.05). For0the0other0components, varietals differences (P<0.05) were

observed. The values0obtained0for the dry0matter, crudes protein, fat, ash, Ca, Cu, Fe,

and Mg were similar to those in pigeon peas grown elsewhere, while those for crude

fiber0and Zn were0higher. In0general, the0compositions of pigeon peas compared

favorably0with those of other legumes such as Bambara-groundnut (Vigna

subterranea). The levels0of crude0protein, crude0fiber, K, Ca, P and Mg indicated0that

pigeonspeas0could be valuables in the diet of the people of Botswana. This0crop0would

positively contribute protein in the diet and the diversification0of agricultural0produce

(Amarteifio et al., 2002).

To0determine the0effect of0mildshydrothermal0treatment and the0addition of

phytase0under optimal0conditions (pH 5.5, 37°C) on0the nutritive0utilization of0the

protein0of pea (Pisum sativum L.) flour was studied (Urbano et al., 2003) in0growing

rats by0examining0the chemical0and biological0balance. Mild0hydrothermal0treatment

produced0reductions of 83, 78, and 72%, respectively, in the levels0of R-galactosides,

phytic0acid, and trypsin0inhibitors and also produced a significant0increase in the

digestive0utilization of0protein. The additional0fall in the levels0of phytic0acid caused

by the0addition of0phytase did not0lead to a subsequent0improvement in the0digestive

utilization of protein. The mild hydrothermal treatment of pea flour produced a

significant increase in the metabolic0utilization of protein0and0carbohydrates, which

27

was reflected1in the protein efficiency ratio and food transformation growth indices.

These effects1were not observed in the phytase-supplemented1pea diet.

The0effects of0germination for 2, 4 or 6 days0with and without0light, on the

proteolytic0activity, the0contents1of soluble0protein and non0protein nitrogen, and the

amount0of available0starch of (Pisum0sativum L.) as0well as their0nutritive0utilization

by growing0rats were studied0by (Urbano et al., 2005). Food0intake0increased

significantly0when the peas were germinated1for 2 or 4 days. This0improvement was

correlated0with the reduction0of factors0responsible for0flatulence. Digestive0utilization

of0nitrogen was similar (among0all the groups0fed germinated-pea flour) to0raw-pea

flour. The0values0for nitrogen0balance, percentage0of retained0to absorbed0nitrogen,

protein0efficiency0ratio, and index0of available0carbohydrates were significantly higher

among0the animals0that consumed0peas allowed0to germinate0for 2 or 4 days0than

among0the animals0given the raw-pea or 6-day-germinated0pea0diets. It was

concluded0that germination0of peas for 2 days0would be sufficient0to0significantly

improve the palatability and nutritive utilization of protein and

carbohydrates0from Pisum sativum L. The presence0or absence0of light0during the

germination0process did not0affect the results0achieved.

Yalcin et al. (2006) studied the physical0properties of pea0seed as a function of

moisture0content. The average0length, width0and0thickness were 7.80, 6.410and 5.55

mm, respectively, at0a moisture0content of010.06 % dry0basis (d.b.). In the0moisture

range0from 10.06%0to 35.08% d.b., studies0on rewetted0pea seed1showed that the

thousand0seed0mass increased1from 177.70to 214.1 g, the projected0area from 30.840to

44.080mm2, the0sphericity0from 0.8360to 0.851, the0porosity0from 38.64%0to 40.32%

28

and0the terminal0velocity from 9.00to 9.4 m/s. The static0coefficient of0friction0of0pea

seed0increased the linearly0against0surfaces0of0four structural0materials, namely,

rubber (0.388– 0.413), aluminium (0.292–0.351), stainless0steel (0.270–0.311) and

galvanized iron (0.360–0.409) as the moisture0content increased0from 10.06%0to

35.08% d.b. The bulk0density decreased1from 712.10to 647.50kg/m3 and the0true

density from 1160.5 to 1085.0 kg/m3 respectively, with an increase in moisture0content

from 10.06%0to 35.08% d.b.

This study was1carried out0to determine the effect of0moisture1contents0on

physical0properties of some0grain legumes0seeds such as kidney0bean (Phaselous

vulgaris), dry0pea (Pisum0sativum), and0black-eyed0pea (Vigna0sinensis) seeds. Three

different0moisture contents0for each grain0legume were evaluated. The average0length,

width, thickness, geometric0mean0diameter, and0it mass0of0seeds ranged0from 16.66,

8.86, 7.17, 10.17 mm and 0.715 g for kidney bean; 7.46, 6.02, 4.49, 5.85 mm and

0.158 g for pea; 9.19, 6.96, 6.26, 7.32 mm, and 0.255 g for black-eyed pea at a

moisture content of 8.21 %,8.20 %,and 5.66 % (wet basis), respectively. The

sphericity, thousand-seed0mass (1000-seed mass), and0projected1area0increased,

whereas the bulk and1kernel0densities-linearly decreased1within increase in0moisture

content0for each grain0legume0seed. The0porosity, the volume0of seed, and angle0of

repose0increased for0three grain0legumes seeds, whereas the angle0of repose0decreased

for black0eyed pea seeds in0the moisture0contents studied. The static0and0dynamic

coefficient0so friction0on0various1surfaces2namely, galvanized metal chipboard,

mildsteel, plywood, and0rubber0also linearly increased with an0increase in0moisture

content0of each grain legume0seed (Altuntas and Demirtola. 2007).

29

The chemical composition and functional properties of two under utilized

legume0seeds (Jack bean and Pigeon pea) flours were compared with that of the

popularly consumed Cowpea seed flour found in Nigeria. The three seeds were

sampled0from the six0geo-political0zones in Nigeria and each of them was0separately

ground0and sieved into0powder and analyzed0for proximate0composition, minerals0and

functional0properties. The result revealed that Jack bean seed flour had the

highest1composition of ash (6.51±0.28%), protein (26.20±0.40%), carbohydrate

(57.83±0.80%), potassium (2.20±0.40mg/g), foam capacity (20.67±0.41%) and

emulsion capacity (71.73±0.44%); Pigeon pea had the highest1compositionsof fat

(4.78±0.22%), fibre (1.10±0.10%), energy (369.38±0.05kcal/100g), calcium

(0.65±0.03mg/g), sodium (2.20±0.01mg/g), magnesium (1.55±0.01mg/g),

phosphorous (55.00±0.20mg/g), least gelatin concentration (6.00±0.10%), oil and

watersabsorption1capacity (148.17±%0.37; 189.77±0.28% respectively) and1Cowpea

had the highest value of1iron (0.80±0.03mg/g), zinc (1.62±0.03mg/g), copper

(0.57±0.10mg/g), foam (15.70±0.31%) and emulsion (15.20±0.37%) stability

(Olalekan and Bosede, 2010).

Tresina et al. (2010) conducted an experiment on three different varieties0of

the1Vigna mungo L. Hepper were analyzed for0their proximate0and0mineral

composition, vitamins (niacin and ascorbic acid), protein fractions, amino0acid0profile

of0total seed0proteins, fatty0acid profile0of seed0lipids, in vitro0protein digestibility0and

certain antinutritional0factors. The major0findings were as follow: crude0protein0content

ranged from 24.37 – 26.22%, crude lipids2.94 – 4.24%, total dietary-fibre 4.24 –

5.47%, ash 2.98 –3.33%, carbohydrates 61.24 – 64.43% and calorific value 1603.65 –

30

1691.81 kJ 100-1 g DM. Seed0samples contained0minerals such as Na, K, Mg and P

in0abundance. The ratios0of Na/K ranged from 0.16 – 0.19% and Ca/P 0.68 – 1.19%.

Albumins1and globulins seem to be the principle protein of the investigated Vigna

mungo varieties. The essential0amino0acid profile0of total0seed0proteins were found0to

be high when compared to the FAO/WHO (1991) recommended pattern. The

fatty0acid0profiles of0all the three0varieties revealed0that the seed-lipids contained

linoleicsand0linolenic acid in high0concentration. The anti-nutritional0factors ranged

from: total0free0phenolics=0.48 – 1.41% and tannins 0.62 – 0.70%.

In another0experiment Barac et al. (2010) studied the extractable0protein

compositions, technological-functional0properties of0pea (Pisum sativum L.) proteins

from six genotypes0grown in Serbia. Also, the relationship0between these

characteristics were presented. Investigated0genotypes showed0significant0differences

in storage0protein content, composition0and extractability. The ratio0of vicilin: legumin

concentrations, as well as the ratio of vicilin + convicilin:

Legumin0concentrations0were positively0correlated with0extractability. Our0data

suggest0that the higher0level of vicilin0and/or a lower0level of legumin have a0positive

influence on0protein extractability. The emulsion activity index (EAI) was

strongly0and positively0correlated with the solubility, while no0significant correlation

was found between emulsion-stability (ESI) and solubility, nor

between1foaming0properties and solubility. No0association was evident

between ESI and EAI. A moderate0positive correlation between emulsion0stability and

foam0capacity1was observed. Proteins0from the investigated0genotypes expressed

significantly0different emulsifying0properties and foam0capacity at different pH

31

values, whereas0low foam0stability was0detected. It0appears0that genotype0has

considerable influence on content, compositionsand1technological-functional

properties of1pea bean proteins. This0fact can be0very useful0for food0scientists in

efforts0to improve0the quality0of peas1and0pea protein0products.

The aim of0this0study was to0determine the dry0matter (DM), ash, organic

matter (OM), crude0protein (CP), ether0extract (EE), crude0fiber (CF), total0sugars,

starches0and0estimate the metabolizable0energy (ME), in ruminants, pigs, poultry,

horses0 and pets (dogs and cats) and digestible0energy (DE) in rabbits0from the 10

most productive0field-pea0genotypes (Pisum sativum L.) obtained0in a trial0with 4×20

different0genotypes. The results (% DM - genotype) allowed0us to0state the0following:

all the 100field pea0genotypes grain were an important0source of0energy (cytoplasmic

carbohydrates) with high0percentages of0soluble sugars (7.95% ISARD to 9.42%

ENDURO) (P<0.05) (Rodrigues et al., 2012).

To explore0the extent0of the variation0for important0seed traits0present in a0set

of028 field0pea landraces collected from various regions of Turkey. A high level0of

variation0was observed for the content0of0protein, crude0fat, ash, fiber0and starch. Seed

weight, volume0and density0also varied markedly, as did hydration0capacity, swelling

index0and cooking0time. The capacity0of the0landraces to0accumulate trace0minerals

(Cu, K, Ca, Mg, P and Zn) also varied. Trait0correlations were established, although

the genetic component of these remains uncertain pending multi- location testing.

Landraces0which produced0either seed0with high protein0content or which0had a0short

cooking0time were identified. One0of the high0protein types0also was a0good

accumulator0of Zn, P and Mg. Our0results provide0an initial0step toward0the

32

identification0of field0pea landraces0that may be useful0for the development0of high-

quality0field pea0cultivars (Ozer et al., 2012).

Likewise Sila and Malleshi, (2012) studied that the premature0green legumes

are good0sources of0nutraceuticals/and antioxidants0and are consumed0as snacks0as

well as0vegetables. They0are seasonal0and have limited0shelf-life. Efforts0are provided

to0prepare shelf-stable0green legumes0to extend0their availability0throughout the0year.

Green0legumes from0chick pea0or Bengal0gram (Cicer arietinum L.) and field0bean

(Dolichos lablab L.) have been0processed to0enhance their0shelf-life, and0determined

their0nutritional, physico-chemical0and nutraceutical0qualities. The0shelf stable0green

legumes (SSGL) show higher water absorption0capacity compared0to matured-dry

legumes (MDL). The total0colour change0in the0processed/dried0SSGL and0MDL

samples0increased significantly (P ≤ 0.05) compared to the freshly0harvested green

samples. The carotenoid0content of Bengal0gram and field0bean SSGLs0are 8.0 and

3.2 mg/100 g, and0chlorophyll0contents are 12.5 and 0.5 mg/100 g, respectively,

which0are in negligible0quantities in matured0legumes; the corresponding0polyphenol

contents0are 197.8 and 153.1 mg/100 g. These0results indicate0that SSGLs0possess

potential0antioxidant0activity.

The Sharma et al. (2013) experiment0performed to investigate the

changeability in dietary arrangement, mineral profile, anti-nutritional0factors

and in0vitro starch edibility of five0desi and four kabuli chickpea0cultivars.

Proximate synthesis fluctuated altogether (P<0.05) among various kinds of

chickpea0cultivars. The unrefined0protein0content changed from018 to031%

being0higher in Kabuli0chickpea cultivars0than desi0chickpea. The0iron was the

33

most0copious mineral0present in each0of the cultivars0of0chickpea (4.6 to

10.5%). Among0anti-nutritional0factors tannin0fixation went from 0.07 to 0.22%

and trypsin inhibitor's substance extended from 9 to 31 mg/g in both the

cultivars0of0chickpea.

Witten et al. (2015) to0studied the composition0of organically0produced0field

peas and field beans as a source of valuable protein for the planned 100 %

organic feeding regulations in organic farming. For this reason, the influence of

environment0and variety0on the contents0of crude0nutrients and the0amino acids0lysine,

methionine, and0cysteine0were examined over three0years. Peas contained on an

average 21.9 g crude0proteins100 g-1 dry0matter with 8.00g lysine0100 g-1, 1.0 g

methionine0100 g, and 1.4 g0cysteine 100 g-1. Environmental0factors and0interactions

also0had influences on the composition0of legume0species. Furthermore, significantly-

negative0correlations were found0between the content0of0crude0protein and0starch (r =

-0.79), sugar (r = -0.55), lysine (r = -0.78), methionine (r = -0.61), and0cysteine (r = -

0.55) in0field0peas.

The aim of this study was to investigate the nutritional and anti nutritional

factors0of0the0two0local0varieties0of0red0gram0seeds. The results0obtained1are presented

as mean0percentage for0moisture1contents0as08.92, ash, 3.21, dietary0fiber, 6.60,

protein, 23.23, Fat, 1.450and total0carbohydrate as 53.230respectively. The study0also

elicited0the mean manganese0content to0be 1.76, copper01.80, iron05.95 and zinc03.52

mg/100g of dried sample respectively. The mean content of galactosyl

oligosaccharides0for the0two varieties0was found0to be 1.42%, for raffinose, 1.75% for

stachyose0and 4.95% for verbascose0respectively. Raffinose0family sugars in split0dhal

34

and immature0seeds were found0to be 0.85 and 1.00%, for0raffinose, 1.54% and

1.11%, for0stachyose and 4.20 and 1.38% for0verbascose0respectively. The0mean

content0of trypsin0inhibitor was 199.40 (TIA)/g sample0and chymotrypsin0inhibitor

was 270 (CIU)/g0sample (Aruna and Devindra, 2016).

Breeding and selection of winter pea for seed quality is a serious

challenge to every breeder. The result of breeding mainly depends on good

knowledge of the genetic material. Chemical and technological analysis was

necessary0for accurate0determination of0the following0traits of technologically0mature

seed0of the winter pea0collection: protein0content, total0nitrogen0content, total0sugars

content, starch0content, fatty oil0content, cellulose0content, and ash0content (g 100 g-1).

Protein0content in tested0lines of pea0ranged 22.86-28.04 g 100 g-1, total0nitrogen

content 3.66-4.49 g 100 g-1, total0sugars0content 10.30-14.67 g 100 g-1, starch0content

39.44-46.23 g0100 g-1, fatty0oil0content 1.48 1.89g0100 g-1,cellulose0content08.79-10.28

g 100 g-1, ash0content 3.08-3.670g 100 g-1. PCA0analysis was used0to mark out the0three

components, which0collectively explained081.59% of0the t0tal variation. The first0one

was mainly0defined by ash0content, total0nitrogen, protein0and0cellulose. The second

main component, independent from the first one, was mainly correlated to fatty oil

content and starch, while the third was defined by the content of total sugars

(Cervenski et al., 2017).

35

2.3. MOLECULAR STUDIES

Baranger et al. (2004) studied 148 Pisum accessions/using01211protein- and

PCR-based0markers. This molecular0marker-based classification0allowed tracing/major

lineages/of pea/breeding and to0follow/the main breeding0objectives/and0improvement

of0frost/tolerance0for winter-sown0peas. The0classification/was/largely0consistent/with

the0available pedigree0data, and0clearly/resolved0the different0main/varietal1types

according0to their0end-uses (fodder, food0and feed peas) from0exotic types0and0wild

forms. Fodder types were further separated into two sub-groups. Feed peas,

corresponding to either spring-sown or winter-sown types, were also separated, with

two0apparently different0gene0pools for0winter-sown0peas. The garden0pea/group was

the most difficult to structure, probably due to a continuum in breeding of feed peas

from0garden0types. The classification also stressed0the paradox between the1narrowness

of the genetic basis of0recent cultivars0and the very large diversity/available within

Pisum sativum.

This experiment was conducted to provide1reliable and cost1effective

genotyping conditions, level of polymorphism in a scope of genotypes and map

position0of/recently/created/microsatellite0markers/to advance0expansive/utilization0of

these0markers/as0a typical/set0for genetic0studies in pea (Loridon et al., 2005). Optimal

PCR conditions-were determined for0340 microsatellite1markers based0on

amplification0in eight0genotypes. Levels1of polymorphism were determined1for 3091of

these1markers. Compared1to data1obtained/for1other1species, levels1of/polymorphism

detected1in a panel1of eight1genotypes were high with a mean0number of03.81alleles0per

polymorphic0locus0and an average0PIC value of00.62, indicating0that pea0represents a

36

rather0polymorphic1autogamous0species. One1of the main0objectives/was to1locate a

maximum0number of/microsatellite0markers0on0the0pea/genetic/map. Data/obtained

from0three/different0crosses were0used/to0build a0composite/genetic0map of 1,4300cm

(Haldane) comprising1239 microsatellite1markers. These includes2160anonymous

SSRs1developed/from1enriched/genomic1libraries and113 SSRs1located/in1genes. The

markers were quite1evenly/distributed1throughout/the seven1linkage/groups1of the1map,

with185% of1intervals/between1the/adjacent1SSR-markers0being/smaller1than110 cm.

There1was a good1conservation/of1marker/order1and linkage1group/assignment1across

the three1populations. In conclusion, this0report was expected1wide application1of0these

markers and0allow information0obtained by0different/laboratories0worldwide0in0diverse

fields1of pea1genetics, such as1QTL mapping1studies and1genetic resource1surveys, to

be easily1aligned.

(Burstin et al., 2008) studied1the genetic1variability/among112 pea1genotypes.

Thirty-one genotypes were polymorphic and the average number of variants per

marker1was 3.6 when1considering/only0polymorphic0markers. Overall, the number0of

variants1for a given1SSR/marker0was correlated0with the length1of the0SSR0but some

12-bp long0SSRs showed1the same0degree0of0polymorphism as longer0ones. The

groupings resulting from the SSR genotyping among the 12 genotypes gave an

interesting0insight into1the possible0origin of1one/recent0cultivar. Database-derived

SSR0markers are highly1variable. They1can provide1useful1information1on the0genetic

diversity0among P. sativum0cultivated0type.

Smykal et al. (2008) made a standard1classification by 121morphological

descriptors1and a classification1by biochemical-molecular1markers. Two1isozyme

37

systems, 10 microsatellite0loci, 2 retrotransposons0for multilocus0inter-retrotransposon

amplified polymorphism (IRAP), and 12 retrotransposon-based insertion

polymorphism (RBIP) DNA0markers0were analyzed. The main1objective of0the0study

was1to examine0the potential of each method1for discrimination1between pea0varieties.

The1results1demonstrated1high0potential1and0resolving0power0of DNA-based0methods.

Superior0in terms0of high0information0content and0discrimination0power0were0SSR

markers, owing1to high1allelic1variation, which was the1only1biochemical-molecular

method0allowing0clear1identification0of all0varieties. Retrotransposon1markers in1RBIP

format1proved to0be the most0robust and0easy to score0method, while0multilocus1IRAP

produced0informative/fingerprint0already in a single0analysis. Isozyme0analysis0offered

a fast0and less0expensive0alternative. The results0showed that0molecular0identification

could be0used to assess0distinctness and complement0morphological0assessment,

especially0in cases0where the0time frame0plays an important1role. Currently1developed

pea marker0systems might serve also9for germplasm0management and genetic0diversity

studies.

In the same way, Tihomir0et al. (2009) analyzed genetic diversity of0European

pea (Pisum sativum L.) germplasm, to0determine differences0between P. sativum var.

arvense and P. sativum ssp. sativum0groups, and to0estimate genetic variability0among

and within0eighteen P. sativum accessions. Co0ancestry/coefficients1across investigated

accessions0varied from00.46 to 1.00. The average0dissimilarity/index0between Pisum

sativum var. arvense and P. sativum ssp. sativum groups was 0.99, where estimates

obtained0by pedigree0data might be0overestimated. Average0morphological0distance

among0all accessions0was slightly0higher than0average molecular0distance (0.620and

38

0.59, respectively). Average0morphological/distance0between P. sativum ssp. sativum

and P. sativum var. arvense0groups/was also0higher/than0average/molecular0distance

(0.710and 0.69, respectively). Results, according0to morphological0traits used in0this

study were well suited to assess differences among accessions. Accessions were

grouped0according to0their/botanical0characters and agronomic0use. Genetic0distances

estimated0by molecular0marker (SSR) data in0comparison with0distances/estimated0by

conventional0methods (pedigree0and morphologic0traits) showed0higher/similarity0with

genetic0distances estimated0by morphological0data. Results0indicated that0inter- crosses

between arvense and sativum0accessions as well0as inclusion of valuable/landraces into

breeding0programmes might0prevent/loss0of diversity in the Pisum gene0pool.

The need for0the conservation0of/plant genetic0resources has been0widely

accepted. Germplasm0characterization and evaluation0yield information0for0more

efficient1utilization of0these valuable0resources. The aim0of the present0study was to

characterize the pea germplasm conserved at the Aegean Agricultural Research

Institute of Turkey using0morphological0and simple0sequence0repeat (SSR)-based

molecular approaches studied by Sarikamis et al. (2010). Genetic characterization of

30 pea-genotypes collected from different/regions of Turkey and 10 commercial pea

cultivars0was performed0using the criteria0of the International0Union for the0Protection

of New Varieties of Plants (UPOV) (TG 7/9 Pisum sativum), and with 10 SSR

markers. Originally 15 SSR markers were tested; 10 of these markers were selected on

the basis0of high0polymorphism information0content in the molecular0assays. Sixty-one

alleles were detected0at the010 loci. The number0of alleles0per SSR0locus ranged from 3

(PVSBE2) to012 (AB53), with0a mean0of06.10alleles. The most0informative0loci were

39

AB53 (120alleles), AA355 (90alleles), AD270 (80alleles), A9 (70alleles), AD61 (7

alleles), and AB25 (60alleles). The0UPGMA0dendrogram defined by0markers0revealed

genetic0relatedness of0the pea0genotypes. These0findings can be0used to guide0future

breeding0studies and germplasm0management of0these pea0genotypes.

Ahmad et al. (2012) studied1genetic diversity1in 35 diverse Pisum0accessions

using 15 polymorphic0microsatellites located on different pea0chromosomes.

Microsatellites1were found1to be1polymorphic, amplifying/a1total of 411alleles and

were able1to differentiate1all 35 Pisum1genotypes. These markers1were scored1by their

polymorphic1information1content (PIC), ranging1from 0.055 (AA206) to 0.660 (AB72)

with1an average1of 0.460, and by their1discriminating1power (D), which varied1from

0.057 (AA206) to 0.679 (AB72) with1an average1of 0.475. Genetic0similarity0values

ranged from00.074 (between Maple0pea NZ0and Line045760) to00.875 (between0Galena

and0Dakota) with an0average0of00.336. Unweighted0pair group0method with0arithmetic

averages (UPGMA) cluster analysis grouped the 35 pea accessions into two major

clusters0and eight0sub-clusters. The majority0of Canadian/and European0genotypes

were0grouped/separately, suggesting0both0these groups0are from0genetically/distinct

gene0pools. The genetically0diverse0groups0identified in this0study can be used0to

derive0parental lines0for pea0breeding

Kumari et al. (2013) assessed0genetic/diversity0among 28 pea (Pisum sativum

L.) genotype0using 32 simple/sequence0repeat0markers. A total0of 440polymorphic

bands, with0an average of02.1 bands per0primer, were obtained. The0polymorphism

information0content ranged from00.657 to 0.309 with an average0of 0.493. The

variation0in genetic/diversity0among these cultivars0ranged from 0.11 to 0.73. Cluster

40

analysis0based0on0Jaccard's0similarity/coefficient0using the unweighted0pair-group

method1with arithmetic0mean (UPGMA) revealed 2 distinct clusters, I and II,

comprising16 and 220genotypes, respectively. Cluster0II was further0differentiated0into

2 sub clusters, IIA and IIB, with 12 and 100genotypes, respectively. Principal

component (PC) analysis revealed results similar to those of UPGMA. The first,

second, and third0PCs contributed021.6, 16.1, and 14.0% of the1variation, respectively;

cumulative0variation of1the first 3 PCs was 51.7% .

Simple0sequence/repeat1markers were developed1based on0expressed/sequence

tags (EST-SSR) and screened0for polymorphism0among 23 Pisum sativum0individuals

to1assist/development1and refinement1of pea0linkage/maps (Zhuang et al., 2013). In

particular, the SSR0markers were1developed1to assist in mapping1of white/mold1disease

resistance1quantitative/trait1loci. Primer1pairs were designed1for 46 SSRs1identified in

EST1contiguous/sequences1assembled from1a 4541pyrosequenced0transcriptome1of the

pea0cultivar, ‘LIFTER’. Thirty-seven1SSR markers1amplified/PCR1products, of1which

11 (30%) SSR0markers produced1polymorphism in 231individuals, including1parents of

recombinant inbred lines, with two to four alleles. The observed and expected

heterozygosities1ranged from00 to 0.43 and from 0.31 to 0.83, respectively.

Gixhari et al. (2014) investigate1the genetic1diversity in the pea1germplasm1of

28 local pea genotypes for 23 quantitative morphological traits, through 14

retrotransposon- based0insertion0polymorphism (RBIP) markers. RBIP0marker0analysis

revealed0the genetic0similarity in range0from 0.06 to00.45. PCA and cluster0analysis

(Ward's method) carried0out for0morphological/traits0divided the local0pea0genotypes

41

into0three clusters. Finally, the study0identified the0agronomicaly important0traits

which will facilitate/the maintenance/and agronomic/evaluation of the collections

Handerson et al. (2014) studied the performance of 34 pea (Pisum sativum L.)

genotypes0including 7 adapted0varieties, 6 popular0local/cultivars0and 210advanced

breeding lines for genetic diversity and relatedness0with 16 morphological0traits and 15

SSR0markers. Genotypes viz., DDR-23, E-6, Makuchabi and KPMR-885 were

identified0as early0flowering while0Rachna, IPFD 09-2, CAU FP-1, IPFD 1-10 and

Pant P-136 were identified0as high0yielding. The number0of alleles/per0SSR/marker

varied from 2 to 5 per0locus. Polymorphic0information/content0values (PIC) ranged

from00.105 to 0.560 per0locus. Variability0among0groups (FIS=0.938) and0variability

within individuals (FIT=0.948) was low. The minimum0and0maximum0molecular

genetic0distances were found0to be 0.12 (Pant P-136 with VL-51) and 0.78 (E-6 with

LP-4) respectively. Genotypes0IPFD 09-2, HFP-620, Azad P-1, Matek, IPFD 1-10,

CAU FP-1, IPFD 09-3, Pant P-136, Rachna, E-6, Matek and LP-3 showed0high/level

of genetic/diversity.

The aim of this research was the development0of a genome-wide0transcriptome-

based pea single-nucleotide polymorphism (SNP) marker platform using next-

generation0sequencing0technology. A total0of 1,536 polymorphic0SNP loci0selected

from0over 20,000 non-redundant0SNPs identified using0deep0transcriptome0sequencing

of0eight diverse Pisum accessions0were used for0genotyping in five RIL0populations

using0an Illumina0GoldenGate assay. The first0high-density0pea/SNP0map/defining0all

seven linkage groups was generated by integrating with previously published anchor

markers. Syntenic relationships of this map with the model legume Medicago

42

truncatula0and lentil (Lens culinaris Medik.) maps were0established. The genic0SNP

map0establishes a foundation0for future0molecular breeding0efforts by enabling0both

the identification0and tracking0of introgression0of genomic0regions harbouring0QTLs

related0to agronomic0and seed/quality0traits (Sindhu et al., 2014).

Simple sequence repeat (SSR) markers have previously been applied to

linkage0mapping of0the/pea (Pisum sativum L.) genome. However, the0transferability

of existing loci to0the molecularly distinct Chinese winter pea gene pool was limited. A

novel0set of pea0SSR markers was accordingly0developed. Together0with existing0SSR

sequences, the genome of the G0003973 (winter hardy) × G0005527 (cold sensitive)

cross was mapped0using 190 F2 individuals. In total, 1570SSR markers were placed in

110linkage/groups0with an average0interval of 9.7 cm and total0coverage of01518 cm.

The novel1markers and genetic1linkage map1will be useful1for marker-assisted1pea

breeding (Sun et al., 2014).

Teshome et al. (2015) stated that field pea (Pisum sativum L.) is among0the

prominent crops in the world as food and feed. There are relatively few simple

sequence0repeat (SSR) markers0developed from0expressed/sequence0tags (ESTs) in P.

sativum. Results: In the present study, 15 new EST-SSR0markers were developed0from

publicly available ESTs. These markers have successfully amplified their target loci

across0seven Pisum sativum sub sp. sativum0accessions. Eleven (73 %) of these0SSRs

were trinucleotide repeats, two (13 %) dinucleotide and two (13 %) were

hexanucleotide0repeats. Across-taxa0transferability of these/new0markers was also

tested0on/other0subspecies of Pisum as well as on P. fulvum, Vicia faba and Lens

culinaris. In Pisum sativum sub sp. sativum, 13 of the 150markers were0polymorphic

43

and 120of them subsequently0used for0genetic/diversity0analysis. Forty0six0accessions,

of0which/43 were from0Ethiopia, were subjected0to genetic0diversity analysis0using

these newly developed markers. All accessions were represented by 12 individuals

except0two (NGB103816 and 237508) that were represented0by 9 and 110individuals,

respectively. A total0of 370alleles were detected0across all0accessions. PS10 was the

most0polymorphic/locus0with six0alleles, and the average0number of0alleles/per0locus

over the 12 polymorphic loci was 3.1. Several rare and private alleles were also

revealed. The most0distinct0accession (32048) had private0alleles at three0loci with 100

% frequency.

Retrotransposons have been highly studied in monocots; however

retrotransposon0diversity in dicot0crops has not0been well0documented. Our0objective

was to assess the diversity harbored by field pea landraces using retrotranposon

markers. In this9research, molecular0characterization of0104 landraces and 34 field pea

breeding lines was assessed using newly developed iPBS-retrotransposon markers.

The 12 iPBS-retrotransposon0primers/generated0a total0106 scorable bands, and 810of

these were found0to be0polymorphic (76.4%), with an0average of 6.750polymorphic

fragments0per0primer. Polymorphism0information0content (PIC) ranged from 0.330to

0.84 with an average0of 0.61. It was evident0that field0pea/landraces0from the0same

geographical region were often placed in different groups in the neighbor joining

analysis, indicating0that grouping0based on0genetic/parameters was not0closely0related

to the geographical0origin. The population structure was determined by using

STRUCTURE0software, and three0populations at K = 3 and five0populations at K = 5

were identified0among0landraces. The plentiful0diversity present0in Turkish0field-pea

44

landraces0could be0used as genetic0resource in0designing/breeding0program, and may

also0contribute to0worldwide0pea breeding0programs. Our0data also suggested a0role of

iPBS-retrotransposons0as ‘a universal0marker’ for0molecular characterization0of pea

germplasm (Baloch et al., 2015).

Ahmad et al. (2015) expressed0that the field0pea (Pisum sativum L.) is an

imperative protein-rich heartbeat trim delivered all around. Expanding the lipid

substance of Pisum seeds through customary and contemporary atomic reproducing

instruments0may convey0increased the value0of the0product. Be that as it may,

information0about hereditary0decent/variety0and lipid0content in field0pea is0restricted.

A comprehension of hereditary decent variety and populace structure in different

germplasm0is vital0and an essential0for hereditary analyzation0of complex0qualities and

marker-attribute0affiliations. Fifty polymorphic0microsatellite/markers0recognizing a

sum0of 2070alleles were utilized0to acquire0data on0hereditary/decent0variety, populace

structure and marker-characteristic affiliations. Bunch investigation was performed

utilizing0UPGMA to0develop a dendrogram0from a pairwise0likeness/lattice. Pea

genotypes were partitioned into five noteworthy groups. A model-based populace

structure0investigation partitioned the pea0promotions into four0gatherings. Rate0lipid

content0in 35 assorted0pea0promotions was utilized0to discover0potential0relationship

with0the SSR0markers. Markers AD73, D21, and AA5 were fundamentally0connected

with0lipid/content0utilizing a blended0direct9model (MLM) taking0populace0structure

(Q) and0relative/family0relationship (K) into0account. The consequences0of this

preparatory0investigation proposed0that the populace0could be0utilized for0marker-

characteristic0affiliation/mapping thinks about.

45

Only1a few studies1on pea (Pisum sativum) investigated1the association1of

single0nucleotide0polymorphisms (SNP) markers0with key agronomic0traits. This study

aimed0to explore0the association0of a standard0set of 3840SNP with grain0yield, seed

protein content, seed weight, onset of flowering, plant height and lodging

susceptibility, in three connected bi-parental recombinant inbred line (RIL)

populations0including 900lines/each. These0RIL originated0from crosses0between three

cultivars that displayed high and stable grain yield across Italian environments,

namely, Attika (A), Isard (I), and Kaspa (K). The 270 lines were phenotyped0in a

spring-sown0environment of0Lodi (northern Italy; 45°19'N, 9°30'E). Variation0among

lines0within the0populations was significant (P < 0.01) in all0cases/except0lodging

susceptibility0in one0cross and, when0expressed in terms of0the genetic0coefficient of

variation, proved0moderately/large0for most0traits (including grain yield and seed

protein content). Overall, we detected0six quantitative0trait0loci (QTL) in the A × I

linkage/map, eight QTL in K × A, and nine QTL in K × I. Among them, there were

three QTL in K × A and two QTL in K × I for grain yield, and one QTL in A × I and

two QTL in both K × A and K × I for0seed protein0content. The consensus0map, which

included0130/markers (covering about 1094 cm), retained0one QTL0for grain0yield and

one0for flowering0time that0co-located on0LGII, and three0for seed0weight on0LGIII,

LGVI/and LGVII. The/QTL0co-locating for0yield and flowering0time explained08%

and 31% of the overall0phenotypic0variation, respectively, for0the two0traits, and0could

be0exploited in marker-assisted0selection for0adaptation to0the target0region (Ferrari et

al., 2016)

46

Genetic0diversity among023 newly0developed homosegregate0pea0lines (Pisum

sativum L.) was assessed0with a total of 13 expressed sequence tag (EST) based-simple

sequence/repeat (SSR) markers. The percentages0of/amplified0and non0amplified

primers were 92% and 8%, respectively, and 58.33% of the used primers0gave the0PCR

product0within the reported0size0range, while041.66% of0primers0gave a0different

product0size. Polymorphism0information0content (PIC), major0allele0frequency, and

variation0in genetic0diversity were calculated. The PIC0ranged from00.32 to00.63 with

an average0of 0.50. Major allele frequency0ranged from 0.48 to 0.78 with a mean value

of 0.56. The dissimilarity0in genetic0multiplicity between0these pea lines extended

from 0.36 to 0.68 by an unkind0value of 0.56. Cluster0analysis/based0on a0dendrogram

divided the 23 pea0lines into0two/main0groups (L-1 and L-2), separated0at 25% genetic

distance. Seven0subclusters were evident/from0these two0main/groups. L-1 grouped

51.2% (12 pea lines) while L-2 contained 47.8% (11 pea lines) of the total0analyzed

population. It was concluded0that EST-SSR0markers are convenient0for0improvement

of0the pea/association0map (Nisar et al., 2017).

Rana et al. (2017) stated0that pea (Pisum sativum L.) is one0of the0oldest

domesticated, highly valued and extensively cultivated pulse crops throughout the

world. They studied its genetic/structure, diversity and inter-relationships in a

worldwide0collection of0151 pea/accessions0using 21 morphological0descriptors and 20

simple0sequence0repeat (SSR) primers. Among0quantitative/traits, seed0yield/per0plant

followed0by seed/weight0and pod0length have shown0significant0variation. SSR0primers

showed0a high level0of diversity/and0amplified/a total0of 1790alleles with usual0of 8.95

alleles0each/primer0in a size/range0of 95–510 bp. Primer AA-122 amplified the

47

maximum (21) alleles0while/primer0AB-64 amplified0the/minimum (4) alleles. Mean

polymorphism information content (PIC) was 0.72. Observed heterozygosity (Ho)

varied from 0.10 to 0.99 in0primers AB-64 and AD-160, respectively, with a0mean

value0of 0.46. Expected0heterozygosity (He) ranged from 0.47 to 0.94 in primers0C-20

and0AA-122, with a mean of00.75. Genetic0relationships/inferred0from a0neighbor

joining0tree separated0accessions into030groups. Bayesianmodel-based0STRUCTURE

analysis0detected 30gene/pools0for the analyzed0pea germplasm0and showed/a high

admixture0within/individual0accessions. Furthermore, STRUCTURE0analysis0showed

that these03 gene/pools co-existed in accessions0belonging to different0geographic

regions indicating frequent transference and exchange of pea germplasm during its

domestication/history.

48

Chapter 03

MATERIAL AND METHODS

These studies were c0nducted during 2015 and 2016 at the University 0f

P00nch Rawa1ak0t, Azad Kashmir. The 1andraces were c011ected fr0m different

locations of district Poonch (Banjosa, Devi gali, Jandali, Dhoke, and Rawalakot), Bagh

(Harigal, Sudhan Gali, Mallot, and Dirkot), Sudhnoti (Trarkhal, Mang, Bloch, and

Plandri), Mirpur and Plant Genetic Resource Institute, NARC, Islamabad.

Seventy five landraces0of0field peas (Pisum sativum L.) were0planted in the

field0following augmented design and one local check variety (Meteor) was used for

the comparison of germplasm and planted 5 times after every 20 landraces. Prior0to

planting, the0field was/prepared by using/standard agronomic practices. Seeds for each

entry were sown in single rows. Sowing was practiced by keeping row0to/row/distance

of060cm and plant0to plant0distance/of 30cm. The fertilizer doses containing nitrogen

(N), phosphorus (P2O5) and potassium (K2O) were/applied/at 30, 45, 50 kg ha-1 in/the

form0of0N, P2O5 and1K2O, respectively. Weeding was done at 2-3 leaf stage, medium

height stage and at pod formation stage. Recommended agronomic practices were

performed from sowing till maturity.

3.1.1. Meteorological Information of locations

3.1.1.1. Poonch District

Poonch/is/located0at/33.77°N 74.1°E. It has/an average elevation of 981 metres

(3218 feet). Poonch has a humid subtropical climate because of its moderately high

elevation0and northerly0position. Winters0are cool, with day time a January normal of

2-6 °C (36.5 °F), and0temperatures below0freezing at0night. Summers are short0and

49

usually p1easant. The0summer1temperature generally d0es n0t rise ab0ve031 °C.

Winters are cool and characterized by rainfall due t0 western disturbances. The

average annua1 rainfall is 674.7 mm. Snowfall is quite common during the months of

January and February.

3.1.1.2. Bagh District

The general0elevation is between 1500 and 2500 meters above0sea level. The

aggregate9area0of the district is 770 square0kilometers. The climate0of0the0region

fluctuates with0height. The temperature for the most0part stays between 2 °C to 40 °C.

The main1eastern0part of the0region is exceptionally cool in winter0and moderate in

summer. May, June and July are the hottest months. Maximum and minimum

temperatures during the-month0of June are about040 °C and 22 °C, respectively.

December, January0and February are the coldest0months. The maximum0temperature

in January is about 16 °C and minimum-temperature is 3 °C, respectively. About0594

mm of precipitation falls annually, mostly during monsoon months.

3.1.1.3. Sudhnoti District

Sudhnoti is situated at Latitude 33° 42′ 54″ N, Longitude 73° 41′ 9″ E. The

aggregate0area of the region is 569 square0kilometers. Climate of0the region fluctuates

with/the height00f the area. Temperature0in0summer is nearly020 to 35 °C and in winter

2 °C. In winter, one may see snow on the close-by Mountains. Snowfall occurs in

December0and0January, while0most rainfall0occurs during the monsoon season from

July0to September. Snowfall0occurs in December and January, while0most rainfall (72

mm) occurs during the monsoon0season from0July to0September.

50

3.1.1.4. Mirpur District

Mirpur City is at 459 m above sea level. It is the0headquarters of Mirpur

District. The latitude of Mirpur is 33.148392, and the0longitude is 73.751770. Mirpur

City, is located1at Pakistan country map in the1Cities place category with the GPS

coordinates0of 33° 8' 54.2112'' N and 73° 45' 6.3720'' E. Mirpur0elevation is 32000

meters height, that is equal to 104,987 feet. The average annual temperature is 27.4 °C.

The average annual rainfall is 109 mm. Mirpur has a climate that is extremely hot and

dry0during summer, making it very similar0to the Pakistani-areas of Jehlum and Gujar

Khan.

3.1.1.5. NARC Islamabad

National-Agricultural-Research-Centre (NARC), Islamabad, is the largest0research

centre0of the Pakistan Agricultural Research0Council (PARC). NARC, with a0total land

area of0approximately 1400 acres, is located0near Rawal-Lake, six0kilometers South-

East0of0Islamabad.

• Latitude: 33°37'N.

• Longitude: 73°5'E.

• Latitude & Longitude for Islamabad, Pakistan in decimal degrees: 33.6°, 73.1°.

• Altitude/ elevation: 508 m (1667 ft).

51

Table.3.1.1: Genotypes selected for morphological studies

FIELD EXPERIMENT

The experiment-was carried 0ut in Augmented-design f0r the m0rph0l0gical

studies. This experiment-was repeated f0r tw0 years (2015 and 2016).

EXPERIMENT No: 01

3.1. MORPHOLOGICAL STUDIES

Morphological study was divided in two parts

Landraces Locat ion Landraces Locat ion Landraces Locat ion L 1 Meteor L 2 6 T rarkhal 3 L 5 1 P landr i 3

L 2 B an j o sa L 2 7 Mang L 5 2 P land r i 4

L 3 B an jo sa 1 L 2 8 Mang 1 L 5 3 Har iga l 1



L 6 Dev i ga l i L 3 1 B lo ch L 5 6 Har iga l 4

L 7 D e v i g a l i 1 L 3 2 B lo ch 1 L 5 7 S .ga l i

L 8 D e v i g a l i 2 L 3 3 B lo ch 2 L 5 8 S .ga l i 1

L 9 D e v i g a l i 3 L 3 4 B lo ch 3 L 5 9 S .ga l i 2

L 1 0 J and a l i M 25 NARC L6 0 Meteor L 1 1 J and a l i 1 M 116 NARC L 6 1 S .ga l i 3

L 1 2 J and a l i 2 M 1 0 2 NARC L 6 2 Ma l l o t

L 1 3 J and a l i 3 M 9 1 NARC L 6 3 Ma l l o t 1

L 1 4 Dho ke M 0 7 NARC L 6 4 Ma l l o t 2

L 1 5 Dho ke 1 M 8 3 NARC L 6 5 Ma l l o t 3

L 1 6 Dho ke 2 M 2 2 NARC L 6 6 D i r ko t

L 1 7 Dho ke 3 M 72 NARC L 6 7 D i r ko t 1

L 1 8 R.ko t 1 M 3 9 NARC L 6 8 D i r ko t 2

L 1 9 R.ko t 2 M 8 6 NARC L 6 9 D i r ko t 3

L 2 0 Meteor M 0 8 NARC L 7 0 M i r p u r

L 2 1 R.ko t 2 M 7 9 NARC L 7 1 M i r p u r 1

L 2 2 R.ko t 3 L 4 7 NARC L 7 2 M i r p u r 2

L 2 3 Tra rkha l L 4 8 P land r i L 7 3 M i r p u r 3

L 2 4 Tr a r k h a l 1 L 4 9 P landr i 1 L 7 4 M i r p u r 4

L 2 5 Tr a r k h a l 2 L 5 0 P landr i 2 L 7 5 M i r p u r 5

52

3.1.1. Qualitative study

3.1.2. Quantitative study

3.1.1. Qualitative study: F0ll0wing parameters were included

1. Gr0wth vig0r

2. Fl0wer c0l0r

3. P0d shape

4. P0d c0l0r

5. Seed Shape

6. Seed C0l0r

Procedure for data collection

1. Growth vigor

Gr0wth vig0r 0f the plant was n0ted by visual 0bservati0n and was n0ted as P,

M, E, f0r p00r, m0derate and excellent.

2. Flower color

After 4-6 weeks 0f planting, fl0wer c0l0r 0f each plant was n0ted by visual

observation. 1, 3 and 7 c0des were used for pure-white, pink and purple-respectively.

3. Pod shape

P0d shape was n0ted by visual 0bservati0n as 3 and 5 c0des were used for

inflated and c0nstricted.

4. Pod color

C0l0r 0f each p0d was n0ted by visual 0bservati0n as 3, 5, 7 for pale-green,

intermediate green and dark-green.

53

5. Seed shape

Seed shape was n0ted by visual 0bservati0n as 3 and 5 f0r r0und and wrinkled.

6. Seed color

Seed c0l0rs were n0ted by visual 0bservati0n as 3, 5, 7 f0r green, yell0w and

br0wn.

3.1.2. Quantitative Study

1. Germination percentage

2. Plant height (cm).

3. Number 0f leaves plant-1.

4. Leaf area (cm2)

5. Leaf length (cm)

6. Leaf width (cm)

7. Days t0 fl0wering initiati0n

8. Days fl0wering c0mpleti0n

9. Days t0 p0d f0rmati0n

10. Number 0f p0ds plant-1

11. P0d length (cm)

12. P0d width (cm)

13. Number 0f seed p0d-1

14. 100-seed weight (g)

15. Seed yield (kg ha-1)

54

Procedure for data collection

1. Germination percentage

Ten (10) seeds 0f each plant were s0wn and after 3 weeks, germinati0n

percentage was calculated.

Germination %age= No. of plant germinate×100 Total seeds sown

2. Plant1height (cm)

Plant height was measure with help of measuring tape from the soil

surface/t0 the/t0p 0f plant/and/then/average was w0rked 0ut.

3. Number/of/leaves/plant-1

T0tal number 0f leaves plant-1 were c0unted at the physi0l0gical

maturity stage fr0m rand0mly selected five plants and average was calculated.

4. Leaf area (cm2)

Leaf0area was measured1with the help/0f leaf area meter.

5. Leaf length (cm)

Leaf1length was/measured with/help/of meter/rod.

6. Leaf width (cm)

Leaf1width was measured with0help/of/meter/rod.

7. Days to flowering initiation

Days1to flowering0initiation were counted0from date/of sowing in each

plot.

8. Days to flowering completion

Days1to flowering completion were counted0from date of/sowing in

each0plot.

55

9. Days to pod formation

Days/were c0unted fr0m germinati0n upt0 50% 0f p0d f0rmati0n.

10. Number of pods plant-1

T0tal0number 0f p0ds/plant -1 was c0unted at 3-4 days interval and/average

was0calculated.

11. Pod length (cm)

P0d/length/was/measured/with/help/0f measuring/tape/and then average

was/w0rked 0ut.

12. Pod width (cm)

P0d width was/measured/with/help 0f measuring/tape/and then average

was/w0rked 0ut.

13. Number of seed pod-1

Number/of seeds of average0f rand0mly selected 20 ripened p0ds was

calculated.

14. 100 dry seed weight (g).

The 100 seed weight of each gen0type was measured by using t0p

l0ading balance/in/grams.

15. Seed yield (kg ha-1)

Seed yield in each pl0t was calculated by weighing the seeds 0n 0pen

pan/balance/and/was c0nverted it int0 kg per/hectare.

56

Experiment No: 02

3.2). BIOCHEMICAL STUDY

Table. 3.2.1: Gen0types selected f0r Bi0chemical and m0lecular study:

On the basis 0f best m0rph0l0gical perf0rmance, 46 genotypes were selected

for biochemical-and molecular-analysis:

Landraces Locat ion Landraces Locat ion

L 1 Meteor M0 7 NARC L 2 Banjosa M8 3 NARC L 3 Banjosa M2 2 NARC L 4 Dev i gal i M7 2 NARC L 5 Dev i gal i M3 9 NARC L 6 Jandal i M8 6 NARC L 7 Jandal i M0 8 NARC L 8 Dhoke M7 9 NARC L 9 Dhoke L3 2 P landr i L 1 0 R.kot L3 3 P landr i L 1 1 R.kot L3 4 Har igal L 1 2 R.kot L3 5 Har igal L 1 3 R.kot L3 6 S .gal i L 1 4 Trarkhal L3 7 S .gal i L 1 5 Trarkhal L3 8 Mal lo t L 1 6 Mang L3 9 Mal lo t L 1 7 Mang L4 0 D i rkot L 1 8 B loch L4 1 D i rkot L 1 9 B loch L4 2 Mi rpur M 2 5 NARC L4 3 Mi rpur M 1 1 6 NARC L4 4 Mi rpur M 1 0 2 NARC L4 5 Mi rpur M 9 1 NARC L4 6 Mi rpur

57

3.2.1. Moisture Content (%)

T0tal m0isture c0ntent 0f seed was determined0by/the meth0d 0f0AOAC

(1994). Two gram fruit sample was taken in petridish and placed it in 0ven at 130oC

for/1 h0ur. After/1 h0ur ample was rem0ved fr0m 0ven and was kept in dessicat0r and

weighed0again. The l0ss in weight was rep0rted as percent m0isture.

Moisture (%) = Weight of fresh sample – Weight of sample after drying×100

Weight of sample

3.2.2. Crude Fat (%)

Fat1content 0f the/sample was determined acc0rding t0 the Soxhlet1extraction

meth0d (AOAC, 1994). A sample0of 7-80g was taken0and kept/in thimble 0n0the

Soxhlet0at165-70oC. Difference-between the weight 0f the r0und b0tt0m flask bef0re

and after extracti0n was rec0rded as the weight 0f the fat extracted.

Crude fat (%) = Weight of beaker with fat – Weight of empty beaker ×100 Weight of original sample

3.2.3. Crude Fiber (%)

Crude0fiber c0ntent was determined0by the meth0d 0f AOAC (1994). Tw0

gram sample was taken fr0m 0il extracted sample and 200 ml H2SO4 (0.255 N) was

added0in/it. The sample was/heated0then kept f0r 300minutes at r00m0temperature. The

sample/was filtered0and residues were collected in another0beaker carefully. About0200

ml NaOH (0.313 N) was added in it and heated till boiling. Then residues were

collected0in crucible and placed1in0oven/at 130 oC for02 hours. After0drying, the sample

was weighed and kept/in furnace/for 3qhours at0550-600 oC. The sample was weight

after0ashing.

58

% crude fiber = (W2 – W3) Weight/of/sample

Where W2 = weight/of/crucible + sample after boiling, washing and drying

W3 = weight/of/crucible × sample/and/ash

3.2.4. Crude Protein (%)

Prt0ein c0ntent were/estimated0by Kjeldhal1Meth0d as0described by1AOAC (1994).

The sample0was weighed/and transferred t0 the/digesti0n/flask. Added 2-3/g digesti0n

mixture0and 250ml c0ncentrated sulphuric acid0and sample was digested. The flask was

rem0ved, co0led and transferred material t0 the 250 ml vl0umetric flask and rinsed

with/small-am0unt 0f water/and/then v0lume was made up. 500ml material0was0taken

and 10 ml str0ng alkali was added till s0lution bec0me alkaline. The material was

distilled int0 250ml 4% b0ric0acid s0lution using0methyl red as0an indicat0r. Finally

material was titrated/with H2SO4 soluti0n. Nitr0gen c0ntent was estimated0as under:

% � =1.4 �V2 − V1�x Normality of HCl x �dilution�

Weight of sample x 100

% Protein = % N x conversion factor (6.25)

3.2.5. Carbohydrate (%)

Carbohydrate1percentage was estimated by the meth0d as described by AOAC

(1990).

% carb0hydrate = 100 - % (crude pr0tein + ash + m0isture + crude fat).

59

3.2.6. Chlorophyll Content (mg/g)

Chlorophyll0content was0estimated0from fresh0leaves, collected0from0base,

middle0and apex0of every0selected0plant from0each0population0under study. Three0leaf

samples0from0each plant were subjected to0experiment. Leaf0cutting of 1 cm2 was

soaked0in 5 ml ethanol0in test-tube for0each sample0and left for0overnight. Next0day

greenish0liquid from0each test0tube was collected0in cavetti and optical0density of that

mixture was taken0at two0different wavelengths0of 663 nm for0chlorophyll A and 645

nm for chlorophyll B at spectrophotometer. Observations of optical densities for

chlorophyll0A and chlorophyll0B from0all the0samples were taken0and their0mean were

obtained. These0values were subjected0to the following0formula for0the final0evaluation

of total0concentration of chlorophyll0for receptive0replication of selected0populations.

Total chlorophyll = 8.0 × O.D at 663 nm +20.2 × O.D at 645 nm

3.2.7. Ash content (%)

Ash c0ntent was determined0by0AOAC (1994). Weight of sample was taken0in

crucible and was placed in open flame to start burning for removal of smoke and

smell. When/smoke was finished0it was kept0in/furnace0at 600oC0for/three0hours. After

removal, it/was/kept0in desicat0r0and/then measured.

Ash% = Weight of sample after ashing x 100 Weight of sample

3.2.8. Phenolic content (mg/g)

T0tal phen0lic c0ntent (TPC) was/determined/by a F0lin-ci0calteu assay/using

gallic0acid (GA) as/the/standard (Singleton et al., 2000). The mixture 0f the sample

s0luti0n (501μL), distilled water (30ml), 250/μL 0f F0lin-ci0calteu’s reagents/s0luti0n

and/70% Na2CO3 (750 μL) was v0rtexed and incubated f0r 8 min at r0om temperature.

60

Then, a dose0of/9500μL of0distilled0water/was added. The0mixture was allowed0to0stand

for02 hr0at room0temperature. The0absorbance was measured0at 765 nm against0distilled

water0as a0blank. The total0phenol0content was expressed0as gallic0acid0equivalents (mg

of0GAE/g0sample) through0the calibration0curve of gallic0acid. Linearity0calibration

curve was 50 to 1000 µg/ml (r = 0.99).

3.2.9. pH

pH was measured with the help 0f digital pH meter. pH of pea plant was

determined by/making 0f extract/0f 1 : 2.5 (pea/extract/and/water) in H0rticulture Lab,

The University 0f P00nch Rawalak0t. Electrode0of pH0meter was inserted0in the

mixture/and/reading/was rec0rded 0n pH meter.

3.2.10. Total Soluble Solid (TSS) %

T0tal s0luble s0lids was determined acc0rding t0 the Ass0ciati0n 0f Official

Analytical Chemists (AOAC, 1994) using a digital refract0meter m0del PA-202

(Misco, USA). at r00m temperature. One1drop of extracted-juice fr0m each sample

was placed 0n abs0lutely dry refract0meter prism and readings were rec0rded in

percent Brix.

61

3.3. MOLECULAR STUDIES

3.3.1. Extraction of genomic DNA

Genomic0DNA isolation0method of Doyle0and/Doyle, (1987) was/utilized; one

or0two/leaves0of every/landrace were1ground/to0fine powder1using liquid0nitrogen.

These0finely/ground samples, were0taken in/a01.5mL/Eppendorf1tube and 1000µL of

CTAB0buffer was/mixed to0it. The samples0were then heated for030 minutes0at 65°C,

followed0by the incorporation0of 0.75mL of CIA (24:1). Then samples were vortexed

to0mix the0contents and spin0at 10,000xg for/100minutes, upper0most/layers/from0each

tube was moved0to a fresh01.5mL Eppendorf0tube. Refrigerated0propanol was mixed to

supernatant, heated for 10 minutes at normal temperature and tubes were shaked by

turning0upside0down. The samples were vortexed0again at 10,000xg for010 minutes.

Aliquoit0was then taken0out and pellet0was treated with070% ethanol0following

centrifugation0at 10,000xg for 50minutes. DNA0pellet was air/dried for 10-15 minutes

and was re-suspended0in 50µL of TE0buffer. Quantification0and dilutions/of DNA/up

to required0level were prepared1prior to/PCR.

3.3.2. Quantification and visualization of DNA

The DNA was quantified0through optical0density (O.D.) at0A260 and0A280

with0a UV/Mass0spectrophotometer. Samples/were subjected0to/electrophoresis0in 1×

TBE0buffer for01 hour at080 V. 5 μL of the isolated0genomic DNA was loaded0on 1 and

2% Agarose0gel stained0with ethidium1bromide to0check/DNA0quality. The/gel was

photographed/under0a Gel/Documentation0system.

62

3.3.3. Conditions optimized for SSR analysis:

The primer0pairs were used0in polymerase0chain reaction for all0genotypes. For

simple0sequence/repeat0analysis/concentration0of/genomic0DNA, MgCl2, dNTPs, Taq

DNA0polymerase, 10x/PCR0buffer, forward0and/reverse0primers/were optimized.

3.3.4. PCR (polymerase/chain/reaction)

Following concentration of PCR reagents were used to make the final reaction

mixture of 20 µL (1x).

Table.3.3.1: Layout for PCR Master Mix

Reagents Concentration Volume Template1DNA 10 mg 2.0 µL0 DNTPs1 2.5 mM1 4.0 µL0 Buffer1 10X 2.0 µL1 MgCl21 25 mM1 1.6 µL1 Primer–F1 20 µM 1.5 µL1 Primer-R1 20 µM 1.5 µL1 DNA Taq/Polymerase 5Uint/µL 0.25 µL1 Double/distilled H2O1 7.15µL Total Volume0 20µL

63

3.3.4. SSR (PCR) Profile

PCR/was carried0out in BIOMETRA1PCR/machine MJ mini personal thermal

cycler (BIORAD). Polymerase1chain0reaction0profile0used0to0amplify0the0genomic

DNA/as follows:

3.3.5. Different/steps/of/PCR

Temperature of PCR steps were changed according to primer nature.

• Heating0Lid (100°C0for 4:000minutes)

• Initial0Denaturation (95°C/for 3:00/minutes)

• Denaturation (94°C0for 00:300seconds)

• Annealing0step (48-55°C0for/00:300seconds) 35/Cycles

• Extension/elongation0step (72°C0for/1:00/minute)

• Final0Extension (72°C0for 10:000minutes)

• Hold0and End (4 0C forever)

3.3.5. Primer Sequences for microsatellite SSR Analysis

Following0primer0combinations0were0utilized0to0validate0the0presence0or

absence/of/variability/among different/landraces of pea.

64

Table. 3.3.2. List of 20 SSR primers along with forward and reverse sequence

used in this study

Sr.No. Primer Forward sequence Reverse sequence

1 AC58 Tccgcaatttggtaacactg Cgtccatttcttttatgctgag

2 AD270 Ctcatctgatgcgttggattag Aggttggatttgttgtttgttg

3 AA335 Acgcacacgcttagatagaaat Atccaccataagttttggcata

4 AB53 Cgtcgttgttgccggtag Aaacacgtcatctcgacctgc

5 AA205 Tacgcaatcatagagtttggaa Aatcaagtcaatgaaacaagca

6 AA163.2 Tagtttccaattcaatcgacca agtgtattgtaaatgcacaaggg

7 AA92 Aaggtctgaagctgaacctgaagg Gcagcccacagaagtgcttcaa

8 D21 Tattctcctccaaaatttcctt Gtcaaaattagccaaattcctc

9 AD148 Gaaacatcattgtgtcttcttg Ttccatcacttgattgataaac

10 AA285 Tcgcctaatctagatgagaata Cttaacattttaggtcttggag

11 AD147 Agcccaagtttcttctgaatcc Aaattcgcagagcgtttgttac

12 AA175 Ttgaaggaacacaatcagcgac Tgcgcaccaaactaccataatc

13 AD83 Cacatgagcgtgtgtatggtaa Gggataagaagagggagcaaat

14 AD73 Cagctggattcaatcattggtg Atgagtaatccgacgatgcctt

15 AB141 Atcccaatactcccaccaatgtt agacttaggcttcccttctacgactt

16 AB72 Atctcatgttcaacttgcaaccttta Ttcaaaacacgcaagttttctga

17 AA103 Aagtgtgaaagtttgccaggtc Cgggtacgggttatgttgtc

18 AA67 Cccatgtgaaattctcttgaaga Gcatttcacttgatgaaatttcg

19 AD51 Atgaagtaggcatagcgaagat Gattaaataaagttcgatggcg

20 AA90 Cccttaccatatttcgtttct Tgcgactccattctagtattg

3.3.6. Gel Electrophoresis

The agarose1gel/was/prepared/by/using/TBE/buffer, visualized0under UV light

by0Etidium bromide staining, gel documentation system was used for taking

65

photograph. Amplified0DNA0fragments/in PCR/were electrophoresed0on Agarose0gels

(3.0 % using0TBE0buffer (0.5X).

3.3.7. Methodology9

1. Three gram of Agarose was added in flask containing 100ml electrophoresis

buffer (0.5X/TBE).

2. The/Agarose/was melted in0microwave/oven0for/30minutes/and/was swirled/to

ensure even mixing.

3. The melted agarose was cooled down by keeping it under tap water with

constant0shaking.

4. Three0µl ethidium1bromide (0.50µl/ml) was added0to flask/containing0melted

agarose.

5. The melted1agarose was poured/in casting0tray by inserting/the gel0comb0and

all/bubbles on0the/surface0of the1agarose was removed/using/micro/tip/before

the gel/will /set.

6. It was kept at/room0temperature/for/15-200minutes/for0solidification.

7. The gel0casting0tray/containing/solidified/gel/was placed/in/the0electrophoresis

tank.

8. Sufficient/electrophoresis0buffer/was/added to cover the/gel.

9. Three/µl 6X0loading0dye (Bromophenol0Blue) was/added in each/PCR0product.

10. The samples (8 µl) were loaded0into/the wells by using a0micropipette.

11. 2µl or 3µl of 100bp DNA/ladder/was/run/along/with/the/samples.

66

12. The voltage was adjusted at 80V to start the electrophoresis and was turn off

when0the loading0dye was migrating to the0end of the0gel for the separation of

DNA0fragments.

13. The gel for variable bands was visualized using gel documentation system

attached0with0computer/having DNA analysis packages/and photographs were

taken1for/references.

14. Scoring0of gel bands0for marker0alleles; The DNA0bands were scored as ‘1’ for

present0band and absent0band was scored as ‘0’ for each0marker.

3.3.8. Statistical/analysis1

The collected/data/for/morphological1and biochemical1traits/were analyzed0to

determine the phenotypic correlation coefficients among various parameters using

SPSS 16.1. Mean0values of/the0agronomic/and biochemical/traits1for/genotypes0were

standardized1and1used/for0computing Euclidean distances between them. Dendrogram

was formed/by1using computer0software PAST. Principal0component0analyses (PCA)

and cluster0analyses were used0to obtain Euclidean0distances between0genotypes and0to

characterize0the relation0to the most0discriminating0traits.

For molecular0analysis, all0the0monomorphic and polymorphic bands were

scored. Only0unambiguous bands were used0in the0analysis. Each band was given0score

of 1 for presence/of polymorphism1and 0 for1absence. Similarities1between0cultivars

were estimated using the numerical taxonomy based software NTSYS-pc (Rohlf,

2000). The dendrogram1based on dissimilarity/matrix was done/using unweighted pair

group0method with arithmetic1averages (UPGMA).

67

Chapter 04

RESULTS AND DISSCUSION

4.1. Morphological Studies

4.1.1.1. Growth vigour

Landraces with 90-100% plant vigor was marked excellent and ranked as 1,

with 80-89% plant vigor marked very good and ranked as 2, with 70-79% plant vigor

marked good and ranked as 3. Appendices No. 11 shows that maximum value of

growth vigor was found for genotypes, L-8, L-9, L-10, L-34, L-47, L-48, L-49, L-50,

L-56, L-57, L-66, L-67, L-68, L-69, L-74 and M-86. Minimum value of growth vigor

was found in L-1, L-2, L-3, L-7, L-14, l-20, L-23, L-25, L-64, M-25, M-91 and M-102

respectively. Genotypes L-5, L-11, L-15, L-49, M-8 and M-82 were showing0moderate

values for growth vigor. Initial seedling vigour plays in important role for

establishment0of normal0crop. Raje (1992) has reported0positive0association0of0seed

size0with vigor0index in0gram. Seedling0vigour is a complex character which is

administered0by numerous0parameters and a critical0trait in seed0technology. Initial

seedling0vigour plays an important0role for0high planting0value of0seed lot0and early

establishment0of0crops (Jain et al., 1998). In chickpea, early0growth and0vigour can be

important0in providing0increased0biomass. Considerable0losses are observed0because of

stiff0competition of0the crop0with0weeds. Particularly0in irrigated and0late-sown

conditions (Lather0et al., 1997). Oudhia0et al., (1997) reported early0establishment of

the crop0to reduce0early crop0weed0competition. The establishment0of healthy0seedling

is important0for successful0production of0any0crop (Matthews et al., 1988). Poor0vigour

call0decrease yields0in two0ways: first. Decreased0emergence may0lead to0sub-optimal

populations0of0irregularly0distributed0plants: secondly, those0seedlings0which0do

68

emerge0grow more0slowly and under0some circumstances. This0can affect final0yields.

The experimental material exhibited significant differences in the field when data was

recorded on plant vigor based on their vegetative growth. Muehlbauer and McPhee,

(1997) also reported that maximum0yield requires0maximum vegetative0growth during

the establishment0of crop0growth.

4.1.1.2. Flower colour purple and white

The values of flower colour were ranging from 1 (white) to 7 (purple).

Appendices No.11 shows that white colour flowers was found for genotypes, L-8, L-9,

L10, L-34, L-47, L-48, L-49, L-50, L-56, L-57, L-66, L-67, L-68, L-69, L-74 and M-

86, whereas purple colour was found in L-1, L-2, L-3, L-4, L-14, L-21, L-22, L-23, L-

24 respectively. Mendel noticed that coloured0seed-coats were always connected

with0coloured (purple) blossoms. He likewise noticed that these coloured0assortments

had pigmentation in the leaf axils. Then again, an unmistakable or dreary testa was

constantly connected with0white blossoms and0the non-appearance of0pigmentation in

the leaf0axils, proposing that0these were pleiotropic0effects of0a single0gene. In0pea, as

in numerous different0plants, the0red, purple0or blue0pigmentation is because of the

amassing of0anthocyanin0compounds. The mutation0in (a) gene cancels anthocyanin

pigmentation0all through the0plant. The discovery that0A was potentially0a0regulatory-

gene0controlling the spatial0expression of0different members0of a structural0multi-gene

family, at the0time, was an exciting0finding. A0gene that0encodes a basic0helix–loop–

helix (bHLH) transcription0factor was identified0as a candidate0gene for0the A0locus

through0comparative0genomics (Hellens0et al., 2010).

69

4.1.1.3. Green and yellow pod (Gp versus gp)

The pod colour remains green in all genotypes. Of Mendel’s three genes that

have not been sequenced, the colour of the immature pods have possibly become the

greatest consideration. For the duration of 1980s there were detailed studies on the

movement of the gene Gp, which controls the green/yellow colour of the pods. Price et

al. (1988) considered the organizational and physical foundation of this alteration and

that the yellow0pod (gp) mutation0resulted in the mesocarp0containing plastids0with an

internal0membrane system constrained0to solitary and paired0membranes. Not0at all the

plastids0of green0pods (Gp), the mutant0form needed grana0and contained0only 5% of

the chlorophyll of the wild type green pods. The synteny between the pea and

Medicago0genomes and the identification0of genes in other0species that are known0to

outcome in tissue-specific regulation of chloroplast development, it might now be

conceivable to recognize candidate genes that may control the green/yellow pod

colour0transformation (Reid and Ross, 2011).

4.1.1.2. Inflated and constricted pod

The values of pod shape were ranging from 1 (inflated), 5 (constricted).

Inflated pods were found in genotypes (CH, L-1, L-2, L-3, L-4, L-13, L-14, L-15, L-

16, L-29, L-32,L-50 and L-53, whereas constricted pod were found in genotypes (L-5,

L-6, L-7, L-8, L-9, L-10, L-11, L-12, L-17, L-18, L-19, and L-20 respectively)

(Appendices No.11). Mendel (1866) mentioned0to the form of the ripe0pod as also over

stated or0deeply constricted (with the pod being quite wrinkled in appearance). Wild-

type0pods are over stated, with a complete0layer of sclerenchyma0on the inside0of the

70

pod0wall. There0are0two0different0single-gene0recessive0mutants, p and v, that lack a

complete layer of0sclerenchyma in the endocarp0of the mature pod, and their pods0are

deeply0constricted because they are inflated0only in those0zones where the seeds0have

occupied. These pods are comestible while undeveloped and are mentioned to as sugar

pods. The over stated against constricted pod phenotype refers to the existence or

absence0of a layer0of lignified0cells (sclerenchyma) adjoining0the epidermis of the0pod

wall0and is referred0to as0parchment. Such pods0without ‘rough0skinny0membrane’

were previously0defined in Herball, and in general0this cell0layer is0absent in0vegetable

pea0types where the whole0pod is0eaten. Absence of these cell layer pointers to a pod

that is constricted0around the seeds at0maturity. Mendel mentioned to peas with this

pod characteristic as P. saccharatum proposing that he used a ‘sugar snap’ type. There

are two0possible genes0involved and it is tough0to be sure which0locus Mendel was

learning0because homozygous0individuals resounding0mutations in either0of the0two

genes0P or V lack0this cell0layer (Ellis et al., 2011). This0trait has obviously0received

less attention0than any of0the other0seven traits0of Mendel, creating the prediction0of

supposed0candidate genes0difficult (Reid & Ross 2011).

4.1.1.5. Round versus wrinkled (R versus r) seeds.

The values of seed shape were ranging from 1 (Round), 5 (Wrinkled).

(Appendices No: 11). Round shape seed were observed in genotypes (CH, L-1, L-2, L-

3, L-4, L-13, L-14, L-15, L-16, L-29, L-32,L-50 and L-53, whereas wrinkled seed

were found in genotypes (L-5, L-6, L-7, L-8, L-9, L-10, L-11, L-12, L-17, L-18, L-19,

and L-20 respectively). Wrinkled seeds0possess higher0sucrose, fructose, and0glucose

levels0on expenditure of0starch, and these effects in higher0water content0in0immature

71

seeds0due to amplified osmotic0pressure and0hence water uptake. Moreover, the

wrinkled0seeds contain a higher level of lipids and a reduced percentage of some

storage0proteins such as0legumin. Given the wide0range of pleiotropic0characteristics

that result0from a change0at the R0locus, it appeared0possible that R0is a0regulatory-

gene that controls multiple structural genes, leading to the wide range of unlike

characteristics. However, the biochemical0indication accumulated0to date well-known

that the primary0lesion in r0embryos was in starch0biosynthesis. This trait0results in the

failure of sugars0to starch conversion and was the first gene0recognized by0biochemical

method. Today0there are known0to be numerous0genes in pea that0discuss a0crumpled

or0wrinkled (rugosus) phenotype0and all are lesions0in unalike0enzymes involved0in

starch0biosynthesis. However, only the r mutant is known to have been obtainable0to

Mendel (Ellis et al., 2011). Thus the first of Mendel’s mutants to be categorized

corresponded0to a mutation0in a gene0encrypting a biosynthetic0enzyme and it was

connected with anvigorous0transposon (Bhattacharyya et al., 1990).

4.1.1.6. Yellow and green seed colour

The values of seed colour were ranging from 1 (green), 5 (yellow) and 7

(brown). Green colour were (CH, L-5, L-6, L-7, L-8, L-9, L-10, L-11, L-12, L-13, L-

14, L-15, L-16, L-17, L-18, L-20,L-66, L-67, L-68, L-69, L-71, L-72, L-73 and L-74,

whereas yellow colour seed were found in genotypes (L-70, M-07, M-08, M-91, and

M-25 respectively. Brown colour was observed in L-1, L-2, L-3, L-4, L-21, L-22, L-

23, and L-24 (Appendices No.11). Another of Mendel’s genes to be sequenced was the

gene accountable for cotyledon colour. This gene was assign0the symbol I by White

(1917). Ripe wild-type (II) seeds are yellow because of the point that the0chlorophyll is

72

lost as the seeds develop, while (ii) seeds stay. This division0can be realized through

the seed0coat; however0is strongest0if the testa0is expatriate. The phenotype0is to0some

degree0variable: wild-type0seeds that dry0out early0once in a while0hold green0shading,

though0green ii seeds can infrequently0fade (Ellis et al., 2011). It was demonstrated

that not0exclusively do the0cotyledons in pea0display a green0shading in the0advanced,

dry seed as0announced by Mendel (1866), but also0senescing leaves0stay green, as do

removed0leaves location0in the0dark (Armstead et al., 2007; Sato et al., 2007; Aubry et

al., 2008). This was the result of0reduced chlorophyll0breakdown during0dark-

incubation (Sato et al., 2007). The matching0gene; homolog0of Stay-Green (SGR) has

been recognized0based on contender0gene approach0using knowledge0from rice0and

Arabidopsis. SGR seems to direct0chlorophyll to the degradation0trail (Armstead et al.,

2007; Sato et al., 2007). However, they provide no indication that this was certainly

the precise mutation that Mendel had used.

4.1.2. Quantitative Study

Seventy five landraces of peas were compared for yield and yield related

characters for two consecutive years (2015-2016). Five randomly selected plants from

each landraces were used to data collection and avareage values were computed for

analysis. The data regarding to germination percentage, plant height, number of leaves,

leaf length, leaf width, leaf area, flowering initition, flowering completion, pod

formation, number of pods per plant, pod length, pod width, seed per pod, 100 seed

weight, and yield are presented in Appendices No. 12.

73

4.1.2.1. Seed Germination

Table 4.1.1 showed mean values for germination percentage. Mean values for

germination percentage ranged from 70% to 90%. Maximum value was recorded for

M-25, M-102, M-91 and M-72 (90%). Minimum value (70%) was observed for L-16,

L-18, M-86, L-47 and L-48.All other landraces remained transitional in performance

with regard to this trait. It is evident from the results that the cultivars differed

significantly for seed germination percentage. Seed0germination and seedling0vigour

are influenced by physiological0age of the seed0at harvest and subsequent0handling

(Muehlbauer and McPhee, 1997). The seeds collected 28 days after anthesis

accomplished, attained0complete viability. If the seed is harvested0earlier than the

proper0maturity-stage, it may result in its reduced0viability0or in other0words, younger

the seed at harvest, lower will be the0viability. Besides harvesting0time, harvesting and

threshing0methods and storage0conditions also affect the seed0viability which affects

the seed0germination (Castillo et al., 1992).

74

Table No: 4.1.1 Means values of germination percentage in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 85 L25 80 L50 75 L1 85 L26 80 L51 80

L2 85 L27 85 L52 80 L3 85 L28 85 L53 85 L4 80 L29 85 L54 75 L5 80 L30 85 L55 85 L6 80 L31 80 L56 75 L7 85 L32 80 L57 75 L8 75 L33 80 L58 80 L9 75 L34 75 L59 80 L10 75 M-25 90 L60 85 L11 80 M-116 85 L61 85 L12 85 M-102 90 L62 85 L13 85 M-91 90 L63 75 L14 85 M-07 85 L64 85 L15 80 M-83 80 L65 85 L16 70 M-22 85 L66 75 L17 75 M-72 90 L67 75 L18 70 M-39 85 L68 75 L19 75 M-86 70 L69 75 L20 75 M-08 80 L70 80 L21 80 M-79 85 L71 80 L22 80 L47 70 L72 75 L23 85 L48 70 L73 80 L24 85 L49 75 L74 75

4.1.2.2. Plant height (cm)

Pea’s landraces also showed variation in plant height. Maximum plant height

(80 cm) was observed in genotype L-29 followed by L-30 (78 cm), L-28 (74 cm) and

L-30 (75 cm) (Table 4.1.2). Genotype L-20 attained minimum plant height (33 cm)

followed by L-6 (34 cm), L-50 (39 cm), -L-18 (40 cm) L-51 (41 cm), CH (41 cm) and

L-15 (42 cm). All other landraces remained intermediate in performance with respect

to this trait. The difference in plant height might be due to the genetic make up of these

75

cultivars. The cultivars with minimum height at flowering are considered as not only

dwarf0but also early0flowering. The variation0in plant height0of the varieties used0may

be attributed to their variable genetic makeup and response to environmental

conditions. Different responses to plant tallness may be because of hereditary

characteristic0of genotypes0and adaptability0to a specific0situation. Scientists0acquired

lengths0changing in the vicinity of 65.67 and 132 cm (Ceyhan and Avci, 2015), 51.20

and 111.30 cm (Georgieva et al., 2016) 65.67 and 126 cm (Khan et al., 2013).On the

other hand, the average (63.64 cm) detailed by Habtamu and Million (2013) is lower

than that got in the present work (80 cm). Contrast0in plant height0may be because0of

hereditary characteristic of genotypes and adaptability to a particular environment

(Khan et al., 2013), particularly that this character is dependent on the environment

(Solberg et al., 2015).

76

Table No: 4.1.2 Means values of plant height in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 41 L25 67 L50 39 L1 55 L26 69 L51 41 L2 58 L27 71 L52 42 L3 47 L28 74 L53 44 L4 50 L29 80 L54 47 L5 52 L30 78 L55 44 L6 34 L31 73 L56 45 L7 47 L32 75 L57 49 L8 46 L33 54 L58 53 L9 47 L34 49 L59 58 L10 52 M-25 44 L60 56 L11 57 M-116 52 L61 59 L12 43 M-102 56 L62 61 L13 44 M-91 49 L63 64 L14 46 M-07 45 L64 66 L15 42 M-83 50 L65 60 L16 47 M-22 53 L66 57 L17 43 M-72 57 L67 54 L18 40 M-39 54 L68 51 L19 46 M-86 59 L69 58 L20 33 M-08 55 L70 61 L21 58 M-79 52 L71 66 L22 59 L47 57 L72 68 L23 65 L48 51 L73 64 L24 68 L49 46 L74 61

4.1.2.3. Number of Leaves per Plant

Highly significant differences were observed in this respect among the

landraces. It is clear from the data that L-72 possessed the highest number of leaves

(77), closely followed by L-64 (76), L-63 (75) and L-71 (75), while, L-20 had the

minimum number of leaves (30) followed by L-6 (35), L-18 (36), L-8 and L-19 (37),

L-12 (38), L-14 and CH (39). All other landraces remained intermediate in

performance with respect to this trait. It is evident that the tall cultivars had similarly

more number of leaves than the dwarf ones. Vegetative0development of pea0plant is

77

influenced0by both0hereditary and natural0components, which interact0with each0other

to further modify plant growth. The genetic0or hereditary0effects0include

photosynthetic0potential, water use efficiency, plant0growth rate, leaf0area index and

seed size etc. The genetic0factors are affected by0environmental conditions0including

plant0density and climatic0conditions (Muehlbauer and McPhee, 1997). Hence,

variation0in pea-cultivars0could be due to their genetic0make up and adaptability0to

prevailing environmental0conditions.

Table No: 4.1.3 Means values of number of leaves in pea genotypes


78

4.1.2.4. Leaf Area

Data regarding to the leaf area of pea is presented in table 4.1.4. Means values

for leaf area ranged from 1.2-18.6 cm2. It is clear from the data that L-29 possessed the

highest leaf area (18.6 cm2), closely followed by L-30 (16.12 cm2) and L-31(14.4

cm2). These landraces exhibited the maximum vegetative growth. L-3 and L-6 had the

shown minimum leaf area (1.2 cm2) followed by L-5 (2.49 cm2), L-4 (2.77 cm2) and L-

1 (2.89 cm2) (Table 4.1.4). All other landraces remained intermediate in performance

with respect to this trait. Vegetative0development of0pea plant is influenced by0both

hereditary0and natural0components, which0interact with each0other to further0modify

plant0growth. The genetic0or hereditary0effects include0photosynthetic0potential, water

use0efficiency, plant growth0rate, leaf area0index and seed size etc. The genetic0factors

are affected by environmental conditions including plant density and climatic

conditions (Muehlbauer and McPhee, 1997). Hence, variation0in pea-cultivars0could be

due0to their genetic0make up and adaptability to0prevailing environmental0conditions.

Varietal0differences in garden0pea in leaf area were also0reported by Akhter, (2004).

79

Table No: 4.1.4 Means values of leaf area in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 4.92 L25 10.2 L50 2.23 L1 2.89 L26 11.1 L51 3.21 L2 4.56 L27 12.5 L52 3.69 L3 2.1 L28 13.4 L53 4.2 L4 2.77 L29 18.6 L54 4.93 L5 2.49 L30 16.12 L55 3.86 L6 2.1 L31 14.4 L56 4.38 L7 5.51 L32 12.87 L57 5.12 L8 4.93 L33 11.1 L58 7.01 L9 3.06 L34 5.92 L59 8.68 L10 7.01 M-25 5.32 L60 7.94 L11 7.47 M-116 5.92 L61 8.94 L12 7.94 M-102 6.78 L62 10.5 L13 9.19 M-91 6.57 L63 11.1 L14 8.19 M-07 5.92 L64 11.3 L15 6.78 M-83 5.72 L65 10.5 L16 6.13 M-22 7.01 L66 8.94 L17 5.51 M-72 7.24 L67 7.01 L18 7.24 M-39 6.78 L68 6.13 L19 6.78 M-86 7.49 L69 9.46 L20 2.36 M-08 7.24 L70 10.81 L21 5.92 M-79 7.01 L71 12.5 L22 5.72 L47 7.7 L72 13.81 L23 9.46 L48 6.13 L73 11.68 L24 11.9 L49 11.1 L74 9.99

4.1.2.5. Leaf length

Mean values for leaf length ranged from 1.7-5.1 cm. It is clear from the data

that L-29 possessed the highest leaf length (5.1 cm), closely followed by L-30 (4.7 cm)

and L-31(4.5 cm). These landraces exhibited the maximum vegetative growth. L-3 and

L-6 had the shown minimum leaf area (1.7 cm) followed by L-50 (1.8 cm), and L-

5(1.9 cm). All other landraces remained intermediate results. This can be clarified0by

photosynthesis0which is more0critical when the size0of stipules and0leaflets are0large,

80

hence the yields0are higher. Basaran et al. (2012) and Basaran et al. (2013) noticed a

strong0correlation between leaflet0length and weight0of 100 seeds in grass0pea.

Table No: 4.1.5 Means values of leaf length in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 2.5 L25 3.8 L50 1.8 L1 2.2 L26 3.9 L51 2.1 L2 2.5 L27 4.2 L52 2.3 L3 1.7 L28 4.3 L53 2.4 L4 2 L29 5.1 L54 2.6 L5 1.9 L30 4.7 L55 2.3 L6 1.7 L31 4.5 L56 2.5 L7 2.8 L32 4.2 L57 2.7 L8 2.6 L33 3.9 L58 3.1 L9 2.1 L34 2.8 L59 3.5 L10 3.1 M-25 2.7 L60 3.3 L11 3.2 M-116 2.9 L61 3.6 L12 3.3 M-102 3.1 L62 3.8 L13 3.6 M-91 3 L63 3.9 L14 3.4 M-07 2.9 L64 4 L15 3 M-83 2.8 L65 3.8 L16 2.9 M-22 3.1 L66 3.5 L17 2.7 M-72 3.2 L67 3.1 L18 3.1 M-39 3 L68 2.9 L19 3 M-86 3.3 L69 3.6 L20 1.8 M-08 3.2 L70 3.9 L21 2.9 M-79 3.1 L71 4.2 L22 2.8 L47 3.3 L72 4.4 L23 3.6 L48 2.9 L73 4 L24 4.1 L49 3.9 L74 3.7

4.1.2.6. Leaf width

Mean values for leaf length ranged from 1.7-5.1 cm. It is clear from the data

that L-29 possessed the highest leaf length (5 cm), closely followed by L-30 (4.7 cm)

and L-31(4.4 cm). These landraces exhibited the maximum vegetative growth. L-3 and

L-6 and L-50 had the shown minimum leaf width (1.7 cm) followed by L-1 (1.8 cm),

81

and L-5 (1.8 cm). All other landraces remained intermediate results. This can be

clarified0by photosynthesis0which is more0critical when the size0of stipules and leaflets

are0large, hence the0yields are0higher. Basaran et al. (2012) and Basaran et al. (2013)

noticed a strong0correlation between leaflet0length and weight0of 100 seeds in0grass-

pea.

Table No: 4.1.6 Means values of leaf width in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 2.7 L25 3.7 L50 1.7 L1 1.8 L26 3.8 L51 2.1 L2 2.5 L27 4.1 L52 2.2 L3 1.6 L28 4.3 L53 2.4 L4 1.9 L29 5 L54 2.6 L5 1.8 L30 4.7 L55 2.3 L6 1.2 L31 4.4 L56 2.4 L7 2.7 L32 4.2 L57 2.6 L8 2.6 L33 3.9 L58 3.1 L9 2 L34 2.9 L59 3.4 L10 3.1 M-25 2.7 L60 3.3 L11 3.2 M-116 2.8 L61 3.5 L12 3.3 M-102 3 L62 3.8 L13 3.5 M-91 3 L63 3.9 L14 3.3 M-07 2.8 L64 3.9 L15 3.1 M-83 2.8 L65 3.8 L16 2.9 M-22 3.1 L66 3.5 L17 2.8 M-72 3.1 L67 3.1 L18 3.2 M-39 3.1 L68 2.9 L19 3.1 M-86 3.3 L69 3.6 L20 1.8 M-08 3.1 L70 3.8 L21 2.8 M-79 3.1 L71 4.1 L22 2.8 L47 3.2 L72 4.3 L23 3.6 L48 2.9 L73 4 L24 4 L49 3.9 L74 3.7

82

4.1.2.7. Days to flowering initiation

The landraces also revealed highly significant differences for days to

flowering. Minimum number of days taken for flowering were found in L-20 (49.0)

followed by L-6 (50.0) L-34 and M-25 (51.0) (Table 4.1.7). Maximum number of days

for flowering were noted in landraces L-29 (62.0) followed by L-12, L-13, L-15 and L-

30. (61.0). The possible0reason of0early flowering0in certain genotypes0indicated

adaptability of these genotypes in a particular environment, better and efficient

utilization0of nutrients in a relatively0hostile environment0which might have resulted in

early0termination of vegetative0phase and initiation0of reproductive0stage as9compared

to0genotypes which took0longer time to0flowering (Ishtiq et al., 1996). Similar0results

have also0been reported0earlier (Hussain and Badshah 2002), Singh et al. (2004)

(Vocanson and Jeuffroy, 2008).

83

Table No: 4.1.7 Means values of days to flowering initiation in pea genotypes


4.1.2.8. Days to Flowering Completition:

The time taken from germination to flower completition revealed significant

differences among the landraces. It is evident from result that L-29 took the maximum

days (77.0) for flowering completition, closely followed by L-30 (75.0) L-27 and L-28

(74.0) and L-24 and L-31 (73.0), whereas L-20, L-6, L-34 and M-25 took the

minimum number of days to complete flowering (61.0 to 64.0). The cultivars taking

minimum number0of days to0flowering are0comparatively early0maturing than0other

cultivars, from0the farmers0point of view such0cultivars seem0more desirable0because

84

early0flowering means0early crop0maturity. According to Makasheva, (1983) pea

cultivars have an adequately0wide range of0duration0of0vegetative-period0and0their

consequent phases (flowering, maturation etc.). The period of vegetative growth

corresponds to agro-c1imatic0peculiarities of0the area of their0cultivation.

Table No: 4.1.8 Means values of days to Flowering Completition in pea genotypes


4.1.2.9. Days to Pod Formation of Pea

The landraces also revealed highly significant differences for days to pod

formation (Table 4.1.9). Maximum number of days taken for pod formation were

found in L-29 and L-39 (69.0 each) followed by L-15 and L-24 (68.0 each) and L-12,

85

L-13, L-23, and L-25, (67.0 each). Minimum number of days for pod formation were

noted in landraces L-6, (56.0) followed by L-33 (57.0) and L-20, L-34, and M-25 (58.0

each). The cultivars taking minimum number0of days to0flowering are0comparatively

early0maturing than other0cultivars, from the farmers0point of view such0cultivars seem

more0desirable because early0flowering means early0pod formation0result in early0crop

maturity. According to Makasheva, (1983) pea cultivars have an adequately0wide

range of duration of vegetative-period and their consequent phases (flowering,

maturation etc.). The period of vegetative growth corresponds to agro-

c1imatic0peculiarities of0the area of their0cultivation.

Table No: 4.1.9 Means values of days to pod formation in pea genotypes


86

4.1.2.10. Number of pods per plant of Pea

Number of pods per plant also revealed highly significant differences among

all the landraces. Maximum pods per plant were found in L-29 (18) followed by L-22,

L-27, L-28, and L-30 (17.0). Data concerning number of pods per plant indicated

significant difference among the landraces. The landraces L-6 and L-57 produced the

minimum number of pods per plant (10.0). It indicated that priority0could be given0to a

certain cultivar over others on the basis 'of number of pods per plant, if other

parameters were also at optimum level. More number of pods per plant might

be0because0of small0pod size as fewer-nutrients0are required for0small pods0compared

with larger0pods (Baginsky et al., 1994). Number of0pods per plant identify to0plant

height. Vigorous0varieties produced0more pods while number0of pods0decreased0with

decrease in plant0height, which may be ascribed to0hereditary or genetic0make-up0of

the plants. Pods0per plant have significant and positive0correlation with biological

yield, grain yield and harvest index. Similar results have also been reported0earlier

(Hussain et al., 2005; Khokar et al., 1998). Some scientist’s observed0numbersof pods

per plant as the most useful yield-component (Javaid et al., 2002).

87

Table No: 4.1.10: Means values of number of pods per plant in pea genotypes


4.1.2.11. Pod length (cm)

Data on pod0length showed important0modifications among0the landraces A

comparison of means for landraces showed that check variety demonstrated the

maximum pod0length (10.5 cm) followed0by M-83 (10.1 cm), L-57(9.8 cm), and M-22

and M-86 (9.5 cm each). Minimum pod length (4.5 cm) was recorded in L-4 followed

by L-2 (4.7 cm). ). A number of prior workers have previously0reported that pea

cultivars0differ importantly0in size and0form of pods0and number of0seeds per0pod

(Makasheva, 1983; Muehlbauer and McPhee, 1997). Shah et al. (1990) have reported

comparable0outcomes. In general, pod0size is a varietal0character, yet it is0additionally

88

influenced by vigour0of plant. More0availability0of0nutrients particularly0during0pod

formation and development stages of more vigorous pea varieties might have

translocated most of its reserved food material towards pod-formation and

development (Arshad et al., 1998; Ishtiaq et al., 1996).

Table No: 4.1.11: Means values of pod length (cm) in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 10.5 L25 7.6 L50 8.6 L1 5.5 L26 7.5 L51 8.7 L2 4.7 L27 8.5 L52 8.1 L3 5 L28 8.6 L53 7.5 L4 4.5 L29 8.7 L54 7.6 L5 5.8 L30 8.2 L55 8.7 L6 5.8 L31 8.3 L56 9.3 L7 6.1 L32 8.5 L57 9.8 L8 6.5 L33 8.6 L58 8.7 L9 7.5 L34 8.7 L59 8.7 L10 6.6 M-25 9 L60 7.6 L11 8 M-116 9.2 L61 7.6 L12 8.7 M-102 9.3 L62 8.7 L13 8.3 M-91 9.3 L63 7.5 L14 8.3 M-07 9.1 L64 8.1 L15 6.6 M-83 10.1 L65 8.2 L16 7.6 M-22 9.5 L66 7.3 L17 7.6 M-72 9.2 L67 7.3 L18 7.1 M-39 9.3 L68 8.3 L19 7.7 M-86 9.5 L69 8.2 L20 7.9 M-08 8.7 L70 8.1 L21 8.2 M-79 9.4 L71 7.6 L22 8 L47 7.6 L72 7.6 L23 7.6 L48 7.6 L73 8.2 L24 7.6 L49 8.5 L74 8.1

4.1.2.12. Pod width

Means values for leaf width ranged from 1-2.1 cm. All the landraces except L-

1, L-3, L-4, L-6, L-7, L-8, L-11 and L-12 produced nearly the same pods width. The

landraces L-1, L-3, L-4, L-6, L-7, L-8, L-11 and L-12 produced the minimum pods

89

width (1cm). In general, pod size is a varietal character, yet it is additionally

influenced by0vigour of0plant. More0availability0of0nutrients particularly0during0pod

formation and development0stages of more vigorous pea varieties0might have

translocated most of its reserved food material towards pod-formation and

development (Arshad et al., 1998; Ishtiaq et al., 1996).

Table No: 4.1.12: Means values of pod width (cm) in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 1.2 L25 1.2 L50 1.1 L1 1 L26 1.2 L51 1.1 L2 1.1 L27 1.1 L52 1.1 L3 1 L28 1.2 L53 1.1 L4 1 L29 1.2 L54 1.2 L5 1.2 L30 1.2 L55 1.2 L6 1 L31 1.2 L56 1.2 L7 1 L32 1.1 L57 1.2 L8 1 L33 1.1 L58 1.2 L9 1.2 L34 1.1 L59 1.2 L10 1.1 M-25 1.2 L60 1.1 L11 1 M-116 1.2 L61 1.1 L12 1 M-102 1.2 L62 1.2 L13 1.1 M-91 1.2 L63 1.1 L14 1 M-07 1.2 L64 1.2 L15 1.2 M-83 1.2 L65 1.2 L16 1.2 M-22 1.2 L66 1.1 L17 1.2 M-72 1.2 L67 1.1 L18 1.2 M-39 1.2 L68 1.2 L19 1.2 M-86 1.2 L69 1.2 L20 1.2 M-08 1.2 L70 1.2 L21 1.2 M-79 1.2 L71 1.1 L22 1.2 L47 1.1 L72 1.1 L23 1.2 L48 1.1 L73 1.2 L24 1.2 L49 1.1 L74 1.2

90

4.1.2.13. Number of seeds per pod

Means values for seed per pod ranged from 4-8. Landraces L-35, L-36, L-37,

L-38, L-39, L-40, L-41, L-42, L-43, L-44, and L-46 excelled in seeds per pod (8.0)

followed by L-11, L-12 and L-13 (7.0), where as landraces L-1, L-2, L-3,and L-4

produced the lowest (4.0) number of seeds per pod. According to Makasheva, (1983)

the number of seeds in a pod is variable depending upon the cultivar The number of

seeds per0pod depends mostly0on the cultivar0and on0the natural0conditions yet has

additionally0been recorded0to be influenced by plant0density. The average0number of

seeds per0pod was inversely0related to plant0population. These outcomes are similar to

those of Arshad et al. (1998) who expressed that number of seeds are correlated with

pod length. The more is the pod length, the more is number of seeds and vice versa.

The environmental and genetic factors of different cultivars may have affected process

of fertilization (Qasim et al., 2001). The number0of seeds0pod-1 is an important0yield

component0and contributes0to the final0yield. Decrease in0seeds pod-1 may result0due to

the genetic characteristics or environmental unsuitability, which may hinder the

process0of0pollination, fertilization0or0cause0abortion. The0possible0reason0of0less

number0of seeds0per-pod may be that environmental0condition was not0appropriate at

the season0of pollination0and0fertilization (Ali et al., 2002).

91

Table No: 4.1.13: Means values of number of seeds per pod in pea genotypes


4.1.2.14. 100-Seed fresh weight (g)

Highly significant differences were also observed among landraces for 100-

seed fresh weight. Maximum 100-seed fresh weight was noted in M-83 (29.6 g)

followed by M-91 (28.3 g) and Check variety (28.2 g). L-2 gave minimum 100-seed

fresh weight (12.0 g) followed by L-1 (12.3 g), L-4 (12.5 g) and L-3 (12.9 g). All other

landraces remained intermediate in performance with respect to this trait. Different

ecological0conditions enable the seed0to be filled0to its genetic0potential. With

increased plants per area, each plant has fewer resources available which could

92

convert0into smaller0seeds. In a few circumstances, plants can abort flower sites so that

all fertile0seeds can fill to0larger0sizes. The reduction0in the number0of pods0per plant,

seeds per0pod and seed0weight at the0higher0densities may be because0of increased

interplant0competition. The results suggest0a strong0relationship between0source and

sink and maximum translocation0of food0material from0vegetative to reproductive

portion0in good0environmental condition0which cause higher0seed weight (Ali et al.,

2002). The rate of0acclimatization of0genotypes may be0considered the possible0cause

of this0variation. Moreover, this variation0might be due0to genetic0variability of

different0genotypes (Hatam and Amanullah, 2001).

Table No: 4.1.14: Means values of 100-seed weight (g) in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 28.2 L25 18.5 L50 22.1 L1 12.3 L26 19 L51 22.5 L2 12 L27 23.8 L52 22.3 L3 12.9 L28 23 L53 21.1 L4 12.5 L29 23.5 L54 22.1 L5 13 L30 23.5 L55 22.9 L6 13.7 L31 23 L56 24.7 L7 13 L32 23.4 L57 24.6 L8 13.4 L33 24.9 L58 23.5 L9 17 L34 23.2 L59 22.5 L10 17.5 M-25 26.8 L60 20.1 L11 19 M-116 27.2 L61 19.7 L12 18.2 M-102 26.4 L62 21.8 L13 19.2 M-91 28.3 L63 18.6 L14 19 M-07 27.2 L64 23.9 L15 18.6 M-83 29.6 L65 23.4 L16 19.2 M-22 25.8 L66 19.5 L17 18.6 M-72 26 L67 20.3 L18 19 M-39 27.3 L68 24.2 L19 21.4 M-86 27 L69 24.6 L20 22 M-08 25.3 L70 23.8 L21 22.6 M-79 26 L71 18.7 L22 22 L47 19 L72 19.8 L23 16.4 L48 19.2 L73 22.9 L24 18 L49 20.1 L74 22.3

93

4.1.2.15. Yield (kg/ha)

The variation0in yield was observed0among different0landraces. Landraces M-

83 had0maximum yield (19.73 kg/ha) followed by M-25 and M-07 (18.13 kg/ha) and

M-91 (18.8 kg/ha). Landraces L-2 produced minimum yield (8.0 kg/ha) followed by L-

1 (8.2 kg/ha) L-4 (8.3 kg/ha) and L-3 and L-7 (8.6 kg/ha each). Yield0is a complex

character determined by the interaction0of many heritable0characters with soil, climate

and agronomic0conditions (Makasheva, 1983). Maximum0yield requires maximum

vegetative0growth during crop0establishment (Muehlbauer and McPhee, 1997). Higher

number0of leaves means more0photosynthesis and ultimately0more yield. More0yields

in various0genotypes-might be because of optimum0plant survival, long0and more

number0of seeds per0pod, which eventually0contributed altogether0towards final0yield.

The performance0of a cultivar0mainly0relies upon0association of hereditary or0genetic

make up and environmental0condition. Therefore, these two0factors provide an index

for0selection of0cultivars for a specific0locality. Similar results have also0been0reported

by Ranalli et al. (1992) who0observed that dissimilar cultivars0varied in their0yield

competence. Warmer weather0condition and storm0cases must be responsible0for

lessening seed yield performance in the second experimental year because high

temperature during0flowering and pod0formation reason for0reduction in seed0yield in

pea. Further, optimum0temperature and comparative0moisture through0grain filling

period might also be responsible for maximum translocation of photo integrates

towards0final end0product. Positive0association of0grain yield with plant0height, pods

per plant and stem girth has also been observed0under field or rainfed0conditions by

Hatam and Amanullah, (2001).

94

Table No: 4.1.15: Means values of yield (kg/ha) in pea genotypes

Genotypes Means Genotypes Means Genotypes Means CH 18.8 L25 12.3 L50 14.7 L1 8.2 L26 12.66 L51 15 L2 8 L27 15.86 L52 14.8 L3 8.6 L28 15.33 L53 14.06 L4 8.3 L29 15.66 L54 14.7 L5 8.6 L30 15.66 L55 15.26 L6 9.13 L31 15.33 L56 16.4 L7 8.6 L32 15.6 L57 16.4 L8 8.9 L33 16.6 L58 15.6 L9 11.33 L34 15.46 L59 15 L10 11.6 M-25 17.86 L60 13.4 L11 12.6 M-116 18.13 L61 13.1 L12 12.13 M-102 17.6 L62 14.5 L13 12.8 M-91 18.8 L63 12.4 L14 12.66 M-07 18.13 L64 15.93 L15 12.4 M-83 19.73 L65 15.6 L16 12.8 M-22 17.2 L66 13 L17 12.4 M-72 17.3 L67 13.53 L18 12.6 M-39 18.2 L68 16.13 L19 14.2 M-86 18 L69 16.4 L20 14.6 M-08 16.86 L70 15.8 L21 15.06 M-79 17.33 L71 12 L22 14.6 L47 12.6 L72 13.2 L23 10.9 L48 12.8 L73 15.2 L24 12 L49 13.4 L74 14.8

4.1.16. Simple Correlation Coefficient

Table 4.1.16 represents the correlation coefficients among all the quantitative

traits. Yield was showing maximum positive and highly significant correlation with

seed weight (1.000** ). Leaf length was showing maximum positive and highly

significant correlation with leaf width (0.994** ) and leaf area (0.989** ) followed by leaf

area and leaf width (0.985** ). Number of seed per pod was having positive and highly

significant correlation with pod length (0.960** ), seed weight (0.935** ) and yield

(0.934** ), respectively followed by days to flower completion with days to flower

95

initiation (0.923** ). Pod length was showing maximum positive and highly significant

correlation with seed weight and yield (0.912** ). The plant height was showing highly

significant and positively correlated with four characters which are: leaf area (0.831** ),

number of leaves (0.821** ), days to flower completion (0.569** ) and days to flower

initiation (0.526** ). Number of leaves was showing highly significant and positive

correlation with the traits such as leaf length (0.798** ), leaf width (0.781** ) and leaf

area (0.777** ). A highly significant correlation was found between pod width with seed

weight and yield (0.621** ). Number of pods per plant has a positive significant

correlation with leaf length (0.227*), leaf width (0.249*) and number of leaves

(0.228*). Yield was correlated with two characters: leaf width (0.262*) and leaf length

(0.239*). This can be clarified by0photosynthesis which is more0critical when the size

of0stipules and leaflets are large, hence the yields0are higher. Basaran et al. (2012) and

Basaran et al. (2013) noted a strong correlation0between leaflet0length and weight0of

100 seeds in grass0pea. Number of0seeds per0pod was negatively0correlated to0weight

of 100 seeds. A negative-significant0correlation between these two0characters was

found0by Gatti et al. (2011). Stipule-length and width leaflet length and width were

correlated0between themselves. The same result was obtained0by Gatti et al. (2011).

Number0of grain per0pod was correlated0positively and significantly with pod0length.

Ali et al. (2007) found0also a significant positive0correlation between these two-

characters.

96

Table.4.1.16: Simple Correlation coefficient for morphological traits among 75 peas landraces

Ger PH NOL LL LW LA DFI DFC PF PP PL PW NOSP SW YIE LD

Ger 1

PH .178 1

NOL .113 .821** 1

LL .116 .822** .798** 1

LW .096 .795** .781** .994** 1

LA .118 .831** .777** .989** .985** 1

DFI .129 .526** .295* .527** .516** .526** 1

DFC .179 .569** .409** .587** .576** .584** .923** 1 PF .139 .346** .155 .382** .378** .376** .754** .748** 1

PP .137 .262* .227* .279* .296** .288* .197 .139 .260* 1

PL .148 .057 .284* .272* .291* .235* -.038 .025 -.105 .322** 1

PW .011 .211 .356** .220 .241* .206 .061 .078 .139 .303** .529** 1

NOSP .170 .015 .228* .227* .249* .190 -.089 -.041 -.127 .328** .960** .559** 1

SW .170 .092 .336** .241* .264* .211 -.127 -.060 -.196 .351** .912** .621** .935** 1

YIELD .172 .091 .334** .239* .262* .209 -.127 -.061 -.196 .355** .912** .621** .934** 1.000**

1

**. Correlation is significant at the 0.01 level (2-tailed). *. Correlation is significant at the 0.05 level (2-tailed).

Where; G= Germination % age, PH= Plant Height, NOL= Number of Leaves, LL= Leaf Length, LW= Leaf Width, LA= Leaf Area, DFI= Days to Flower initition, DFC= Daya to Flowering completion, PF= Pod formation, PP= Pod per plant, PL= Pod length, PW= Pod width, NOSP=Number of Seed per pods, SW= 100 Seed weight, Y= Yield.

97

4.1.17. CLUSTER ANALYSIS

Average linkage distance among peas landraces

The dendrogram indicated the expected association among the Peas landraces.

Dendrogram was created with computer software PAST, using seventy five landraces

showed two main clusters I, and II at linkage distance of near about 160. Cluster I

includes two sub clusters I-A and I-B. Cluster I-A comprised of 16 landraces namely

L-3 and L-7, L-4 and L-5, L-1 and L-2, L-13 and L-15, L-12 and L-14, L-18 and L-19,

L-8 and L-9 were correlating each other at same linkage distance. Genotypes Check

and L-10 were outliers in this sub cluster (I-A) showing vriability. Sub Cluster I-B

comprised of thirteen landraces. Landraces L-16 and L-20, L-53 and L-55, L-51 and L-

52, L-16 and L-17, L-54 and L-56 were similar to each other in term of traits studies

while landraces L-50, L-57 and L-34 were outliers for this cluster.

Cluster II was also comprised of two sub cluters II-A and II-B. Sub cluster II-A

was comprised of two sub sub clusters II-A1 and II-A2. II-A1 was comprised of ten

landraces M-102 and M-72, M-22 and M-79, M-39 and M-116, M-25 and M-91 that

were present at same linkage distance while landraces M-83 and M-07 were outliers

for this cluster. Sub sub cluster IIA-2 comprised of 16 landraces, L-21 and L-22, L-66

and L-67, L-69 and L-74, L-48 and L-49, M-08 and L-58 were correlated to each other

at same linkage distance whereas L-47, M-86 and L-33 were outliers for the cluster.

While sub cluster II-B was containing 20 landraces from which only L-64, L-71, L-23

and L-24 were showing maximum variability and were outliers for the cluster.

Landraces L-27 and L-28, L-31 and L-32, L-30 and L-29, L-62 and L-65, L-70 and L-

98

73, L-63 and L-72, L-60 and L-61, L-25 and L-26 were significantly related to each

other, respectively.

Figure 4.1.1: Dendrogram based on average linkage distance for 75 peas

genotypes

99

Figure 4.1.2: Dendrogram based on average linkage distance for 15 Traits

4.1.18: Average linkage distance among pea’s traits based on morphological

studies

The cluster analysis exposed as a dendrogram showed the predictable

association among 15 Peas traits. Dendrogram was constructed with computer

software PAST, using seventy five genotypes showed two main clusters I and II at

linkage distance of near about 950. Cluster I was sub divided into two clusters I-A and

I-B. I-A comprised of Germination percentage and Flower completion whereas I-B

comprised of four traits; flower inititation and pod formation, plant height and number

of leaves at same linkage distance. Cluster II was subdivided into two sub cluster II-A

100

and II-B. Sub cluster II-A comprised of three traits including pod per plant and yield at

same linkage distance whereas seed weight was outlier in this cluster. Pod length and

seed per pod, leaf length and leaf width were correlating each other for sub cluster II-

B. Leaf area and pod width were outliers in this cluster.

4.1.19. PRINCIPAL COMPONENT ANALYSIS

Principal0components analysis (PCA) has an ability0to recognize0and eliminate

redundant0data from0experimental0results. Using PCA, large0number of available0data

is0reduced, which results in different number of the new variables, so0called

principal 0components (PC). Principal0component (PC) is in fact a linear0combination

of0original0variables. In0practice, it is usually sufficient to retain only a few

principal0 components, whose sum includes large percentage of total0variable. There

are three Eigen values higher than 1 in principal components. Three separated

components0showed cumulatively 78.53 % of total0variability. The first of them

accounts for 41.22%, the second for 27.52% and the third for 9.79% of all0variations.

The principal0components (PC1 and PC2) account for 68.74 % of all0variations of

genotype0characteristics. The maximum Eigen value was 6.18, while the minimum

was 1.46.

Table 4.1.18: The Eigen values for 15 traits of Pisum sativum L. genotypes.

PC 1 2 3 Eigen value 6.18 4.12 1.46 % variance 41.22 27.52 9.79 Cumulative Eigen Value 41.22 68.74 78.53

101

Figure 4.1.3: Scatter Biplot diagram of 75 landraces of Peas on the basis of

morphological characterization

Germ.%

Plntheght

leaves.no

leaflngthleafwdthleafarea

flowrinit.flwrcomp.podform.

pod/plnt

podlngth

podwdth

seed/podseedwtyield

CH

L1L2

L3L4

L5

L6

L7L8

L9

L10

L11

L12L13L14

L15

L16

L17

L18

L19

L20

L21L22

L23

L24

L25L26

L27 L28

L29

L30

L31L32

L33

L34

A35

A36

A37

A38

A39

A40

A41A42

A43

A44

A45

A46

L47

L48

L49

L50L51

L52

L53 L54

L55

L56

L57

L58

L59

L60

L61

L62

L63

L64

L65

L66

L67

L68

L69L70

L71

L72

L73L74-8.0 -6.4 -4.8 -3.2 -1.6 1.6 3.2 4.8 6.4

Component 1

-4

-3

-2

-1

1

2

3

4

Com

pon

ent

2

102

1EXPERIMENT NO. 02

4.2. Biochemical Studies

4.2.1.1. Moisture Content (%)

Table No. 4.2.1 was shows1the values1for moisture content of peas. The values

of moisture-content ranged from 7.1 to 9.9%. Maximum value of moisture-content was

found1for landraces, M-102 (9.9%) followed by M-91 (9.4%), M-07 and M-22 (9.1%).

Minimum value/of moisture/content was1found in L-13 (7.1%) followed by L-20 and

L-29, L-23, L-28 and L-32 (7.3%) and L-30 (7.4%). Other1landraces were showing

moderate1values for moisture-content. Pea seeds with low initial seed moisture content

(7 .5percent) were0lower in germination/and/had/a slower0growth/rate as compared0to

seeds/with/moisture/content of l3.5 percent or/higher. Low/imbibitions temperature led

to1reduced seedling dry weights1of peas, but had no effect on germination. The results

with/faba/beans and/peas/agree/with/what is known1about legumes0in1general, i.e.,

germination1and seedling0vigor are adversely1affected by low seed1moisture and low

imbibition0temperatures (Roos0and Manalo, 1976; Hobbs0and Obendorf, 1972). High

variations in composition/of/Field/peas/were/found (Jezierny/et al., 2011; Ravindran/et

al., 2010; Schumacher0et al., 2009; Bastianelli0et al., 1998) with0regard1to

high1differences in the selection1of0varieties. The0present results were generally0in

agreement0with those1outcomes. Fluctuations1could be additionally1due-to varying

environmental-influence.

103

Table No: 4.2.1 Means values of moisture content in pea genotypes

Genotype Means Genotype Means CH 7.8 L24 7.7 L2 8.1 L25 7.7 L3 7.7 L26 8.6 L4 7.7 L27 7.6 L5 8.9 L28 7.3 L6 8.3 L29 7.2 L7 8.8 L30 7.4 L8 8.2 L31 7.8 L9 8.2 L32 7.3 L10 8.1 L33 7.9 L11 8.5 L34 8.3 L12 8.3 M-25 8.3 L13 7.1 M-116 8.7 L14 8.3 M-102 9.9 L15 8.8 M-91 9.4 L16 7.5 M-07 9.1 L17 7.7 M-83 8.3 L18 7.9 M-22 9.1 L19 8.3 M-72 8.9 L20 7.2 M-39 8.8 L21 7.9 M-86 8.9 L22 8.7 M-08 8.8 L23 7.3 M-79 8.7

4.2.1.2. Crude Fat (%)

Table No. 4.2.2 shows1values for fat-content. The values1of fat were ranging

from 1.21% to 1.62%. Maximum1value of (1.62%) was found for landraces, M-25,

followed1by M-72 (1.59%) and M-08 (1.57%). Minimum1value (1.21%) was found in

CH, followed1by L-8 (1.23%) and L-15 (1.24%). Other1landraces were showing

intermediates result1for this trait. The fat substance1of beans, peas, and1lentils is

generally0very low and there is no1cholesterol. Protein-content is high, more than the

amount0of protein that is found in cereal1grains (USDA, 2015). The decrease in fat

content1of seed could be due to1total solid loss1during soaking prior to germination or

104

use of1fat as an energy source in sprouting1process (Wang et al., 1997). Other1authors

observed0diverting results especially1for CP and-starch, as well as comparable1results

for1fat, ash, and CF. High variations1of the composition0of Field-peas were found

(Jezierny et al., 2011) with/regard to high differences in the selection1of0varieties. The

present1results were generally1in agreement0with those/outcomes. Fluctuations0could

be additionally/due/to/varying/environmental-influence.

Table No: 4.2.2 Means values of fat content in pea genotypes


105

4.2.1.3. Crude Fibers %

Minimum fiber were found0in L-3 (0.83%) followed by L-11 (0.88%) and CH

(0.89%), where as maximum fiber were observed0in L-10 (1.98%) followed1by L-31

(1.53%) and L-26 (1.52%). All1other landraces show moderate1results. Another

essential1segment of beans, peas, and lentils is fiber. Fiber is a piece of1plant

nourishments1that can't be1processed. Beans, peas, and lentils have around 7 g of

dietary fiber. Insoluble1fiber masses stool1and abatements travel1time1through the

colon, accordingly1anticipating1constipation. The solvent1fiber in beans, peas, and

lentils is profoundly fermentable in the colon, which is believed to be health-enhancing

(USDA, 2015). Fiber is an indigestible complex carbohydrate found in

structural1components of plants. They cannot-be1absorbed by the body1and therefore,

have no1calorific value1however, the health0benefits0of/eating/fiber0rich/diet are

immense1including0prevention1of1constipation, regulation1of blood/sugar, protection

against heart diseases, reducing high levels of and prevention of certain forms

of1cancers. Fibers are classified1into insoluble and soluble1depending1upon1their

solubility. Insoluble0fibers consist1mainly of/cell/wall components1such as0cellulose,

hemi-cellulose/and lignin/and soluble/fibers/are non-cellulosic/polysaccharides/such as

pectin, gums1and0mucilage (Yoon0et al., 2005). Chemical1content of pea0seeds can

vary. Genetic (variety) and environmental1factors (location0of cultivation0area, soil

characteristics, exchangeable1cations, trace1elements, cropping year, total1rainfall,

relative1humidity, solarisation, temperature) are/of importance (Kraus0et al., 2003,

Wang et al., 2004, Nikolopoulou et al., 2006) as well as technological1treatments

106

(dehulling, cooking, soaking, germination, extrusion) (MartinezVillaluenga et al.,

2008, Wang et al., 2004, Al-Marzooqi and Wiseman, 2009.

Table No: 4.2.3 Means values of fiber content in pea genotypes


4.2.1.4. Crude Protein %

Table No. 4.2.4 was showing the1values for protein-content. The values of

protein were ranging from 27.01% to 17.67%. Maximum-value of (27.01%) was found

for landraces, L-34, followed by L-25 (26.31%). Minimum-value (17.67%) was found

in L-3 and L-4 (19.05%). Other1landraces were showing1intermediates result1for this

trait. Differences in1climate, soil, varieties, and agronomic1practices1may cause

107

different/crude/protein/content/when/grown/in various1parts of the1world. The/results

obtained/in/this/study/are showing1us that genotype had a significant1influence on the

levels1of crude/protein/in/the/field/pea (Wang/and/Daun, 2004). In accordance1Witten

et al., (2015) describes0that the variety1of1field-peas has/an influence on its-crude

protein content. In addition they revealed that environmental conditions and agronomic

practice/have/strong0influence on0pulse-seed/quality.

However, the mean0protein0content of0235 ± 15.5 g kg–1 was0similar to1those

reported/in the literature (Marquardt/and/Bell, 1988). Although only two0green-seeded

and two1brown-seeded cultivars1were included0in this0study, it appeared1that the

variations in protein1contents are/not/related/to/seed-coat1colour, since/the lowest1and

highest/values are within the1yellow-seeded cultivars. There was also no0correlation (r

= –0.07; P ≥ 0.05) between1protein/content and seed0size. This finding1confirms the

previous1study by Ali/and/Youngs (1973), who/obtained a1correlation/coefficient of –

0.12 between0protein and seed0size and/suggested/that selection0for high0protein

would/not have any/deleterious/effects/on seed/size. This wide range of protein content

could0be a reflection1of the0conditions1under/which/the1cultivars were grown0or the

inherent1varietal-differences. In this/regard, protein1contents of peas are0known1to

vary/with soil0type and nitrogen1application (Igbasan0et al., 1996), location1and year

(Ali /and/Youngs, 1973) and1genotypes (Matthews and Arthur, 1985). The0crude

protein/content reported/by Hove et al. (1978) ranged from 205 to 226 g/kg DM. There

are numerous1causes of1variability in the content1of crude-protein, including1genetic

(variety), cultural/and/environmental (soil, climate) origins Protein content is typical of

individual1materials and depends on many1factors, such as: variety, cultivar, soil- and

108

climate1related1factors, fertilization1and others. (Rawel et al., 2002) (Labuckas et al.,

2008). Similar0protein0levels have/also been/reported by/other1authors (Chavan et al.,

1999).

Table No: 4.2.4 Means values of protein content in pea genotypes


109

4.2.1.5. Carbohydrate (%)

Minimum1carbohydrate were1found in L-34 (59.32%) followed1by M-91

(61.7%), M-07 (61.8%), and L-26 (61.9%), L-25 (61.9%) and L-24 (61.9%), where as

maximum1carbohydrate were observed in L-3 (69.5%) followed by L-4 (68.5%), L-18

(67.7%), L-29 (67.3%) and L-28 (67.0%). All other1landraces showed intermediate

results. Starch is the most1abundant component1of/peas. The/content/of/total (444-520

g/kg0DM) and0enzyme1susceptible (391-447 g/ kg DM) starch0in pea0seeds

significantly/differed among/cultivars. Despite/this, the/average total1starch level/was

similar1to that (480 g/kg) determined0by0Cerning-Bernard and0Filiatre, (1976).

According1to1Colonna et al., (1992) pea starch contained 33.2% amylose and 64.7%

amylopectin.

Other1authors observed1diverting1results1especially for/CP/and/starch, as well

as comparable1results for EE, ash, and/CF. High/variations/of the composition of Field

peas0were founds(Jezierny0et al., 2011; Ravindran0et al., 2010; Schumacher0et al.,

2009; Bastianelli0et al., 1998) with regard to high differences in the selection of

varieties. The present results were generally in agreement with those outcomes.

Fluctuations1could be additionally-due to varying environmental-influence.

110

Table No: 4.2.5 Means values of carbohydrate in pea genotypes


4.2.1.6. Ash %

Minimum ash contents were found in L-19 (2.1%) followed by L-9 (2.2%), and

L-6, L-10 and L-26 (2.3%), where as maximum ash contents were observed in M-07

(4.4%) followed by M-91 (4.2%). All1other landraces showed average1results. Ash

content1in fruits and1vegetables are affected by agro-climatic1conditions such as

cultivation1practices, nature1of soil, and climatic1conditions. Ash0content is0used to

determine0the total1mineral present in a food1produce. A0high0percentage ash1value

equals a high total/mineral/value/in/the/fruit and vegetable/sample. Mineral availability

in fruits and vegetables-are influenced positively or negatively by these agro-

111

climatic1conditions (Forster0et al., 2002). The absence0of marked0differences in0the

nature0of soil0and climatic/conditions are/factors/that/explain/the lack1of difference in

the/ash/content/of/all/cultivars examined (Bugaud et al., 2006). Other authors observed

diverting0results1especially for0CP and0starch, as/well as1comparable results0for/EE,

ash, and/CF. High1variations of the composition of Field peas were founds(Jezierny et

al., 2011; Ravindran0et al., 2010; Schumacher0et al., 2009; Bastianelli0et al., 1998)

with0regard/to high0differences in0the selection1of0varieties. The present/results were

generally0in agreement/with/those/outcomes. Fluctuations/could be additionally/due/to

varying0environmental-influence.

Table No: 4.2.6 Means values of ash content in pea genotypes


112

4.2.1.7. Phenolics (mg/g)

Minimum phenolic-contents were found in L-12 (1.163) followed by L-9 (1.27

mg/l), and A-43 (1.29 mg/l), where as maximum phenolic-contents were observed in

L-38 (3.91 mg/l) followed by A-36 (3.82 mg/l). All1other landraces showed average

results. It has been recognized1that phenolic compounds act as antioxidants1and were

found high/amount in peas. The association/of antioxidant-properties of plant1phenolic

compounds and their effects in the prevention1of various1oxidative stress diseases, for

example, cancer or cardiovascular/diseases were explained by Dai and Mumper 2010.

Phenolics or polyphenol have received considerable1attention because of their

physiological-functions, including1antioxidant, antimutagenic and antitumor-activities.

They have been reported to be potential-contender to0combat free radicals, which are

harmful to our body1and foods-systems (Nagai et al., 2003). Although, phenolic

compounds1do-not have any1known nutritional-function, they may be important to

human health because of0their antioxidant/potency (Hollman et al., 1996). Phenolics

are ubiquitous plant/components that are primarily/derived from/phenylalanine via the

phenylpropanoid/metabolism (Dixon and Paiva, 1995). Substantial/dissimilarities that

exist in quantity/and/quality/of1total/polyphenols in plant foods have been attributed to

diverse inherent and external-conditions such as genetic-composition, plant/cultivar,

soil/composition, state of plant maturity, and postharvest practices (Jaffery et al., 2003;

Faller and Fialho, 2010).

Many studies/confirmed that the content/of phenolic-compounds depends on

the type of analyzed/sources. High temperature/processing leads to/alteration of the

molecular0compounds0resulting0in0polymerization0and0alteration0of0the-molecular

113

structure of phenolic1compounds thus leading to a condensed/extractability (Nayak

et al., 2011; Sharma et al., 2012). The high phenolic1contents in all fruit1cultivars

analyzed1agree with Sarawong et al., (2014) who claim that increase in phenolics

could be due to the disruption/of cell/walls by all extrusion/conditions thus subsequent

in higher TPC/content.

Table No: 4.2.7 Means values of phenolic content in pea genotypes


114

4.2.1.8. Chlorophyll content (mg/g)

Minimum chlorophyll contents were found in L-19 (11.1) followed by L-23

(12.2mg/g), L-7 (13.2mg/g) and L-8 (13.6mg/g), where as maximum chlorophyll

contents were observed in L-30 (33.92mg/g) followed by L-34 (32.35mg/g) and L-24

(31.93mg/g). All/other landraces showed moderate-results. Chlorophyll1is0one of0the

major/chloroplast-components for/photosynthesis, and/relative-chlorophyll-content has

positive0relationships with0photosynthetic1rate. The1decrease in chlorophyll1content

has been considered a typical symptom of oxidative stress and may be the result

of0pigment photo-oxidation and chlorophyll degradation. Photosynthetic pigments

are0important/to plants-mainly for harvesting light/and production/of reducing/powers.

Both0the0chlorophyll0a0and0b0are0prone0to soil dehydration. Environmental0stresses

have a direct impact on the photosynthetic apparatus, essentially by disrupting all

major components of photosynthesis including the thylakoid electron transport,

the carbon0reduction0cycle and the stomatal0control of the CO2 /supply, together with

an increased accumulation of carbohydrates, peroxidative destruction of lipids and

disturbance0of water0balance. The "non-stomatal" mechanisms include1changes in

chlorophyll synthesis, functional1 and structural0changes in0chloroplasts, and

disturbances0in processes0of 1accumulation, transport, and distribution of assimilates

(Allen and Ort, 2001).

115

Table No: 4.2.8 Means values of chlorophyll content in pea genotypes


4.2.1.9. pH

Table No. 4.2.9 shows the values for pH. The values of pH were ranging from

5.3 to 6.9. Maximum value of pH (6.9) was found for landraces, L-3, followed by L-8,

L-17 and L-30 (6.8). Minimum value (5.2) was found in L-2 and A-36 followed by, L-

27 and A-41 (5.4). Other1landraces were showing/intermediates result/for this trait.

Alkarkhi0et al. (2011) also1report/alike fall outs for0the0pH of young/green0banana

flour. Conversely, the0pH standards of0all young0cultivars were0higher than0values

obtained0in ripe1cultivars as0reported by/Arvanitoyannis/and/Mavromatis, (2009) due

116

to0the associated1increase in organic0acids present0in fruits/as ripening increases. The

pH of/food measures the amount/of/hydronium/ions (H3O+) present in a food/produce.

Many0food/quality1criteria have0been found to/correlate/better with pH than with acid

concentration (Sadler0and9Murphy, 2010).

Table No: 4.2.9 Means values of pH in pea genotypes


117

4.2.1.10. Total Soluble Solid (TSS) %

Table No. 4.2.10 shows the values for total0soluble0solids. The values of0total

soluble solids/were ranging from 1.1% to 2.9%. Maximum value of (2.9%) was found

for landraces, L-23, followed by L-29, M-116 and L-9 (2.8%). Minimum value (1.1%)

was found in L-3 and L-30 followed by, L-14 and CH (1.2%), and L-5, L-19, L-22,

and M-102 (1.3%). Other landraces were showing intermediates result for this trait.

Generally, the1amount/of1TSS in/a fruit/is directly/proportional/to/the/grade/of

fruit1maturity as1TSS is supposed/to1increase with1fruit maturity. Thus, TSS/can/also

oblige/as0a convenient/directory in0the determination0of0fruit ripeness and0maturity.

Comparable outcomes were recorded for TSS of green Cavendish banana flour and

unripe1banana (Alkarkhi et al., 2011). The low1values recorded1for the TSS0of all

cultivars0are accredited to0the fact0that the obtainable0starch existent in the1unripe

cultivars1are yet to be converted/into soluble0sugars0through0enzymatic0degradation

(Zhang0et al., 2005). Degradation/and consequent0reduction0in starch/proceed/rapidly

during/the1onset/of/ripening/thus leading/to/an/overall/increase in/TSS/of/fruits.

118

Table No: 4.2.10 Means values of total soluble solid in pea genotypes


4.2.11. CLUSTER ANALYSIS

Average linkage distance among peas germplasm

The cluster1analysis revealed1as a dendrogram1figure 4.2.1 indicated the

expected association/among 46 Peas1landraces. Dendrogram1was constructed with

computer1software PAST, using fourty1six genotypes/showed three main1clusters I, II

and/III at linkage/distance of near about 26. Cluster I includes/two sub-clusters I-A and

I-B. Cluster I comprised/of fifteen/landraces. In/sub-cluster/I-A, landraces L-16/and L-

20, L-18 and L-35, L-11 and L-12 were significantly correlating each other while

119

landraces L-13 and L-21 were outliers in this sub/cluster. Sub/Cluster I-B comprised of

landraces, L-23 and L-22, L-8 and L-33 present at same linkage distance showing

maximum/similarity in term of traits/studied while L-25, L-7 and L-19 were outliers.

Cluster II comprised/of fourteen/landraces and was sub divided/into/two/sub

cluster, II-A0and II-B. Sub-cluster1II-A was comprised/of landraces, L-15 and L-38,

CH and L-2, L-5 and A-42, L-17 and L-28 at same linkage/distance whereas landraces

L-27 and L-31 were outliers/for the cluster. While/sub/cluster II-B1was comprised-of

landraces, L-14 and L-30, L-24 and L-34 were correlating/each other at same/linkage

distance, respectively.

Cluster0III 1was1further0divided1into two0sub clusters, III-A1and III-B. Sub

cluster1III-A was comprised1of1landraces L-3 and L-4 were at1same linkage/distance.

Sub1Cluster III-B was composed of L-9 and L-29, M-116 and M-79, L-10 and M-83,

M-22 and M-86, M-07 and M-08 were significantly/correlating to each/other at same

linkage-distance. Landraces L-37, L-32, L-26 and M-39 were outliers for this cluster,

showing-variation.

120

Figure 4.2.1: Dendrogram based on average linkage distance for 46 peas

landraces

121

4.2.12. Average linkage distance among pea’s traits based on biochemical studies

The cluster/analysis exposed as a dendrogram1showed the probable/association

among 10 Peas traits. Dendrogram1was constructed with computer1software PAST,

using fourty six genotypes showed/two1main clusters1I and II1at linkage1distance of

near/about 400. Cluster I includes only one trait i.e, Carbohydrate, while, cluster II was

subdivided into/two sub-cluster II-A/and/II-B. Sub cluster II-A comprised/of four traits

including moisture/content and pH, protein1and chlorophyll1at same linkage distance

whereas, fats and fibers, phenolics and ash contents were correlating/each other for sub

cluster II-B. Total /soluble solids/were outlier in this/cluster.

122

Figure 4.2.2: Dendrogram based on average linkage distance for 10 Traits

123

Figure 4.2.3: Scatter Biplot diagram of 46 landraces of peas on the basis of

biochemical characterization

4.1.13: Simple Correlation Coefficient

Table 4.2.11 represents the correlation0coefficients/among0all/the0biochemical

traits. Ash0was showing0maximum positive/and highly0significant/correlation0with

moisture0content (0.583** ), phenolic1content (0.76** ) and0fat (0.371** ). Fiber0was

showing1highly significant0and positively/correlated with three characters/which/are:

protein (0.455** ), total1soluble1solid (0.437** ), and0fat (0.399** ). Maximum0positive

and highly significant correlation was observed between carbohydrate and pH

(0.418** ). Fat was showing positive and significant correlation with moisture content

Moist.Moist.Moist.Moist.

TSSTSSTSSTSS

Phen.Phen.Phen.Phen.

PhPhPhPh

ProteinProteinProteinProtein

FatFatFatFat

FiberFiberFiberFiber

AshAshAshAsh

Carbo.Carbo.Carbo.Carbo.

Chloro.Chloro.Chloro.Chloro.CHCHCHCH

L2L2L2L2

L3L3L3L3

L4L4L4L4

L5L5L5L5

L6L6L6L6

L7L7L7L7

L8L8L8L8

L9L9L9L9

L10L10L10L10

L11L11L11L11

L12L12L12L12L13L13L13L13

L14L14L14L14

L15L15L15L15

L16L16L16L16L17L17L17L17

L18L18L18L18

L19L19L19L19 L20L20L20L20L21L21L21L21

L22L22L22L22

L23L23L23L23

L24L24L24L24

L25L25L25L25L26L26L26L26

L27L27L27L27

L28L28L28L28

L29L29L29L29L30L30L30L30

L31L31L31L31

L32L32L32L32

L33L33L33L33

L34L34L34L34

A35A35A35A35

A36A36A36A36

A37A37A37A37

A38A38A38A38

A39A39A39A39

A40A40A40A40

A41A41A41A41

A42A42A42A42

A43A43A43A43

A44A44A44A44

A45A45A45A45

A46A46A46A46

-5-5-5-5 -4-4-4-4 -3-3-3-3 -2-2-2-2 -1-1-1-1 1111 2222 3333

Component 1Component 1Component 1Component 1

-3.0-3.0-3.0-3.0

-2.4-2.4-2.4-2.4

-1.8-1.8-1.8-1.8

-1.2-1.2-1.2-1.2

-0.6-0.6-0.6-0.6

0.60.60.60.6

1.21.21.21.2

1.81.81.81.8

2.42.42.42.4

CC CCoo oo

mm mmpp pp

oo oonn nn

ee eenn nn

tt tt 22 22

124

(0.316*), protein (0.313*) and0total/soluble0solid (0.312*), respectively. Maximum

positive and significant correlation was observed between chlorophyll content and

phenolic1contents (0.342*), whereas maximum positive/and significant/correlation was

observed for total soluble solids and moisture content (0.338*). A strong negative and

highly significant correlation was observed between carbohydrate and protein (-

0.447** ).

It/is stated/that/starch/accounts/for/variations/in the/CP/content/of/field/peas in

the first place (Bastianelli et al., 1998); Holl and Vose, 1980; Reichert and MacKenzie,

1982; Wang et al. (2008). A reason for this negative/correlation between starch and CP

contents can be the higher1increase of0starch in0comparison to CP in the

maturation0process of1the1seeds (Borreani0et al., 2007). This0change in the

relationships1between the ingredients1during maturation1could also1is a0possible

reason for described correlations between other nutrients like CP and sugar.

Correlations1with partly1varying/strength has been0found by different1researchers.

Reichert/and/MacKenzie (1982) also/found/negative/correlations of/starch, EE, and CF

with/CP. Nikolopoulou/et al. (2007) published/higher/correlations/between/CP/and ash

and0further/correlations0between ash/and/EE, ash0and starch, as well as EE/and starch

than/within/the present/data. They found/CP and EE positively/correlated in field peas.

Bastianelli0et al. (1998) found0EE with0CP, starch, and0CF negatively1correlated.

The correlation coefficients seem strongly dependent on the data basis. Hence,

correlations1are not suitable for predicting0the composition1of0harvested crops/due/to

a high variability of genetic and environmental influences on the maturation process

(Gallardo et al., 2008); Gutierrez0et al. (2007); Weber0et al. (2005).

125

Table 4.2.11: Correlation matrix on ten traits

Moist TSS Phe pH Pro Fat F A C Chl Moist 1

TSS .338* 1

Pheno .209 .076 1

Ph -.208 -.064 .174 1

Protein .141 .251 .226 .050 1

Fat .316* .312* .113 .017 .313* 1

Fiber .273 .437** .195 .081 .455** .399** 1

Ash .583** .220 .376** .039 .010 .371** .041 1

Carbo. -.143 -.041 .026 .418** -.447** -.127 .037 -.043 1

Chloro .203 -.019 .342* .154 .284 .219 .143 .245 .027 1

**. Correlation is significant at the 0.01 level (2-tailed). *. Correlation is significant at the 0.05 level (2-tailed). Where; Moist= Moisture %age, TSS= Total soluble solid, Pheno= Phenolic content, Carbo= Carbohydrates, and Chloro= Chlorophyll content.

4.1.16. PRINCIPAL/COMPONENT /ANALYSIS

Principal1component analysis1simplifies the complex0data by1changing the

number of related variables into smaller number of variables called principal

components. Principal component analysis was performed based on ten characters. The

first1four principal1components (PC) accounted/for 68.86% of the/variation (27.06,

17.06, 14.71 and 10.03 for PC1, PC2, PC3and PC4, respectively). The1maximum

Eigen1value was 2.71 while/the minimum/was 1.00.

Table 4.2.12: The Eigen values for 10 traits of Pisum sativum L. Genotypes

PC 1 2 3 4

Eigenvalue 2.71 1.71 1.47 1.00

% variance 27.06 17.06 14.71 10.03

Cumulative variance % 27.06 44.12 58.83 68.86

126

FACTOR LOADINGS FOR VARIOUS COMPONENTS

Figure 4.2.4: Factor Loadings for PC1 for biochemical traits of pea

Figure 4.2.4 showed/the factor0loadings1for ten biochemical/traits1in Peas

genotypes. In factor loading for PC 01 maximum1positive/load1was contributed1by

protein-content (0.6077) followed0by moisture-content (0.5986), fat (0.5562), total

soluble-solids (0.4663), fiber (0.434), ash-content (0.3936), phenolic-content (0.2001)

and Chlorophyll-content (0.1853), while0maximum1negative1load1was explained1by

carbohydrates (-0.8834) followed by pH (-0.5037) respectively.

0.3639

0.2835

0.1216

-0.3062

0.36940.3381

0.26380.2393

-0.537

0.1126

Moi

st.

TSS

Phe

n. Ph

Pro

tein

Fat

Fibe

r

Ash

Car

bo.

Chl

oro.

-1.0

-0.8

-0.6

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8

Loa

ding

127

Figure 4.2.5: Factor Loadings for PC2 for biochemical traits pea

Figure 4.2.5 showed the factor/loadings for ten biochemical1traits in Peas

genotypes. In factor/loading for PC 02 maximum0positive load/was/contributed/by ash

(0.7862) followed1by moisture (0.5262), phenolic-content (0.3124), chlorophyll

content (0.2013), carbohydrates (0.112) and fat (0.0254, while/maximum negative/load

was explained by protein (-0.5943) followed by fiber (-0.5184), total soluble solids (-

0.1333) and pH (0.01622) respectively.

0.4029

-0.102

0.2392

-0.07367

-0.455

0.01496

-0.3969

0.6019

0.11730.1541

Moi

st.

TSS

Phe

n. Ph

Pro

tein

Fat

Fibe

r

Ash

Car

bo.

Chl

oro.

-1.0

-0.8

-0.6

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8Lo

adi

ng

128

Figure 4.2.6: Factor Loadings for PC3 for biochemical traits of pea

Figure 4.2.6 showed the factor1loadings for ten biochemical1traits in Peas

genotypes. In factor1loading for PC 03 maximum1positive/load1was contributed1by

chlorophyll/content (0.6559) followed1by phenolic1content (0.5436), protein-content

(0.1543), moisture-content (0.2154), carbohydrates (0.0031) and protein (0.4066) and

pH ( 0.303) while maximum negative1load was explained by total1soluble/solids (-

0.5102), followed by moisture content (-0.2826), carbohydrates (-0.2745), fiber (-

0.197), fat (-0.0495) and ash (-0.00629) respectively.

-0.233

-0.4207

0.4482

0.28140.3352

-0.07828

-0.1625

-0.005186

-0.2263

0.5408

Moi

st.

TSS

Phe

n. Ph

Pro

tein

Fat

Fibe

r

Ash

Car

bo.

Chl

oro.

-1.0

-0.8

-0.6

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8

Loa

ding

129



genotypes. In factor/loading for PC 04 maximum1positive/load was contributed/by pH

(0.5412) followed1by fat (0.4377), fiber (0.4), phenolic1content (0.37). Total soluble

solids (0.3), ash (0.1), carbohydrates (0.196) and chlorophyll (0.02543) while

maximum negative load was explained by protein (-0.2255) and moisture (-0.1932)

respectively.

-0.1929

0.3202 0.3205

0.5404

-0.2252

0.4370.3993

0.15970.1957

0.02539

Moi

st.

TSS

Phe

n. Ph

Pro

tein

Fat

Fibe

r

Ash

Car

bo.

Chl

oro.

-1.0

-0.8

-0.6

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8Lo

adi

ng

130



genotypes. In factor1loading for PC 05 maximum1positive/load1was contributed1by

phenolic1content (0.593), followed0by total/soluble/solids (0.213), fiber (0.157),

moisture/content (0.017), carbohydrate (0.087), and protein (0.006) while/maximum

negative/load/was explained by fat (-0.587) followed/by chlorophyll/content (-0.2607),

pH (-0.093) and ash (-0.0476) respectively.

0.06723

0.2767

0.6354

-0.1

0.02149

-0.629

0.1682

-0.05101

0.01272

-0.2793

Moi

st.

TSS

Phe

n. Ph

Pro

tein

Fat

Fibe

r

Ash

Car

bo.

Chl

oro.

-1.0

-0.8

-0.6

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8Lo

adi

ng

131


Figure 4.2.9 showed the factor1loadings for six quantitative1traits in Peas

genotypes. In factor1loading for PC 06 maximum positive1load was contributed by

chlorophyll1content (0.5506)) followed1by fiber (0.3598s), carbohydrates (0.227),

moisture (0.09022), and phenolic content (0.03629) while/maximum/negative load was

explained by pH (-0.3679) followed1by Protein content (-0.2391), ash (-0.2575), fat (-

0.0311) and total soluble solids (-0.0130) respectively.

0.1026

-0.01488

0.04129

-0.4186

-0.272

-0.03542

0.4093

-0.2929

0.3023

0.6264

Moi

st.

TSS

Phe

n. Ph

Pro

tein

Fat

Fibe

r

Ash

Car

bo.

Chl

oro.

-1.0

-0.8

-0.6

-0.4

-0.2

0.0

0.2

0.4

0.6

0.8Lo

adi

ng

132

Figure. 4.2.10: Scree plot diagram of various factors

Scree1plot diagram constructed/for ten traits showed/that out of 10

six traits were showing/the Eigen value greater than 0.7. Eigen value

greater than 0.7 (Jolif cutoff) indicated that six component/or traits were

showing/maximum variance in term of/variability.

0 1 2 3 4 5 6 7 8 9 10

Component

0

3

6

9

12

15

18

21

24

27Eig

enva

lue

%

133

EXPERIMENT NO: 03

4.3. MOLECULAR STUDY

The local landraces of peas in Azad-Kashmir as well in1Pakistan1indicated

larger1diversity among them1while comparison1is made on yield1and yield1relates

characters. In order to as certain their diversity on the basis0of DNA known/primer

was employed1using PCR techniques and standard-gelelectrophoresis/methodologies.

The banding patterns were compared and photographs were taken for reference.

Twenty-different-primers for pea varietal/discrimination were used to find out the

molecular diversity among 46 local landraces of peas. Almost every primer indicated

variability1in1the amplified0band among the landraces the representative0banding

pattern with/specific/primers/are given/below.

Figure 4.3.1: PCR Amplification products of AD-51 primer among 46 pea

Landraces (A)

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

134

Figure 4.3.1(b): PCR Amplification products of AD-51 primer among 46 pea

Landraces (B)

Figure 4.3.2: PCR Amplification products of AA-163.2 primer among 46 pea

landraces (A)

L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

135

Figure 4.3.2(b): PCR Amplification products of AA-163.2 primer among 46 pea

landraces (B)

Figure 4.3.3: PCR Amplification products of AA285 primer among 46 pea

landraces (A)

L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

136

Figure 4.3.3(b): PCR Amplification products of AA285 primer among 46 pea

landraces (A)

Figure 4.3.4: PCR Amplification products of D21 primer among 46 pea landraces

(A)

L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

137

Figure 4.3.4(b): PCR Amplification products of D21 primer among 46 pea

landraces (B)

Figure 4.4.5: PCR Amplification products of AD83 primer among 46 pea

landraces (A)

L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

138

Figure 4.3.5(b): PCR Amplification products of AD83 primer among 46 pea

landraces (A)

Figure 4.3.6: PCR Amplification products of AA92 primer among 46 pea

landraces (A)

L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

1000

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

139

Figure 4.3.6(b): PCR Amplification products of AA92 primer among 46 pea

landraces (B)

Figure 4.3.7: PCR Amplification products of AB72 primer among 46 pea

landraces (A)

L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

140

Figure 4.3.7(b): PCR Amplification products of AB72 primer among 46 pea

landraces (B)

4.3.1. Molecular comparison among the Landraces

The selection system of breeding-material on the basis of morphological

characters-remain valuable, but this assessment-has limitations, including the influence

of environment or management practices (Nemera et al., 2006), whereas the SSR

based1markers are free-from such0biase. Microstaellite-polymorphism were scored/for

presence “1” and0absence “0” of/amplified1bands and were used for the1estimation of

dissimilarity-coefficients-dice-coefficient method by using-NTSYs.pc.

Moreover, the conventional1approach to characterize1the cultivars in crop1and

vegetable1species on the basis1of phenotypic1observations is slow1due to the long life

cycle1of the plants1therefore, there is need to1incorporate-the new0methods based0on

studies1at-the DNA/level/in/order to1determine the genetic/relationships and/diversity

among different cultivars. In the present study, a high value of polymorphism was

L 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

3000

2000

1500

1200

1000

900

800

700

600

500

400

300

200

100

141

recorded/for/the/entire/SSR/markers/investigated.

In-traditional1breeding0programmes, large/quantity/of/useful/alleles/have/been

lost, which has hindered genetic improvement of wheat. Molecular markers are

capable to provide understanding of heritable assets, used for evaluation of1genetic

variability and also used for evaluating the variability regardless1of agronomic1and

geographical/origins (Shiran/et al., 2007). The-bands obtained through electrophoresis

were photographed using Gel-Documentation system.

Out of 20 amplification product scored, 595 were found out of which 357 were

monomorphic and 257 were polymorphic. The average number of the scorable bands

per0primer was 29.75%, while average number of monomorphic and polymorphic

bands0was 16.25% and 12.85%, respectively. The high-frequency of polymorphism

was detected0with all0selected1primers. The percentage of polymorphic0bands1was

100%0with three primers0i.e; AC58, AD270 and AA90, while low-value0of

polymorphism0was recorded0for primer AA205 and AB141 (0%), AA103 (21.4%),

AA285 (24.4%), AD147 (26.8%), AA175 (27.3%) and AA67 (30%), respectively.

Moderate-values of0polymorphism were recorded9for primer AB72 (505), AA92

(52.6%), D21 (53.6%), AA163.2 (55.8%), AA355 (60.7%), AD148 (66.7%), AD51

(68.2%) and AB53 (73.7%), respectively.

A study on genetic0diversity-among1varieties and0hybrid lines of0Pea (Pisum

sativum0L.) as revealed1by/morphological1traits and SSR/markers was conducted1by

Badr et al. (2015). The results1showed/that the number of total bands and polymorphic

bands1and the percentage1of polymorphism/in/the/five/parent/varieties were generally

higher0than their1corresponding-values1in-their hybrid0lines. A maximum0number/of

142

720bands was0scored in/Var. Master0B and includes 430polymorphic-bands/including

two unique bands scoring 59.97% polymorphism. The other four varieties showed

lower0percentages of0polymorphism; the two0parents Lincoln0and Little/marvel/have

identical1percentage of051.6%; the0variety-Sugarles0 has a percentage/of/50.0%. The

hybrid0lines Lincoln0x Little0Marvel, Lincoln0x Sugarless0and Little0Marvel x

Sugarless showed lower proportion of polymorphism (34.1%, 35.6% and 36.9%

respectively). On0the other/hand, the two hybrid lines (Luxer x Master B and Master B

x Little0Marvel) showed/higher percentage/of SSR/polymorphism (47.2% and/49. 1%)

compared to other hybrid/lines. The/other/17/hybrids /have /intermediate/percentages

of/polymorphism-ranging-between038.3% in the two0hybrid0lines Little0Marvel x

Luxer0and Sugarless/x Master/B to 45.3% in the hybrid1line Master/B x/Lincoln.

Simple0sequence/repeat/markers/were developed/based on expressed/sequence

tags (EST-SSR) and screened0for/polymorphism/among/23 Pisum/sativum/individuals

to assist development and refinement of pea linkage maps. In particular, the SSR

markers were developed to assist1in mapping of white0mold disease resistance

quantitative1trait0loci. Primer pairs were designed for 46 SSRs identified in EST

contiguous1sequences-assembled0from a 454/pyrosequenced0transcriptome of/the/pea

cultivar, ‘LIFTER’. Thirty-seven/SSR1markers0amplified PCR1products, of/which/11

(30%) SSR1markers produced0polymorphism in 230individuals, including1parents of

recombinant inbred lines, with two to four alleles. The observed and expected

heterozygosities ranged1from 0 to 0.43/and from/0.31 to 0.83, respectively (Zhuang et

al., 2013).

143

Molecular markers/have been applied to address genetic-diversity and breeding

of and have great potential to0speed-up the process of developing1improved/cultivars.

The/simple/sequence/repeats (SSR), also known as microsatellites, have/been used/on

various collections of/peas/as a sole/source of0variation (Sarıkamı0et al., 2010) and in

combination with morphological variation. Although several hundreds of simple

sequence repeats (SSR) markers have been identified. Additional SSR markers with

polymorphism0are needed, for the development1of linkage1maps for use/in1breeding-

new1varieties with-resistant to/white/mold/disease/and for/mapping/studies (Zhuang et

al., 2013).

144

Table: 4.3.1: Polymorphism among Pea genotypes generated by 20 Primers

Primers Total No. of Bands

Monomorphic bands

Polymorphic bands

Monomorphic %age

Polymorphic %age

AC58 5 0 5 0.0 100.0 AD270 4 0 4 0.0 100.0 AA335 28 11 17 39.3 60.7 AB53 19 5 14 26.3 73.7 AA205 28 28 0 100.0 0.0 AA163.2 43 19 24 44.2 55.8 AA92 57 27 30 47.4 52.6 D21 28 13 15 46.4 53.6 AD148 18 6 12 33.3 66.7 AA285 45 34 11 75.6 24.4 AD147 41 30 11 73.2 26.8 AA175 33 24 9 72.7 27.3 AD83 32 23 9 71.9 28.1 AD73 47 26 21 55.3 44.7 AB141 20 20 0 100.0 0.0 AB72 30 15 15 50.0 50.0 AA103 28 12 6 42.9 21.4 AA67 30 18 9 60.0 30.0 AD51 44 14 30 31.8 68.2 AA90 15 0 15 0.0 100.0 Total 595 325 257 970.2 984.0

4.3.2: Hirrareical cluster

The cluster/diagram constructed0by mean 0f NTSys.pc revealed8two/main

clusters I and II at distance-of about 0.38. Cluster I comprised of only one landrace; L-

46. Cluster II was subdivided0into two sub0clusters IB and IIB. Sub-cluster IB

comprised-of only/two landraces L-44 and L-45 correlating each other at same linkage

distance. Sub cluster IIB comprised-of two sub sub-clusters IIB1 and IIB2. IIB1

comprised/of only-one landrace-namely L-43 whereas cluster IIB2 further-sub-divided

145

into0three sub sub-sub-clusters, IIB2a, IIB2b and IIB2c. IIIB2a comprised0of 6

landraces-namely; L-31(M-79) and L-33, L-30 (M-08) and L-34 were correlating0each

other0at same distance while L-29 (M-86) and L-32 were outliers for the cluster. IIB2b

was consisting0of two landraces, L-41 and L-42. IIB2c was comprised of 34 landraces.

L-2 and L-3, L-6 and L-6 and L-7, L-9 and L-10, L-12 and L-16, L-13 and L-14, L-15

and L-18, L-20 (M-25) and L-24 (M-07), L-26 (M-22), L-35, L-21(M-116) and L-36

were-correlating to each other0at same linkage distance. While L-1, L-5, L-8, L-11, L-

24 (M-07), L-19, L-17, L-25 (M-83), L-23 (M-91), L-36 and L-37 were-outliers in the

clusters1showing0variation. Similar/studies were carried-out by Kumari et al., 2013

who0studied the/genetic0diversity0among028/pea (Pisum/sativum L.) genotypes/using

320simple1sequence0repeat0markers. Cluster0analysis based0on Jaccard’s0similarity-

coefficient0using the unweighted0pair-group0method with arithmetic/mean (UPGMA)

revealed02 distinct0clusters, I0and0II, comprising06/and 22pgenotypes, respectively.

Cluster0II was further0differentiated-into020subclusters, IIA0and0IIB, with012/and

100genotypes, respectively.

Ahmad et al. (2012) evaluated0the genetic1diversity in 350diverse Pisum

accessions utilizing 15 polymorphic microsatellites situated on various pea

chromosomes. Microsatellites1were observed to be1polymorphic, amplifying a total-of

411alleles and could1separate every/one of the 350Pisum0genotypes. These1markers

were scored0by their polymorphic0information0content (PIC), ranging0from 0.055

(AA206) to00.660 (AB72) with0a normal/of00.460, and by/their/discriminating/power

(D), which0varied from00.057 (AA206) to00.679 (AB72) with1an average/of00.475.

Unweighted0pair0group0method0with arithmetic0averages (UPGMA) cluster/analysis

146

grouped the 35 pea accessions into two majors clusters and eight sub-clusters. The

larger part of Canadian and European genotypes were assembled independently,

suggesting/both0these groups/are/from/genetically/distinct/gene/pools. The/genetically

diverse groups identified in this study can be used to derive parental lines for pea

breeding.

Another0scientist, Kumari et al. (2013) analyzed028 pea (Pisum sativum L.)

genotype0to asses/genetic diversity by using032 simple0sequence repeat markers. A

total of 44 polymorphic bands, with an average of 2.1 bands per primer, were

obtained. Cluster analysis based on Jaccard's similarity coefficient using the

unweighted pair-group method with arithmetic mean (UPGMA) revealed two distinct

clusters, I0and0II, comprising06 and 220genotypes, respectively. Cluster II was further

differentiated0into/2sub-clusters, IIA/and/IIB, with 12/and 100genotypes, respectively.

Principal component (PC) analysis revealed results similar to those of UPGMA. The

first, second, and0third PCs-contributed021.6, 16.1, and014.0% of the0variation,

respectively; cumulative/variation/of/the/first/3/PCs was/51.7%.

147

Figure 4.3.8: Dendrogram based on average linkage distance for 20 SSR Primer

148

4.3.3: Correlation Matrix

The correlation matrix was computed by mean of Dice similarity coefficient

(Figure No: 4.3.1. Similarity0matrix was ranging/between 0.18 and 0.98. Maximum

similarity-was noticed among L-7 and L-6 (0.97) followed by L-14 and L-13 (0.97), L-

3 and L-1, L-15 and L-13, L-17 with L-13 and L-15, L-19 with L-12, L-15, L-13 and

L-17 (0.94), L-5 and L-3, L-20 and L-18 (0.93), L-10 and L-9 (0.92), L-15 and L-14,

L-16 with L-10 and L-14, L-19 and L-14 (0.92), L-4 and L-2 , L-9 and L-8, L-12 and

L-10, L-19 and L-18, L-6 and L-2 (0.91), L-4 and L-3, L-6 and L-5, L-20 and L-12, L-

20 with L-17 and L-19 (0.90), L-13 and L-12, L-16 with L-13 and L-15, L-19 and L-

16, L-2 and L-10 (0.89), L-5 and L-2, L-7 and L-2, L-10 and L-7 (0.88), L-15 and L-

12, L-17 and L-12 (0.88),0respectively.

Moderate0values for0similarity were found/for L-15 and L-2 (0.80), L-16 with

L-2 (0.81) and L-9 (0.84), L-19 and L-4 (0.75), L-20 and L-4 (0.76), L-25 and L-24

(0.86), L-26 and L-24 (0.80), L-30 and L-24 (0.48).

Minimum/values of similarity/coefficient were noticed/among L-33 and L-46

(0.18), L-42 and L-33 (0.31), M-86 and L-33 (0.29), L-33 and M-08 (0.33), L-33 and

M-79 (0.29), M-79 and L-32 (0.22), M-08 and L-32 (0.33), M-79 and L-31 (0.33), L-

29 and L-46 (0.29), L-23 and L-24 (0.22), respectively. The genetic diversity among

280pea (Pisum0sativum L.) genotypes was analyzed using 32 simple sequence repeat

markers by (Kumari et al., 2013). A total of 44 polymorphic bands, with an average of

2.10bands per0primer, were/obtained. The polymorphism0information-content ranged

from 0.657 to 0.309 with/an average of 0.493. The variation in genetic diversity among

these0cultivars ranged from 0.110to00.73. Simioniuc0et al. (2002) reported0a

149

relatively0higher similarity1range (0.80-0.94) with/RAPD/markers compared with that

obtained0using AFLP0markers in pea0cultivars (0.85-0.94). Baranger/et al. (2004) got

an extensive variety of similitude (0.0-1.0) in 148 Pisum genotypes utilizing protein

and/PCR-based-markers. In this-examination, the evaluated-hereditary-assorted/variety

(0.05-0.82) among pea accessions in view of SSR-markers was higher than that

revealed by Tar'an0et al. (2005) (0.0-0.66) and Ford0et al. (2002) (0.05-0.48) yet/like

those0distributed0by Cupic0et al. (2009) (0.24-0.84). The1higher/estimated1genetic

distance could be described to differences between accessions owing to diversification

in/the/pedigree/of/the/genotypes.

150

CONCLUSION AND RECOMMENDATIONS

Two-years/field studies and0laboratory based0experimentation revealed/the

following-conclusions/regarding the landraces/of peas collected from Azad Jammu and

Kashmir and NARC, Islamabad. All landraces-indicated maximum0diversity in almost

all0morphological, biochemical and molecular-traits compared, hence could be utilized

in further0breeding and production0of high yielding/landraces of peas in future. Based

on0average1linkage distance0between1landraces, computed0from0morphological

data0following landraces0were showed maximum-variability, Check, L-10, L-50,

L-57, L-34, M-39, L-47, M-86, M-83, L-33, L-24, L-71 and L-64 Cluster0based

on biochemical1analysis revealed that maximum-variability was contributed0by

carbohydrates0and total-soluble-solids, while0landraces L-13, L-21, L-25, L-7,

L19, L-27, L-31, L-32, L-34 and L-26 were also0diverse and1contributing

maximum toward variation. Dendrogram constructed on the basis of molecular

studies revealed-landraces M-39, L-29, L-32, Check, L-5, L-8, L-11, L-24, L-19,

L-17, L-25, L-23, M-102 and M-83 were showing0maximum-diversity.

To select parents of desired proximate composition and put these selected seeds

through further-hybridization-program for improvement0of these and other-agronomic

traits studies on large scale are required. Based on the knowledge obtained from

morphological, biochemical1and molecular1characterization of0populations of Pisum

sativum, the present1study could/be used/as/a/benchmark/for future0studies. The study

had also-revealed the presence of0diversity, which needs to be explored further. On the

basis of present0research following1landraces Check-variety, (L-24, L-25, these

landraces are from Trarkhal), (L-32, L-34 these landraces are from Bloch), (M-39, M-

151

83 and M-86 these landraces are from NARC) show best/performance on/the/basis/of

morphological, biochemical and molecular/characterization of peas. This was indicated

by the fact0that some local1landraces of Peas were better0than the released varieties in

their proximate-composition. These landraces0can be used in future for0breeding and

producing-high yielding-cultivars for off season-growing of peas. In general, the study

implied0the importance of intensive0collection and characterization-work needed to be

done in the future.

The0prospects of Pea-crop are very bright in Pakistan. Keeping in view its

incredible potential a comprehensive and integrated effort to improve the existing

germplasm should be initiated which may lead to diversification0in conventional

agricultural system and may become a profitable venture for poor farmers of the

country.

152

SUMMARY

Legumes0are important0crops worldwide, and they have major0impacts on

agriculture, the0environment, animals1and human1nutrition. Pea (Pisum sativum L.), a

leguminous-crop, belongs0to family1leguminoseae, which/has an/important/ecological

advantage1because it contributes0to the/development of/low-input farming/systems by

fixing1atmospheric0nitrogen and it serves as a break-crop which further-minimizes the

need for1external inputs. Keeping in view the importance of pea crop and the

importance0of its genetic0diversity, the available1germplasm was evaluated for

economically-important-traits, phenotypic1elaboration and their further1utilization in

the breeding1programs. The current0study was designed1to select1some morpho-

physiological, biochemical1and yield1parameters responsible0for higher1yield of peas

that could be helpful1to develop-high yielding off season varieties in future. This study

was/conducted during/2015-16/at University of/The/Poonch, Rawalakot.

On the basis of morphology, maximum germination1percentage1was

observed0in case of M-72, M-102, M-91, M-25, L-18 and L-16 (90). Maximum

growth1vigour was noticed among/landraces, L-8, l-9, L-10, L-48, L-49, L-50, L-

56, L-57, L-63 and M-86. Maximum plant1height was observed1in case of L-29

i.e, 80 cm. Maximum-numbers of seed per pod were recorded in case of M-83 and

Check variety, while 100-seed1weight and yield was maximum in case of

landraces M-83 that was 29.60 kg and 19.73 kg/hectare, respectively. The

correlation1coefficients among all the quantitative1traits computed for1morphological

traits1revealed that the yield had maximum1positive with highly significant correlation

with seed1weight (1.000** ). Leaf length showed maximum positive and highly

153

significant correlation with leaf width (0.994** ) and leaf area (0.989** ) followed by leaf

area and leaf1width (0.985** ). Number of seed1per pod was having positive and highly

significant1correlation with pod1length (0.960** ), seed-weight (0.935** ) and1yield

(0.934** ), respectively1followed by days to flower1completion with days to flower

initiation (0.923** ). Pod1length showed maximum0positive and highly1significant

correlation with seed-weight and0yield (0.912** ). The plant1height showed highly

significant and positive-correlation with four0characters: leaf area (0.831** ), number of

leaves (0.821** ), days to flower0completion (0.569** ) and days to flower-initiation

(0.526** ). Number of leaves0showed highly significant and positive correlation with

the traits1such as leaf1length (0.798** ), leaf1width (0.781** ), leaf1area (0.777** ). A

highly significant-correlation was found between pod width with seed weight and yield

(0.621** ). Number0of pods per0plant had a positive0significant-correlation with leaf

length (0.227*), leaf1width (0.249*) and number1of leaves (0.228*). Yield was

correlated0with two0characters: leaf-width (0.262*) and leaf-length (0.239*). Principal

component1analysis demonstrated three separated0components, cumulatively-showing

78.53 % of total variability.

On the basis of biochemical1studies, maximum phenolic-content was observed

in M-91 (3.91 ml/l), protein1content in L-34 (27.01 %), fat in M-25 (1.62 %), fiber in

L-10 (1.98 %), ash1content in M-91 (4.4 %) and1carbohydrate in L-3 (69.59 %). The

correlation coefficients among all the biochemical traits illustrated that Ash was

showing maximum1positive and highly1significant-correlation with moisture1content

(0.583** ), phenolic-content (0.76** ) and fat (0.371** ). Fiber was showing highly

significant and positively1correlated with three-characters which are: protein (0.455** ),

154

total1soluble1solid (0.437** ), and0fat (0.399** ). Maximum positive1and0highly

significant0correlation was observed between1carbohydrate and/pH (0.418** ). Fat/was

showing1positive and significant1correlation with moisture0content (0.316*), protein

(0.313*) and total soluble solid (0.312*), respectively. Maximum positive and

significant correlation was observed between chlorophyll contents and phenolic

contents (0.342*) whereas maximum positive and significant-correlation was observed

for total soluble solids and moisture content (0.338*). Principal component analysis

was performed based on ten biochemical characters. The first three principal

components (PC) accounted for 77.11% of the variation (26.17. 17.99 and 15.08 for

PC1, PC20and1PC3, respectively). The maximum Eigen value was 2.60 while the

minimum was 1.50.

Dendrogram9constructed on the basis of molecular0studies revealed

genotypes M-39, L-29, L-32, L-1, L-5, L-8, L-11, L-24, L-19, L-17, L-25, L-23,

L-37 and M-83 were showing0maximum-diversity. The correlation0matrix was

computed by mean of Dice similarity coefficient. Similarity matrix was ranging

between 0.18 and 0.98. Maximum-similarity was noticed0among L-7 and L-6 (0.97)

followed by L-14 and L-13 (0.97), L-3 and L-1, L-15 and L-13, L-17 with L-13 and L-

15, L-19 with L-12, L-15, L-13 and L-17 (0.94), L-4 and L-2 , L-9 and L-8, L-12 and

L-10, L-19 and L-18, L-6 and L-2 (0.91), L-4 and L-3, L-6 and L-5, L-20 and L-12, L-

20 with L-17 and L-19 (0.90), L-13 and L-12, L-16 with L-13 and L-15, L-19 and L-

16, L-2 and L-10 (0.89), L-5 and L-2, L-7 and L-2, L-10 and L-7 (0.88), L-15 and L-

12, L-17 and L-12 (0.88), whereas minimum values of similarity1coefficient were

noticed-among L-33 and L-46 (0.18), M-72 and L-33 (0.31), M-86 and L-33 (0.29), L-

155

33 and M-08 (0.33) and L-33 and M-79 (0.29), respectively. Out of 20 amplification

product1scored, 595 were found out of which 357 were monomorphic1and 257 were

polymorphic. The average/number of the scorable1bands per/primer was 29.75% while

average number of monomorphic and polymorphic bands was 16.25% and 12.85%,

respectively. The high-frequency of1polymorphism was detected with all1selected

primers. The1percentage of1polymorphic bands/was 100%0with three primers1i.e;

AC58, AD270 and AA90, while low value of1polymorphism was recorded1for primer

AA205 and AB141 (0%), AA103 (21.4%), AA285 (24.4%), AD147 (26.8%), AA175

(27.3%) and AA67 (30%), respectively. Moderate values of polymorphism were

recorded1for primer AB72 (505), AA92 (52.6%), D21 (53.6%), AA163.2 (55.8%),

AA355 (60.7%), AD148 (66.7%), AD51 (68.2%) and AB53 (73.7%), respectively

Principal1component1analysis was performed1based on 20 primers. The eight

principal1components (PC) accounted for 74.2% of the variation (21.74, 37.46, 46.22,

53.95, 60.14, 65.33, 69.83 and 74.2 for PC1, PC2, PC3, PC4, PC5, PC6, PC7 and

PC8, respectively). The maximum Eigen value was 5.65, while the minimum was

1.13. The present research is a launching pad for future breeding programs for

improvement of peas crop, particularly for AJK agroecological1conditions.

156

Chapter No. 05

LITERATURE CITED

Acikgoz, E., A. Ustun, I. Gul, E. Anlarsal, A. S. Tekeli, I. Nizam, R. Avcioglu, H.

Geren, S. Cakmakci, B. Aydinoglu, C. Yucel, M. Avci, Z. Acar, I. Ayan, A.

Uzun, U. Bilgili, M. Sincik and M. Yavuz. 2009. Genotype×environment

interaction and stability analysis for dry matter and seed yield in field pea

(Pisum sativum L.). Spanish Journal of Agriculture Research, 7: 96-106.

Adawy, T.A., E.H. Rahma, A. A. Bedaweyand A. E. Beltagy. 2003. Nutritional

potential and functional properties of germinated mung bean, pea and lentil

seeds. Journal of Plant Foods for Human Nutrition, 58:1-13.

Ahmad, S., M. Singh, N. D. Lamb-Palmer, M. Lefsrud and J. Singh. 2012. Assessment

of genetic diversity in 35 Pisum sativum accessions using microsatellite

markers. Candian Journal of Plant Science, 92: 1075-1081.

Ahmad, S., S. Kaur, N. D. Lamb-Palmer, M. Lefsrud and J. Singh. 2015. Genetic

diversity and population structure of Pisum sativum accessions for marker-trait

association of lipid content. The Crop Journal, 3: 238- 245.

Akhter, N. 2004. Morphological change of garden pea (Pisum sativum L.) under

different reducing light level. M.Sc. Thesis, Dept. Crop Botany BSMRAU,

Gagipur, Bangladesh.

Ali, I., A. Rub and S. A. Hussain. 2002. Screening of pea germplasm for growth, yield

and resistance against powdery mildew under the agro-climatic conditions of

Peshawar. Sarhad Journal of Agriculture, 18: 177-181.

157

Ali, S. T., E. A. Tekeli and E. Ates. 2007. Yield and its components in field pea

(Pisum arvense L.) lines. Journal of Central European Agriculture, 4: 313-317.

Ali, S. T. and C. G. Youngs. 1973. Variation in protein of field peas. Canadian Journal

of Plant Science, 53: 37-41.

Alkarkhi, A. F. M., S. Ramli, Y. S. Yong and A. M. Easa. 2011. Comparing

physicochemical properties of banana pulp and peel flours prepared from green

and ripe fruits. Food Chemistry, 129: 312-318.

Allen, D. J. and D. R. Ort. 2001. Impact of chilling temperatures on photosynthesis in

warm climate plants. Trends in Plant Science, 6: 36-42.

Al-Marzooqi, W. and J. Wiseman. 2009. Effect of extrusion under controlled

temperature and moisture conditions on ileal apparent amino acid and starch

digestibility in peas determined with young broilers. Animal Feed Science

and Technology, 153: 113-130.

Altuntas, E. and H. Demirtola. 2007. Effect of moisture content on physical properties

of some grain legume seeds. New Zealand Journal of Crop and Horticultural

Science, 35: 423-433.

Amarteifio, J. O., D. C. Munthali, S. K. Karikari and T. K. Morake. 2002. The

composition of pigeon peas (Cajanus cajan L.) (Mill sp) grown in Botswana.

Plant Foods for Human Nutrition, 57: 173–177.

Ambrose, M. J., N. Maxted, C. J. Coyne, R. Ford, R. J. Redden, O. Kosterin, J.

Corander, A. J. Flavell, G. Kenicer and P. Smýkal. 2011. Phylogeny,

phylogeography and genetic diversity of the Pisum genus. Plant Genetics and

Research, 9: 4–18.

158

Amjad, M. and M. A. Anjum. 2002. Performance of nine pea cultivars under

Faisalabad conditions. Pakistan Journal of Agriculture Science, 39: 6-19.

Anonymous. 2012. Pakistan statistical year book. 2012. Statistics Division, Federal

Bureau of Stat. Govt. of Pakistan, Islamabad.

AOAC. 1990. Official method of analysis. The association of official analytical

chemist.15thEdition Arlington, USA.

AOAC. 1994. Official method of analysis. The association of official analytical

chemist.16thEdition Arlington, USA.

Armstead, I., I. Donnison, S. Aubry, J. Harper and S. Hörtensteiner. 2007. Cross-

species identification of Mendel’s locus. Science, 315: 73pp.

Arshad, M., S. A. Hussain, S. A. N. Ali, N. Muhammad and Ziaullah. 1998. Screening

of pea (Pisum sativum L.) cultivars in Kohat valley. Sarhad Journal of

Agriculture, 14: 559-562.

Aruna, T. and S. Devindra. 2016. Nutritional and Anti-Nutritional Characteristics of

Two Varieties of Red gram (Cajanus cajan L) Seeds. International Journal of

Scientific and Research Publications, 6: 567-572.

Arvanitoyannis, I. S. and A. Mavromatis. 2009. Banana cultivars, cultivation practices,

and physicochemical properties. Critical Review of Food Science and

Nutrition, 49:113-135.

Ashraf, I. M., A. Pervez, M. Amjad and R. Ahmad. 2011. Effect of varying irrigation

frequencies on growth, yield and quality of pea’s seed. Journal of Agricultural

Research, 49: 339-351.

159

Atta, S., S. Maltese and R. Cousin. 2004. Protein content and dry weight of seeds from

various pea genotypes. Agronomy, 24: 257-266.

Aubry, S., J. Mani and S. Hörtensteiner. 2008. Stay-green protein, defective in

Mendel’s green cotyledon mutant, acts independent and upstream of

pheophorbideaoxygenase in the chlorophyll catabolic pathway. Plant

Molecular Biology, 67: 243-256.

Badr, A., H. S. Ahmed, M. Hamouda and S. F. Badr. 2015. Genetic Diversity Among

Varieties and Hybrid Lines of Pea (Pisum sativum L.) as Revealed by

Morphological Traits and SSR Markers. Egyptian Journal of Botany, 55: 17-

29.

Baginsky, C., H. Faiguenbaum and C. Krarup. 1994. Pre and post-harvest evaluation

of six pea cultivars. Horticultural Abstracts, 64: 70-81.

Baloch, F. S., A. Alsaleh, L. E. Sáenz de Miera, R. Hatipoglu, V. Çiftçi, T.

Karaköy, M. Yıldız, H. Ozkan. 2015. DNA based iPBS-retrotransposon

markers for investigating the population structure of pea (Pisum sativum L.)

germplasm from Turkey. Biochemical Systematics and Ecology, 61: 244- 252.

Barac, M., S. Cabrilo, M. Pesic, S. Stanojevic, S. Zilic, O. Macej and N. Ristic. 2010.

Profile and functional properties of seed proteins from six pea (Pisum sativum

L.) genotypes. International Journal of Molecular Science, 11:4973-4990.

Baranger, A. G., G. Aubert, G. Arnau, A. L. Laine, G. Deniot, J. Potier, C.

Weinachter, I. L. Henaut, J. Lallemand and J. Burstin. 2004. Genetic diversity

within (Pisum sativum L.) using protein and PCR-based markers. Theoretical

and Applied Genetics, 108: 1309-1321.

160

Bastianelli, D., F. Grosjean, C. Peyronnet, M. Duparque and J. M. Regnier. 1998.

Feeding value of pea (Pisum sativum L.) chemical composition of different

categories of pea. Animal Sciences, 67: 609-619.

Basaran, U., H. Mut, O. Asci, E. Gulumser, Z. Acar and I. Ayan. 2012. Variation in

seed yield and morphological traits in Turkish grass pea (Lathyrus sativus L.)

genotypes. Options méditerranéennes: serie A. Séminair méditerranian, 102:

145-148.

Basaran, U., Z. Akar, M. Karacan and A. N. Onar. 2013. Variation and correlation of

morpho-agronomic traits and biochemical contents (protein and B-ODAP) in

Turkish grass pea (Lathyrus sativus L.) landraces. Turkish Journal of Field

Crops, 18: 166-173.

Bhattacharya, S. and N. G. Malleshi. 2012. Physical, chemical and nutritional

characteristics of premature-processed and matured green legumes. Journal of

Food Science and Technology, 49: 459-466.

Bhattacharyya, M., A. M. Smith, T. H. N. Ellis, C. Hedley and C. Martin. 1990. The

wrinkled-seed character of pea described by Mendel is caused by a transposon-

like insertion in a gene encoding starch-branching enzyme. Cell, 60: 115–122.

Bhatty, R. S. and G. I. Christison. 1984. Composition and nutritional quality of pea

(Pisum sativum L.), faba bean (Vicia faba L. spp. minor) and lentil (Lens

culinaris Medik.) meals, protein concentrates and isolates. Plant Foods for

Human Nutrition, 34: 41-51.

161

Blair, M. W., J. M. Diaz, R. Hidalgo and L. M. Diaz. 2007. Microsatellite

characterization of Andean races of common bean (Phaseolus vulgaris L.).

Theoretical and Applied Genetics, 116: 29-43.

Borreani, G., P.G. Peiretti and E. Tabacco. 2007. Effect of harvest time on yield and

pre-harvest quality of semi-leafless grain peas (Pisum sativum L.) as whole-

crop forage. Field Crop Research, 100:1-9.

Boye, J. B., F. Zare and A. Pletch. 2003. Pulse proteins: Processing, characterization,

functional properties and applications in food and feed. International Journal of

Food Research, 43, 414-431.

Bressani, R. and L. G. Elias. 1988. Seed quality and nutritional goals in Pea, Lentil,

Faba Bean and Chickpea breeding. Current Plant Science and Biotechnology in

Agriculture, 5: 381-404.

Bugaud, C., M. Chillet, M. P. Beautea and C. Dubois. 2006. Physicochemical analysis

of mountain bananas from the French West Indies. Science Horticulturae,

108:167–172.

Burstin, J., G. Deniot, J. Potier, C. Weinachter, G. Aubert and A. Barranger.

2008. Microsatellite polymorphism in pea (Pisum sativum L.). Plant Breeding,

120: 311-317.

Castillo, A. G., 1. G. Hampton and P. C. Bear. 1992. Effect of time and method of

harvest on seed vigour in garden peas (Pisum sativum L.). Journal of Applied

Seed Production, 10: 31-36.

Cerning, B. J. and A. Filiatre. 1976. A comparison of the carbohydrate composition of

legume seeds: horse beans, peas and lupines. Cereal Chemistry, 53: 968-978.

162

Cervenski, J., D. Danojevics and A. Savi. 2017. Chemical composition of selected

winter green pea (Pisum sativum L.) genotypes. Jounal of Serbian Chemical

Society, 82: 1–10.

Ceyhan, E. and M. A. Avci. 2015. Determination of some agricultural characters of

developed pea (Pisum sativum L.) lines. International Journal of Biology,

Biomolecules, Agriculture and Food Biotechnology, 9:12pp.

Chavan, U. D., F. Shahidi, A. K. Balb and D. B. McKenzied.1999. Physico-chemical

properties and nutrient composition of beach pea (Lathyrus maritimus L.).

Journal of Food Chemistry, 66:43-50.

Cokkizgin, A. 2012. Botanical characteristics of chickpea genotype (Cicer arietinum

L.) under different plant densities in organic farming. Scientific Research and

Essays, 7: 498-503.

Colonna, P., A. Buleon and J. L. Doublier. 1992. Structural features of smooth and

wrinkled peas starches. Proceedings of 1st European Conference on Legume

Grains, Angers, 401-402pp.

Cupic, T., M. Tucak, S. Popovic, S. Bolaric, S. Grljusic, V. Kozumplik. 2009 .Genetic

diversity of pea (Pisum sativum L.) genotypes assessed by pedigree,

morphological and molecular data, Journal of Food Agriculture &

Environment, 7: 343–348.

Dahl, J. W., L. M. Foster and R. T. Tyler. 2012. Review of the health benefits of peas

(Pisum sativum L.). British Journal of Nutrition, 3: 85-89.

163

Davies, D. R., G. J. Berry, M. C. Heath and T. C. K. Dawkins. 1985. Pea (Pisum

sativum L.). Journal of American Society of Horticulture Science, 104:548-

550.

Dimitrios, B. 2006. Sources of natural phenolic antioxidants. Trends in Food Science

and Technology, 17: 505-512.

Dixon, R. A. and N. L. Paiva. 1995. Stress induced phenol-propanoid

metabolism. Plant Cell, 7: 1085-1097.

Doyle, J. J. and J. I. Doyle. 1987. A rapid DNA isolation procedure or small quantities

of fresh leaf tissue. Phytochem. Bulletin, 19: 11-15.

Duke, J. A. 1981. Hand book of legumes of world economic importance. Plenum

Press, New York, 39: 199-265.

El-Adawy, T. A. 2003. Nutritional composition and anti-nutritional factors of

chickpeas (Cicer arietinum L.) undergoing different cooking methods and

germination. Plant Foods Human Nutrition, 57:83-97.

Ellis, T. H. N. and S. J. Poyser. 2002. An integrated and comparative view of pea

genetic and cytogenetic maps. New Phytology, 153: 17-25.

Ellis, T. H. N., J. I. Hofer, G. M. Timmerman-Vaughan, C. J. Coyne and R. P. Hellens.

2011. Mendel, 150 years on. Trends in Plant Science, 16: 590–596.

Ellis, T. H. N. 2011. Pisum. In: Kole, C. (Ed.): Wild Crop Relatives: Genomic and

Breeding Resources. Chapter 12, Springer-Verlag, Berlin-Heidelberg, 237–

248pp.

Elzebroek, T. and K. Wind. 2008. Guide to cultivated plants. CAB International,

Oxford Shire, UK.

164

Enderes, G., S. Forster, H. Kandel, J. Pasche, M. Wunsch, J. Knodel and K. Hellevang.

2016. Field pea production. North Dakota State University, 11pp.

Faller, A. L. K. and E. Fialho. 2010. Polyphenol content and antioxidant capacity in

organic and conventional plant foods. Journal of Food Composite and

Analytics, 23: 561-568.

FAO. 2016. Global Forum on Food Security and Nutrition. FSN

Forum.http://www.fao.org/fsnforum/activities/discussions/pulses.

Ferrari B., M. Romani, G. Aubert, K., Boucherot, J. Burstin, L. Pecetti, M. Huart-

Naudet, A. Klein and P. Annicchiarico. 2016. Association of SNP markers with

agronomic and quality traits of field pea in Italy. Czech Journal of

Genetics and Plant Breeding, 52: 83–93.

Ford, R., K. Le Roux, C. Itman, J. B. Brouwer. 2002. Diversity analysis and

genotyping in Pisum with sequence tagged microsatellite site (STMS) primers.

Euphytica, 124: 397-405.

Forster, M. P., E. R. Rodriaguez, J. D. Martian and C. D. Romero. 2002. Statistical

differentiation of bananas according to their mineral composition. Journal of

Agriculture and Food Chemistry, 50:6130–6135.

Gallardo, K., R. Thompson and J. Burstin. 2008. Reserve accumulation in legume

seeds. Crop Research Biology, 331: 755-762.

Gatti, I., M. A. Esposito, P. Almiron, V. P. Cravero and E. L. Cointry. 2011. Diversity

of pea (Pisum sativum L.) accessions based on morphological data for

sustainable field pea breeding in Argentina. Genetics and Molecular Research,

10: 3403-3410.

165

Ghixari, B., H. Vrapi and V. Hobdari. 2014. Morphological characterization of pea

(Pisum sativum L.) genotypes stored in Albanian gene bank. Albanian Journal

of Agricultural Sciences, 9: 78-83.

Gill, N. T. and K. C. Vear. 1980. Agricultural Botany. 3rd edition. (K. C. Vear and D.

J. Barnard edition) Gerald Duck worth and Co. Ltd. London.

Gixhari, B., M. Ludvikova, H. Ismaili, V. Hekuran, A. Jaupi and P. Smykal. 2014.

Genetic diversity of Albanian pea (Pisum sativum L.) landraces assessed by

morphological traits and Molecular Markers. Czech Journal of Genetics and

Plant Breeding, 50:177-184.

Goa, Y. 2014. Evaluation of Chick Pea (Cicer arietinum L.) varieties for Yield

performance and adaptability to Southern Ethiopia. Journal of Biology,

Agriculture and Healthcare, 4: 34-38.

Graham, P. H., and P. Ranalli. 1997. Common Bean (Phaseolus vulgaris L.). Field

Crop Research, 53:131–146.

Graham, P. H. and C. P. Vance, 2003. Legumes: Importance and constraints to greater

use. Plant Physiology, 131: 872–877.

Gutierrez, L., O. V. Wuytswinkel, M. Castelain and C. Bellini. 2007. Combined net-

works regulating seed maturation. Trends in Plant Science, 12: 294-300.

Habib, N. and M. Zamin. 2003. Off season pea cultivation in Dir Kohistan valley.

Asian Journal of Plant Science, 2: 283-285.

Habtamu, S. and F. Million. 2013. Multivariate analysis of some Ethiopian field pea

(Pisum sativum. L) genotypes. International Journal of Genetics and Molecular

Biology, 5:78-87.

166

Hancock, J. F. 2004. Plant evolution and the origin of crop species. CABI Publishing

Wallingford UK and Cambridge, MA.

Handerson, C., S. K. Noren, T. Wricha, N. T. Meetei, V. K. Khanna, A.

Pattanayak and S. Datt. 2014. Assessment of genetic diversity in pea (Pisum

sativum L.) using morphological and molecular markers. Indian Journal of

Genetics and Plant Breeding, 74:205-212.

Hartmann, H. T., A. M. Kofranek, V. E. Rubatzky, and W. J. Flocker. 1988. Plant

Science: Growth, development and utilization of cultivated plants. 2nd edition.

Prentice Hall Career and Technology Englewood Cliffs NJ. McGee, USDA-

ARS.

Hatam, M. and Amanullah. 2001. Grain yield potential of garden peas (Pisum sativum

L.) germplasm. Journal of Biological Sciences, 1: 242-244.

Hellens, R. P., C. Moreau, K. Lin-Wang, K. E. Schwinn, S. J. Thomson, M. Fiers, T. J.

Frew, S. R. Murray, J. M. I. Hofer, Allan A.C. and T. H. N. Ellis. 2010.

Identification of Mendel’s white flower character. Plos One, 5: 132-140.

Hobbs, P. R. and R. L. Obendorf. 1972. Interaction of initial seed moisture and

imbibitional temperature on germination and productivity of soybean. Crop

Sciences, 12: 664-667.

Holl, F. B. and J. R. Vose. 1980. Carbohydrate and protein accumulation in developing

field pea seeds. Canadian Journal of Plant Sciences, 60: 1109-1114.

Hollman, P. C. H., M. G. L. Hertog and M. B. Katan. 1996. Analysis and health effects

of flavonoids. Food Chemistry, 57:43–46.

167

Hove, E. L., S. King and G. D. Hill. 1978. Composition, protein quality, and toxins of

seeds of the grain legumes Glycine max, Lupinus spp., Phaseolus spp., Pisum

sativum, and Viciafaba. Newzeland Journal of Agriculture Research, 21: 457-

462.

Hulse J. H. 1994. Nature, composition, and utilization of food legumes. Expanding the

production and use of cool season food legumes. Journal of Food, Agriculture

and Environment, 13: 77-97.

Hussain, S. A and N. Badshah. 2002. Study on the adaptive behavior of exotic pea

(Pisum sativum L.) varieties under local condition of Peshawar. Asian Journal

of Plant Sciences. 1: 567-569.

Hussain, S. A., M. Hussain, M. Qasim and B. Hussain. 2005. Performance and

economic evaluation of pea varieties at two altitudes in Kaghan Valley. Sarhad

Journal of Agriculture, 21: 587-589.

Igbasan, F. A., W. Guenter and B. A. Slominski. 1997. Field peas: Chemical

composition and energy and amino acid availabilities for poultry. Canadian

Journal of Animal Sciences, 77: 293-300.

Ishtiaq, M., Z. Ahmad and A. Shah. 1996. Evaluation of exotic cultivars of pea in

Peshawar valley. Sarhad Journal of Agriculture, 12: 425-431.

Jaffery, E. H., A. F. Brown, A. C. Kurilich, A. S. Keek, N. Matusheski and B. P.

Klein. 2003. Variation in content of bioactive components in broccoli. Journal

of Food Composite Analytics, 16: 323-330.

Jain, P. K., S. K. Ramgiry and C. B. Singh. 1998. Genotype and environment

interaction of seedling character in chickpea. Crop Research, 16: 321-324.

168

Jambunathan, R., H. L. Blain, K. H. Dhindsa, L. A. Hussein, K. Kogure, L. Li-Juan

and M.M. Youssef. 1994. Diversifying use of cool season food legumes

through processing. Journal of Food, Agriculture and Environment, 19: 98-112.

Janzen, J., G. Brester and V. Smith. 2014. Dry peas: Trends in production, trade, and

price, Agricultural Marketing Policy Center, 57-77pp.

Javaid, A., Ghafoor and R. Anwar. 2002. Evaluation of local and exotic pea (Pisum

sativum L.) germplasm for vegetative and dry grain traits. Pakistan Journal of

Botany, 34: 419-427.

Jezierny, D., R. Mosenthin, N. Sauer, S. Roth, H. P. Piepho, M. Rademacher and M.

Eklund. 2011. Chemical composition and standardised ileal digestibilities of

crude protein and amino acids in grain legumes for growing pigs. Live-stock

Science, 138: 229-243.

Kakar, A. A., M. Saleem, R. Shah and S. A. Q. Shah. 2002. Growth and pod yield

performance of peas (Pisum sativum L.). Asian Journal of Plant Science, 1:

532-534.

Khan, T. N., A. Ramzan, G. Jillani and T. Mehmood. 2013. Morphological

performance of peas (Pisum sativum L.) genotypes under rainfed conditions of

potowar region. Journal of Agriculture Research, 51:51-60.

Khokar, K. M., M. A. Khan, S. I. Hussain, T. Mahmood and H. U. Rehman. 1998.

Cooperative evaluation of some foreign and local pea cultivars. Pakistan

Journal of Agricultural Research, 9: 549-551.

Kraus, T. E. C., R. A. Dahlgren and R. J. Zasoski. 2003. Tannins in nutrient dynamics

of forest ecosystems - A review. Plant and Soil, 256: 41-66.

169

Kumari, P., N. Basal, A. K. Singh, V. P. Rai, C. P. Srivastava and P. K. Singh. 2013.

Genetic diversity studies in pea (Pisum sativum L.) using simple sequence

repeat markers. Genetics and Molecular Research, 2: 3540-3550.

Labuckas, D. O., D. M. Maestri, Perelló, M. L. Martínez and A. L. Lamarque. 2008.

Phenolic from walnut (Juglans regia L.) kernels: Antioxidant activity and

interactions with proteins. Food Chemistry, 107: 607-612.

Lather, V. S., R .S.Waldia and I. S. Mehla. 1997. Early vigour spontaneous mutant in

Chickpea. International Chickpea Newsletter, 4: 11-12.

Lioi, L., A. R. Piergiovanni, D. Pignone, S. Puglisi, M. Santantonio and G. Sonnante.

2005. Genetic diversity of some surviving on-farm Italian common bean

(Phaseolus vulgaris L.) landraces. Plant Breeding, 124: 576-581

Lock, M., B. Mackinder, B. Schrirer and G. Lewis. 2005. Legumes of the World;

Royal Botanical Gardens: Kew, UK.

Loridon, K., K. McPhee, J. Morin, P. Dubreuil, M. L. Pilet-Nayel, G. Aubert, C.

Rameau, A. Baranger, C. Coyne, I. Lejeune and J. Burstin. 2005. Microsatellite

marker polymorphism and mapping in pea (Pisum sativum L.). Theoretical and

Applied Genetics, 111: 1022–1031.

Louette, D., A. Charrier and J. Berthaud, 1997. In situ conservation of maize in

Mexico: genetic diversity and maize seed management in a traditional

community. Ecological Botany, 51: 20–38.

Mahbub, M. M., M. M. Rahman, M. S. Hossain, F. Mahmud and M. M. Kabir. 2015.

Genetic variability, correlation and path analysis for yield an yield components

170

in soybean. American-Eurasian Journal of Agricultural & Environmental

Sciences, 15: 231-236.

Mahbub, M. M., M. S. Hossain, L. Nahar and B. J. Shirazy. 2016. Morpho-

physiological Variation in Soybean (Glycine max (L.) Merrill). American-

Eurasian Journal of Agricultural & Environmental Sciences, 16: 234-238.

Makasheva, R. K. 1983. The Pea. Oxonian Press Pvt. Ltd. New Delhi, India. 78 -

107pp.

Marquardt, R. R. and J. M. Bell. 1988. Future potential of pulses for use in animals

feeds. Pages 42-441 in J. R. Summer field, World crops: Cool season food

legumes. Kluwer Academic, Dordrecht, the Netherlands.

Martinez, C., P. Gulewicz, J. Frias, K. Gulewicz and C. V. Valverde. 2008.

Assessment of protein fractions of three cultivars of (Pisum sativum L.) effect

of germination. European Food Research and Technology, 226: 1465-1478.

Matthews, P. and E. Arthur. 1985. Genetic and environmental components of variation

in protein content in peas. Pages 369-381 in P. D. Hebblethwaite, M. C. Health,

and T. C. K. Dawkins, The pea crop. A basis for improvement. Butterworths,

London, UK.

Matthews, S., A. S. Powell and S. Spaeth. 1988 .Seedling Vigour and susceptibility to

diseases and pests: In World crop: Cool season legumes. Summer field- R.J

.Reading University U.K. Dept. of Agriculture. Dordrecht (Netherlands).

Kluwer Academic Publishers, 619-625.

McPhee, K. 2003. Dry pea production and breeding – A minireview. Food, Agriculture

and Environment. 1: 64-69.

171

Mendel, G. 1866. Versuche uber Pflanzen-Hybriden. Verhandlungen des

naturforschenden Vereines in Brunn, (Abhandlungen) 4: 3–47.

MNFRS, 2017. Agricultural statistics of Pakistan 2016-17. www.mnfrs.gov.pk- last

assessed at 31st Oct, 2017.

Muehlbauer, E. J. and K. E. McPhee. 1997. Peas: In The Physiology .of Vegetable

Crops (Ed. H.C. Wein). CAB International, Walling ford, UK. 429 – 459pp.

Mumm, R. H. and S. P. Moose. 2008. Molecular plant breeding as the foundation for

21st century crop improvement. Plant Physiology, 147: 969–977.

Mustafa, H., M. M. Ozcan, S. Karadaşand E. Ceyhan. 2012. Protein and mineral

contents of pea (Pisum sativum L.) genotypes grown in central Anatolian

region of turkey. South Western Journal of Horticulture, Biology and

Environment, 1: 159-165.

Mustafa, T. A., K. O. C. Zeynep and D. Gul. 2012. Morphological characteristics and

seed yield of east anatolian local forage pea (Pisum sativum L.) ecotypes.

Turkish Journal of Field Crops, 17: 24-30.

Nagai, T., I. Reiji, I. Hachiro and S. Nobutaka. 2003. Preparation and antioxidant

properties of water extract of propolis. Food Chemistry, 80:29-33.

Nawab, N. N., G. M. Subhani, K. Mahmood, Q. Shakil and A. Saeed. 2008. Genetic

variability correlation and path analysis studies in garden pea (Pisum sativum

L.) Journal of Agricultural Research, 46: 333-340.

Nayak, B., J. D. E. Berrios, J. Tang and J. Powers. 2011. Effect of extrusion on the

antioxidant capacity and color attributes of expanded extrudates prepared from

172

purple potato and yellow pea flour mixes. Journal of Food Science, 76: 874–

883.

Nei, M. and W. H. Li. 1979. Mathematical model for studying genetic variation in

terms of restriction endonucleases.Proceeding of National Academy of Science,

USA, 76: 5269- 5273.

Nemera, G., T. M. Labuschange and C. D. Viljoen. 2006. Genetic diversity analysis in

sorghum germplasm as estimated by AFLP, SR and morpho-agronomical

markers, Biodiversity and Conservation, 15:3251-3265.

Nikolopoulou, D., K. Grigorakis, M. Stasini, M. Alexi and K. Iliadis. 2006. Effects of

cultivation area and year on proximate composition and anti-nutrients in three

different Kabuli-type chickpea (Cicer arientinum L.) varieties. European Food

Research Technology, 23: 737-741.

Nikolopoulou, D., K. Grigorakis, M. Stasini, M. N. Alexis and K. Iliadis. 2007.

Differences in chemical composition of field pea (Pisum sativum L.) cultivars:

Effects of cultivation area and year. Food Chemistry, 103: 847-852.

Nisar, M., A. Khan, S. F. Wadood, A. A. Shah, H. Fatih. 2017. Molecular

characterization of edible pea through EST-SSR markers. Turkish Journal of

Botany, 41: 1608-1617.

Nisar. M., A. Ghafoor, M. R. Khan, H. Ahmad, A. S. Qureshi and H. Ali. 2007.

Genetic diversity and geographic relationship among local and exotic chickpea

germplasm. Pakistan Journal of Botany, 39: 1575- 1581.

Olalekan, A. J. and B. F. Bosede. 2010. Comparative Study on Chemical Composition

and Functional Properties of Three Nigerian Legumes (Jack Beans, Pigeon Pea

173

and Cowpea). Journal of Emerging Trends in Engineering and Applied

Sciences, 1: 89-95.

Ouafi, L. O., F. Alane, H. R. Bouziane and A. Abdelguer. 2016. Agro-morphological

diversity within field pea (Pisum sativum L.) genotypes. African Journal of

Agricultural Research, 11: 4039-4047.

Oudhia, P., S. S. Kolhe and R. S. Tripathi. 1997. Allelopathic effect of Blume alacera

L. on wheat. Abstracts Seventh Biennial Conference. Ludhlana, Punjab, India.

Indian Society of Weed Science, 109pp.

Ozer, S., E. Tumer , F. S. Baloch , T. Karakoy , F. Toklu and H. Ozkan. 2012.

Variation for nutritional and cooking properties among Turkish field pea

landraces. Journal of Food, Agriculture & Environment, 10: 324-329.

Phillips, D. A. 1980. Efficiency of symbiotic nitrogen fixation in legumes. Annual

Review of Plant Physiology, 31: 29–49.

Price, D. N., C. M. Smith and C. L. Hedley. 1988. The effect of the gp gene on fruit

development in Pisum sativum L. structural and physical aspects. New

Phytologist, 110: 261-269.

Qasim, M., M. Zubair and D. Wadan. 2001. Evaluation of exotic cultivars of pea in

Swat valley. Sarhad Journal of Agriculture, 17: 545-548.

Rahman, M. M., M. Syed A. Akter, M.M. Alam and M.M. Ahsan. 2014. Genetic

Variability, Correlation and Path Coefficient Analysis of Morphological Traits

in Transplanted Aman Rice (Oryza sativa L.). American-Eurasian Journal of

Agricultural & Environmental Science, 14: 387-391.

174

Raje, R. S. 1992. Evaluation of chickpea genotypes of varying seed size for

germination, seedling vigour and seed yield components. M.Sc. (Agriculture)

Thesis. JNKVV. Jabalpur.

Rana, J. C., M. Rana, V. Sharma, A. Nag, R. K. Chahota and T. R. Sharma. 2017.

Genetic Diversity and Structure of Pea (Pisum sativum L.) Germplasm Based

on Morphological and SSR Markers. Plant Molecular Biology Reporter, 35:

118–129.

Ranalli, P., I. Giordano, U. Ziliotto, G. M. Lomabrcho, V. Pirami, E. Lahoz, V.

Bcuonaccorso, P. Talluri, P. Bottozzi, G. Lucque, D. Rosoe, G. Ruaro, B.

Casrini and P. Re. 1992. Yield potential of pea for dry seed in different Italian

environments. SementiElette, 38: 15-43.

Ravindran, G., C. L. Nalle, A. Molan and V. Ravindran. 2010. Nutritional and

biochemical assessment of field peas (Pisum sativum L.) as a protein source in

poultry diets. Journal of Poultry Science, 47: 48-52.

Rawel, H. M., D. Czajka, S. Rohn and J. Kroll. 2002. Interactions of different

phenolic acids and flavonoids with soy proteins. International Journal of

Biology and Macromolecules, 30:137–150.

Reichert, R. D. and S. L. MacKenzie. 1982. Composition of peas (Pisum sativum L.)

varying widely in protein content. Journal of Agricuture and Food Chemistry,

30: 312-317.

Reid, J. B. and J. J. Ross. 2011. Mendel’s genes: Toward a full molecular

characterization. Genetics, 189: 3–10.

175

Rodrigues, A. M., C. M. G. Reis and P. J. Rodrigues. 2012. Nutritional assessment of

different field pea genotypes (Pisum sativum L.). Bulgarian Journal of

Agricultural Sciences, 18: 571-577.

Rohlf, F. J. 2000. NTSYSpc: Numerical Taxonomy and Multivariate Analysis System.

Version 2.02. Exeter Software, Setauket, New York.

Roos, E. E. and J. R. Manalo. 1976. Effect of initial seed moisture on Snap bean

emergence from cold soil. American Journal of Social and Horticultural

Sciences, 101: 321-324.

Ross, J. J. and J. B. Reid. 2011. Mendel’s genes: Toward a full molecular

characterization. Genetics, 189, 3-10pp.

Sadler, G. D. and P. A. Murphy. 2010. pH and titratable acidity. In: Nielsen SS,

editor; Food analysis. New York, NY: Springer Science Business Media. 219-

260pp.

Sanchez-Chino, X., C. J. Martinez, G. D. Ortiz, I. A. Gonzalez and E. M. Bujaidar.

2015. Nutrient and no nutrient components of legumes and its chemo

preventive activity: A Review. Nutrition and Cancer Research, 67: 401–10.

Santalla, M., J. M. Amurrio and A. M. Ron. 2001. Food and feed potential breeding of

green dry and vegetable pea germplasm. Canadian Journal of Plant Science, 81:

601-610.

Sarawong, C., R. Schoenlechner, K. Sekiguchi and E. Berghofer. 2014. Effect of

extrusion cooking on the physicochemical properties, resistant starch, phenolic

content and antioxidant capacities of green banana flour. Food Chemistry, 143:

33-39.

176

Sarikamis, G., F. Yasar, M. Bakir, K. Kazan and A. Ergul. 2009. Genetic

characterization of green bean (Phaseolus vulgaris L.) genotypes from eastern

Turkey. Genetics and Molecular Research, 8: 880-887.

Sarıkamis, G., R. Yanmaz, S. Ermiş, M. Bakir and C. Yüksel. 2010. Genetic

characterization of pea (Pisum sativum L.) germplasm from Turkey using

morphological and SSR markers Genetics and Molecular Research, 9: 591-600.

Sato, Y., R. Morita, M. Nishimura, H. Yamaguchi and M. Kusaba. 2007. Mendel’s

green cotyledon gene encodes a positive regulator of the chlorophyll-degrading

pathway. Proceedings of National Academy of Sciences USA, 104: 14169-

14174.

Schumacher, H., H. M. Paulsen and A. E. Gau. 2009. Phenotypical indicators for the

se-lection of methionine enriched local legumes in plant breeding. Land-

bauforsch, 59: 339-344.

Shah, A., S. D. Lal and A. Shah. 1990. Comparative performance of some pea

cultivars under rainfed conditions of U.P. hills. Progressive Horticulture in

India, 22: 121-124.

Sharma, P., H. S. Gujral and B. Singh. 2012. Antioxidant activity of barley as affected

by extrusion cooking. Food Chemistry, 131:1406-1413.

Sharma, S., N. Yadav, A. Singh and R. Kumar. 2013. Nutritional and anti-nutritional

profile of newly developed chickpea (Cicer arietinum L.) varieties.

International Journal of Food Research, 20: 805-810.

Shiran, B., N. Amirbakhtiar, S. Kiani, S. Mohammadi, B. E. Sayed Tabatabaei and H.

Moradi. 2007. Molecular characterization and genetic relationship among

177

almond cultivars assessed by RAPD ans SSR markers. Journal of Horticulture,

111: 280-292.

Siddika, A. M., A. Islam, M. G. Rasul, M. A. Khaleque and J. U. Ahmed. 2007.

Genetic variability in advanced generations of vegetables peas (Pisum sativum

L.). Global Science Books, 9: 31-53.

Sila, B. and N. G. Malleshi. 2012. Physical, chemical and nutritional characteristics of

premature-processed and matured green legumes Journal of Food Science and

Technology, 49: 459-466.

Simioniuc, D., R. Uptmoor, W. Friedt and F. Ordon. 2002. Genetic diversity and

relationships among pea cultivars revealed by RAPDs and AFLPs. Plant

Breeding, 121: 429-435.

Sindhu, A., L. Ramsay, L. A. Sanderson, R. Stonehouse, R. Li, J. Condie, S. K. Arun,

Shunmugam, Y. Liu, A. B. Jha, M. Diapari, J. Burstin, G. Aubert, B. Taran ・

K. E. Bett, T. D. Warkentin, A. G. Sharpe. 2014. Gene‑based SNP discovery

and genetic mapping in pea. Theoretical and Applied Genetics, 10: 14-32.

Singh, U. P., B. K. Sarma, D. P. Singh and A. Bahadur. 2002. Plant growth promoting

rhizobacteria-mediated induction of phenolics in pea (Pisum sativum L.) after

infection with Erysiphepisi. Current Microbiology, 44:396-400.

Singleton, V. I. and R. M. Raventos. 2000. Analysis of Total Phenols and other

Oxidation Substrates and Antioxidants by means of Folin-Ciocalteu Reagent,

Method in Enzymology, 299: 152-178.

Slinkard, A. E., G. Bascur and G. H. Bravo. 1994. Biotic and abiotic stresses of cool

season food legumes in the Western Hemisphere. 5: 195-203.

178

Smart, J. 1990. Grain Legumes: Evolution and genetic resources. Cambridge

University Press Cambridge, UK. 7: 200-202.

Smykal, P., J. Horacek, R. Dostalova and M. Hybl. 2008. Variety discrimination in pea

(Pisum sativum L.) by molecular, biochemical and morphological markers.

Journal of Applied Genetics, 49:155-166.

Solberg, S. O., A. K. Brantestam, K. Olsso, M. W. Leino, J. Weibull and F. Yndgaard.

2015. Diversity in local cultivars of (Pisum sativum L.) collected from home

gardens in Sweden. Biochemical System and Ecology, 62:194-203.

SPSS. 1999. Base 9.0 for Windows Users Guide. SPSS Inc, USA.

Sumner, L. W. and R. A. Dixon. 2003. Legume natural products: Understanding and

manipulating complex pathways for human and animal health. Plant

Physiology, 131: 878–885.

Sun, X., T. Yanga, J. Haoc, X. Zhang, R. Ford, J. Jianga, F. Wanga, J. Guana and X.

Zonga. 2014. SSR genetic linkage map construction of pea (Pisum sativum L.)

based on Chinese native varieties. The Crop Journal, 2: 170 -174.

Taran, B., C. Zhang, T. Warkentin, and A. Tullu. 2005. Genetic diversity among

varieties and wild species accessions of pea (Pisum sativum L.) based on

molecular markers, and morphological and physiological characters. Genome,

48: 257-272.

Tekeli, A. S. and E. Ates. 2003. Yield and its components in field pea (Pisum arvense

L.) lines. Journal of Central European Agriculture, 4: 313-317.

179

Teshome, A., B. R. Baum, L. Fahrig, J. K. Torrance, T. J. Arnason and J. D. Lambert.

1997. Sorghum (Sorghum bicolor L.) landrace variation and classification in

North Shewa and South Welo, Ethiopia. Euphytica, 97: 255–263.

Teshome, A., T. Bryngelsson, K. Dagne and M. Geleta. 2015. Assessment of genetic

diversity in Ethiopian field pea (Pisum sativum L.) accessions with newly

developed EST-SSR markers. Bio Med Central Genetics, 16: 2-12.

Tihomir, C., M. Tucak, S. Popovic, B. Sonja and G. V. Kozumplik. 2009. Genetic

diversity of pea (Pisum sativum L.) genotypes assessed by pedigree

morphological and molecular data. Journal of Food Agriculture and

Environment, 7: 213-219.

Tolessa. T. T., G. Keneni, T. Sefera, M. Jarsoand Y. Bekele, 2013. Genotype ×

Environment interaction and performance stability for grain yield in field pea

(Pisum sativum L.) genotypes. Global Science Books, 3: 31-44.

Tresina, S. P., K. Kala, V. R. Mohan and V. Vadivel. 2010. The Biochemical

Composition and Nutritional Potential of three Varieties of (Vigna mungo L.)

Hepper. Advances in Bioresearch, 2: 6-16.

Urbano, G., P. Aranda and E. G. Villalva. 2003. Nutritional evaluation of pea protein

diets after mild hydrothermal treatment and with and without added phytase.

Journal of Agriculture and Food Chemistry, 51: 2415–2420.

Urbano, G., P. Aranda, E. G.Villalva, S. Frejnagel, J. M. Porres, J. Friäas and M. L.

Jurado. 2005. Effects of germination on the composition and nutritive value of

proteins in (Pisum sativum L.). Journal of Agriculture and Food Chemistry, 93:

671-679.

180

United State Department of Agriculture, Agricultural Research Service. 2015. USDA

National Nutrient Database for Standard Reference, Release 28. Nutrient Data

Laboratory Home Page. Available at: http://www.ars.usda.gov/main/

site_main.htm?modecode=80-40-05-25

Vocanson, A. and M. H. Jeuffroy. 2008. Agronomic performance of different pea

cultivars under various sowing periods and contrasting soil structures. Journal

of Agronomy, 100: 748-759.

Wang, N. and J. K. Daun. 2004. Effect of variety and crude protein content on

nutrients and certain antinutrients in field peas (Pisum sativum L). Journal of

the Science of Food and Agriculture, 84, 1021–1029.

Wang, N., D. W. Hatcher, T. D. Warkentin and R. Toews. 2008. Effect of cultivar and

environment on physicochemical and cooking characteristics of field pea

(Pisum sativum L.). Food Chemistry, 118: 109-115.

Wang, X., T. D.Warkentin, C. J. Briggs, B. D. Oomah,C. G. Campbell and S. Woods.

1997. Total phenolics and condensed tannins in field pea (Pisum sativum L.)

and grass pea (Lathyrus sativus L.). Euphytica, 101: 97-102.

Weaver, W. W. 2003. Peas: Encyclopedia of Food and Culture. Edition. Solomon H.

Katz. 3rd Edition. New York, Charles Scribner & Sons.

Weber, H., L. Borisjuk and U. Wobus. 2005. Molecular physiology of legume seed

development. Annual Review of Plant Biology, 56: 253-279.

Witten, S., H. Böhm and K. Aulrich. 2015. Effect of variety and environment on the

contents of crude nutrients, lysine, methionine and cysteine in organically

181

produced field peas (Pisum sativum L.) and field beans (Vicia faba L.). Applied

Agriculture Forestry Research, 205-216pp.

Yalcın, C. O., Zarslan, T. and A. Akbas. 2006. Physical properties of pea (Pisum

sativum) seed. Journal of Food Engineering, 79: 731–735.

Yoon, K. Y., M. Cha, S. R. Shin and K. S. Kim. 2005. Enzymatic production of a

soluble fiber hydrolysate from carrot pomace and its sugar composition. Food

Chemistry, 92: 151-157.

Zeven, A. C. 1998. Landraces: A review of definitions and classifications. Euphytica,

104: 127-139.

Zhang, P., R. L. Whistler, J. N. BeMiller and B. R. Hamaker. 2005. Banana starch:

production, physicochemical properties, and digestibility- a

review. Carbohydrates Polymer, 59: 443-458.

Zhuang, X., K. E. Mcphee, T. E. Coram, T. L. Peever and M. I. Chilvers. 2013.

Development and characterization of 37 novel EST-SSR markers in Pisum

sativum. Journal of Application in Plant Sciences, 220-249pp.

Zohary, D., M. Hopf and E. Weis. 2013. Domestication of plants in the old world. 4th

edition Oxford University press, 264pp.

182

APPENDICES

1. DNA0Extraction 0Buffer (2×CTAB)

Chemicals0 Concentrations

CTAB0 20g

1M0Tris HCl0 100ml

0.5M EDTA0 40ml

NaCl0 81.8g

PVP (K-30) 10g

Distilled0water Upto 1000ml

Not autoclavable.

Mercapto-ethanol 0.2% is added at end. Buffer is kept in oven at 65°C.

2. Chloroform/isoamylalcohol (CIA)

Chemicals0 Concentration

Chloroform0 24ml

Isoamylalcohol0 1ml

3. Ice0chilled02-propanol (0.66ml)

4. 70% Ethanol (70ml- Ethanol, 30ml-D2H2O)


Ethanol0 70ml

Distilled0Water 30ml

183

5. a. Tris0acetate EDTA (5×TAE0Buffer)

Chemicals Concentration

Trizma0Base 54gm

Acetic0Acid 27.5gm

0.5M0EDTA 20ml

Distilled0Water Fill upto01000ml

5. b. 1×TAE0Buffer


5×TAE0Buffer 200ml

Distilled0Water 800ml

6. Loading0Dye/ Buffer


Bromophenol0Blue 0.25% 0.031gm

30%0Glycerol 3.75ml

70ml0H2O 8.75ml

184

7. Tris EDTA (TE) Buffer


1M0Tris HCl0 10ml

0.5M EDTA0 2ml

pH0 7.5-8.0

8. Gel Formation


Agarose0Gel 0.8%0

1×TBE Buffer 100ml0

Add01ul of Ethidium0Bromide

9. Layout for PCR Master Mix

Reagents Concentration Volume Template0DNA 20-50 ng/ul 1.65 µL DNTPs0 2.5 mM 2.0 µL Buffer0 10X 2.0 µL MgCl20 25 mM 2.5 µL Primer–F0 20 µM 0.8 µL Primer-R0 20 µM 0.8 µL DNA Taq0Polymerase 5Uint/µL 0.25 µL Double0distilled0H2O 10µL Total0Volume 20µL

185

10. List of 20 SSR Primers along with forward and reverse sequence used

in this study

Sr.No. Primer Forward sequence Reverse sequence

1 AD73 Cagctggattcaatcattggtg Atgagtaatccgacgatgcctt

2 AA92 aaggtctgaagctgaacctgaagg Gcagcccacagaagtgcttcaa

3 D21 Tattctcctccaaaatttcctt Gtcaaaattagccaaattcctc

4 AD148 Gaaacatcattgtgtcttcttg Ttccatcacttgattgataaac

5 AD270 Ctcatctgatgcgttggattag Aggttggatttgttgtttgttg

6 AA335 Acgcacacgcttagatagaaat Atccaccataagttttggcata

7 AB53 Cgtcgttgttgccggtag Aaacacgtcatctcgacctgc

8 AA205 Tacgcaatcatagagtttggaa Aatcaagtcaatgaaacaagca

9 AC58 Tccgcaatttggtaacactg Cgtccatttcttttatgctgag

10 AD83 Cacatgagcgtgtgtatggtaa Gggataagaagagggagcaaat

11 AB141 Atcccaatactcccaccaatgtt Agacttaggcttcccttctacgactt

12 AA285 Tcgcctaatctagatgagaata Cttaacattttaggtcttggag

13 AD147 Agcccaagtttcttctgaatcc Aaattcgcagagcgtttgttac

14 AA175 ttgaaggaacacaatcagcgac Tgcgcaccaaactaccataatc

15 AA163.2 Tagtttccaattcaatcgacca Agtgtattgtaaatgcacaaggg

16 AD51 atgaagtaggcatagcgaagat Gattaaataaagttcgatggcg

17 AA90 Cccttaccatatttcgtttct Tgcgactccattctagtattg

18 AA103 Aagtgtgaaagtttgccaggtc Cgggtacgggttatgttgtc

19 AB72 atctcatgttcaacttgcaaccttta Ttcaaaacacgcaagttttctga

20 AA67 Cccatgtgaaattctcttgaaga Gcatttcacttgatgaaatttcg

186

11. QUALITATIVE DATA

Treat. G.VIGOR F.COLOR P.SHAPE P.COLOR S.SHAPE S.COLOR

CH 1 1 1 1 1 1

L1 1 7 1 1 1 3

L2 1 7 1 1 1 3

L3 1 7 1 1 1 3

L4 2 7 1 1 1 3

L5 2 1 2 1 2 1

L6 2 1 2 1 2 1

L7 1 1 2 1 2 1

L8 3 1 2 1 2 1

L9 3 1 2 1 2 1

L10 3 1 2 1 2 1

L11 2 1 2 1 2 1

L12 1 1 2 1 2 1

L13 1 1 1 1 1 1

L14 1 1 1 1 1 1

L15 2 1 1 1 1 1

L16 1 1 1 1 1 1

L17 1 2 1 2 1

L18 1 1 2 1 2 1

L19 1 1 2 1 2 1

L20 1 1 2 1 2 1

L21 2 7 1 1 1 3

L22 2 7 1 1 1 3

L23 1 7 1 1 1 3

L24 1 7 1 1 1 3

L25 2 1 2 1 2 1

L26 2 1 2 1 2 1

L27 1 1 2 1 2 1

L28 1 1 2 1 2 1

L29 1 1 1 1 1 1

L30 1 1 1 1 1 1

L31 2 1 1 1 1 1

L32 2 1 1 1 1 1

L33 2 1 2 1 2 1

L34 3 1 2 1 2 1

M-25 1 1 1 1 1 2

M-16 1 1 1 1 1

187

M-102 1 1 1 1 1 1

M-91 1 1 1 1 1 2

M-07 1 1 1 1 1 2

M-83 2 1 1 1 1

M-22 1 1 1 1 1 1

M-72 1 1 1 1 1 1

M-39 1 1 1 1 1 1

M-86 3 1 1 1 1 1

M-08 2 1 1 1 1 2

M-116 1 1 2 1 2 1

L47 3 1 2 1 2 1

L48 3 1 2 1 2 1

L49 3 1 2 1 2 1

L50 3 1 1 1 1 1

L51 2 1 1 1 1 1

L52 2 1 1 1 1 1

L53 1 1 1 1 1 1

L54 3 1 2 1 2 1

L55 1 1 2 1 2 1

L56 3 1 2 1 2 1

L57 3 1 2 1 2 1

L58 2 1 2 1 2 1

L59 2 1 2 1 2 1

L60 1 1 2 1 2 1

L61 1 1 2 1 2 1

L62 1 1 2 1 2 1

L63 3 1 1 1 1 1

L64 1 1 1 1 1 1

L65 1 1 1 1 1 1

L66 3 1 1 1 1 1

L67 3 1 1 1 1 1

L68 3 1 1 1 1 1

L69 3 1 1 1 1 1

L70 2 1 1 1 1 2

L71 2 1 1 1 1 1

L72 3 1 1 1 1 1

L73 2 1 1 1 1 1

L74 3 1 1 1 1 1

188

12. Mean values for Morphological parameters among 75 pea genotypes

G P L LL LW LA FI FC PF P/P PL PW S/P SW Y

CH 85 41 39 2.5 2.7 4.92

60 73 65 15 10.5 1.2 8 28.2 18.8

L1 85 55 46 2.2 1.8 2.89

58 70 63 12 5.5 1 4 12.3 8.2

L2 85 58 49 2.5 2.5 4.56

58 70 63 13 4.7 1.1 4 12 8

L3 85 47 41 1.7 1.6 2.1

58 70 64 12 5 1 4 12.9 8.6

L4 80 50 43 2 1.9 2.77

56 70 64 12 4.5 1 4 12.5 8.3

L5 80 52 44 1.9 1.8 2.49

56 69 63 11 5.8 1.2 5 13 8.6

L6 80 34 35 1.7 1.2 2.1

50 62 56 10 5.8 1 5 13.7 9.13

L7 85 47 43 2.8 2.7 5.51

55 70 63 12 6.1 1 5 13 8.6

L8 75 46 37 2.6 2.6 4.93

57 68 62 11 6.5 1 5 13.4 8.9

L9 75 47 42 2.1 2 3.06

57 69 63 12 7.5 1.2 6 17 11.33

L10 75 52 45 3.1 3.1 7.01

57 68 62 10 6.6 1.1 6 17.5 11.6

L11 80 57 50 3.2 3.2 7.47

56 68 61 16 8 1 7 19 12.6

L12 85 43 38 3.3 3.3 7.94

61 75 67 13 8.7 1 7 18.2 12.13

L13 85 44 46 3.6 3.5 9.19

61 74 67 13 8.3 1.1 7 19.2 12.8

L14 85 46 39 3.4 3.3 8.19

60 74 66 12 8.3 1 7 19 12.66

L15 80 42 51 3 3.1 6.78

61 75 68 14 6.6 1.2 6 18.6 12.4

L16 70 47 48 2.9 2.9 6.13

57 67 63 15 7.6 1.2 6 19.2 12.8

L17 75 43 54 2.7 2.8 5.51

57 69 65 14 7.6 1.2 6 18.6 12.4

L18 70 40 36 3.1 3.2 7.24

58 70 66 16 7.1 1.2 6 19 12.6

L19 75 46 37 3 3.1 6.78

59 70 66 13 7.7 1.2 7 21.4 14.2

L20 75 33 30 1.8 1.8 2.36

49 61 58 13 7.9 1.2 7 22 14.6

L21 80 58 53 2.9 2.8 5.92

59 71 65 16 8.2 1.2 7 22.6 15.06

L22 80 59 52 2.8 2.8 5.72

58 71 66 17 8 1.2 7 22 14.6

L23 85 65 65 3.6 3.6 9.46

56 70 67 16 7.6 1.2 6 16.4 10.9

L24 85 68 70 4.1 4 11.9

58 73 68 11 7.6 1.2 6 18 12

L25 80 67 66 3.8 3.7 10.2

58 72 67 13 7.6 1.2 6 18.5 12.3

L26 80 69 65 3.9 3.8 11.1

59 72 66 14 7.5 1.2 6 19 12.66

L27 85 71 68 4.2 4.1 12.5

60 74 67 17 8.5 1.1 7 23.8 15.86

L28 85 74 69 4.3 4.3 13.4

60 74 67 17 8.6 1.2 7 23 15.33

L29 85 80 74 5.1 5 18.6

62 77 69 18 8.7 1.2 7 23.5 15.66

L30 85 78 71 4.7 4.7 16.12

61 75 63 17 8.2 1.2 7 23.5 15.66

L31 80 73 67 4.5 4.4 14.4

59 73 61 14 8.3 1.2 7 23 15.33

L32 80 75 66 4.2 4.2 12.87

59 72 62 11 8.5 1.1 7 23.4 15.6

L33 80 54 58 3.9 3.9 11.1

52 65 57 13 8.6 1.1 7 24.9 16.6

L34 75 49 52 2.8 2.9 5.92

51 64 58 12 8.7 1.1 7 23.2 15.46

189

A35 90 44 49 2.7 2.7 5.32

51 64 58 14 9 1.2 8 26.8 17.86

A36 85 52 57 2.9 2.8 5.92

54 66 59 16 9.2 1.2 8 27.2 18.13

A37 90 56 62 3.1 3 6.78

55 65 60 15 9.3 1.2 8 26.4 17.6

A38 90 49 57 3 3 6.57

53 65 59 14 9.3 1.2 8 28.3 18.8

A39 85 45 54 2.9 2.8 5.92

53 67 69 16 9.1 1.2 8 27.2 18.13

A40 80 50 56 2.8 2.8 5.72

57 71 63 15 10.1 1.2 8 29.6 19.73

A41 85 53 60 3.1 3.1 7.01

57 70 62 14 9.5 1.2 8 25.8 17.2

A42 90 57 64 3.2 3.1 7.24

58 71 62 15 9.2 1.2 8 26 17.3

A43 85 54 59 3 3.1 6.78

55 69 60 16 9.3 1.2 8 27.3 18.2

A44 70 59 67 3.3 3.3 7.49

57 70 62 15 9.5 1.2 8 27 18

A45 80 55 63 3.2 3.1 7.24

56 69 60 14 8.7 1.2 7 25.3 16.86

A46 85 52 61 3.1 3.1 7.01

56 70 61 14 9.4 1.2 8 26 17.33

L47 70 57 65 3.3 3.2 7.7

58 72 62 13 7.6 1.1 6 19 12.6

L48 70 51 59 2.9 2.9 6.13

55 68 61 14 7.6 1.1 6 19.2 12.8

L49 75 46 62 3.9 3.9 11.1

54 67 61 14 8.5 1.1 7 20.1 13.4

L50 75 39 44 1.8 1.7 2.23

54 65 59 16 8.6 1.1 7 22.1 14.7

L51 80 41 47 2.1 2.1 3.21

53 67 59 11 8.7 1.1 7 22.5 15

L52 80 42 48 2.3 2.2 3.69

53 67 59 12 8.1 1.1 7 22.3 14.8

L53 85 44 50 2.4 2.4 4.2

55 70 61 12 7.5 1.1 6 21.1 14.06

L54 75 47 51 2.6 2.6 4.93

56 71 62 13 7.6 1.2 6 22.1 14.7

L55 85 44 49 2.3 2.3 3.86

56 69 60 14 8.7 1.2 7 22.9 15.26

L56 75 45 49 2.5 2.4 4.38

55 70 61 11 9.3 1.2 8 24.7 16.4

L57 75 49 53 2.7 2.6 5.12

58 72 63 10 9.8 1.2 8 24.6 16.4

L58 80 53 61 3.1 3.1 7.01

55 70 62 12 8.7 1.2 7 23.5 15.6

L59 80 58 66 3.5 3.4 8.68

56 70 61 13 8.7 1.2 7 22.5 15

L60 85 56 63 3.3 3.3 7.94

56 71 62 11 7.6 1.1 6 20.1 13.4

L61 85 59 64 3.6 3.5 8.94

58 72 62 12 7.6 1.1 6 19.7 13.1

L62 85 61 72 3.8 3.8 10.5

59 73 66 14 8.7 1.2 7 21.8 14.5

L63 75 64 75 3.9 3.9 11.1

58 72 65 15 7.5 1.1 6 18.6 12.4

L64 85 66 76 4 3.9 11.3

59 73 65 11 8.1 1.2 7 23.9 15.93

L65 85 60 71 3.8 3.8 10.5

58 72 64 14 8.2 1.2 7 23.4 15.6

L66 75 57 66 3.5 3.5 8.94

55 69 61 15 7.3 1.1 6 19.5 13

L67 75 54 62 3.1 3.1 7.01

55 69 61 16 7.3 1.1 6 20.3 13.53

L68 75 51 59 2.9 2.9 6.13

54 68 60 11 8.3 1.2 7 24.2 16.13

L69 75 58 63 3.6 3.6 9.46

57 71 63 12 8.2 1.2 7 24.6 16.4

L70 80 61 74 3.9 3.8 10.81

58 70 62 12 8.1 1.2 7 23.8 15.8

L71 80 66 75 4.2 4.1 12.5

59 73 63 11 7.6 1.1 6 18.7 12

190

L72 75 68 77 4.4 4.3 13.81

59 72 62 14 7.6 1.1 6 19.8 13.2

L73 80 64 73 4 4 11.68

57 70 63 13 8.2 1.2 7 22.9 15.2

L74 75 61 65 3.7 3.7 9.99

56 70 63 12 8.1 1.2 7 22.3 14.8

SD.V 5.22 10.29 11.76 0.75 0.75 3.49 2.66 3.06 2.91 1.95 1.17 0.07 1.02 4.19 2.80

C.V 27.25 105.96 138.36 0.56 0.56 12.18 7.09 9.33 8.49 3.79 1.37 0.00 1.04 17.57 7.85

13. Means values for biochemical parameters among pea genotypes

Moist. TSS Phen. Ph Protein Fat Fiber Ash Carbo. Chloro. CH 7.8 1.2 3.213 6.6 23.16 1.21 0.89 2.8 65.03 28.5 L2 8.1 1.4 3.102 5.3 23.07 1.32 1.11 3.4 64.11 27.2 L3 7.7 1.1 1.793 6.9 17.67 1.34 0.83 3.7 69.59 23.1 L4 7.7 1.7 2.069 6.7 19.05 1.28 0.92 3.4 68.57 25.6 L5 8.9 1.3 2.063 6.1 21.4 1.29 1.12 2.9 65.51 27.4 L6 8.3 1.8 2.552 6.3 23.91 1.37 1.26 2.3 64.23 22.66 L7 8.8 2.1 2.914 6.4 20.13 1.39 1.34 3.8 65.88 13.2 L8 8.2 2.6 1.387 6.8 21.23 1.23 1.42 3.5 65.84 13.6 L9 8.2 2.8 1.272 5.8 22.67 1.41 1.23 2.2 65.52 21.7 L10 8.1 1.7 1.535 6.4 23.78 1.44 1.98 2.3 64.38 23.7 L11 8.5 2.2 1.421 6.3 24.32 1.47 0.88 2.6 63.11 18.6 L12 8.3 1.6 1.163 5.6 24.78 1.53 0.96 3.2 62.19 18.9 L13 7.1 1.4 1.984 6.7 24.89 1.43 0.94 3.7 62.88 18.9 L14 8.3 1.2 1.845 6.5 23.56 1.32 0.99 3.1 63.72 33.1 L15 8.8 2.8 3.219 6.3 23.4 1.24 1.23 3.6 62.96 29.2 L16 7.5 1.7 2.767 6.3 22.27 1.37 1.29 3.7 65.16 15.9 L17 7.7 1.6 3.01 6.8 21.35 1.38 1.28 2.9 66.67 27.1 L18 7.9 1.5 2.045 6.7 20.89 1.26 1.32 2.2 67.75 17.3 L19 8.3 1.3 1.342 6.3 22.45 1.25 1.34 2.1 65.9 11.1 L20 7.2 1.8 2.142 5.9 23.43 1.33 1.35 2.7 65.68 15.6 L21 7.9 2.3 2.515 6.4 24.23 1.39 1.28 2.3 64.18 18.6 L22 8.7 1.3 2.291 6.1 23.65 1.45 1.33 2.8 63.4 13.6 L23 7.3 2.9 3.125 6.7 24.86 1.49 1.45 2.7 63.65 12.2 L24 7.7 2.1 3.311 6.5 25.87 1.54 1.44 2.9 61.99 31.93 L25 7.7 1.7 2.872 5.8 26.31 1.31 1.41 2.7 61.98 14.24 L26 8.6 2.5 2.635 5.7 25.87 1.27 1.52 2.3 61.96 23.2 L27 7.6 1.9 1.238 5.4 22.09 1.32 1.29 2.4 66.71 29.3 L28 7.3 1.4 3.612 6.4 21.45 1.46 1.34 2.7 67.09 26.9 L29 7.2 2.8 1.694 6.5 21.34 1.51 1.37 2.6 67.35 23.3 L30 7.4 1.1 2.436 6.8 23.73 1.55 1.42 2.4 64.92 33.92 L31 7.8 2.2 2.255 6.1 25.76 1.34 1.53 2.8 62.3 28.9 L32 7.3 1.6 1.755 6.3 25.09 1.45 1.47 2.7 63.46 25.36

191

L33 7.9 2.4 1.479 6.2 21.79 1.47 1.26 2.9 65.94 13.5 L34 8.3 1.7 2.981 6.4 27.01 1.57 1.37 3.8 59.32 32.35 A35 8.3 1.4 2.523 5.7 20.92 1.62 1.39 3.2 65.96 17.5 A36 8.7 2.8 3.821 5.3 21.78 1.34 1.31 3.6 64.58 22.3 A37 9.9 1.3 3.311 5.7 22.23 1.45 1.24 4.2 62.22 25.1 A38 9.4 2.3 3.913 6.2 23.25 1.52 1.28 4.4 61.7 27.2 A39 9.1 2.7 1.635 6.1 23.57 1.54 1.47 3.9 61.89 23.2 A40 8.3 1.5 2.045 6.4 23.45 1.34 1.45 3.1 63.81 24.6 A41 9.1 2.7 1.326 5.4 22.56 1.56 1.41 3.7 63.08 22.4 A42 8.9 2.3 2.454 5.7 21.42 1.59 1.39 3.5 64.59 26.2 A43 8.8 2.4 1.292 5.8 23.35 1.52 1.44 3.4 62.93 23.9 A44 8.9 2.1 1.367 5.9 23.32 1.48 1.34 3.6 62.7 21.3 A45 8.8 2.7 2.198 6.3 24.31 1.57 1.49 3.2 62.12 22.7

A46 8.7 2.3 2.987

6.5

21.66 1.55 1.35 3.5 64.59 23.8 Max 9.9 2.9 3.913 6.9 27.01 1.62 1.98 4.4 69.59 33.92

Mini 7.1 1.1 1.163 5.3 17.67 1.21 0.83 2.1 59.32 11.1

14. The Eigen values for 15 morphological traits of Pisum sativum L. Genotypes.

PC 1 2 3

Eigen value 6.18 4.12 1.46

% variance 41.22 27.52 9.79

Cumulative Eigen Value 41.22 68.74 78.53

15. The Eigen values for 10 biochemical traits of Pisum sativum L. Genotypes

PC 1 2 3 4

Eigenvalue 2.71 1.71 1.47 1.00

% variance 27.06 17.06 14.71 10.03

Cumulative variance 27.06 44.12 58.83 68.86

192

16. The Eigen values for 20 Primers in Pisum sativum L. Genotypes

PC 1 2 3 4 5 6 7 8

Eigen Value 5.65 4.09 2.28 2.01 1.61 1.35 1.17 1.13

% Variance 21.74 15.72 8.76 7.73 6.19 5.19 4.50 4.37

Cumulative variance 21.74 37.46 46.22 53.95 60.14 65.33 69.83 74.2

MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR …

Documents

Transcript of MORPHOLOGICAL, BIOCHEMICAL AND MOLECULAR …