Morphological and Genomic Diversity in the Genus Pteridium ...

Annals of Botany 85 (Supplement B): 77-99, 2000 QAdoi:10.1006/anbo.1999.1101, available online at http://www.idealibrary.com on IIE L®

Morphological and Genomic Diversity in the Genus Pteridium (Dennstaedtiaceae)

JOHN A. THOMSON*

National Herbarium of NSW, Royal Botanic Gardens, Sydney, NSW 2000, Australia

Received: 20 July 1999 Returned for revision: 25 October 1999 Accepted: 27 December 1999

Morphometric comparisons of frond material grown under standardized garden conditions and DNA fingerprintingby arbitrarily-primed PCR were used to assess taxonomic groupings and relationships in the cosmopolitan brackenferns of the genus Pteridium (Dennstaedtiaceae). The genus comprises a limited number of relatively stable, generallyat least partially interfertile, morphotypes which were placed by R. M. Tryon (Rhodora 43: 1-31, 37-67, 1941) in asingle species containing 12 varieties. Both morphometric analysis and DNA fingerprinting of 72 accessions including11 of these varieties (excluded is var. feei from Central America) resolves groupings corresponding to vars africanurn,arachnoideum, esculentum, latiusculum and revolutum from each other. DNA fingerprinting further (a) distinguishesan additional grouping of Atlantic Island (Azores, Madeira) and European brackens as an 'aquilinum complex'including var. aquilinum and a number of morphotypes recognised by C. N. Page (The ferns of Britain and Ireland.2nd edn. Cambridge: Cambridge University Press, 1997) and others at various taxonomic levels (near atlanticum,fulvum, pinetorum, osmundaceum); (b) confirms var. yarrabense as a tetraploid hybrid (4n = 208) of var. esculentumand var. revolutum; (c) establishes that at least those accessions of var. caudatum examined here are tetraploid hybridsinvolving var. arachnoideum as one progenitor; (d) indicates that the closest relatives of var. decompositum are var.latiusculurn and var. revolutum; and (e) provides evidence of close genomic relationships between var. latiusculum, var.pseudocaudatum and var. pubescens in North America. These conclusions are consistent with the results of themorphometric analysis. The DNA evidence suggests that morphotypes in Pteridium are determined by specificqualitative and quantitative combinations of a limited number of highly conserved, additively assorted, genomicelements. A general model based on allopolyploidy followed by one or more rounds of autogamous allohomoploidyis proposed to account for the origin, maintenance and interrelationships of morphotypes in Pteridium. It is suggestedthat Tryon's varieties africanum, aquilinum, arachnoideum, decompositum, esculentum, latiusculum and revolutummight best be treated as species; pseudocaudatum and pubescens as varieties within latiusculum; yarrabense andcaudatum (at least in part) as hybrids. ( 2000 Annals of Botany Company

Key words: Pteridium, bracken, systematics, evolution, genome architecture, hybrids, biogeography, polymerasechain reaction, speciation, numerical taxonomy, polyploidy.

INTRODUCTION

Tryon's (1941) monographic treatment of bracken ferns inthe world-wide genus Pteridium Gled. ex Scop. rationalizedmore than 135 forms named up to that time into twosubspecies containing between them 12 varieties. With theexception of var. feei, which was not available for thepresent study, these varieties are listed in Table 1, togetherwith alternative nomenclature in current use. The taxonomyof Pteridium has long been contentious-Tryon (1941)emphasized three reasons for this. The first concernsphenotypic plasticity. There is much evidence of strongenvironmental influences on morphology, includingcharacters used for taxonomic diagnosis (e.g. Tryon,1941, pp. 12, 19, 27; Sheffield et al., 1989; Dolling, 1996;Ashcroft and Sheffield, 1999). The second reason foruncertainty in systematic treatment of these ferns derivesfrom the widespread occurrence of morphological inter-mediates between taxa as at present delimited (e.g. Tryon,1941; Mickel and Beitel, 1988; Page, 1989; Rumsey,Sheffield and Haufler, 1991; Speer and Hilu, 1999). Athird problem in bracken taxonomy, relating in part to thefirst two, is a paucity of reliable, diagnostic characters for

* Fax +61 2 9251 7231, e-mail [email protected]

0305-7364/00/0B0077 + 23 $35.00/00

distinguishing taxa below the level of Tryon's subspecies.As Tryon (1941, p.9) commented, 'in some cases aspecimen will resemble another variety so closely that itwould certainly be identified with it except by usingthe geographic 'character'. In other words, the criticalcharacters of the varieties are not thoroughly stable'. Takentogether, these difficulties have led to the present situationin which there are few generally accepted guidelines forpositioning taxonomic boundaries in the genus, and noobjective criteria by which hierarchical levels can beassigned to those groupings that are recognized.

Except where taxonomic level is explicitly indicated, thenames of currently designated taxa within Pteridium areused here to specify recognizable morphotypes withoutimplication of taxonomic rank. 'Morphotype' here means aphenotypically consistent group of plants, morphologicallydistinct from other such groups within the genus. Thisusage appears to accord with that by others (e.g. Speer,Werth and Hilu, 1999).

The status of bracken taxa recently recognized in Britain(Page, 1989, 1997; Page and Mill, 1995a; Bridges, Ashcroftand Sheffield, 1998; Ashcroft and Sheffield, 1999) is ofparticular interest. Rumsey et al. (1991), supported byevidence from isozyme studies, suggested that Scottish

© 2000 Annals of Botany Company

Downloaded from https://academic.oup.com/aob/article-abstract/85/suppl_2/77/194622by gueston 12 April 2018

6191

78 Thomson-Morphological and Genomic Diversity in Pteridium

0

s

o

s

io

.o

3

r

,2

b:

os

, ..

o

,1

<

c

;:

I,

x

2:

oo so - A - - - - - - -oe - t oo -o -V V " " N " . . . . . . .0 I'l It lr t t 't °N °, " 'S It I t t t - t 9

a,C~

Z W O > Z Z :aw; s 3

_~ 3.~ =; 1 C~(4 L. a.= < Z ;b 4 4 : w;T

< X~ 3a.t~:~:j-1 : U r y U 0. o_e ::204 5 Z =

4 Y4 C4 X o

U =M 0 2U8 U 0

_ C, 00 _ ~ ;; 0 _< x00__ _ 0- I - - - C O O

zt - - - tIt N 9-Nm�VI OIVi � r`M�O\OCC��-cio000\01n0 \00\ bb�DmmO3--Omm m --- N

BU ·e

fa, F:

3 , E eB � " ·"

� " ds, qP�

&o"

> >IIE

F f LI��

9; 4; 4;5�

CL0

=

i ^

I0

CL

xi~

.1U > E~xS Z

Z mI

. 10 QYa

C23

.·S Z. ·

s

- <

m I °0 : :P m

:g t

.. 4 ~ - - ~T~ ~T ~~~~0 0 -7c 'Eo~~~~ ooo 3 e E o :~

n , ' C z t a E a--

-M r

t< z<< FP <. <m , ; >>;n:s2vvm m

2 g * . 1 2 ' E I 2 t * . E0 E 4

o o o t < m o m som ^ ot " D " *It0 - T , - F, too- ks 01-1 10 -so r _ CD r= IooOo ooT

, t tv b1 I O1 It 't bI t It It Itt "T "T "T "T "T1

°' ° °s ° r C°SN Nrl = N nr~l r~l °S N NN N

.sXEa -114 z� ru


Thomson-Morphological and Genomic Diversity in Pteridium

0CO

.d .

E , . o C o C C

m% rep " fiESS^m=° =*C +' 8 o EOc ·C hEQtt C C- E ~- - > -= ~ 3 , ., ¢) 4E: ~ ~~~~ "~9~~~ .c·r · E . ~. o 'C~~0 * *~ tCO~ 0m. Fvsaa

0 0 .0 . 0 -~ C -. .C * ) B)

.0~ d~cd dErEpriEE u~~ji

o ~ e n ' 0 e n- O en-I O 0

000 0 0 C D0C>00C,00

'0oa en 00 bEnE ne -0

It r T "o o oNto

z :z < < ES

1m rn re 00 'e C - < < '

e n O -0 - eneNe -N e

Ln °= = S4 ' U a

s ~~~~O _z _c s

0 -_ O 0 0 N O\ '0 0 '00 CC 0 0 00 C n = 0 CC 000

I rt n t t en en en It en en

;X33L33Xmzaz

en _ O v 00 en (A '0 '0 '0 -

0 e 0 ' 0 C - z en 0 n 00-0 m e C10- n0 e - n

0

E 0.

0

9 C't %

.E .:

0 0. C C

0 0z;4

00 ~ 0 0 0

-a , i = I 0CO.s

"

UI'r

:2.

r> L)r oC O

^ D^ ,m00 V

HcOCO ~'O V -

0C 0 n -00 - 00 - O- N N - O _ N t -eNOeNeNe 0 -eNb

.20M1

.ooCC0

0 Z0-, .i

0.-..ZI 4)~

en

0 0 r S C'

79

00 0.CO CO

* 0

0. o E CO

E B

80 0

C 0 L~~

~cOCO CO

E~r :

8 .

,._

o

O0.

c 0

' C

3 ~

oM. CO

--O

o

0

:9 i~n, C._

_I 9

M es

;

2 ¢

Z - C

~C C

*s C C

9 D;

ON-

0

.0 0 C

Om m

, o

O s:

C 2 > X

. C > C0 E0

3 0OCO

° '0 o

- CQU

3 0

0f o· 00s0.0~

C0:CO;E

0CC 03

O 0 0U

O ': Bo-a

$-'; "'K 1

Ni .~ 0 CCoi 0.0

CCOOf

0m 00.; 0 0

OCO4~



bracken originally assigned to latiusculum (Page, 1989)and subsequently separated as pinetorum (Page and Mill,1995b), represents a hybrid between North Americanlatiusculum and European aquilinum. The results ofpreliminary DNA analyses were also consistent with thepresence of a latiusculum genome in Britain (Wolf et al.,1995). Earlier, Page (1989) suggested, on the basis ofmorphological, phenological and ecological criteria, thataquilinum might be a hybrid between atlanticum andlatiusculum.

Three North American bracken morphotypes poseproblems similar to those in British brackens. Thus Tryon(1941) stated that vars pubescens and latiusculum intergradenear contact zones, as do latiusculum and pseudocaudatum.On the basis of isozyme evidence suggestive of unrestrictedgene flow between latiusculum and pseudocaudatum at a siteof co-occurrence of the two morphotypes, Speer andcolleagues (Speer and Hilu, 1999; Speer et al., 1999) con-cluded that they are conspecific but morphometricallysufficiently distinct to retain varietal rank. Again, amongstAustralian and south-east Asian brackens, there is morpho-logical evidence that yarrabense represents hybridizationand/or introgression between esculentum and revolutum(Brownsey, 1989), a conclusion supported by restriction-sitedata (Thomson, Weston and Tan, 1995).

The potential for dynamic genetic exchange betweentaxonomic entities at Tryon's varietal level has also beensubstantiated by laboratory studies. Most are at leastpartially interfertile in the laboratory, including var.decompositum (subsp. aquilinum) from the HawaiianIslands with arachnoideum (subsp. caudatum) from Peru(Klekowski, 1973; but excluding decompositum with ara-chnoideum from the Galapagos Islands). Given the wide-spread evidence of the potential for, and in some casesrealization of, genetic interchange between morphotypes,recombination should, over time, lead to blurring of themorphological boundaries between varieties. Yet suchbreakdown appears relatively rare and/or localized, sothat overall at least most bracken morphotypes arerelatively stable over wide geographic areas and geologicallylong time periods. In their extensive sampling of easternNorth American latiusculum and pseudocaudatum, Speeret al. (1999) report 'few' morphological intermediates.Viewing the whole genus, Tryon (1941) wrote 'Suchintermediates are not common, but they are of suchfrequency that, assuming indiscriminate rather than criticalcollecting, they must form a percentage of the Pteridiumpopulation of the area that cannot be overlooked'.

A special feature of the biology of bracken possiblyrelevant to its success as a colonizing species and tomorphotypic stability is the occurrence of intragameto-phytic self-fertilization (autogamy) as well as intergameto-phytic fertilization involving outcrossing or sporophyticself-fertilization. Autogamy has the potential to produce, ina single generation, a sporophyte homozygous at all loci.Autogamy was observed by Klekowski (1972) in gameto-phytes from at least some spore collections of a number ofvarieties of Pteridium, including arachnoideum, caudatum,esculentum, pubescens and latiusculum, as well as decompo-situm (Klekowski, 1973). The work of Korpelainen (1997)

adds wightianum (= revolutum, see Table 1) to this list.Consistent but low rates of intragametophytic selfing wereinferred by Wolf, Haufler and Sheffield (1988) from studiesof both North American and British populationsof P. aquilinum (vars unspecified) using isozyme allelefrequencies.

Difficulties in defining taxa in Pteridium are compoundedby our lack of understanding of the fundamental geneticarchitecture of the morphotypes within the genus. There areas yet no conceptual models on which to structure aconsistent taxonomy. In general, bracken sporophyteshave 104 chromosomes, gametophytes 52 (e.g. Page, 1976;Brownsey, 1989; Sheffield et al., 1989). Exceptionalindividual sporophytes collected in the field have shown156 (Sheffield et al., 1993) and 208 (Jarrett, Manton andRoy, 1968) chromosomes, respectively. No aneuploidplants have been reported to date. A count of n = 26(Brownlie, 1954) is seen in the putatively related genusPaesia. This suggests a chromosome number series which,together with overwhelming evidence of the widespread roleof polyploidy in fern evolution (Walker, 1979; Wagner andWagner, 1980), has led to the conclusion that Pteridiumrepresents a polyploid array with a base chromosomenumber of x = 26 (Chapman, Klekowski and Selander,1979; Page, 1976; Brownsey, 1989), or lower (perhapsx =13). The karyotype of 104-chromosome brackensporophytes may thus be either (4x = 2n) or (8x = 2n).

From the idea of an ancient allopolyploid origin forPteridium arises the speculation summarized by Brownsey(1989) that 'Different combinations of a few basic genomesets could provide the sort of variation and geographicdistribution seen in the northern hemisphere population ofP. aquilinum'. Against the idea of such a simple model ofgenetic structure in the genus is unequivocal evidence fromisozyme studies that, at least for enzyme loci, brackenalways behaves genetically as a functional diploid (Wolf,Haufler and Sheffield, 1987, 1988; Speer et al., 1999). IfPteridium evolved through polyploidy, there has since beencomplete diploidization of these loci.

Pteridium is a distinctive, isolated genus with noconfusingly close allies. What is its ancestry? If it arose asan allopolyploid, were genomes contributed by commonancestors of present day Paesia, Hypolepis or Dennstaedtia?If Pteridium did arise through allopolyploidy, how didmorphotypic differentiation occur? Why are these morpho-types stable, yet capable of genetic exchange as anapparently rare event, which even so is sufficiently commonto make the appearance of morphological intermediates apersistent theme in the genus?

This study sought the answers to these questions via a re-examination of diversity in Pteridium worldwide, andincludes the first reported broad assessment of geneticrelationships across the genus based on DNA studies. Toaddress the problem of phenotypic plasticity in morpho-logical characters, and to provide material for DNAfingerprinting of the same accessions, a living collectionof bracken sporophytes from around the world has beengrown in Sydney under standardized open-garden condi-tions. The specific aims of the study were: (1) to assess thevalidity and status of Tryon's (1941) subspecies and

80



varieties and to determine whether these taxa encompassrecognizable morphotypes within Pteridium; (2) to deter-mine whether DNA fingerprinting can be used to establishmarkers for particular genomic elements, the tracing ofwhich might provide evidence of the origin of Pteridiumand of relationships between its morphotypes; and (3) tosuggest a coherent model accounting for the genetic archi-tecture in Pteridium which results in subgeneric structureseen as a series of relatively stable, although oftenpotentially interfertile, morphotypes.

MATERIALS AND METHODS

Plants

A living collection of bracken sporophytes grown fromknown wild sources around the world was established inSydney, Australia. Collection strategies aimed at a widegeographic as well as taxonomic coverage of the genus:11 of Tryon's (1941) 12 varieties are represented (Table 1).For consistency of presentation and convenient reference,Table 1 is based on Tryon's nomenclatural system withalternative or additional names shown in parentheses.Taxonomic assignments were made by J.A.T. followingTryon's keys and descriptions (Tryon, 1941; Tryon andTryon, 1982) in agreement with interpretations given byBrownsey (1989), Mickel and Beitel (1988) and Page (1976,1989, 1997). Geographic origin was not considered inmaking these identifications. Accessions which consistentlyshowed morphological characters apparently intermediatebetween those diagnostic of particular varieties in Tryon'sscheme are shown as unassigned. All such plants in thepresent collection were ascribed to subsp. aquilinum and aretherefore listed under 'aquilinum complex' in Table 1. Alsoincluded in Table 1 under 'aquilinum complex' are plants ofsubsp. aquilinum distinguished as taxa other than var.aquilinum by at least one of the authors responsible for theoriginal definition of that taxon.

Sporophytes were grown either from frequently wateredmass spore sowings on a sterile mix of peat moss, sand, oldcrushed lime mortar and charcoal, or from rhizomesegments collected in the field. Usually several hundred,but in all cases more than 20, sporelings were checked forobvious abnormalities. A random sample of about ten fromeach collection were grown-on in the glasshouse until therhizome was established as an underground structure(Thomson, 1990). Five apparently normal sporelings werethen transferred progressively to larger pots. Rhizomeportions and sporelings were potted individually to ensurethat each fully established tub contained a single genet.Each plant was assigned an individual number and eachcollection site was allocated a four-letter code (Table 1) bywhich the single plant sampled from each locality isidentified in the text. Established plants were maintainedover a period of 5-15 years in well separated tubs (320 mmdiameter) on elevated racks in the open garden, withprogrammable automatic drip irrigation to each tub. Plantswere thinned and repotted every 12-18 months in astandardized free-draining mix of coarse sand and compostto maintain soil condition and provide space for rhizome

extension. At the time of sampling, plants showed stablephenology and consistent frond morphology from year toyear, apparently reflecting their genetic growth potential forthese conditions. Frond heights and average rhizomediameters varied between taxa from 30-350 cm and0-5-2.5 cm respectively.

The mean daily maximum summer temperature inSydney is 25.5°C and the mean daily winter minimum is8.7°C. Temperatures exceed 30°C on an average of 14-4 dper annum. The minimum recorded winter temperaturewas 2.1°C. In these mild winter conditions, latiusculumaccessions MOGJ, KUKR, BRMN and WMCH (Table 1)require artificial cold treatment of the rhizomes (4°C for4-8 weeks) to ensure successful spring emergence ofcroziers.

All except four of the plants sampled for the morpho-metric and DNA studies were grown in the Sydneycollection. DNA and herbarium material of the 'aquilinumcomplex' accessions fulvum (FULV), osmundaceum(OSMN) and pinetorum (PINT) were provided byK. M. Bridges (University of Manchester, UK) from wild-source rhizomes authenticated by C. N. Page (Bridges et al.,1998). These were grown-on at Manchester, UK. Freshfronds of the outgroup Paesia (PAES) were collected forDNA extraction from a wild stand apparently representing asingle genet in Auckland, New Zealand. Voucher material ofall plants sampled for the morphometric and DNA studiesare deposited in the National Herbarium of New SouthWales, Sydney (NSW). NSW database numbers, plant andlocality identification codes as well as collection details areshown in Table 1.

Herbarium specimens used to supplement material listedin Table 1 for studies of the relationship between guard celllength and ploidy level included arachnoideum (CodeDGAL, KEW, Sheet H2146/97/2) and a presumed hybridrelated to arachnoideum (Code TGAL, KEW, Sheet H2146/97/1), both from the Galapagos Islands. These had beengrown in Britain from field-collected rhizomes, and showedrespectively sporophyte chromosome complements of 104(based on n = 52) and 2n = 208 (Jarrett, Manton and Roy,1968). Supplementary herbarium specimens of yarrabensewere also used (SING, NSW360385, Bels 264 fromSingapore; GPNG; NSW360386, Hoogland 5293 andPullen from Goroka, PNG; IRNQ, NSW360382, Coveny7107 and Hind from Iron Range, QLD, Australia).

Morphometric analysis

A set of 27 characters (Table 2) was chosen to describethe adult bracken frond morphometrically using the pinnaas the base unit of the fractal series (Mandelbrot, 1983) ofunits (blade, pinna, pinnule, pinnulet) comprising thelamina. Frond features selected for quantitation included,but were not confined to, routinely-used taxonomiccharacters, or their probable correlates.

Characters 1-21 provided information on the pinnalamina in relation to area, shape, pattern of dissection,symmetry and ontogeny (the last being reflected, forexample, in the relative development of the basal pinnules).Character 2, laminal area of the pinna, was measured using

81



TABLE 2. Characters usedfor morphometric study of Pteridium

I. Pinna length (cm)2. Laminal area of pinna (cm 2)3. Number of pinnules in basal half of pinna4. Position of longest pinnule, number up from base of pinna5. Length of longest pinnule (cm)6. Length of free mid-vein from longest to next (distal) pinnule on same side (cm)7. Length of shortest basal pinnule of first two pairs (cm)8. Length of free pinna mid-vein basal to first pinnule (cm)9. Length of longest pinnule on narrower side of pinna (cm)

10. Length from tip of longest pinnule to nearest pinnule incised to half its length (mm)11. Position of the longest pinnulet, number up from base of pinnule12. Length of longest pinnulet (mm)13. Length of shortest basal pinnulet (mm)14. Number of pinnulets in basal half of longest pinnule15. Width at base of longest unsubdivided pinnulet, including free lobe if any (mm)16. Width at half its length of longest unsubdivided pinnulet (mm)17. Greatest pinnulet spacing mid-vein to mid-vein (mm)18. Shape of pinnulets unsubdivided along their length (0, simple; 1, decurrent; 2, incised decurrent; 3, free lobe; see Fig. IA)19. Type of attachment of longest pinnulet (0, adnate; 1, partly free; 2, free, unstalked; 3, free, stalked; see Fig. B)20. Dissection of pinnulets to fourth order based on combined trends for pinnules at the base and half way along the length of the pinna

(u, undemarcated; i, incised less than half its length; d, incised more than half its length)At half length u u u i dAt pinna base u i d d dScore 0 1 2 3 4

21. Maximum number of segments incised to half their length for any pinnulet22. Density of hairs on the recurved membranous margin* of ultimate segments (0, absent/few; 1, medium density; 2, many)23. Hairs on pinnulet mid-veins of the lower laminal surface (0, absent; 1, short and few/medium density; 2, medium length and medium

density; 3, long and few/medium density; 4, long and very dense)24. Hairs on inter-vein areas of the lower surface of ultimate segments (0, absent; 1, short/medium length; 2, long; 3, gnarled)25. Density of hairs on upper laminal surface, along the pinna mid-veins (0, absent/few; 1, medium density; 2, high density)26. Guard cell length, mean for 30 stomata (m)27. Petiolar roots (0, absent; 1, localized near base; 2, emerge over extended length near petiole base)

*The modified sterile margin of non-fertile segments, in fertile segments called the adaxial indusium (Tryon and Tryon, 1982, p. 390) or falseindusium (Mickel and Beitel, 1988, p. 317)

Characters 1-3, 5-10, 12-17, 21 and 26 are interval variables in the units shown; other characters are ordinal variables given the character-statescores indicated.

an electronic leaf area meter Model LI3000, LiCor Inc.,Lincoln, NE, USA). Characters 22-25 provided a descrip-tion of hairs on the pinna surfaces, including many of thosefeatures most frequently employed in standard taxonomictreatments of the genus. Character 24 referred to thegnarled trichomes typical of arachnoideum and esculentum(Thomson and Martin, 1996). Character 26, mean guard celllength, was used as an indicator of ploidy level (Barrington,Paris and Ranker, 1986; Sheffield et al., 1993). Guard cellmeasurements were made on epidermal preparations stainedwith ruthenium red as described by Thomson and Martin(1996). Care was taken to ensure that a random sample ofguard cells was measured because stomata along veins tendto be elongated relative to those more centrally positioned inintervein areas. Character 27 dealt with the presence ofpetiolar roots emerging at the base of the stipe above itspoint of emergence from the rhizome (O'Brien, 1990).Alternative states for Characters 18 and 19 are illustrated inFig. 1. The scores used for different states of each characterare shown in Table 2.

For the morphometric study, a fully-unfurled frondwithout obvious physical damage or fungal infection wastaken from each of the Pteridium accessions listed inTable 1. Pinna characteristics were scored on fresh material,using the third pinna from the frond base. If this was

unavailable, for example because of storm damage, thefourth pinna was used.

Morphometric data were standardized by range (Gower,1971) for each variable to minimize the effects of using avariety of measurement scales for these characters. Theresulting standardized data matrix was used to computeEuclidean distances between the accessions for ordinationanalysis by principal coordinates analysis (PCoA), imple-mented according to Rohlf (1998) with the NTSYS-pcnumerical taxonomy and multivariate analysis system,

0 1 2 3

B

0 A 2 3

FIG. 1. Score allocation for different states of Characters 18 and 19(Table 2). The dotted outlines indicate alternative segmentprofiles. A, Character 18 (pinnulet shape); B, Character 19 (type of

pinnulet attachment).

121


6191


Version 2.02c (Exeter Software, Setauket, NY, USA).Ordination of the standardized morphometric data matrixwith Kruskal's (1964) non-metric multidimensional scaling(NMDS) was also carried out with the NTSYSpc package.Comparison of the results of PCoA and NMDS was used toassess the validity of the assumption underlying PCoA, butnot NMDS, that the distance estimates are metric (see, forexample, Crisp and Weston, 1993).

DNA analysis

Fresh, soft laminal segments that were just fully unfurledwere pulverized in liquid nitrogen for nucleic acid extractionusing the hot CTAB detergent method as modified bySaghai-Maroof et al. (1984). DNA was purified from thecrude CTAB-nucleic acid pellet by binding to silica usingsodium perchlorate as the chaotrope (Gilmore, Weston andThomson, 1993).

DNA fingerprinting was done by the arbitrarily-primed polymerase chain reaction (AP-PCR; Welsh andMcClelland 1990; Williams et al., 1990) with decamericoligonucleotide primers supplied by Operon TechnologiesInc. (Alameda, CA, USA). Preliminary tests identified 17primers (A03-All11, A13-A19 and Z05; Table 3) that gaveproducts between 300-2000 base pairs (bp) in length thatare favourable, in terms of number, spacing and fluorescentintensity, for reliable scoring of band profiles after agarosegel separation and ethidium bromide staining.

PCR reactions were carried out in capillary thermocyclers(Models FTS-1S and FTS-4000, Corbett Research, Sydney,Australia). Reactant concentrations followed Hilu (1994),in a final volume of 20 l. After an initial incubation of3 min at 94°C, 40 cycles of 94°C (1 min), 36°C (1 min) and72°C (1.5 min) were followed by a longer final incubationat 72°C (5 min). Amplification products were separatedby electrophoresis in 1.25% agarose gels (20 cm x 20 cm)with fragment-length standards (pGEM DNA markers,Promega Corp., Madison, WI, USA). After staining inethidium bromide, gels were photographed under UV lightusing Type 665 positive/negative film from Polaroid Corp.(Cambridge, MA, USA). The negative (resolution 160-180 lines mm- l) was scanned to produce an enlarged imagefor band analysis. AP-PCR bands at each identified sitewere subjectively assessed as dense to very dense, moder-ately dense, weak or absent to facilitate descriptive com-parison and pattern recognition. For reference purposes,individual bands are designated by primer number followedby fragment length in base pairs, e.g. band A03-1080 is a1080 bp fragment produced using primer A03. Fragmentlengths cited are the means of three estimates from differentgels. Bands at all sites resolved were also scored simply aspresent or absent for objective analysis using ordination andclustering techniques. From the resulting presence/absencedata matrix, a similarity matrix was calculated with the Dicecoefficient (Sneath and Sokal, 1973), taking into accountshared presence of bands but not shared absence (cf. Hilu,1994). This matrix was used to calculate Euclidean distancesfor ordination by PCoA, and for NMDS. The independentmorphometric and AP-PCR matrices were compared by thematrix correlation coefficient method of Lapointe and

TABLE 3. Primers usedfor PCR amplifications

A-03A-04A-05A-06A-07A-08A-09A-10A-11A-13A-14A-15A-16A-17A-18A-19Z-05

AGTCAGCCACAATCGGGCTGAGGGGTCTTGGGTCCCTGACGAAACGGGTGGTGACGTAGGGGGTAACGCCGTGATCGCAGCAATCGCCGTCAGCACCCACTCTGTGCTGGTTCCGAACCCAGCCAGCGAAGACCGCTTGTAGGTGACCGTCAAACGTCGGTCCCATGCTG

Legendre (1992). Accessions were also grouped pheneticallyby SAHN cluster analysis according to their coefficients ofassociation calculated from the Dice matrix, employing thesingle-link, complete-link and UPGMA algorithms (Sneathand Sokal, 1973) implemented with the NTSYS-pc program(Rohlf, 1998).

For examination of fragment sequences to elucidatestructure and homology, DNA fragments from selectedAP-PCR bands were ligated into the pGEM-T plasmidvector (Promega Corp., Madison, WI, USA) following thesupplier's recommended protocol and transformed into abacterial host. Inserts were sequenced in both directions onan ABI Prism 377 instrument (PE Applied Biosystems,Foster City, CA, USA), following the manufacturer's dye-terminator protocols. Sequences were examined for openreading frames and repeat structures using SequencherVersion 2.1 (Gene Codes Corp., Ann Arbor, MI, USA) anda dot-plot program (Gilbert, 1990).

RESULTS

Morphometrics

Fronds sampled for morphometric analysis from garden-grown plants conformed in morphotype to field-collectedvoucher material from the same ramet (rhizome-derivedplants, R, Table 1), or to the parental sporophyte in thecase of spore-derived plants (S, Table 1). Sporophytesraised from spore samples were generally uniform inphenotype. Exceptional in this respect was pseudocaudatumaccession HFLA, for which about 20% of sporophytesfrom the same fertile frond showed small asymmetries andrepetitious irregularities of pinna dissection of the kindassociated by Wagner (1962) with hybrid genotypes. Aplant showing uniform pinna dissection typical of themajority of HFLA sporophytes (Plant No. 195, Table 1)was sampled for morphometric analysis.

Consistent differences in maximum frond length havebeen maintained over 5-15 years in garden-grown plants,but this character was not used in the morphometricanalysis. The maximum frond length for all accessions ofrevolutum exceeded 25 m, except for YGIN (India), for

83



which maximum frond length did not exceed 1-5 m. Frondlength in yarrabense exceeded 15 m only in accessionLSFQ. Maximum frond length for morphotypes other thanrevolutum was <2 m, for pseudocaudatum <1 Im, fordecompositum < 50 cm.

Mean guard cell lengths (Character 26, Table 2) areshown in Fig. 2A for accessions of yarrabense, esculentumand revolutum with 95% confidence intervals (CI). Of theaccessions assigned to yarrabense, only LSFQ (13, Fig. 2A)has a mean guard cell length in the range of esculentum andrevolutum accessions (31-40 pm). The other six yarrabenseaccessions shown have mean guard cell lengths of43-48 gm, with 95% CIs which do not overlap with anyesculentum or revolutum accession (least significant differ-ence, P < 0.001). The DNA value of yarrabense accessionPFNT (12, Fig. 2A) is reported as 4C = 32 pg (Tan andThomson, 1990, where the locality information for thisplant is incorrectly cited; see Table 1 for correct details),and that of revolutum accession PMAL (15, Fig. 2A) as2C = 19 pg. Thus plants assigned here to yarrabense(Table 1) are probably tetraploid (4n = 208), except forLSFQ, which is probably diploid (2n = 104).

Mean guard cell lengths of four accessions of arach-noideum (3-6: SPBR, OPBR, LCCR, RMEX; Fig. 2B)grown in Sydney are significantly lower (least significantdifference, P < 0.001) than those of caudatum (7-10:QCOL, CJPN, HECR, COCR; Fig. 2B) also grown inSydney. Accession LCCR (arachnoideum) has a DNA valueof 2C = 16-5 pg, whereas HECR (caudatum) has4C = 31 pg (Tan and Thomson, 1990). It is therefore likelythat caudatum accessions QCOL, CJPN and COCR are alsotetraploid. Herbarium material of arachnoideum (DGAL)and a presumed hybrid of arachnoideum (TGAL) grown inEngland under unspecified conditions from rhizomescollected in the wild in the Galapagos Islands gavechromosome counts consistent with sporophyte chromo-some complements of 2n = 104 and 4n = 208, respectively(Jarrett et al., 1968). Although guard cell length forarachnoideum plant DGAL (1, Fig. 2B) is significantly less(P < 0.001) than that of the presumed hybrid TGAL (2,Fig. 2B), mean guard cell length in DGAL is significantlyhigher than that for any Sydney-grown arachnoideum. Themean guard cell lengths of Sydney-grown latiusculum,pseudocaudatum, pubescens and 'aquilinum complex' plantsrange from 38-45 pm, overlapping the range for Sydneygrown caudatum. Morphotype pubescens (16, OWUS,Fig. 2B) has a DNA value of 2C = 19.5 pg (Tan andThomson, 1990).

The characters used for morphometric analysis (Table 2)were scored for all 73 Pteridium accessions listed in Table 1.There were no missing values in the resulting data matrix.After range standardization for each attribute to allow forthe different scales used to quantify the characters (Gower,1971), this matrix was used to compute Euclidean distancesbetween accessions for PCoA in four dimensions, associ-ated respectively with 32%, 17%, 13% and 8% of totalvariance. The distribution of accessions in dimension 1 (notshown) provides indicative separation of arachnoideum,esculentum and africanum from revolutum, latiusculum andthe 'aquilinum complex'; the first five of these are fully

ou

Ej45

40

~t 35

30

25

50

E 45

cc

40

aU

.z 35CZ

30

i

I I I I I I I I I I I I I I I I I

1 2 3 4 5 6 7 8 9 1011121314151617181920

Accession (see caption)

B

IIf i

if j

I I I I I l I I I I l I l I I J I1 2 3 4 5 6 7 8 9101112131415161718 1920

Accession (see caption)

FIG. 2. Mean guard cell length with 95% confidence limits for laminalstomata in Pteridium. A, Numbers 1-3, yarrabense (SING, GPNG,IRNQ); 4-9, esculentum (KEWA, WAWA, DOVT, RYNA, KONC,GINZ); 10-13, yarrabense (KMAL, MLNT, PFNT, LSFO); 14-20,revolutum (YGIN, PMAL, BOGI, WFNQ, AMSL, HKSL, KLPH).Known DNA values: accession 12 (PFNT), 4C; accession 15 (PMAL),2C (Tan and Thomson, 1990). B, Numbers 1, 3-6, arachnoideum(DGAL, SPBR, OPBR, LCCR, RMEX); 2, presumed hybrid ofarachnoideum (TGAL); 7-10, caudatum (QCOL, CJPN, HECR,COCR); 11-12, pseudocaudatum FLUS, HFLA); 13 14, 18, latiuscu-lum (BRMN, WMCH, KUKR); 15, 17, 19-20, 'aquilinum complex'(AOUS, YCCM, RPLN, ACAW); 16, pubescens (OWUS). Knownkaryotypes: accession I (DGAL), 2n = 104 based on n = 52; accession2 (TGAL), 4n = 208 (Jarrett et al., 1968). Known DNA values:accession 5 (LCCR), 2C; accession 9 (HECR), 4C; accession 16

(OWUS), 2C (Tan and Thomson, 1990).

resolved from each other in the three dimensions repre-sented by plots of dimensions 2 against 3 (Fig. 3A) anddimensions 2 against 4 (Fig. 3B). Morphotypes arachnoi-deum, revolutum and esculentum are separated from eachother and from latiusculum and africanum in Fig. 3A, withyarrabense between esculentum and revolutum. In this plot,pseudocaudatum (FLUS, HFLA) is placed close to latiuscu-lum, as is pubescens (OWUS). Between these groups aredistributed caudatum, decompositum (MAHI) and the'aquilinum complex' accessions. African accessions (qfrica-num) are clearly separated from other morphotypesincluding latiusculum in Fig. 3B.

84

ZA _ A

l - A7A

i f i i f i

_

l B

L

25lL_



1-50

090

0ce

030

E

-0-30

-090

Dimension 2

090

045

.00 0 00

-045

-090

Dimension 2

FIG. 3. Principal coordinates analysis (four dimensions) based on 27 morphometric characters in 73 bracken accessions. Joined points outline thepositions of arachnoideum, esculentum, revolutum, latiusculum and africanum. North American plants, () pseudocaudatum, () other; yarrabense,(A); caudatum, (); decompositum, (A); 'aquilinum complex', (0). A, Plot for dimension 2 against dimension 3; B, plot for dimension 2 against

dimension 4.

85



The validity of groupings indicated by the PCoA analysiswas tested by comparative ordination of the morphometricdata using NMDS in four dimensions. This resulted inslightly looser groupings compared with PCoA but withhighly congruent separations in plots of dimensions 2, 3 and4 (not shown). With the PCoA result as an initial con-figuration, stress reduced stepwise at each iteration in theNMDS analysis to reach a minimum of 0.08, indicating agood fit to the data (Kruskal, 1964).

DNA fingerprinting

Seventy-two accessions of Pteridium, together with out-group representatives Dennstaedtia (DENN), Hypolepis(HYPM) and Paesia (PAES), were examined. All accessionsshown in Table 1 were included in the analysis, with theexception of the 'aquilinum complex' morphotype osmund-aceurn (OSMN) for which DNA was not available.Examples of the DNA fingerprints obtained by AP-PCRwith a range of primers are shown in Fig. 4A-H.

Generalfeatures. Only one band out of those at 170 bandpositions scored for 17 primers appears unique to a singleplant (BRFR, 'aquilinum complex'). For two other sites,bands are represented in only three accessions, but mostbands are seen in many accessions from geographicallywell-separated sites.

Certain bands consistently appear especially dense(intensely fluorescent after ethidium bromide staining) inat least some accessions compared with others. Examplesinclude bands A03-1080 and A03-1410 (Fig. 4A, F),A15-1580 (Fig. 4B), Z05-925 (Fig. 4G) and A13-930(Fig. 4H). Such bands are referred to here as major bandsin contrast to those which appear of more uniform density.Major bands (total 101 positions) were scored subjectivelyfor each accession as dense to very dense, moderately dense,weak or absent. A portion of the resulting data matrixshowing the patterns for selected primers is illustrated inTable 4.

AP-PCR fingerprints produced with particular primersfrequently contain groups of bands, here designatedsubprofiles, which are recognizable as component subsetsin the band complements of a range of accessions. Anexample seen in Fig. 4C is the subprofile containingbands A18-965 and A18-545 which is shared by 'aquilinumcomplex' accessions AMTK, FULV and TRBL and NIFR(lanes 7-10); by pseudocaudatum accessions FLUS andHFLA (lanes 1-2) and by latiusculum accessions BRMN,WMCH, and KUKR (lanes 4-6). Given inevitable minorgel-to-gel variation, for instance in slight band curvature,and the close spacing of some of the bands scored, sub-profiles are often more confidently recognized by eye asgestalt patterns rather than from measured band positions.Fingerprints obtained with particular primers may involveseveral different subprofiles, each relating to matching sub-profiles in the fingerprints of a different set of accessions.For example, one subprofile in fingerprints obtained withprimer Z05 is characteristic of arachnoideum and caudatum,another links pseudocaudatum, pubescens and NorthAmerican 'aquilinum group' accessions, while a third is

characteristic of africanum. The subprofile relationshipssummarized in Table 5 are based on all sites resolved foreach primer, not only on the major bands diagrammed inTable 4. In a number of cases, congruent patterns ofsubprofile matching are observed amongst the independentfingerprints produced with two to six different primers(Table 5).

Single bands, or particular band subprofiles, may appearadditively in the fingerprints of other accessions. Thusband A03-1410 seen without band A03-1080 in lanes 1,3-4, 6 8 and 11-12 of Fig. 4A, and band A03-1080 seenin lanes 5, 9 and 13 without band A03-1410 in the samegel, appear together in lanes 2 (HECR) and 10 (COCR).More complex examples include for primer A09,MAHI (decompositum) = [KLPH(revolutum) + YSCH(latiusculum)]; for 'aquilinum complex' accessions withAll, RAMD = (PHUN + FZSW) and with A16,NIFR = (TRBL + PINT); and for Z05 (Fig. 4G),WFNQ (revolutum) = [SERI (revolutum) + SHJP (latius-culum)]. Additivity of bands or subprofile patterns appears,in some instances, to consistently reflect an approximately1:1 ratio of contributions (e.g. A03-1410 and A03-1080 inyarrabense and most caudatum) (Fig. 4A, F). Exceptionalin these two morphotypes is COCR (lane 10, Fig. 4A) inwhich A03-1410 appears disproportionately weak. Forother morphotypes, variation in the relative density of agiven band in the profiles of different but related groupsoften appears to be consistently well outside a 1:1relationship. The reproducibility of relative intensity forbands from a given primer within and between accessionsis sufficiently good to support the contention that thequantitative differences in subprofile content are a signifi-cant feature of the AP-PCR band patterns. An exampleis shown in Fig. 4G for africanum accessions DKSA,MCAM, and GSAF (lanes 10-12) which share with eachother a band profile not seen in other brackens representedon the gel, while also sharing a subprofile with 'aquilinumcomplex' accessions AMTK, PINT, TRBL, NIFR (lanes6-9). Band Z05-690 is dense in the African profiles, butconsistently not more than about one-quarter as intense inlanes 6-9 (Fig. 4G), strongly suggesting differentialrepresentation of this DNA segment.

Ordination and clustering analysis. Band presence at170 sites for 17 primers was tabulated for 72 of the 73accessions used for morphometric analysis, excludingOSMN (osmundaceum, 'aquilinum complex') for which noDNA was available. Missing values in this matrix were datafor primers A10 and A14 with latiusculum accessions CHJP,GNCH, IBJP, YOJP; primer A07 with revolutum accessionsMHJI and SERI; primer A09 for 'aquilinum complex'plants ASSP, BRFR, BRGW, CORF, LBSP (all var.aquilinum) and PINT (pinetorum); primer All withpseudocaudatum accessions HFLA and BRMN. The Dicesimilarity matrix for these data was used to compute aEuclidean distance matrix for PCoA in three dimensionsassociated, respectively, with 17%, 12% and 7% of theoverall variance. A plot for dimensions 1 against 2 is shownin Fig. 2. NMDS ordination based on the Dice matrix gavecongruent although slightly looser groupings for the first

86


Thomson-Morphological and Genomic Diversity in Pteridium 87

FIG. 4. Arbitrarily-primed PCR band patterns from Pteridium and outgroups Dennstaedtia, Hypolepis and Paesia. Lanes marked M showfragment-length markers from top down of 2645, 1605, 1198, 676, 517, 460, 396, and 350 bp. A, Primer A03. Lanes 1, 7, 8, YCCM, MAJS, EDSC('aquilinum complex'); 2, 10, HECR, COCR (caudatum); 3, MAHI (decompositum); 4, YOJP (latiusculum); 5, OPBR (arachnoideum); 6, 11,WFNQ, HKSL (revolutum); 9, 13, GINZ, RYNA (esculentum); 12, NDNG (africanum). Pointers indicate the positions of bands A03-1410 andA03-1080. B, Primer A15. Lane 1, DENN (Dennstaedtia); 2, HYPM (Hypolepis); 3, PAES (Paesia); 4, MAHI (decompositum, light loading); 5, 7,YGIN, KLPH (revolutum); 6, 9, 12, RAMD, FZSW, AOUS ('aquilinum complex'); 8, 10, NDNG, BBSA (africanum); 11, YSCH (latiusculum). Apointer indicates the position of band A15-1580. C, Primer A18. Lanes 1-2, FLUS, HFLA (pseudocaudatum); 3, OWUS (pubescens); 4-6, 14-16,BRMN, WMCH, KUKR, TTWN, MOGJ, SHJP (latiusculum); 7-10, AMTK, FULV, TRBL, NIFR ('aquilinum complex'); 11-13, DKSA,MCAM, GSAF (africanum); 17, PAML (revolutum). Pointers indicate the positions of bands A18-965 and A18-545. D, Primer A16. Lane 1,DENN IIDennstaedtia); 2, HYPM (Hypolepis); 3, PAES (Paesia); 4, MAHI (decompositum); 5, 7, YGIN, KLPH (revolutum); 6, RAMD('aquilinum complex'); 8, NDNG (africanum). Pointers indicate the positions of bands A16-1450 and A16-950. E, Primer A05. Lanes 1-4, YGIN,AMSL, HKSL, BOGI (revolutum); 5-8, KMAL, PFNT, MLNT, LSFQ (yarrabense); 9-11, KONC, RYNA, DOVT (esculentum); 12-14, 17,OPBR, SPBR, LCCR, RMEX (arachnoideum); 15-16, QCOL, CJPN (caudatum). Pointers indicate the positions of bands A05-1020 and A05-850.F, Primer A03. Lane 1, TTWN (latiusculum); 2, HYPM (Hypolepis); 3, MHJI (revolutum); 4, 6, RAMD, RPLN ('aquilinum complex'), 5, KMAL(yarrabense). Pointers indicate the positions of bands A03-1410 and A03-1080. G, Primer Z05. Lane 1, HFLA (pseudocaudatum); 2, OWUS(pubescens); 3-5, 13-15, BRMN, WMCH, KUKR, TTWN, MOGJ, SHJP (latiusculum); 6-9, AMTK, PINT, TRBL, NIFR ('aquilinumcomplex'); 10 12, DKSA, MCAM, GSAF (africanum); 16-18, PMAL, WFNQ, SERI (revolutum). Pointers indicate the positions of bands Z05-925 and Z05-690. H, Primer A13. Lanes 1 2, MOGJ, SHJP (latiusculum); 3-5, PMAL, WFNQ, SERI (revolutum). A pointer indicates the

position of band A13-930.



TABLE 4. The distribution of selected major A-P PCR bands in 55 Pteridium accessions and the outgroups Dennstaedtia,Hypolepis and Paesia, shown for representative primers. Bands were graded subjectively as: dense to very dense (),

moderately dense (0), weak () or absent

Hypolepis arachnoideum pseudocaudatum pubescens latiusculum africanum caudatum

Dennstaedtia esculentu revolutum latiusculum 'aqulinum complex' I decompositu m I yarrabensePaeoi I I I I I I I , I . . . . . . . . . . . . . . . . .|H |

F M

L c

S..

8SAY

RWO uC

I l iaa******@ llill 1l*L1 I*IIII 1 -1110 I j I I I___ T

,11-570

,11 495 l I I I13-930 I I I I,13-860

-1570-1450-1340-1060-950

-850 1 1 1 1 1 101 1

-640 0-580 0520 11 1

rre I I

I.[ I Is

I .. I - IAustralasia I Tropical Asia

South & Central America

a

IOI

0~00

*l·lr.l I

I Atlantic IslandsNorth America I

Europe

I ' h Ie n nt aNorth-East Asia Africa Amerca

Hawaiian islands South-East A mericaHawaiian islands South-East Asia

two dimensions (not shown), with minimum stress 015,reflecting an acceptable fit between ordination groups anddata (Kruskal, 1964).

The ordination analysis shown in Fig. 5 separated africa-num, arachnoideum, caudatum, esculentum, latiusculum,revolutum and yarrabense from each other and fromEuropean-ccessiens of haw,'aquilinum complex' withoutoverlap. North American accessions of pseudocaudatum(FLUS, HFLA), pubescens (OWUS), and the 'aquilinumcomplex' plants AOUS (near pubescens) and YCCM (near

latiusculum) form a loose group near North Americanlatiusculum accessions WMCH and BRMN but well separ-ated from the European 'aquilinum complex' (see Table 1).The Hawaiian morphotype decompositum (MAHI) is placedbetween latiusculum and revolutum, yarrabense betweenesculentum and revolutum, and caudatum below and tothe left of arachnoideum (Fig. 5). Within the European'aquilinum complex', var. aquilinum (ASSP, BRFR,BRGW, CLYW, CORF, CPHW, FZSW, LBSP, MAJS,OXLN, RAMD, RPLN), and ACAW (near atlanticum), are

A11-65511-610

qqqq

A18-760Al S-710AIS-670

AI8-575A18-545

ZOS-1160Z0o-1115

Z05649ZO5-510

I.I.I.I I

I1.1'.'T T''

. I � I - -.03-1410.03-1080

,05-1020

43-520 · ),05470

,05-430

,11-825

, I - I , . . I

. . rt-~-

rTT_ NT.ttt8

=- M , _,_I

-I 1 - - _ T _

I I



TABLE 5. Selected subprofile matches in AP-PCR fingerprints

Primers Subprofile matches Comments

A03, A05 DOVT, GINZ, KEWA, KONC, RYNA, Characteristic of arachnoideum and esculentumWAWA, LCCR, OPBR, SPBR, RMEX, Supports hybrid status of caudatum and yarrabenseKMAL, LSFQ, MLNT, PFNT, CJPN,COCR, HECR, QCOL

A06, A10, All DOVT, GINZ, KEWA, KONC, RYNA, Characteristic of esculentum and yarrabense, distinguishWAWA, KMAL, LSFQ, MLNT, PFNT esculentum from arachnoideum

A08, A09, A10, A18, A19, Z05 LCCR, OPBR, SPBR, RMEX, CJPN, Characteristic of arachnoideum and caudatum, distinguishCOCR, HECR, QCOL arachnoideum from esculentum

A18 AMSL, BOGI, HKSL, KLPH, MHJI, Common to all revolutum and links MAHIPMAL, SERI, WFNQ, YGIN, MAHI (decompositum). [A13 subprofile in revolutum except

YGIN (also not MAHI). Z05 distinguishes YGIN, linksMAHI with revolutum]

A16 CHJP, GNCH, IBJP, MOGJ, SHJP, Supports NE Asian latiusculum as a group. [Z05 alsoTTWN, YOJP, YSCH, MAHI, KUKR shows relationship of MAHI. A06, A07 link KUKR]

A17 BRMN, WMCH, FLUS, HFLA, OWUS, Links pseudocaudatum, latiusculum and decompositumCHJP, GNCH, IBJP, MOGJ, SHJP, (MAHI). [A04, A09, A18 confirm relationship betweenTTWN, YOJP, YSCH, MAHI, KUKR pseudocaudatum and N American latiusculum]

A17 BRMN, WMCH, FLUS, HFLA, OWUS, N American latiusculum, pseudocaudatum, pubescens andAOUS, YCCM 'aquilinum complex' share a genomic element marked by

band A17-565

A19 AOUS, YCCM, OWUS, LCCR, OPBR, Links pubescens and N American 'aquilinum complex'SPBR, RMEX, CJPN, COCR, HECR, with arachnoideum and caudatumQCOL

Z05 AOUS, YCCM, OWUS, FLUS, HFLA Links pseudocaudatum, pubescens, AOUS and YCCM

A04, A07, A08, A09 AMTK, FULV, NIFR, TRBL Distinguishfulvum within 'aquilinum complex'

A07, A08, A09, A16 ACAW, AZOR, EDSC, FZSW, PHUN, Suggest that these accessions share a genomic elementRAMD, RPLN restricted to certain of the 'aquilinum complex'

A04, A06, A08, A17, Z05 BBSA, DKSA, GCOM, GSAF, MCAM, Characteristic of africanumNDNG

positioned further to the left of africanum and latiusculumthan the majority of other 'aquilinum complex' plants.

Groupings amongst a set of 55 accessions includingall morphotypes (as for Table 4) were also examinedphenetically by SAHN clustering. Coefficients of associationcalculated for the Dice similarity matrix for 170 sites coveredby 17 primers using the UPGMA algorithm resulted in asingle phenogram (Fig. 6) of good fit to the similarity matrix(cophenetic correlation, r = 0-83; Rohlf and Sokal, 1981;Rohlf, 1998). Robustness of the clusters indicated in Fig. 6was tested by comparative analysis of the same data usingother clustering algorithms. Single-link clustering alsoresulted in one phenogram of best fit, while the completelink method found two tied phenograms of best fit. A strictconsensus phenogram for the complete-link result sharedwith the single-link phenogram groupings which matchClusters 3 (caudatum), 7 (arachnoideum), 8 (esculentum), 11(pubescens, AOUS and YCCM), 12 ('aquilinum complex'),13 (africanum), 14 (yarrabense) and 15 (a subset ofrevolutum) in the UPGMA phenogram (Fig. 6). Theseconsistent groupings represent ball clusters (Jardine, vanRijsberger and Jardine, 1969; Rohlf, 1998). Such clusters arewell separated as the greatest distance between any twoaccessions within one such cluster is necessarily less than thesmallest distance between any member of the cluster and any

member of another such cluster. After omission of caudatumand yarrabense, reanalysis of the data showed revolutum alsoas a ball cluster.

The single- and complete-link phenograms both groupedthe north-east Asian latiusculum accessions (MOGJ, SHJP,TTWN, YSCH) into one cluster, but placed NorthAmerican pseudocaudatum (FLUS, HFLA) and latiusculum(WMCH and BRMN) in another, indicating that theseclusters are also robust. Within Cluster 10, KUKR(latiusculum from Ukraine) clustered with North Americanpseudocaudatum and latiusculum in the complete-link case,but with north-east Asian latiusculum and decompositum(MAHI) in the single link phenogram. Within Cluster12 (European 'aquilinum complex'), the accessions repre-senting var. aquilinum (FZSW, RAMD, RPLN) grouptogether with EDSC and ACAW (near atlanticum) withinCluster 19 (Fig. 6). Consistent with subjective recognitionof band subprofile sharing (Table 5), 'aquilinum complex'accessions AMTK, FULV (fulvum), NIFR and TRBLgroup as Cluster 20.

Clusters 1 and 2 (Fig. 6; coefficient of association = 0-34)correspond respectively to Tryon's (1941) subsp. caudatumand subsp. aquilinum, except that yarrabense (Cluster 14) isplaced with revolutum in Cluster 9 within Cluster 2 ratherthan in Cluster 1. Table 4 shows that major bands

89



0'28

cq

r.a.

a0'00

-028

-055-050 -020 0.10 040 070

Dimension 1

FIG. 5. Principal coordinates analysis (three dimensions) based on 170 band sites for 17 primers studied in 72 bracken accessions (as in Fig. 3A, Bwith the omission of OSMN for which no DNA was available). Plot for dimension 1 against dimension 2. Joined points outline the positions ofarachnoideum, esculentum, revolutum, latiusculum, africanum and accessions of the 'aquilinum complex' from Atlantic Islands and Europe. North

American plants, () pseudocaudatum, () other; yarrabense, (A); caudatum, (); decompositum, (A); 'aquilinum complex', (0).

TABLE 6. Distribution of AP-PCR bands in caudatum compared with arachnoideum and North American (NA)brackens generally

Number of bands

Presence in arachnoideum and NA QCOL CJPN HECR COCR Occupied band sites

Both 16 15 13 13 17arachnoideum only 10 9 14 14 15NA only 18 17 15 21 26Neither 6 6 10 15 16Total bands 50 47 52 63 74Total sites 170 170 170 170

A03-1410 and A05-1020 are present without A03-1080 andA05-850 in all of Tryon's predominantly northern hemi-sphere varieties of subsp. aquilinum. Tryon's subsp.caudatum, arachnoideum and esculentum have bands A03-1080 and A05-850 but not A03-1410 nor A05-1020, where-as arachnoideum and caudatum show all four bands,consistent with both the latter being hybrids between aprogenitor belonging to subsp. aquilinum and a progenitorbelonging to subsp. caudatumn. While many other bands areshared by arachnoideum and esculentum, bands such asA19-850 are seen in all esculentum and yarrabense (exceptKMAL) but not in arachnoideum nor caudatum. Con-versely, bands A18-450 (Table 4) and A19-1150 occur in

arachnoideum and caudatum, but not in esculentum andyarrabense. Placement of yarrabense in Cluster 2 (Fig. 6) isdue to greater similarity of band pattern with revolutumrather than esculentum (compare Fig. 5). Within Cluster 9,yarrabense (Cluster 14) shares more bands with revolutumaccessions grouped in Cluster 15 than those in Cluster 16.

The distribution, in arachnoideum and North American(NA) brackens, of bands generally matching those seen incaudatum (CJPN, COCR, HECR and QCOL) of Cluster 3is summarized in Table 6. Seventy-four band sites in a totalof 170 are occupied in at least one of the four caudatumaccessions. Of the 74 different bands present in thesecaudatum patterns, 17 are seen in at least one each of both

esculentum

KEWaS

KONC

PYNA< LCCRrOB

GINZ RMEX

arachnoideum

HECR

v COC

v OCOL

vCJPNS ~ ~ ~

Eu"aq

latiusculum A LS

v PFNT

WFNO , MLNTWFNQ

YGIN

e KA S KMALe PMvLu \ IMHJ iHKSL

SE=is -X BOGI

revolutumM -% A

rr I



030 040 050 0 60 070 080 0.90 1.00Coefficient of association

FIG. 6. UPGMA clustering phenogram for 55 accessions of Pteridium, based on a Dice similarity matrix for arbitrarily-primed PCR bands at170 sites for 17 primers. Clusters are numbered arbitrarily for reference.

arachnoideum and NA accessions, 15 in arachnoideum onlyand 26 in NA only. Sixteen bands are represented in thecaudatum accessions but not in either arachnoideum norNA; these include 6/50 bands in QCOL, 6/47 in CJPN,10/52 in HECR and 15/63 in COCR; (Table 7). Bandscomparable in mobility with all 16 occur in the fingerprintsof africanum, latiusculum and the European 'aquilinumcomplex'.

Band comparisons for four accessions of yarrabense(KMAL, LSFQ, MLNT, PFNT) with the profiles shown

by six accessions of esculentum and nine accessions ofrevolutum (listed in Table 1) are summarized in Table 7. Of170 sites examined, bands are present at 62 positions in atleast one yarrabense accession. Thirteen of these bandsoccur in at least one accession each of both esculentum andrevolutum, 11 in esculentum only, and 29 in revolutum only.Nine of the 62 bands are not present in either the esculentumor revolutum accessions examined. These nine bands allappear in the profiles of at least one accession of africanum,latiusculum, or the European 'aquilinum complex'.

91



TABLE 7. Distribution of AP-PCR bands in yarrabense compared with esculentum and revolutum

Number of bands

Presence in esculentum and revolutum KMAL MLNT PFNT LSFQ Occupied band sites

Both 12 11 11 10 13esculentum only 6 8 9 10 11revolutum only 27 24 23 23 29Neither 7 3 4 3 9Total bands 52 46 47 46 62Total sites 170 170 170 170

Major band A13-930 (Table 4) is particularly strongin all revolutum accessions (Clusters 15 and 16, Fig. 6)except YGIN (India) and in the yarrabense plant LSFQ(Queensland, Australia). YGIN is the only accession of therevolutum morphotype which has a maximum frond lengthof less than 2 m under standard garden conditions, whileLSFQ is the only plant ascribed to yarrabense to exceed1.5 m in maximum frond length. Accessions of revolutumshare major bands with other morphotypes in variouscombinations. Band A06-820 is prominent in all revolutumfingerprints, in yarrabense (except LSFQ), decompositum(MAHI) and in africanum accessions NDNG, GSAF andGCOM. A16-950 is present in all revolutum, all latiusculumand decompositum (Table 4). A09-1665 is represented inrevolutum other than WFNQ and KLPH, in decompositumand in yarrabense.

Cluster 10 groups decompositum (MAHI), latiusculumand pseudocaudatum and is sister to Cluster 11 (Fig. 6),which comprises pubescens and two other North Americanaccessions AOUS (near pubescens) and YCCM (nearlatiusculum). Bands A07-560, A14-765 and most preciselyZ05-1160 (Table 4) are particularly associated with thelatiusculum morphotype in North American, north-eastAsian and European (KUKR, Ukraine) brackens. Thesebands also occur in decompositum (MAHI). Fingerprints ofMAHI show bands at 62 of 170 sites scored; 43 of thesebands are shared with both latiusculum and revolutum, eightoccur in latiusculum but not revolutum and nine in revolutumbut not latiusculum. Two bands in MAHI profiles occur inneither revolutum nor latiusculum, although both areobserved sporadically in africanum, arachnoideum, esculen-tum and in plants of the 'aquilinum complex'. Major bandsA05-430 in all revolutum and all yarabense link decom-positum with revolutum. Similarly, Z05-1160 exemplifiesbands present in all latiusculum and in decompositum. A16-950 occurs in band profiles of all revolutum, all latiusculumand of some accessions from North America and Africa.

The accessions of latiusculum in Cluster 10 (Fig. 6)appear in three groupings. The north-east Asian plantsYSCH, TTWN, MOGJ, and SHJP group as sister toMAHI (decompositum) in Cluster 17. North Americanlatiusculum (BRMN, WMCH) is sister to pseudocaudatum(FLUS, HFLA) within a cluster sister to the Europeanlatiusculum KUKR (Ukraine) in Cluster 18. Major bandsZ05-1160, the distribution of which most closely followsthis morphotype (Table 4), A07-560 and A14-765 particu-larly associate North American, north-east Asian and

European (KUKR) latiusculum; these bands also occur indecompositum (MAHI). No bands unique to north-eastAsian latiusculum have been identified. KUKR (Ukraine) isthe only bracken from Europe to group outside theEuropean section (see Table 1) of the 'aquilinum complex'(Cluster 12, Fig. 6). DNA fingerprints of KUKR have atotal of 47 bands at 170 sites. Of these, 35 occur both inother accessions of latiusculum and in European accessionsof the 'aquilinum complex', while 12 are shared with eitherother latiusculum accessions or the 'aquilinum complex' butnot both.

North American brackens assigned to pseudocaudatumand latiusculum group in Cluster 10 (Fig. 6), sister toCluster 11 comprising pubescens (OWUS), AOUS (nearpubescens) and YCCM (near latiusculum, Table 1). Nobands present exclusively in all North American brackenshave been identified; major bands of these accessionsare widely shared not only with latiusculum but also withrevolutum, the 'aquilinum complex' and africanum(Table 4). Bands A10-750 and A19-1150 distinguish pub-escens (OWUS), AOUS and YCCM from pseudocaudatumaccessions FLUS, HFLA and from latiusculum accessionsBRMN and WMCH. Bands A14-765, A16-460 and A18-545 are shared by FLUS, HFLA, WMCH and BRMN butare not represented in OWUS, AOUS or YCCM. BandA08-1310 occurs in all North American accessions exceptOWUS, and is also seen in KUKR and some north-eastAsian latiusculum (e.g. MOGJ).

The close relationship existing between the three NorthAmerican morphotypes latiusculum, pseudocaudatum andpubescens is evidenced by their grouping in Fig. 5. Insummary, bands are present in at least one of the fouraccessions FLUS, HFLA, BRMN, and WMCH at 96 of thepositions scored (Table 8). These four accessions haveabout the same number of bands in common with bothother North American (ONA) brackens and latiusculum(range 25/161 to 34/170), and similar proportions of bandsrepresented in either one or in neither of these. Seven of12 bands seen in FLUS, HFLA, BRMN or WMCH whichare seen in neither ONA nor latiusculum are represented inrevolutum, three in latiusculum, three in arachnoideum andtwo in European 'aquilinum complex' accessions.

Accessions shown in Table 1 as 'aquilinum complex'share many bands, but the two American plants AOUS(near pubescens) and YCCM (near latiusculum) do not showcertain bands common to all the accessions of Cluster 12,from the Atlantic Islands (Azores, Madeira) and Europe.

92



TABLE 8. Distribution of AP-PCR bands in North American pseudocaudatum and latiusculum compared with otherNorth American (ONA) brackens OWUS (pubescens) AOUS, YCCM ('aquilinum complex') and NE Asian (NEA)

latiusculum accessions MOGJ, SHJP, TTWN and YSCH

Number of bands

Presence in ONA and NEA FLUS HFLA BRMN WMCH Occupied band sites

Both 34 28 25 26 44ONA only 7 8 10 11 18NEA only 17 11 14 15 22Neither 7 6 5 7 12Total bands 65 53 54 59 96Total sites 170 161 161 170

Bands in this latter category include major bands A11-775,A11-495, A16-520, A18-965 and Z05-510, all represented inaccessions identified here as var. aquilinum (Table 1),including RAMD, FZSW and RPLN (Table 4). TheAtlantic Island brackens AZOR and RAMD (var. aquili-num) together with the European brackens EDSC, FZSW(var. aquilinum), ACAW (near atlanticum), RPLN (var.aquilinum), and to a lesser degree NIFR, share dense bandsincluding A10-1165, Al11-495 and A11-655 (Table 4) moreconsistently than do other European 'aquilinum complex'accessions not identified as var. aquilinum. Band patterns ofthe latter appear qualitatively and quantitatively morevaried. Bands such as A16-520, A16-580, A17-610, A19-480 and Z05-510 are widely represented in, but not restrictedto, Atlantic Island/European accessions including KUKR(latiusculum, Ukraine). ACAW (near atlanticum) is aloneamongst the 'aquilinum complex' brackens in lacking bandsA17-610 and A08-1565. The accessions most distinct fromothers in Cluster 12 are PHUN and RVIT, but thefingerprints of neither contain unique bands. Amongst51 bands at 170 sites scored for PHUN, 38 are seen in othermembers of the European 'aquilinum complex' and innorth-east Asian latiusculum, 12 in European 'aquilinumcomplex' brackens only, and 1 in north-east Asian latius-culum only.

Cluster 20 (Fig. 6), within Cluster 12, groups the fourgeographically distant 'aquilinum complex' accessionsAMTK (Turkey), FULV (fulvum, Scotland), NIFR(France) and TRBL (Bulgaria). This cluster is stronglysupported by subprofile evidence with four primers(Table 5) and these accessions are positioned relativelyclose to each other towards the lower left of the European'aquilinum complex' grouping in Fig. 5.

African plants of morphotype africanum group quiteclosely as Cluster 13 (Fig. 6). Major bands seen only inafricanum (A04-1190), or as a conspicuous element in allafricanum fingerprints and only rarely in other morpho-types include A18-670 and Z05-925 (Fig. 4G, Table 4). TheAfrican brackens share major bands with all other regionsin various combinations. Bands A07-430, A16-520,A17-515 and A19-480, present in all africanum fingerprints,are otherwise distributed predominantly in Atlantic Islandand European 'aquilinum complex' plants. In contrast,A17-610 and Z05-510, also present in these 'aquilinumcomplex' accessions (except ACAW, near atlanticum,which lacks A17-610) are not seen in africanum. African

accessions share A18-450 with all arachnoideum and mostcaudatum accessions, but this band is absent from escu-lentum and yarrabense. Elements common to latiusculumare differentially represented in africanum. Band A16-1340,for instance, is present in all north-east Asian latiusculum.This band is dense in africanum plants DKSA and GCOM,weak in NDNG, and apparently absent from BBSA, GSAFand MCAM.

Outgroup band patterns

Bands are present in fingerprints of the outgroupsDennstaedtia (DENN), Hypolepis (HYPM) and Paesia(PAES) at 58 of 101 major band sites in Pteridium;examples are shown in Table 4. Four of these sites areoccupied in fingerprints from all three outgroups, sixadditional sites are occupied in both DENN and HYPM,six in both HYPM and PAES and five in both DENN andPAES. Thus 40% of major Pteridium band sites areoccupied in fingerprints of at least two of the threeoutgroups, suggesting strong genomic relationships betweenall four genera. Bands are present in fingerprints of oneonly of the outgroups at a further 13 sites for DENN, 16 forHYPM, contrasting with four for PAES. Band A15-1580(Table 4) is a particularly conspicuous band of uniformlyhigh density that is present in all Pteridium accessions butonly in Hypolepis (HYPM) amongst the outgroups.

Band structure and homology

Fragments cloned and sequenced from a small sample ofspecific bands are listed in Table 10 in which sequencelength, summary base composition, homology and pre-dominant occurrence by region/taxon is indicated for each.Sequences from bands of the same apparent mobilityderived from separate accessions in each case differed infewer than 2% of base pairs, e.g. A03-1080 (Table 4) fromRYNA (esculentum) and from the isomigratory band ofGINZ (also esculentum) are confirmed as homologous.Similarly for revolutum, A13-930 from BOGI and fromMHJI are homologous with each other and with the bandat the corresponding site in PMAL band patterns. A16-1450 and A16-850 from CJPN (caudatum) are each homo-logous with the corresponding bands from QCOL (cauda-tum). Band A16-950 from MHJI (revolutum) is homologouswith A16-950 from YOJP (latiusculum).

93



Dot-plot analyses (Gilbert, 1990) show no significantinternal repeat structure in the sequences cloned to date,and no open reading frames of significant length weredetected in either direction. Base composition of differentfragments varies widely (A + T/G + C ratio = 098-1 47,Table 9). No direct relationship is evident between bandA03-1080 of arachnoideum and esculentum and A03-1410of subsp. aquilinum (Table 4, Fig. 4A, F). The lengthdifference between the fragments in these bands is not dueto simple internal deletion or duplication.

Comparison of morphometric and DNA-fingerprintinganalyses

PCoA ordination plots based on the morphometricand DNA-fingerprinting data sets show congruent group-ings of bracken accessions assigned to morphotypesafricanum, arachnoideum, esculentum, latiusculum andrevolutum, place caudatum outside the grouping of ara-chnoideum, and position decompositum (MAHI) betweenlatiusculum and revolutum. The matrix correlation coeffi-cient (Lapointe and Legendre, 1992) for comparison of themorphometric and DNA-based distance matrices covering72 Pteridium accessions included in both is r = 0.29. Usingthe table applicable to independently derived pheneticgroupings (Lapointe and Legendre, 1992), interpolation for72 operational taxonomic units indicates that the morpho-metric and DNA-fingerprint matrices are significantly moresimilar than expected by chance alone (P < 0.01).

DISCUSSION

Sampling strategy

Accessions were chosen for analysis to provide the broadestpossible geographic and taxonomic coverage with littleemphasis on possible local polymorphisms. Inevitably thedata set is open to the criticism that the number ofaccessions sampled from different regions/taxons variedfrom one (decompositum) to nine (revolutum), although formost regions four to six plants were studied (Table 1). Thiswill bias numerical comparisons of band origins because ofthe different probabilities of picking up polymorphic bands,but potential markers unique to particular morphotypesmust all be represented. A further critical considerationconcerns the origin of some of the sporophytes studied fromspores (S), others from rhizome segments (R) as shown inTable 1. Where only one individual is available to representa morphotype, this has been grown from field-collectedrhizomes [decompositum (MAHI), fulvum (FULV), pine-torum (PINT), osmundaceum (OSMN)] with the exceptionof the accession ACAW (near atlanticum) raised fromspores. Comparison of the DNA fingerprints of spore-derived (KMAL, Malaysia) and rhizome-derived (MLNTand PFNT, Australia) sporophytes of yarrabense confirmstheir close genetic similarity (Table 4, Figs 5 and 6).Similarly, the AP-PCR band patterns of the European'aquilinum complex' accessions FULV (R, Scotland),AMTK (S, Turkey) and TRBL (S, Bulgaria) are closelycomparable (Table 5, Fig. 5).

Morphometrics

A significant problem for bracken taxonomists is thenature of the herbarium material available. Seldom arewhole fronds represented in herbaria, and only in rare caseshas the frond been collected down to its connections withthe rhizome. The largest commonly available, complete,structural unit of the frond lamina is the pinna. The pinnawas chosen here for morphometric comparisons designedto encode information on pinna blade area, subdivision,shape and symmetry as a basis for objective comparisonsincorporating the characteristics on which most varietaldiagnoses for Pteridium are based (Tryon, 1941). Examplesinclude the extent of fourth-order subdivision (relative tothe frond lamina as a whole) in africanum, and the presenceof free lobes on the rachis and midvein of pinna/pinnule inarachnoideum and esculentum but not caudatum. The pinnacan be viewed as part of a fractal series (Mandelbrot, 1983):frond lamina, pinna, pinnule, pinnulet. The features of thepinna are not only mirrored at higher and lower (wholefrond) levels in the series, but provide additional indirectinformation likely to be of taxonomic value. Pinnameasurements provide evidence of ontogenetic patterns atother fractal levels, such as the timing of developmentalprocesses which lead to the suppression or partial suppres-sion in some morphotypes of basal pinnules of the pinna,and basal pinnae of the frond lamina. Asymmetry ofthe pinna measured here as the difference betweenCharacter 5 and Character 9 (Table 2) reflects overlapbetween successive pinnae presumptively related to max-imization of light harvesting. At the whole frond level, thisis expressed in curvature of the rachis (used descriptively asin 'rachis deflexed'; Page, 1989). Thus pinna morphologymay provide measures of frond characteristics not otherwiseaccessible in herbarium material.

The maximum length of the fronds produced by abracken sporophyte is a potentially useful taxonomiccharacter, especially where plants are grown under stand-ardized conditions in cultivation. However, this characterwas not employed in morphometric analysis here because itis highly labile under field conditions and is seldomappropriately recorded in data associated with herbariumspecimens.

Guard cell length has been widely validated in manyplants including Pteridium (Barrington et al., 1986;Sheffield et al., 1993) as an indicator of ploidy level.Guard cell data presented here (Fig. 2A), consideredtogether with congruent evident of chromosome countsand/or DNA determinations where available, unequivo-cally indicate that esculentum and revolutum are diploid(2n = 104), whereas yarrabense accessions with theexception of LSFQ are tetraploid (4n = 208). Guard celllength differs significantly between diploid and triploidaquilinum from the same locality (Sheffield et al., 1993), andbetween diploid arachnoideum and a tetraploid arachnoi-deum hybrid, both grown in England from rhizomescollected in the Galapagos Islands (Fig. 2B). Of the plantsgrown in Sydney, accessions of arachnoideum from Brazil,Costa Rica, and Mexico show significantly lower meanguard cell lengths than the four caudatum accessions CJPN,

94



TABLE 9. Origin, base ratios and GenBank accession numbers for cloned and sequenced bands

Sequence length (A + T) Reference Comparison GenBankBand (bp) (G + C) source source(s) accession Predominant occurrence

A03-1410 1410 1.33 RPLN AF159792 All taxa except arachnoideum,esculentum

A03-1080 1080 1.23 RYNA GINZ AF159791 arachnoideum, esculentum,caudatum, yarrabense

A13-930 934 1.41 PMAL BOGI, MHJI AF159793 revolutum

A16-1450 1431 1.47 QCOL CJPN AF159796 africanum, arachnoideum,esculentum, caudatum, yarrabense

A16-950 963 1.39 YOJP MHJI AF159797 latiusculum, revolutum

A16-850 887 0.98 QCOL CJPN AF159795 arachnoideum, caudatum

COCR, HECR and QCOL, consistent with the latter beingtetraploid (4n = 208) as indicated by the 4C DNA value ofHECR (Tan and Thomson, 1990). Guard cell lengths in theSydney-grown caudatum (Fig. 2B) are significantly less thanfor both the diploid and tetraploid Galapagos plants raisedin England, suggesting environmental influences on guardcell length. Moreover, Sydney-grown caudatum accessionsoverlap the ranges of guard cell lengths in pubescens(OWUS) and the 'aquilinum complex' (Fig. 2B), also grownin Sydney. As the mean lengths of guard cells for Sydney-grown accessions of the 'aquilinum complex', latiusculumand pseudocaudatum lie in the same general range as thosereported by Sheffield et al. (1993) for diploid aquilinum,response to environmental conditions must depend ongenotype. The relation between guard cell length and ploidyshould therefore be verified separately for each morpho-typic comparison in Pteridium.

DNA fingerprinting

The AP-PCR band profiles presented here indicate lowlevels of local polymorphism: a band was present at onlyone of 170 sites investigated in only a single accession.

Consistent differences in the relative intensity of particu-lar bands in the fingerprints of particular accessions withthe same primer are especially striking. Such differences inband intensity are consistent within and between samplesfor any set of accessions. Similar variation in band intensityhas been reported from AP-PCR genome comparisons inother plant groups (Leguminosae; Kazan, Manners andCameron, 1993), where such denser bands, here describedas major, have been attributed to the presence in thatgenome of multiple-copy sequences containing homo-morphic core fragments. Differences in intensity of thiskind in the bracken band profiles cannot be ascribed toPCR drift (Wagner et al., 1994) because of their consistent,reproducible manifestation.

Other key findings are that the fingerprints of particularaccessions contain subprofile band groups identifiable in thepatterns produced with the same primer in other accessions,that different morphotypes show different combinations ofthese subprofiles, and that congruent patterns of subprofile

sharing are revealed by different primers (Table 5). Further-more, a common subprofile, revealed as a different group ofbands with each primer, may be detected with differentsensitivity by each primer, due to either variation in copynumber in the unit detected by the different primers, or toeffects related to primer binding-site affinities [mediatedby factors involved in PCR selection (Wagner et al., 1994)such as differences in the influence of adjacent secondarystructures]. These observations support the conclusion that alimited number of genomic elements, in different qualitativeand quantitative combinations, provides the basis forgenetic differentiation of morphotypes in Pteridium.

The pattern of band sharing with outgroups Dennstaedtia(DENN), Hypolepis (HYPM) and Paesia (PAES), at bandsites identified in Pteridium suggests extensive homologybetween their genomes (examples in Table 4). Of 101Pteridium band sites compared in the four genera, bandsare present at 51 in at least one of the outgroups, but at allthree for only four sites. This pattern is consistent withcommon ancestry of Pteridium and the outgroup genera,some of the elements involved being common to all threeoutgroups, some to only one or two of them.

Homology of isomigratory bands has so far been verified,and base sequence examined for a sample of only sixdifferent bands (Table 9). Consistent with the likelihoodthat major bands in Pteridium may derive from multiplehomomorphic core elements of repeated sequences (Kazanet al., 1993), no open reading frames of substantial lengthwere detected in DNA sequenced from these bands. Nonecontained internal repeats. The range of base compositionis wide, with A + T/G + C ratios ranging from 0.98-1.47.Of particular interest is the finding that band A03-1080, amarker distinguishing arachnoideum and esculentum, isunrelated in base sequence to A03-1410, a comparablemarker for morphotypes of subsp. aquilinum. These bandsare not related by deletion, duplication or rearrangement ofinternal segments.

Phenetic grouping of Pteridium accessions by ordinationand clustering analysis based on the DNA-fingerprintingdata shows a pattern remarkably congruent with thatindicated by morphometric analysis (Fig. 3A-B). Bothcorrelate well with the taxonomic groupings in Table 1.

95



Reconciliation of morphotype and variety

Taking the morphometric and DNA-fingerprintinganalyses together, the range of variation representedamongst the 72 accessions studied here can be accommo-dated in the varieties defined by Tryon (1941). There is noevidence for the existence within Pteridium of hithertounrecognized groupings at a level equivalent to that of thefive morphotypes africanum, arachnoideum, esculentum,latiusculum and revolutum. These are well resolved morpho-metrically and by DNA fingerprinting, and correspond withTryon's varieties. Each of these varieties has unique geneticelement(s) in addition to elements shared with othermorphotypes or accessions. Plants assigned here to var.aquilinum (Table 1) also have genomic element(s) uniqueto the Atlantic Island and European members of the'aquilinum complex'. However, the 'aquilinum complex' ofAtlantic Island-European accessions is still inadequatelyresolved. As well as accessions attributable to var. aquilinum,this informal complex groups a number of apparentlyoverlapping, lower level morphotypes of as yet undeter-mined status (near atlanticum, pinetorum, osmundaceum,fulvum; Table 1) and probable intermediates. Such acces-sions share genomic element(s) unique to this 'aquilinumcomplex'.

Taxonomic assignments shown in Table 1 were madebefore morphometric analysis and DNA fingerprintinganalyses began. Plants of var. feei were not available forstudy. The following reassignments and qualificationsfacilitate further reconciliation of morphotype and varietyaccording to Tryon (1941).

North American accession AOUS (Oregon) shown as'near pubescens' (Table 1), groups with pubescens (OWUS)by DNA fingerprinting (Figs 5 and 6) and may now beassigned to var. pubescens. This is satisfactory also ondistributional grounds (Tryon, 1941). North Americanaccession YCCM (Massachusetts), shown in Table 1 as'near latiusculum', appears with pubescens (OWUS andAOUS) in Cluster 11 (Fig. 6). YCCM should therefore beregarded as var. pubescens, or as an intermediate betweenvar. pubescens and var. latiusculum. Although pubescens ispredominantly a western North American variety, itsdistribution includes Michigan (USA), extending north-east to Ontario and Quebec (Canada), so that the presenceof var. pubescens or a genetically close intermediatemorphotype in Massachusetts is not unexpected. Isozymeevidence of the close genetic relationship between pseudo-caudatum and North American latiusculum has beenreported recently (Speer et al., 1999), together with con-firmation of the morphological distinction between thesetwo taxa (Speer and Hilu, 1999).

Variety yarrabense is here confirmed as the tetraploid(4n = 208) hybrid esculentum x revolutum (Brownsey,1989; Thomson et al., 1995) based on accessions KMAL(Malaysia), MLNT and PFNT (Northern Australia),supported by evidence from guard cell length estimates ofploidy level for herbarium specimens of field-collectedmaterial SING (Singapore), GPNG (Papua New Guinea)and IRNQ (North Queensland, Australia). AccessionLSFQ (North Queensland, Australia) is the only plant

assigned to yarrabense (Table 1) in which maximum frondlength exceeds 15 m, which shows the 'tall' marker bandA13-930 (Table 4) of revolutum, and has guard cell lengthsin the diploid range and a sporophyte chromosome countof 2n circa 100 (J. A. Thomson, unpubl. res.). Thus LSFQdoes not conform to yarrabense in many major featuresalthough it was confirmed by DNA fingerprinting to havegenomic elements from both esculentum and revolutum andappears more appropriately classified as an exceptionaldiploid introgressant, perhaps derived through backcross-ing of yarrabense and revolutum. Contrary to Brownsey(1989), yarrabense accessions may be at least partially fertile(Tan and Thomson, 1990). PFNT (Northern Australia),grown from a field-collected rhizome segment, has pro-duced fertile as well as aborted spores; KMAL (Malaysia)was raised from wild-collected spores.

Variety caudatum is represented by four accessions in thisstudy. All are apparently tetraploid (4n = 208) hybridsof arachnoideum and an unspecified progenitor carryinggenomic elements diagnostic of subsp. aquilinum. Variabilityof AP-PCR banding amongst these accessions suggests thathybridization may have occurred independently on morethan one occasion. Investigation of further plants of var.caudatum is required to establish the generality of theseconclusions.

Genetic basis of morphotypic variation

The size of the genomic elements identified here byAP-PCR is not yet known. Those detected using more thanone primer which result in consistent patterns of bandsubprofile distribution amongst accessions according tomorphotype (Table 5) may represent whole genomes (base-number sets of chromosomes), or individual chromosomes.Single bands seen in only a few related accessions [e.g.A13-860 in KONC (esculentum) and LSFQ (esculen-tum x revolutum introgressant)] may be markers for indi-vidual chromosomes or chromosome segments, either ofhomologous or homeologous sets.

The number of different genomic elements contributingband subprofiles to the AP-PCR band complements ofeach morphotype is small. The minimum number of suchgenomic elements would be one each for africanum,aquilinum, esculentum, latiusculum, revolutum, subsp. aqui-linum as a group and subsp. caudatum as a group (Table 5).As indicated above, the structural properties ofsequences cloned from these genomic elements suggestthat they are, or are associated with, non-coding, perhapsrepeated DNA.

Speer et al. (1999), in considering the closely relatedNorth American morphotypes pseudocaudatum and latius-culum, suggest that homozygosity vs. heterozygosity for asingle gene exhibiting pleiotropy and dominance mightdetermine their alternative phenotypes. Such a mechanismappears feasible when the extent of morphotypic differ-entiation is small, but not when higher-level morphotypicdistinctions apparently relate to the presence or absence ofwhat seem to be quite large genomic elements.

96



A multistage evolutionary model for Pteridium

Pteridium is an isolated genus, morphologically distinctfrom its apparently nearest relatives, Dennstaedtia, Hypo-lepis and Paesia, but sharing with each of these one or moregenomic elements. Within Pteridium, particular qualitativeand quantitative assemblages assorted from a small numberof alternative genomic elements correlate with the principalmorphotypes. Such genomic elements may represent wholechromosome sets (i.e. karyotypic architecture might bebased on 8x = 2n = 104 or 4x = 2n = 104), single chromo-somes, chromosome segments, or a combination of these.Morphotypes are relatively stable over wide geographicareas and presumably long evolutionary time periods,typically show few intermediates and are generally at leastpartially infertile. Morphotypes in Pteridium are function-ally diploid with sporophytes having 2n = 104; exceptionsare yarrabense and at least some accessions of caudatumwhich are tetraploid (4n = 208) hybrids. With these featuresin mind, a general scheme to account for the origin,maintenance and genetic interrelationships of morphotypesis proposed in Table 10.

Stage I (Table 10) represents establishment of anancestral Pteridium karyotype of 104 chromosomes throughallopolyploidy involving unknown progenitors carryinggenomic elements of which at least one is common to allof Dennstaedtia, Hypolepis and Paesia as well as Pteridium,while others are probably shared between these andPteridium in various combinations. Stage II involvesstabilization of gene expression through gene silencing toachieve functional diploidy (Werth and Windham, 1990).Stage III invokes autogamous allohomoploidy (Conant andCooper-Driver, 1980; Haufler, 1996) to account for themaintenance of an array of potentially stable, generallyinterfertile, morphotypes, establishment of which wouldbe enhanced by allopatry. One key feature of thisproposition is the occurrence in Pteridium of autogamy(intragametophytic self-fertilization) as well as inter-gametophytic cross-fertilization and intergametophyticselfing (Klekowski, 1972, 1973). A second important featureconcerns the contribution to genetic isolation betweenpotentially interfertile brackens arising from the twinnecessities of proximity and water to effect spermatozoidtransfer between them, for example in one drop of waterspanning both gametophytes. The concept of autogamousallohomoploidy as advanced by Conant and Cooper-Driver(1980) is that two species of the same ploidy level, say for

example diploid, hybridize to produce a fertile Fl sporo-phyte. This plant produces F2 recombinant spores whichdisperse and develop into hermaphroditic gametophytes.All gametes produced by one such gametophyte will behomozygous at each locus, except for those duplicatehomeologous sites at which different alleles are present.Most spores will be non-recombinants. Dispersal aroundthe spore-producing plant will then form a local populationof genetically identical gametophytes, producing by eitherintra- or inter-gametophytic selfing, a colony of homo-zygous sporophytes which are genetically identical andtherefore potentially identical morphologically. Stage IV(Table 10) involves hybridization between diploid brackenmorphotypes, such as yarrabense, to produce tetraploid(4n = 208) morphotypes and probably derivative intro-gressants.

This model predicts that morphotypes based on differentqualitative and quantitative combinations of a limitednumber of alternative genomic elements may show disjunctdistributions within wide areas over which their componentelements co-occur. Reassortment of genomic elements maylead to the independent appearance of the same morpho-type in distant localities. This might account, for example,for the scattered distribution reported for atlanticum inBritain, the Iberian Peninsula and West Africa [Page, 1997;although recognition of this morphotype is contentious(Ashcroft and Sheffield, 1999)]. Cluster 20 (Fig. 6), whichgroups accessions from Scotland (FULV, fulvum), France(NIFR), Bulgaria (TRBL) and Turkey (AMTK) mayrepresent another example.

CONCLUSIONS

Formal taxonomic revision in Pteridium should await DNAstudies of the European 'aquilinum complex'. However, it isprobable that Tryon's (1941) 12 varieties within Pteridiumsatisfactorily encompass major variation in the genus.Neither morphometric nor DNA-fingerprinting datasuggest the existence of hitherto unrecognized morphotypeswith a level of genetic differentiation corresponding toTryon's varieties africanum, aquilinum, arachnoideum,esculentum, latiusculum or revolutum.

Certain Tryon varieties possess exclusive genomicelements, while others do not. Such genetic discontinuitiesare reflected in part in the principal morphogenetic group-ings shown in Fig. 3A and B and consequently tend also tofit taxonomic practice in many cases where Tryon's varieties

TABLE 10. Proposed model of the origin, diversification and maintenance of Pteridium morphotypes

I. Origin of the 104-chromosome Pteridium karyotype through allopolyploidy involving n = 13 or n = 26 ancestorsII. Diploidization of 104-chromosome karyotypes through gene silencing, regularizing meiosis and stabilizing gene expression

III. One or more rounds of autogamous allohomoploidy to produce an array of potentially stable and generally interfertile morphotypes by thefollowing steps:

(i) Hybridization of 2 diploid (2n = 104) morphotypes(ii) Diploid F1 hybrid produces haploid recombinant spores

(iii) Spores disperse. In isolation, obligatory intragametophytic selfing produces homozygous diploid F2 sporophytes(iv) Except for rare recombinant spores due to homeologous pairing, all spores from each homozygous F2 sporophyte are genetically

identical and give rise to colonies of genetically and morphotypically' identical sporophytes through either intra- or inter-gametophytic fertilization

IV. Chromosome-number doubling and hybridization produces tetraploid (4n = 208) morphotypes (and back-cross introgressants)

97



are recognized at species level by other authors (see forexample Mickel and Beitel, 1988; Brownsey, 1989). Qualita-tively distinct genomic elements are observed in africanum,arachnoideum, esculentum, latiusculum and revolutum. This,considered with their morphological separation, supportsrecognition of these taxa as species.

The 'aquilinum complex' as defined here is separable(Fig. 5) as a group of morphotypes distinguished bypossession of genetic element(s) unique to the members ofthe complex. With regard to both qualitative and quanti-tative features of its DNA profile, the most distinctive of themorphotypes recognized within this genetically close com-plex to date is var. aquilinum, which accordingly might begiven species status. No evidence has been obtained fromDNA fingerprinting of the exclusive presence in morpho-types such as fulvum, pinetorum, osmundaceum or 'nearatlanticum' of distinctive genomic elements. These morpho-types within the 'aquilinum complex' might therefore bestbe regarded as varieties and hybrids within speciesaquilinum or species latiusculum as appropriate. NorthAmerican morphotypes pseudocaudatum and latiusculum(Speer and Hilu, 1999; Speer et al., 1999) and pubescens (seeabove) are closely related to each other. Morphotypespseudocaudatum and pubescens appear to be without geneticelement(s) unique to either, and might be placed as varietieswithin a North American subspecies of species latiusculum.

Brownsey (1989) has already recognized yarrabense asthe hybrid P. esculentum x revolutum on morphologicalgrounds; it is now confirmed as tetraploid (4n = 208). Thestatus of caudatum must await further evidence. Fouraccessions of caudatum examined here suggest that thismorphotype may represent a tetraploid hybrid (comparableto yarrabense), involving arachnoideum and a progenitorfrom subsp. aquilinum. Variety decompositum, characterizedby a distinctive combination of genomic elements sharedpredominantly with latiusculum and revolutum, may alsobest be treated as a separate species.

ACKNOWLEDGEMENTS

I thank the many members of the international botanicalcommunity named in Table 1 who sent wild-collectedspores or rhizomes to establish a living sporophytecollection in Sydney. Jennifer Taylor assisted in growingsporelings. Kate Brandis participated in maintenance ofolder sporophytes. I am grateful to Katharine Bridges andElizabeth Sheffield for exchange of DNA samples andvoucher specimens grown from rhizomes of fulvum, pine-torum and osmundaceum originating from authenticatedfield sites (Bridges et al., 1998). I thank Elizabeth Sheffieldfor criticisms and suggestions which led to substantialimprovement of the final manuscript. Barbara Briggs andPeter Weston also provided helpful comments and advice. Ithank Gwen Harden, Elizabeth Brown and Tim Entwislefor support at NSW, Barbara Wiecek for specimencuration, Adam Marchant and Carolyn Porter for manycontributions to the success of the laboratory work, andHelen Stevenson for preparation of the final line drawings.Peter Edwards and Bob Johns facilitated access tomaterial in KEW. I acknowledge financial assistance for

bench costs from the Janet Cosh Bequest to the RoyalBotanic Gardens, Sydney.

LITERATURE CITED

Ashcroft CJ, Sheffield E. 1999. Rejection of Pteridium aquilinum sub-species atlanticum (C.N. Page). Botanical Journal of the LinneanSociety 130: 157-170.

Barrington DS, Paris CA, Ranker TA. 1986. Systematic inferences fromspore and stomate size in the ferns. American Fern Journal 76:149-159.

Bridges KM, Ashcroft CJ, Sheffield E. 1998. Population analysis of thetype localities of some recently recognised taxa of BritishPteridium (Dennstaedtiaceae: Pteridophyta). Fern Gazette 15:205-213.

Brownlie G. 1954. Cyto-taxonomic studies of New Zealand ferns.Transactions of the Royal Society of New Zealand 82: 665-666.

Brownsey PJ. 1989. The taxonomy of bracken (Pteridium: Dennstaed-tiaeceae) in Australia. Australian Systematic Botany 2: 113-128.

Chapman RH, Klekowski E, Selander RK. 1979. Homoeologousheterozygosity and recombination in the fern Pteridium aquilinum.Science 204: 1207 1209.

Conant DS, Cooper-Driver G. 1980. Autogamous allohomoploidy inAlsophila and Nephelea (Cyathaceae): a new hypothesis forspeciation in homoploid homosporous ferns. American Journalof Botany 67: 1269-1288.

Crisp MD, Weston PH. 1993. Geographic and ontogenetic variationin morphology of Australian waratahs (Telopea: Proteaceae).Systematic Biology 42: 49-76.

Dolling A. 1996. Pteridium aquilinum (L.) Kuhn. Ecology and inter-ference effects on regeneration of hemiboreal forests in southernSweden. Silvestria 13: 1-49.

Gilbert DG. 1990. Dot plot sequence comparisons on Macintoshcomputers. Computer Applications in the Biological Sciences 6:117.

Gilmore S, Weston PH, Thomson JA. 1993. A simple, rapid,inexpensive and widely applicable technique for purifying plantDNA. Australian Systematic Botany 6: 139-148.

Gower JC. 1971. A general coefficient of similarity and some of itsproperties. Biometrics 27: 857-871.

Haufler C. 1996. Species concepts and speciation in pteridophytes. In:Camus JM, Gibby M, Johns RJ, eds. Pteridology in perspective.Kew: Royal Botanic Gardens, 291-305.

Hilu K. 1994. Evidence from RAPD markers in the evolution ofEchinochloa millets (Poaceae). Plant Systematics and Evolution189: 247-257.

Jardine N, van Rijsbergen CJ, Jardine CJ. 1969. Evolutionary ratesand the inference of evolutionary tree forms. Nature 216: 185.

Jarrett FM, Manton I, Roy SK. 1968. Cytological and taxonomic noteson a small collection of living ferns from Galapagos. Kew Bulletin22: 475-480.

Kazan K, Manners JM, Cameron DF. 1993. Genetic variation inagronomically important species of Stylosanthes determined byusing random amplified polymorphic DNA markers. Theoreticaland Applied Genetics 85: 882-888.

Klekowski EJ. 1972. Evidence against genetic self-incompatibility inthe homosporous fern Pteridium aquilinum. Evolution 26: 66-73.

Klekowski EJ. 1973. Genetic endemism of Galapagos Pteridium.Botanical Journal of the Linnean Society 66: 181-188.

Korpelainen H. 1997. Comparison of gametophyte growth, sexdetermination and reproduction in three fern species from thetropics. Nordic Journal of Botany 17: 133-143.

Kruskal JB. 1964. Non-metric multidimensional scaling: a numericalmethod. Psychometrika 29: 115 129.

Lapointe F-J, Legendre P. 1992. Statistical significance of the matrixcorrelation coefficient for comparing independent phylogenetictrees. Systematic Biology 41: 378-384.

Mandelbrot BB. 1983. The fractal geometry of nature. San Francisco:Freeman.

Mickel JT, Beitel JM. 1988. Pteridophyte flora of Oaxaca, Mexico.Memoirs of the New York Botanical Garden 46: 1-568.

O'Brien TP. 1990. Some observations on the structure and morphologyof Victorian bracken fern. In: Thomson JA, Smith RT, eds.

98



Bracken biology and management. Sydney, Australia: AustralianInstitute of Agricultural Science, 3-46.

Page CN. 1976. The taxonomy and phytogeography of Pteridium-a review. Botanical Journal of the Linnean Society 73: 1-34.

Page CN. 1989. Three sub-species of bracken, Pteridium aquilinum (L.)Kuhn in Britain. Watsonia 17: 429-434.

Page CN. 1997. The ferns of Britain and Ireland, 2nd edn. Cambridge:Cambridge University Press.

Page CN, Mill RR. 1995a. The taxa of Scottish bracken in a Europeanperspective. Botanical Journal of Scotland 47: 229-247.

Page CN, Mill RR. 1995b. Scottish bracken (Pteridium): new taxa andnew combination. Botanical Journal of Scotland 47: 139-140.

Rohlf FJ. 1998. NTSYSpc Numerical taxonomy and multivariateanalysis system. User guide. Setauket: Exeter Software.

Rohlf FJ, Sokal RR. 1981. Comparing numerical taxonomy studies.Systematic Zoology 30: 459-490.

Rumsey FJ, Sheffield E, Haufler CH. 1991. A re-assessment ofPteridium aquilinum (L.) Kuhn in Britain. Watsonia 18: 297-301.

Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW. 1984.Ribosomal DNA spacer-length polymorphisms in barley: Mendel-ian inheritance, chromosomal location, and population dynamics.Proceedings of the National Academy of Sciences, USA 81:8014-8018.

Sheffield E, Wolf PG, Haufler CH, Ranker TA, Jermy AC. 1989.A re-evaluation of plants referred to as Pteridium herediae(Colmeiro) Lve & Kellqvist. Botanical Journal of the LinneanSociety 99: 377-386.

Sheffield E, Wolf PG, Rumsey FJ, Robson DJ, Ranker TA, ChallinorSM. 1993. Spatial distribution and reproductive behaviour of atriploid bracken (Pteridium aquilinum) clone in Britain. Annals ofBotany 72: 231-237.

Sneath PHA, Sokal RR. 1973. Numerical taxonomy. San Francisco:Freeman.

Speer WD, Hilu KW. 1999. Relationships between two infraspecifictaxa of Pteridium aquilinum (Dennstaedtiaceae) I. Morphologicalevidence. Systematic Botany 23: 305-312.

Speer WD, Werth CR, Hilu KW. 1999. Relationships between twoinfraspecific taxa of Pteridium aquilinum (Dennstaedtiaceae) II.Isozyme evidence. Systematic Botany 23: 313-323.

Tan MK, Thomson JA. 1990. Variation of genome size in Pteridium. In:Thomson JA, Smith RT, eds. Bracken biology and management.Sydney, Australia: Australian Institute of Agricultural Science,87-93.

Thomson JA. 1990. Bracken morphology and life cycle: preferredterminology. In: Thomson JA, Smith RT, eds. Bracken biology andmanagement. Sydney, Australia: Australian Institute of Agri-cultural Science, 333-339.

Thomson JA, Martin AB. 1996. Gnarled trichomes: an understudiedcharacter in Pteridium. American Fern Journal 86: 36-51.

Thomson JA, Weston PH, Tan MK. 1995. A molecular approach totracing major lineages in Pteridium. In: Smith RT, Taylor JA,eds. Bracken: an environmental issue. Aberystwyth: InternationalBracken Group, 21-28.

Tryon RM. 1941. A revision of the genus Pteridium. Rhodora 43: 1-31,37-67.

Tryon RM, Tryon AF. 1982. Ferns and allied plants with specialreference to tropical America. New York: Springer-Verlag.

Wagner A, Blackstone N, Cartwright P, Dick M, Misof B, Snow P,Wagner GP, Bartels J, Murtha M, Pendleton J. 1994. Surveys ofgene families using polymerase chain reaction: PCR selection andPCR drift. Systematic Biology 43: 250-261.

Wagner WH. 1962. Irregular morphological development in hybridferns. Phytomorphology 12: 87-100.

Wagner WH, Wagner FS. 1980. Polyploidy in pteridophytes. In: LewisWH, ed. Polyploidy: biological relevance. New York: Plenum,199-214.

Walker TG. 1979. The cytogenetics of ferns. In: Dyer AF, ed. Theexperimental biology offerns. London: Academic Press.

Welsh J, McClelland M. 1990. Fingerprinting genomes using PCR witharbitrary primers. Nucleic Acids Research 18: 7213-7218.

Werth CR, Windham MD. 1990. A model for divergent, allopatricspeciation of polyploid pteridophytes resulting from silencing ofduplicate gene expression. American Naturalist 137: 515-526.

Williams JGK, Knbelik AR, Livak KI, Rafalski JA, Tingey SV. 1990.DNA polymorphisms amplified by arbitrary primers are useful asgenetic markers. Nucleic Acids Research 18: 6531-6535.

Wolf PG, Haufler CH, Sheffield E. 1987. Electrophoretic evidence forgenetic diploidy in the bracken fern (Pteridium aquilinum). Science236: 947-949.

Wolf PG, Haufler CH, Sheffield E. 1988. Electrophoretic variation andmating system of the clonal weed Pteridium aquilinum (L.) Kuhn(bracken). Evolution 42: 1350-1355.

Wolf PG, Sheffield E, Thomson JA, Sinclair RB. 1995. Bracken taxa inBritain: a molecular analysis. In: Smith RT, Taylor JA, eds.Bracken: an environmental issue. Aberystwyth: InternationalBracken Group, 16-20.

99


Morphological and Genomic Diversity in the Genus Pteridium ...

Documents

Transcript of Morphological and Genomic Diversity in the Genus Pteridium ...